PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN...

of 35 /35
PORPHYRIAS (Vampires and Crazy Kings) Urs A. Meyer Biozentrum of the University of Basel CH-4056 Basel, Switzerland www.biozentrum.unibas.ch/meyer.html Falk Symposium No.156, Genetics in Liver Diseases October 08-09, 2006 - Freiburg

Transcript of PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN...

Page 1: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIAS(Vampires and Crazy Kings)

Urs A. MeyerBiozentrum of the University of Basel

CH-4056 Basel, Switzerlandwww.biozentrum.unibas.ch/meyer.html

Falk Symposium No.156, Genetics in Liver DiseasesOctober 08-09, 2006 - Freiburg

Page 2: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIAS

Obscure diseases with confusing names

considered only when the need for a

diagnosis is desperate

(Antony McDonagh, 1997)

Porph1

Page 3: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRINS (TETRAPYRROLES) ARE THE PIGMENTS OF LIFE

Chlorophyll

Vitamin B12

Heme

Parent molecule: Uroporphyrinogen IIIPorph6

Page 4: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRINS

“The compounds which make grass green

and blood red” ( Hans Fischer, 1930 )

hamb/97

Porphyrins are intermediates in the

synthesis of heme (Fe-Protoporphyrin IXα)

Page 5: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

HEMEPROTEINS

Hemoglobin

Myoglobin

Catalase

Mitochondrialcytochromes

Tryptophandioxygenase

Nitric oxide synthase

Guanylate cyclase

Microsomalcytochromes P450

Page 6: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIAS

Disorders resulting from partial

deficiencies in enzymes of heme

synthesis

hamb/97

Page 7: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIAS

Disorders resulting from partial

deficiencies in enzymes of heme

synthesis

hamb/97Meyer et al., N. Engl. J. Med. 286,1277-1282 ( 1972 )

Intermittent Acute Porphyria: demonstration of a genetic defect in porphobilinogen deaminase

Page 8: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Heme synthesis pathway

Glycine

Succinyl-CoA

HEME

Uro-porphyrinogen IIIProtoporhyrin

Hydroxymethylbilane

Aminolevulinic acid

Porphobilinogen

Copro-porphyrinogen III

Protoporphyrinogen

Fe2+

ALAD

Cpo

Uro-P Synthase

PBGD ( HMBS )

Uro-P decarboxylase

Proto-P oxidase

Ferrochelatase

ALAS

Page 9: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PROPOSED NOMENCLATURE FOR PORPHYRIAS

AcutePorphyrias

PBG-synthase deficiency

PBG-deaminase deficiency

(HMBS deficiency) (AIP)

Copro’gen oxidase deficiency (HCP)

Proto’gen oxidase deficiency (VP)

Uro’gen III synthase deficiency (CEP)

Uro‘gen decarboxylase deficiency (PCT)

Ferrochelatase deficiency (EPP)

CutaneousPorphyrias

Porph26

Page 10: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIASCLINICAL MANIFESTATIONS

SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

ATTACKS OF NEUROLOGIC DYSFUNCTIONASSOCIATED WITH ACCUMULATION OF THE PORPHYRIN PRECURSOR DELTA-AMINO-LEVULINIC ACID IN (INDUCIBLE) ACUTE PORPHYRIAS

Porph5

Page 11: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS
Page 12: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PORPHYRIASCLINICAL MANIFESTATIONS

SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

ATTACKS OF NEUROLOGIC DYSFUNCTIONASSOCIATED WITH ACCUMULATION OF THE PORPHYRIN PRECURSOR DELTA-AMINO-LEVULINIC ACID IN (INDUCIBLE) ACUTE PORPHYRIAS

Porph5

Page 13: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

SYMPTOMS AND SIGNS OF INDUCIBLE ACUTE PORPHYRIAS

85 – 9543 – 8348 – 845 – 12

Abdominal painVomitingConstipationDiarrhea

Neuropsychiatric

CV, autonomic NS

Pain in extremities, back, chest, etc.ParesisRespiratory paralysisMental symptoms (agitation, confusion, hallucinations)Convulsions

