Pleiotrophic Effects of 2 Enterococcus faecalis sagA– Like Genes ...
Transcript of Pleiotrophic Effects of 2 Enterococcus faecalis sagA– Like Genes ...
E. faecalis salB, Biofilm, and ECM Binding • JID 2006:193 (15 January) • 231
M A J O R A R T I C L E
Pleiotrophic Effects of 2 Enterococcus faecalis sagA–Like Genes, salA and salB, Which Encode ProteinsThat Are Antigenic during Human Infection,on Biofilm Formation and Binding to CollagenType I and Fibronectin
Jamal A. Mohamed,1,2 Fang Teng,1,2 Sreedhar R. Nallapareddy,1,2 and Barbara E. Murray1,2,3
1Division of Infectious Disease, Department of Internal Medicine, 2Center for the Study of Emerging and Reemerging Pathogens,and 3Department of Microbiology and Molecular Genetics, University of Texas Medical School, Houston
Background. We have shown previously that Enterococcus faecium SagA has broad-spectrum binding to extra-cellular matrix (ECM) proteins. In the present study, 2 sagA-like genes, salA and salB, were identified in Enterococcusfaecalis.
Methods. We compared the salA and salB mutants; their parental strain, OG1RF; and the salB-complementedstrain for binding to ECM proteins and biofilm formation.
Results. The salB mutant (TX5123) grew more slowly but showed greater binding (∼10%–20% of cells bound)to fibronectin (FN) and collagen type I (CI) than did OG1RF (∼1% of cells bound) ( ). Although TX5123P ! .001showed decreased biofilm formation in tryptic soy broth plus 0.25% glucose (TSBG) ( vs. OG1RF), aP ! .001marked increase in biofilm formation was shown by TX5123 but not by OG1RF when they were grown in TSBGplus horse serum (HS) or TSBG plus FN, and the increase was coincident with increased attachment and hydro-phobicity of TX5123. Complementation of the salB mutant restored the wild-type phenotypes.
Conclusions. Whether SalB expression is ever sufficiently low in vivo to enhance adherence to ECM proteinsor the serum-elicited increase in biofilm formation seen with the salB mutant in vitro is not currently known,but it is a potential way in which this organism could increase its adherence and biofilm formation during infection.
Enterococci are common causes of endocarditis, with
Enterococcus faecalis causing the majority of cases [1,
2]. Because of their intrinsic and acquired resistance to
multiple antibiotics, the treatment of enterococcal en-
docarditis can be very difficult; in some cases, this re-
sults in treatment failure and the death of the patient.
The extracellular matrix (ECM) is a macromolecular
structure in eukaryotic tissues that is composed of gly-
Received 15 March 2005; accepted 2 August 2005; electronically published 12December 2005.
Potential conflicts of interest: none reported.Financial support: Division of Microbiology and Infectious Diseases, National
Institute of Allergy and Infectious Diseases, National Institutes of Health (grantR37 AI47923 to B.E.M.).
Reprints or correspondence: Dr. Fang Teng, Div. of Infectious Disease, Centerfor the Study of Emerging and Reemerging Pathogens, University of Texas MedicalSchool, MSB 2.112, 6431 Fannin St., Houston, TX 77030 ([email protected]).
The Journal of Infectious Diseases 2006; 193:231–40� 2005 by the Infectious Diseases Society of America. All rights reserved.0022-1899/2006/19302-0009$15.00
coproteins and proteoglycans such as fibronectin (FN),
laminin (LN), and collagens. Microbial adherence to
various components of the ECM has been shown to be
important for colonization and infection of the host.
Our earlier studies showed that most E. faecalis clini-
cal isolates were able to bind to collagen type I (CI),
collagen type IV (CIV), and LN but could do so only
conditionally (e.g., when grown at 46�C), whereas only
1 (MD-8) of 44 strains tested showed conditional bind-
ing to FN (∼9% of cells bound, where 5% was consid-
ered to be significant) [3]. When grown in brain-heart
infusion (BHI) at 37�C, most isolates (including MD-
8 and a reference strain, OG1RF) did not show signif-
icant binding in our assay to any of the ECM proteins
tested—including fibrinogen (FG), FN, CI, CIV, and
LN [3]—although other assays may have shown low-
level binding [4]. Our subsequent studies of the con-
ditional adherence of enterococci to ECM identified a
collagen-binding protein, Ace, in E. faecalis and a spe-
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
232 • JID 2006:193 (15 January) • Mohamed et al.
Table 1. Strains used in the study.
Strain (alternative name) CharacteristicsReference or
source
E. coliDH5a Host strain StratageneTX10107 (FT1) DH5a expressing 321 aa of the N-terminal part of SalA; Spcr Present studyTX10108 (YX36) DH5a expressing 349 aa of the C-terminal part of SalB; Kanr [10]
E. faecalisOG1RF (TX4002) Well-characterized strain; Rifr, FAr [16]TX10106 salA disruption mutant; Spcr Present studyTX5123 salB (p54) disruption mutant; Kanr [11]TX10109 OG1RF with pAT18; Eryr Present studyTX10110 TX5123 with pAT18; Kanr, Eryr Present studyTX10111 TX5123 with pAT18 containing salB; Kanr, Eryr Present study
NOTE. Ery, erythromycin; FA, fusidic acid; Kan, kanamycin; Rif, rifampin; Spc, spectinomycin.
Table 2. Oligonucleotides used in the study.
Oligonucleotide Sequence (5′r3′) Usage
6259-2 CATTAACAAGCGTAGCGTTG salA disruption/expression6259-3 GCCTTTTTCAGGAGTCGTTG salA disruption/expressionsalBupper CACGTGAAAACTAGTCGTAA salB complementationsalBlower TCATTGCTGATTAGGCTGAG salB complementationsalA1 GTATTAACTTCGGTTATGGT RT-PCRsalA2 CTGGAAAACGCCATACAACA RT-PCRsalA-down1 TGTTGTATGGCGTTTTCCAG RT-PCRsalA-down2 TCTATTAAAGCTGAAGCGAT RT-PCRsalB1 CAACTGAAACAACTACACCA RT-PCRsalB2 TTAGGCTGAGTGTCCTACGAT RT-PCRsalB-down1 ATCGTAGGACACTCAGCCTAA RT-PCRsalB-down2 GTAAAAGGAATCTGACTACT RT-PCR
NOTE. RT-PCR, reverse-transcription polymerase chain reaction.
cific collagen–binding adhesin, Acm, in E. faecium. Recombi-
nant Ace was found to adhere to CI, CIV, and LN, whereas
Acm specifically bound to collagens but not to other ECM
proteins [5, 6]. More recently, we identified a gene encoding a
major secreted antigen, SagA, by screening an E. faecium ge-
nomic-expression library with serum from patients with E. fae-
cium endocarditis. The E. faecium sagA gene is located down-
stream of mreC/D genes, which encode cell shape determinants,
and has been shown to be essential for E. faecium growth [7].
The SagA protein consists of 3 domains and has shown broad-
spectrum binding to ECM proteins, including FG, CI, CIV, FN,
and LN [7]. In the present study, the SagA sequence was used
to search for homologues in E. faecalis, and the sagA-like genes
of E. faecalis (salA and salB—EF3060 and EF0394, respective-
ly—from strain V583 [8]) were identified. Sequence analysis
of these genes revealed that salB had been identified previously
in our laboratory as p54 (named for the calculated molecular
mass of a previously identified protein [9]) and that it encodes
an antigen expressed during infection in humans [10], although
disruption of the gene did not have an effect in the mouse
peritonitis model [11]. Recently, the salB gene was studied by
Breton et al. [12] (who called it “sagA” because of its similarity
to the E. faecium sagA gene) and was shown to be important
for resistance to various stress conditions, including bile salts,
NaCl, SDS, ethanol, H2O2, heat shock, and alkaline and acid
pH. In that study, electron microscopy showed that disruption
of this gene resulted in an abnormal shape and cell surface
[12]. Although those researchers did not examine binding to
ECM proteins, our previous observation with E. faecium SagA
suggested that this would be a logical next step.
Another phenotype that reflects the ability of bacteria to
adhere and that may be important for pathogenesis is biofilm
formation. Biofilm has been shown in many other pathogens
to be important for virulence, and the biofilms that form on
heart valves are termed “vegetations” [13, 14]. In our previous
work, the first systematic study of biofilm in E. faecalis en-
docarditis isolates, we examined our large collection and found
that endocarditis isolates produced biofilm significantly more
often and in significantly greater amounts than did nonendo-
carditis isolates [15]. Some E. faecalis mutants were also eval-
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
E. faecalis salB, Biofilm, and ECM Binding • JID 2006:193 (15 January) • 233
Figure 1. Analysis of the sal genes and their products. A, Reverse-transcription polymerase chain reaction (RT-PCR) and PCR of sal genes.Lane 1, intragenic fragment of salA (with primers salA1 and salA2); lane2, fragment spanning salA and its downstream gene (with primers salA-down1 and salA-down2); lane 3, intragenic fragment of salB (with primerssalB1 and salB2); lane 4, fragment spanning salB and its downstreamgene (with primers salB-down1 and salB-down2). RT-PCR and PCR wereperformed with RNA and genomic DNA of OG1RF. B, Western blots. Lane1, protein extracts from YX36; lane 2, protein extracts from FT1. Antibodieseluted from YX36 (SalB peptide) were used in the experiment shown inthe left panel and antibodies eluted from FT1 (SalA peptide) were usedin the experiment shown in the right panel.
uated in that study, and the disruption of the epa, atn, gelE,
and fsr genes resulted in significantly less primary attachment
and less biofilm formation on a polystyrene surface [15]. In
the present study, the effect of the disruption of E. faecalis
OG1RF salA and salB genes on ECM protein binding was stud-
ied, as was the effect of serum and ECM proteins on biofilm
formation.