TachycardiaArterial hypertension

Estimated incidence, %Gastrointestinal

50 – 7042 – 689 – 2040 – 5810 – 20

64 – 8536 - 55

Anderson et al., Ann. Int. Med. 142, 439-450, 2005

Page 14: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

CHARACTERISTICS OF THE 4 INDUCIBLE ACUTE PORPHYRIAS

(combined prevalence ~5 cases / 100‘000 persons)

7~5ALA dehydratase(porphobilinogensynthase )

Autosomal recessive

ALA-dehydratasedeficientporphyria (ADP)

120~50Protoporphyrinogenoxidase

Autosomal dominants

Variegateporphyria (VP)

36~50Coproporphyrinogenoxidase

Autosomal dominant

Hereditarycoproporphyria(HCP)

227~50Porphobilinogen-deaminase ( HMBS)

Autosomal dominant

Acuteintermittentporphyria (AIP)

KnownMutations

Enzyme Activity

(% )

Deficient EnzymesInheritanceDisease(Abbreviation)

Anderson et al., Ann. Int. Med. 142, 439-450, 2005

Page 15: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PRECIPITATION OF ATTACKS IN ACUTE PORPHYRIAS

• DRUGS

• HORMONAL CAUSES

• INFECTION

• CALORIC RESTRICTION

• HEAVY SMOKING (?)

• ALCOHOL

• UNKNOWNPorph8

Page 16: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

HEPATIC ACUTE PORPYHRIAS

QUESTIONS

- WHAT CAUSES NEUROLOGICAL DYSFUNCTION?

- HOW DO DRUGS, FASTING AND HORMONES

PRECIPITAE PORPHYRIA?

- WHAT ARE MECHANISMS OF APPARENTLY

BENEFICIAL EFFECTS OF CARBOHYDRATES

AND HEME?

Porph3

Page 17: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Attacks are always associated with ↑↑ hepatic ALAS1

HypothesisAll triggering factors directly upregulate ALAS1 at the

transcriptional level

2. How does fasting increase ALAS1?

1. How do drugs increase ALAS1?

3. What factors determine the liver specificALAS1 induction?

4. What else potentially activates ALAS1 and thereforetrigger attacks?

Page 18: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Nature Genetics12: 195-199, 1996

Page 19: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Vincent

Page 20: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS
Page 21: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS
Page 22: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Urinary excretion of ALA duringphenobarbital treatment

0 1 2 3 4 5 6 7 8 9 10

0.0

0.5

1.0

1.5

T1/T2 (male, n=2) T1/T2 (female, n=2) control (n=2)

ALA

(µm

ol/µ

mol

cre

atin

ine)

Day

INDUCTION OF ALAS IN PBGD-knockdown MICE

Page 23: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Drug-Response Elements of ALAS1

Human AGCTGGGTGAGCTAAGTTCATCTGTGCTGCCGTGACCTCTGMouse AGCTGGGTGAACCGAGTTCGTTTGCACTGCCTTGGCCTGTGRat AACTGGGTTAACTGAGTTCGTTTGTACTGCCTTGATCTGTG

* ****** * * ***** * ** ***** ** ** **

-16kb-21kb

Fraser, D. J.et al. (2002) J Biol Chem

Podvinec, M. .et al. (2004) PNAS

Fraser, D. J.et al. (2003) J Biol Chem

Mouse Rat

Human

Chicken

DR4 DR4

ALAS1

PXR CAR CXR

Page 24: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Xenosensors CAR and PXR mediateDrug Induction of ALAS1

Fraser et al. 2002, 2003; Podvinec et al. 2004

CAR/PXR ALAS1- 16kb

CYP3ACYP2B UGT1A1

Nuclear Hormone Receptor Family of Transcription Factors

Drug

Negative feedback regulation of ALAS1 by heme amplifiesthe response to drugs of ALAS1 in acute porphyrias

Page 25: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Urinary excretion of ALA duringphenobarbital treatment

0 1 2 3 4 5 6 7 8 9 10

0.0

0.5

1.0

1.5

T1/T2 (male, n=2) T1/T2 (female, n=2) control (n=2)

ALA

(µm

ol/µ

mol

cre

atin

ine)

Day

INDUCTION OF ALAS IN PBGD-knockdown MICE

Page 26: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

What Triggers the FastingResponse ?