MATERIALS AND METHODS
Bacterial strains and media. Bacterial strains used in the
study are listed in table 1. Escherichia coli strains were grown
in Luria-Bertani medium (Difco Laboratories) with appropriate
antibiotics, and BHI (Difco) or tryptic soy broth (TSB; Becton
Dickinson) medium with different supplements, as described
below, were used for E. faecalis.
Nucleic-acid and protein techniques. Primers used in the
study are listed in table 2. Polymerase chain reaction (PCR)
amplification, DNA cloning, and DNA sequencing were per-
formed in accordance with standard methods [17]. RNA ex-
traction from OG1RF (grown in BHI at 37�C for 24 h) and
reverse-transcription (RT)–PCR were performed as described
elsewhere [18]. The 963-bp region near the 5′ end of the salA
gene was amplified from OG1RF with primers 6259-2 and
6259-3 (table 2), cloned into pTEX5235 [19] (which resulted
in pTEX5235-2), and used to construct the salA disruption
mutant of OG1RF, as described elsewhere [19]. pTEX5235-2
was also used in E. coli (as FT1 [TX10107]) to express the N-
terminal part of SalA. Complementation of the salB mutant
was performed by cloning the whole length of the salB gene
with the ∼200-bp upstream region into the shuttle vector pAT18
[20]; the construct was introduced into the salB mutant by
conjugation, using S17-1 as the donor [19]. The pAT18 vector
was also introduced into OG1RF and the salB mutant by the
same method [19]. E. coli clones FT1 and the previously made
YX36 (TX10108) (expressing partial SalB [10]) were used for
the elution of anti-SalA and anti-SalB antibodies, respectively,
from serum from patients with E. faecalis endocarditis, using
methods described elsewhere [21] for protein extraction and
Western blotting [21].
Adherence assay. E. faecalis adherence to ECM proteins FG,
FN (Enzyme Research Laboratories), CI, CIV (Sigma Chemi-
cal), and LN (Invitrogen) was performed as described elsewhere
[3, 5], except that, for labeling, ∼107 cfu of bacteria were in-
oculated into 5 mL of BHI broth with 10 mCi of Tran35S-label/
mL, and the cultures were grown at 37�C to an OD600 of ∼0.9
(for OG1RF and the salA mutant) or ∼0.8 (for the salB mutant
TX5123), at which point they entered a stationary phase. 35S-
labeled TX5123 cells (OD600 adjusted to 0.2 in PBS) were in-
cubated with various concentrations of either CI or FN (0, 1,
50, or 100 mg/mL) for 1 h at 37�C and then centrifuged at 3400
g, followed by resuspension in PBS with 0.1% Tween 80 and
0.1% bovine serum albumin to remove excess unbound ECM
proteins, before the addition of labeled cells to the ECM-coat-
ed wells in adherence assay [3, 5].
Biofilm formation assay. Biofilm formation by E. faecalis
was determined quantitatively as described elsewhere [15], with
minor modifications. Briefly, E. faecalis strains were grown
overnight in TSB plus 0.25% glucose (TSBG) with appropriate
antibiotics at 37�C, and the OD600 was adjusted to 1.0 for each
inoculum. Cultures were diluted 1:100 in TSBG, TSBG plus
10% horse serum (HS; Invitrogen), TSBG plus FN (50 mg/mL;
Enzyme Research Laboratories or Sigma [the latter was used
in the biofilm formation experiment]), or TSBG plus CI (50
mg/mL), and 200 mL of this bacterial suspension was inoculated
into sterile 96-well polystyrene microtiter plates, followed by
incubation at 37�C. Bacterial growth in the microtiter plates
was measured by reading the optical density at 600 nm, and
biofilm formation was assessed by crystal violet staining and
phase-contrast microscopy, as described elsewhere [15]. To test
the stability of the salB-complemented strain in TSBG plus HS,
bacteria were taken from the wells at 6 and 24 h, serially diluted,
and plated on plain BHI, BHI-kanamycin (Kan; 2000 mg/mL),
and BHI-erythromycin (Ery; 10 mg/mL) plates.
Primary adherence assay. The initial adherence of OG1RF
and its isogenic mutants to a polystyrene surface was deter-
mined as described elsewhere [15], except that bacteria grown
in TSBG were adjusted to an OD600 of 0.1 with TSBG, TSBG
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
234 • JID 2006:193 (15 January) • Mohamed et al.
Figure 2. Growth curves of OG1RF, the sal mutants, and the salB-complemented strain. Bacteria were grown in brain-heart infusion (BHI) broth ina test tube, and growth in tryptic soy broth plus 0.25% glucose (TSBG), TSBG plus horse serum (HS), TSBG plus fibronectin (FN), and TSBG pluscollagen type I (CI) was assessed in microtiter plates as growth controls for biofilm formation. TX10109 is OG1RF with pAT18, TX10110 is the salBmutant with pAT18, and TX10111 is the salB mutant with pAT18 that contains salB (the salB-complemented strain).
plus HS, TSBG plus FN, or TSBG plus CI (as described above)
and then processed as described elsewhere [15], with the num-
bers of bacteria in 5 different microscopic fields counted in at
least 2 independent determinations.
Hydrophobicity assay. Cell surface hydrophobicities of E.
faecalis OG1RF and its mutants were tested as described else-
where [22], with some modifications. Briefly, bacterial strains
were grown overnight in 3 mL of TSBG and TSBG plus HS at
37�C. After the cells were washed with PUM buffer (22.2 g of
K2HPO4, 7.26 g of KH2PO4, 1.8 g of urea, 0.2 g of MgSO4, and
distilled water added to reach 1 L [pH 7.1]), cells were resus-
pended in 3 mL of PUM buffer, and the initial optical density
at 470 nm (ODI) was measured. Then, 300 mL of n-hexadecane
(Sigma Chemical) was added to the 3 mL of bacterial suspen-
sion; this was incubated at 37�C for 15 min. The mixture was
vortexed vigorously for 90 s and then allowed to stand for 10
min at room temperature. The aqueous phase was carefully
removed, and the final optical density at 470 nm (ODF) was
measured. The percentage of cell hydrophobicity was calculated
as follows: .[1 � (OD /OD )] � 100F I
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
E. faecalis salB, Biofilm, and ECM Binding • JID 2006:193 (15 January) • 235
Figure 3. Adherence to extracellular matrix (ECM) proteins. A, Adher-ence to fibronectin (FN) and collagen type I (CI) by OG1RF, the sal mutants,the salB-complemented strain, and plasmid controls. For the salA mutant(TX10106), the experiment was performed 2 times, with duplicates ineach experiment; for the other strains, the experiment was performed 6times, with duplicates in each experiment. TX10109 is OG1RF with pAT18,TX10110 is the salB mutant with pAT18, and TX10111 is the salB mutantwith pAT18 that contains salB (the salB-complemented strain). B, Ad-herence to FN and CI by the salB mutant (TX5123) after preincubationwith FN or CI. The experiment was performed 6 times, with duplicatesin each experiment. The mean � SD percentages of radiolabeled cellsbound to the ECM proteins are shown.
Figure 4. Biofilm formation by the sal mutants and OG1RF at 24 h.The experiment was performed 3 times, with quadruplicates in each ex-periment, and the mean � SD optical densities at 570 nm are shown.CI, collagen type I; FN, fibronectin; HS, horse serum; TSBG, tryptic soybroth plus 0.25% glucose.
Statistical analysis. Student’s t test was used to compare
OG1RF and its isogenic mutants.
RESULTS AND DISCUSSION
Identification of sal genes in E. faecalis and characterization
of the Sal proteins. In our search for SagA homologues in E.
faecalis, we identified 2 sagA-like open-reading frames in the
V583 genome database, which we named salA (EF3060) and
salB (EF0394); we had previously identified the latter as an
antigen-encoding gene [10]. Analysis of the sequences revealed
that salA, like sagA of E. faecium, has the mreC/D genes in its
immediate upstream region, whereas genes encoding hypo-
thetical proteins were found upstream of salB. Downstream of
salA and salB is a putative transcriptional regulator (EF3059)
and a putative methionine synthase (EF0395), respectively. Se-
quence analysis revealed transcriptional terminators after salA
and salB genes and separate promoters for EF3059 and EF0395;
RT-PCR with primers crossing salA (salB) and their down-
stream genes did not produce products (figure 1A), which sup-
ports the prediction that salA and salB are not cotranscribed
with their downstream genes. The salB gene has also recently
been identified by another group and named sagA on the basis
of its sequence similarity to the sagA gene of E. faecium [12].
However, because it shares similarity to SagA only in the N-
terminal part (as described below), we feel that the use of a
different name is more appropriate.