ALAS1 activity

0200400600800

10001200

fed fasted 16h

nm

ole

ALA

/g

liv

er/

h

ALAS1 mRNA

0

2

4

6

8

fed fasted 16hrel m

RN

A e

xp

ress

ion

** p < 0.01 fasted vs fed controll

Page 27: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Cell 122: 505-515, 2005

The mediator of the fastingresponse of ALAS1 is PGC-1α

Page 28: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

PGC-1α

Versatile co-activator

GluconeogenesisLiver

Peroxisome Proliferator Activator Receptor γ Coactivator 1-α

TISSUE FUNCTION TFs

HNF4α, GR, FOXO1

Page 29: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

NRF1FOXO1 HNF3βHNF3β ALAS1- 380 - 60

PGC-1α acts via FOXO1 and NRF1

Handschin et al. ( 2005 )

Fasting response is blunted in the absence of PGC-1α

ALAS1

Page 30: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Bile acids induce human ALAS1( Anne-Kathrin Peyer )

0

2

4

6

8

10

GFP VP16 FXR

Rel

mR

NA

Exp

ress

ion

vehicleGW4064

#

#

*

*

Human Liver Slice(MG Elferink, GM Groothuis,Diana Jung)

Cultures of Primary Human Hepatocytes

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

8h 16h 24h 8h 16h 24h 8h 16h 24h

Rel

mR

NA

Exp

ress

ion vehicle

10uM CDCA100uM CDCA

Donor A Donor B Donor C

0123456789

vehicle CDCA PB CDCA+PB

Rel

mR

NA

Exp

ress

ion

ALAS1ALAS1

ALAS1

Page 31: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Transcriptional Effects on ALAS1

PGC1α PGC1α PGC1αPGC1α PGC1α PGC1α PGC1α

-30kb -25kb -20kb -15kb -10kb -5kb 0 +20kb+15kb+10kb+5kb

HNF4αHNF4αHNF4α HNF4αHNF4α HNF4αHNF4α FXRCAR PXR

Xenobiotics EndobioticsBile Acids

ALAS1

NRF1

PGC1α

FOXO1

ALA, PBG ↑

Acute Neurovisceral Crisis

Fasting

PGC-1αCREB

Glucagon

cAMP

Page 32: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

CONCLUSIONS

Induction of neurovisceral attacks in acute

porphyrias:

Drug-effects on ALAS1 are mediated by the

xenosensors CAR and PXR

Bile acids induce ALAS1 via activation of FXR

( clinical importance not known )

Fasting effects on ALAS1 are mediated via PGC-1α

Page 33: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

HEPATIC ACUTE PORPYHRIAS

QUESTIONS

- WHAT CAUSES NEUROLOGICAL DYSFUNCTION?

- HOW DO DRUGS AND HORMONES PRECIPITATE

PORPHYRIA?

- WHAT ARE MECHANISMS OF APPARENTLY

BENEFICIAL EFFECTS OF CARBOHYDRATES

AND HEME?

Porph3

Page 34: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS
Page 35: PORPHYRIAS...Cutaneous Porphyrias Porph26 PORPHYRIAS CLINICAL MANIFESTATIONS SUNLIGHT-INDUCED SKIN LESIONS (PHOTOSENSITIVITY) DUE TO PORPHYRIN ACCUMULATION IN SKIN IN CUTANEOUS PORPHYRIAS

Raija Lindberg*Christoph Handschin*Adrian Roth*Carmela Gnerre*David Fraser*Michael Podvinec*

Sharon BlaettlerTaoufiq HarachDiana JungAnne-Kathrin PeyerFranck Rencurel

Maja MatisViola Tamasi

Renate LooserMichel R. KaufmannMarkus Beer

Urs A. Meyer GroupCore Program Genome Scale Biology

& BioinformaticsPharmacology/Neurobiology