Comparison of predicted polypeptide sequences of SalA,
SalB, and SagA revealed a similar N-terminal domain (44% and
50% identity and 52% and 62% similarity for SalA and SalB,
respectively, vs. SagA of E. faecium), which were predicted by
Coilscan (Wisconsin Package version 10.0; Genetics Computer
Group) to form a coiled-coil structure but a different C-ter-
minal domain from each other. The repeat domain present in
the middle of SagA was not found in SalA and SalB. Similar
to SagA, both SalA and SalB were predicted by PSORT (avail-
able at: http://psort.nibb.ac.jp/) to be secreted proteins with a
cleavable 27-aa signal peptide. The N-terminal part of SalA
expressed in E. coli was found to react with E. faecalis patient
serum, which suggests that SalA, like SagA [7] and SalB [10],
is also an antigen expressed in vivo. Eluted antibodies from
Western blots that contained the N-terminal part of SalA (FT1)
did not react with protein extracts of YX36 (which contains
partial SalB) or vice versa (multiple bands were shown on the
Western blots, probably because of degradation of the proteins;
figure 1B), which indicates a specific reaction between these
proteins and their antibodies.
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
236 • JID 2006:193 (15 January) • Mohamed et al.
Figure 5. Attachment and hydrophobicity. A, Initial attachment of OG1RF, the sal mutants, and the salB-complemented strain to a polystyrenesurface. The experiment was performed 2 times, and 5 fields were counted in each experiment. The mean � SD no. of bacteria per field are shown.B, Hydrophobicity of wild-type OG1RF, the sal mutants and the salB-complemented strain. The experiment was performed 2 times, with 1 duplicatein each experiment, and the mean � SD percentage of hydrophobicity are shown. TX10106 is the salA mutant, TX5123 is the salB mutant, TX10109is OG1RF with pAT18, TX10110 is the salB mutant with pAT18, and TX10111 is the salB mutant with pAT18 that contains salB (the salB-complementedstrain). CI, collagen type I; FN, fibronectin; HS, horse serum; TSBG, tryptic soy broth plus 0.25% glucose.
Effect of the disruption of salA and salB on E. faecalis
growth in vitro. Unlike SagA in E. faecium, which could not
be disrupted without prior complementation, disruptions in
salA and salB were successfully constructed. In BHI broth, the
salA disruption mutant (TX10106) showed a growth curve sim-
ilar to that of OG1RF; in contrast, the salB mutant (TX5123)
generated a slightly lower optical density at 600 nm than did
OG1RF starting from 1 h, and the difference was obvious after
2 h and at entry into the stationary phase (figure 2). The growth
of TX10106, TX5123, and OG1RF were also compared in TSBG,
TSBG plus HS, TSBG plus FN, and TSBG plus CI in a 96-well
microtiter plate—the same conditions used for determining bio-
film formation. The optical-density change for TX5123 lagged
behind that of OG1RF and TX10106, but their optical densities
beyond 18 h were approximately the same. The growth of TX10106
and OG1RF was similar under all these conditions (figure 2). The
growth of the salB-complemented strain (TX10111) in BHI was
similar to that of OG1RF that contained pAT18 (TX10109),
whereas the salB mutant that contained only pAT18 (TX10110)
showed lower optical densities at 600 nm (figure 2). The growth
of TX10109 and TX10111 in TSBG, TSBG plus HS, TSBG plus
FN, and TSBG plus CI in a microtiter plate was similar to that of
OG1RF, whereas the growth of TX10110 was similar to that of
TX5123 under these conditions (data not shown).
Effect of the disruption of salA and salB on E. faecalis
binding to ECM proteins. The salB mutant TX5123, after
growth in BHI broth at 37�C, showed significant binding to CI
and FN (∼10% or ∼20% of salB mutant cells bound to CI or
FN), whereas OG1RF and the salA mutant TX10106 were non-
binders (∼1% of cells bound, with !5% considered to indicate
no binding) under these conditions ( for the salB mu-P ! .001
tant vs. OG1RF) (figure 3A). The salB-complemented strain,
like OG1RF, did not bind to CI or FN (figure 3A). Binding to
other ECM proteins—including FG, CIV, and LN—was not
detected for the sal mutants or for OG1RF under this condition.
After preincubation with 50 or 100 mg of CI or FN, binding
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
E. faecalis salB, Biofilm, and ECM Binding • JID 2006:193 (15 January) • 237
Figure 6. Biofilm development by the sal mutants and OG1RF. The experiment was performed 2 times, with quadruplicates in each experiment,and the mean � SD optical density at 570 nm at each time point is shown. CI, collagen type I; FN, fibronectin; HS, horse serum; TSBG, tryptic soybroth plus 0.25% glucose.
of the salB mutant to both CI and FN was significantly reduced
( ) (figure 3B). Preincubation with 1 mg of CI or FNP ! .001
did not affect binding (figure 3B).
Effect of the disruption of salA and salB on biofilm for-
mation of E. faecalis. Testing of the sal mutants and OG1RF
after 24 h of growth in TSBG in microtiter plates showed a
small (∼8%) but statistically significant reduction in biofilm
formation for the salA mutant TX10106 ( vs. OG1RF),P p .03
whereas the disruption of salB markedly impaired biofilm pro-
duction (∼54% reduction; vs. OG1RF) (figure 4). TheP ! .001
sal mutants and OG1RF were next grown in TSBG plus HS;
subsequently, FN and CI and were tested for biofilm formation.
OG1RF and TX10106 formed less biofilm in TSBG plus HS
and TSBG plus FN than in TSBG alone. However, the salB
mutant TX5123 formed very strong biofilm in TSBG plus HS
and TSBG plus FN ( vs. in TSBG and vs. OG1RF andP ! .001
TX10106 in TSBG, TSBG plus HS, and TSBG plus FN); in-
creased biofilm was not seen in TSBG plus CI (figure 4).
Effect of the disruption of salA and salB on initial attach-
ment to a polystyrene surface and hydrophobicity. To de-
termine whether salA and salB affect biofilm formation at the
primary adherence stage, the sal mutants and OG1RF were com-
pared for initial adherence to a polystyrene surface under dif-
ferent conditions. There was a significant reduction in initial
adherence by the salB mutant, compared with that of OG1RF
and the salA mutant, in TSBG ( ) (figure 5A), whichP p .002
suggests that SalB is important for initial attachment on the
surface; this is a prerequisite for biofilm formation. In contrast,
in TSBG plus HS and TSBG plus FN, the initial attachment of
the salB mutant was greater than that of OG1RF and the salA
mutant ( ) (figure 5A), which is consistent with theP ! .001
increased biofilm formed by the salB mutant under these con-
ditions. The salB mutant also showed higher initial adherence
in TSBG plus CI (figure 5A).
Because initial bacterial adhesion may be related to physi-
ochemical properties of the bacterial and biomaterial surfaces,
such as hydrophobicity or electrostatic charge [23], the hydro-
phobic properties of OG1RF and the mutants were compared
after growth in TSBG and TSBG plus HS. Results showed that
the salB mutant grown in TSBG plus HS had an increase in
hydrophobicity, compared with OG1RF and the salA mutant,
but that the hydrophobicity of the mutants and parental OG1RF
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
238 • JID 2006:193 (15 January) • Mohamed et al.
Figure 7. Biofilm formation by the salB-complemented strain. The experiment was performed 2 times, with quadruplicates in each experiment, andthe mean � SD optical density at 570 nm at each time point is shown. TX10109 is wild-type OG1RF with pAT18, TX10110 is the salB mutant withpAT18, and TX10111 is the salB mutant with pAT18 that contains salB (the salB-complemented strain). CI, collagen type I; FN, fibronectin; HS, horseserum; TSBG, tryptic soy broth plus 0.25% glucose.
were almost the same when grown in TSBG (figure 5B). The
salB-complemented strain TX10111 showed adherence and hy-
drophobicity similar to that of TX10109 (figure 5).
Time course of biofilm development. A time-course ex-
periment over 24 h was performed to study biofilm develop-
ment in the sal mutants and OG1RF under different conditions.
OG1RF and the salA mutant grown in TSBG displayed a steady
increase in biofilm formation up to the final time point, whereas
biofilm formation by the salB mutant was severely hindered at
all time points in TSBG (figure 6). In TSBG plus HS or FN,
salB mutant biofilm formation increased steadily up to an OD570
of 3–4 at 24 h, whereas the salA mutant and wild-type (wt)
OG1RF showed a slight decrease in biofilm formation under
these conditions (figure 6). Biofilm formation by the salB mu-
tant in TSBG plus CI reached a maximum (OD570, ≈1.3) at 6
h, after which the optical density decreased, whereas the for-
mation of biofilm by OG1RF and the salA mutant in TSBG
plus CI approximated that in TSBG (figure 6). The biofilm
formation of the salB-complemented strain TX10111 was sim-
ilar to that of TX10109 (OG1RF with the cloning vector) under
these conditions, except that, in TSBG plus HS and after 6 h,
TX10111 showed increased biofilm formation versus TX10109
to a level approximately one-half that of TX10110 at 24 h (fig-
ure 7). To rule out the possibility that, in TSBG plus HS, the
salB-complemented strain may lose the shuttle vector, we tested
the stability of the plasmid and found comparable colony-form-
ing units on BHI, BHI-Kan, and BHI-Ery plates. When Ery
was added to TSBG plus HS, biofilm formation by TX10109,
TX10110, and TX10111 was similar to that formed in TSBG
plus HS without Ery; these results indicate that the salB-com-
plemented strain was stable under this condition.
Phase-contrast microscopic analysis of biofilm. Microscopic
images taken 3 and 24 h after inoculation are shown in figure
8. After 3 h of incubation, the salB mutant started forming
clusters of cells in TSBG plus HS but not in TSBG. After 6 h
in TSBG, OG1RF and the salA mutant covered the surface,
forming microcolonies, whereas the salB mutant did not form
microcolonies; there were few attached bacteria, leaving broad
empty areas of plastic surface. In contrast, the salB mutant in
TSBG plus HS produced thick and mature biofilm after 6 h of
inoculation. The salB-complemented strain TX10111 showed
biofilm formation in TSBG and TSBG plus HS (figure 8). These
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
E. faecalis salB, Biofilm, and ECM Binding • JID 2006:193 (15 January) • 239
Figure 8. Phase-contrast microscopic analysis of biofilm structure. A, Bacteria grown in tryptic soy broth plus 0.25% glucose (TSBG). B, Bacteriagrown in TSBG plus horse serum. TX10106 is the salA mutant, TX5123 is the salB mutant, and TX10111 is the salB mutant with pAT18 that containssalB (the salB-complemented strain).
data are consistent with the indirect determination of biofilm
formation by the crystal violet staining method.
In summary, our results indicate that the absence of SalB
allows E. faecalis OG1RF to adhere to FN and CI and to form
a biofilm in the presence of serum. This is the first time that
we have been able to show, using our adherence assay, high-
level E. faecalis binding to FN or that an OG1RF derivative can
adhere to collagen when it is grown in BHI at 37�C. The salB-
complemented strain, like OG1RF, did not bind to FN or CN,
which confirms the negative effect of salB in this process. Fur-
thermore, our results show that serum and FN each elicited
strong biofilm formation by the salB mutant, whereas these
components had no effect on the salA mutant and OG1RF, and
that the increased initial attachment to the polystyrene surface
by the salB mutant grown in HS could be due, at least in part,
to the increased hydrophobic nature of the cell surface of the
salB mutant. Because both FN and CI increased the initial
attachment of the salB mutant to the polystyrene surface, it
may be that the salB mutant binds first to FN and CN, which
then attach to the plates; the subsequent increase in optical
density with HS or FN but not with CI suggests several pos-
sibilities, including that CI may be destroyed in the process,
that HS and FN may promote intercellular adherence, and/or
that HS and FN cause the activation or induction of additional
factors that further increase biofilm formation. Complemen-
tation fully restored wt phenotypes in biofilm formation (e.g.,
in TSBG and TSBG plus FN) and partially restored them in
TSBG plus HS, which suggests that the increased number of
copies of salB creates a disequilibrium and/or that FN (or some
other factor) in serum is not present in sufficient quantities to
lead to the same effect when salB is present in multiple copies.
The abnormal shape and cell surface of the salB mutant dem-
onstrated elsewhere [12] also suggested that the salB mutant
has an altered cell surface that may unmask factors involved
in FN/CI binding and biofilm formation. Reduced binding of
the salB mutant to both FN and CI after preincubation with
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018
240 • JID 2006:193 (15 January) • Mohamed et al.
either FN or CI suggests that some specific binding factor(s)
on the salB mutant may be involved in binding to both FN
and CI. Recently, we identified a family of putative microbi-
al surface component–recognizing adhesive matrix molecules
(MSCRAMMs) from E. faecalis [24], which includes the pre-
viously identified collagen/laminin-binding MSCRAMM Ace
[5]. Future studies with these putative MSCRAMMs will ad-
dress whether any of these proteins are expressed and/or ex-
posed on the surface of the salB mutant. Although these in
vitro observations with a constructed mutant may not have
clinical relevance, it is tempting to speculate that, under certain
in vivo conditions—perhaps on an intravenous catheter or in
a cardiac vegetation—salB expression might be sufficiently
down-regulated to allow in vivo FN/CI adherence and a serum-
elicited increase in biofilm formation, which might increase the
capability of this organism to cause infection.
References
1. Murray BE. The life and times of the Enterococcus. Clin Microbiol Rev1990; 3:46–65.
2. Fernandez-Guerrero ML, Verdejo C, Azofra J, de Gorgolas M. Hospital-acquired infectious endocarditis not associated with cardiac surgery:an emerging problem. Clin Infect Dis 1995; 20:16–23.
3. Xiao J, Hook M, Weinstock GM, Murray BE. Conditional adherenceof Enterococcus faecalis to extracellular matrix proteins. FEMS ImmunolMed Microbiol 1998; 21:287–95.
4. Tomita H, Ike Y. Tissue-specific adherent Enterococcus faecalis strainsthat show highly efficient adhesion to human bladder carcinoma T24cells also adhere to extracellular matrix proteins. Infect Immun 2004;72:5877–85.
5. Nallapareddy SR, Qin X, Weinstock GM, Hook M, Murray BE. En-terococcus faecalis adhesin, Ace, mediates attachment to extracellularmatrix proteins collagen type IV and laminin as well as collagen typeI. Infect Immun 2000; 68:5218–24.
6. Nallapareddy SR, Weinstock GM, Murray BE. Clinical isolates of En-terococcus faecium exhibit strain-specific collagen binding mediated byAcm, a new member of the MSCRAMM family. Mol Microbiol 2003;47:1733–47.
7. Teng F, Kawalec M, Weinstock GM, Hryniewicz W, Murray BE. AnEnterococcus faecium secreted antigen, SagA, exhibits broad-spectrumbinding to extracellular matrix proteins and appears essential for E.faecium growth. Infect Immun 2003; 71:5033–41.
8. Paulsen IT, Banerjei L, Myers GS, et al. Role of mobile DNA in the
evolution of vancomycin-resistant Enterococcus faecalis. Science 2003;299:2071–4.
9. Furst P, Mosch HU, Solioz M. A protein of unusual composition fromEnterococcus faecium. Nucleic Acids Res 1989; 17:6724.
10. Xu Y, Jiang L, Murray BE, Weinstock GM. Enterococcus faecalis antigensin human infections. Infect Immun 1997; 65:4207–15.
11. Singh KV, Qin X, Weinstock GM, Murray BE. Generation and testingof mutants of Enterococcus faecalis in a mouse peritonitis model. J In-fect Dis 1998; 178:1416–20.
12. Breton YL, Maze A, Hartke A, Lemarinier S, Auffray Y, Rince A. Iso-lation and characterization of bile salts-sensitive mutants of Entero-coccus faecalis. Curr Microbiol 2002; 45:434–9.
13. Donlan RM, Costerton JW. Biofilms: survival mechanisms of clinicallyrelevant microorganisms. Clin Microbiol Rev 2002; 15:167–93.
14. O’Toole G, Kaplan HB, Kolter R. Biofilm formation as microbial de-velopment. Annu Rev Microbiol 2000; 54:49–79.
15. Mohamed JA, Huang W, Nallapareddy SR, Teng F, Murray BE. Influ-ence of origin of isolates, especially endocarditis isolates, and variousgenes on biofilm formation by Enterococcus faecalis. Infect Immun 2004;72:3658–63.
16. Murray BE, Singh KV, Ross RP, Heath JD, Dunny GM, Weinstock GM.Generation of restriction map of Enterococcus faecalis OG1 and inves-tigation of growth requirements and regions encoding biosyntheticfunction. J Bacteriol 1993; 175:5216–23.
17. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratorymanual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Lab-oratory Press, 1989.
18. Teng F, Nannini EC, Murray BE. Importance of gls24 in virulence andstress response of Enterococcus faecalis and use of the Gls24 protein asa possible immunotherapy target. J Infect Dis 2005; 191:472–80.
19. Teng F, Murray BE, Weinstock GM. Conjugal transfer of plasmid DNAfrom Escherichia coli to enterococci: a method to make insertion mu-tations. Plasmid 1998; 39:182–6.
20. Trieu-Cuot P, Carlier C, Poyart-Salmeron C, Courvalin P. Shuttle vec-tors containing a multiple cloning site and a lacZ alpha gene for con-jugal transfer of DNA from Escherichia coli to gram-positive bacteria.Gene 1991; 102:99–104.
21. Xu Y, Murray BE, Weinstock GM. A cluster of genes involved in poly-saccharide biosynthesis from Enterococcus faecalis OG1RF. Infect Im-mun 1998; 66:4313–23.
22. Rosenberg M, Gutnick D, Rosenberg E. Adherence of bacteria to hy-drocarbons: a simple method for measuring cell-surface hydrophobic-ity. FEMS Microbiol Lett 1980; 9:29–33.
23. Bos R, van der Mei HC, Busscher HJ. Physico-chemistry of initial mi-crobial adhesive interactions—its mechanisms and methods for study.FEMS Microbiol Rev 1999; 23:179–230.
24. Sillanpaa J, Xu Y, Nallapareddy SR, Murray BE, Hook M. A family ofputative MSCRAMMs from Enterococcus faecalis. Microbiology 2004;150:2069–78.
Downloaded from https://academic.oup.com/jid/article-abstract/193/2/231/909413by gueston 07 April 2018