PHYLOGENETIC AND BIOGEOGRAPHIC RELATIONSHIPS OF CHEIRODENDRON

NUTT. EX. SEEMAN (ARALIACEAE)

A THESIS SUBMITTED TO THE GRADUATE DIVISON OF THE

UNIVERSITY OF HAWAIʻI AT MĀNOA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

IN

BOTANY

AUGUST 2014

By

Chelsea Osaki

Thesis Committee:

Clifford Morden, Chairperson

Donald Drake

David Lorence

ii

ACKNOWLEDGEMENTS

I would like to acknowledge the following people whom I am grateful for in helping

me to complete this project: Dr. Clifford Morden for his patience and kindness with the

project and throughout my time as a graduate student; Dr. Donald Drake for his insightful

comments on my thesis; and Dr. David Lorence for his knowledge of the Marquesas Islands.

I would also like to thank Joel Lau, whose ideas about the evolution and speciation of

Cheirodendron have served as the foundations of this project. To Mitsuko Yorkston, who has

taught me every lab technique I know. Thank you to Dr. Anthony Mitchell for his comments

and suggestions for primers and Dr. Ines Schönberger from Allan Herbarium (CHR) for

providing outgroup samples.

There were many people who have been involved in field work, collecting specimen,

sorting herbarium samples, performing DNA extractions, PCRs, and analyses, whose help I

greatly appreciate: Dr. Gregory Plunkett, Dr. Pei-Luen Lu, Dr. Richard Pender, Nipuni

Sirimalwatta, Adam Williams, Seana Walsh, Dylan Morden, Wendy Kishida, Steve Perlman,

Dr. Timothy Gallaher, Vianca Cao, Jesse Adams, Peter Wiggin, Bao Ying Chen, April

Cascasan, Dylan Davis, Jacy Miyaki, Gavin Osaki, Erin Fujimoto, George Akau, Matthew

Campbell, Isaiah Smith, Dr. Daniel Rubinoff, Dr. Michael Thomas, and Robert Tamayo.

Finally, I would like to thank the Botany Department at the University of Hawaiʻi at

Mānoa for providing me with opportunities to do my research; National Tropical Botanical

Garden for excellent hospitality during my stay on Kauaʻi; and finally, the Kōkeʻe Resource

Conservation Program for providing me with the opportunity to learn about conservation,

native Hawaiian plants and the beautiful island of Kauaʻi.

iii

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...................................................................................................... ii

LIST OF TABLES .................................................................................................................... v

LIST OF FIGURES ................................................................................................................. vi

CHAPTER 1. LITERATURE REVIEW AND THESIS PROPOSAL ................................... 1

INTRODUCTION ................................................................................................................. 1

Family Araliaceae ............................................................................................................. 2

Taxonomic history of the genus Cheirodendron................................................................ 3

Traditional uses ................................................................................................................. 5

PROPOSED RESEARCH AND HYPOTHESES ................................................................ 6

MATERIALS AND METHODS .......................................................................................... 7

Taxon sampling, outgroup sampling and DNA extraction ................................................ 7

DNA sequencing and analysis ........................................................................................... 8

Preliminary data ................................................................................................................ 9

Future directions ............................................................................................................... 9

CHAPTER 2. PHYLOGENETIC AND BIOGEOGRPAHIC RELATIONSHIPS OF

CHEIRODENDRON NUTT. EX. SEEM. (ARALIACEAE) ................................................. 13

ABSTRACT ........................................................................................................................ 13

INTRODUCTION ............................................................................................................... 14

MATERIALS AND METHODS ........................................................................................ 19

iv

Sampling and DNA extraction ......................................................................................... 19

DNA amplification and DNA sequencing ........................................................................ 20

Primer screening and analysis ........................................................................................ 23

RESULTS............................................................................................................................ 27

DISCUSSION ..................................................................................................................... 33

Relationships among taxa ................................................................................................ 34

Current taxonomy vs. phylogenetic relationships ........................................................... 37

Biogeographic relationships............................................................................................ 39

Future directions ............................................................................................................. 40

CHAPTER 3. SYNTHESIS- HYPOTHESES REVISITED ................................................. 42

LITERATURE CITED ........................................................................................................... 44

v

LIST OF TABLES

Table Page

1.1 Comparison of revisions of Cheirodendron………………………………………...10-11

2.1 Voucher information and locality of specimen used in this study………………….21-22

2.2 List of primers and references………………………………………………………24-26

vi

LIST OF FIGURES

Figure Page

1.1 Infrafamilial phylogenetic relationships of Araliaceae………………………………12

2.1 ETS phylogeny of Cheirodendron…………………………………………………...29

2.2 ITS phylogeny of Cheirodendron………………………………………………….…30

2.3 ndhF-rpl32 phylogeny of Cheirodendron…………………………………………....31

2.4 Combined phylogeny comparing MP, ML, and BI methods………………………..32

1

CHAPTER 1. LITERATURE REVIEW AND THESIS PROPOSAL

INTRODUCTION

Understanding infrageneneric relationships are crucial in providing a basis in analysis

for other studies such as biogeography, ecology, macroevolution, systematics, and

conservation biology (Sites & Marshall 2004). One way to determine these relationships is

through phylogenetics. Understanding phylogeny, or how species are related to one another,

provides a comprehensive interpretation of evolutionary processes, including speciation

(Harrison 1998). The study of molecular phylogenetics and phylogenetic trees has provided a

direct record of the speciation events that have led to the extant species we see today

(Barraclough & Nee 2001).

Phylogenetic analysis has been a useful tool in elucidating the microevolutionary and

macroevolutionary relationships in a number of lineages, including the family Araliaceae.

Progress has been made in resolving the placement of Araliaceae within the order Apiales

(Henwood & Hart 2001, Plunkett & Lowry 2001, Plunkett et al. 2004) as well as

understanding relationships within and among closely related genera (e.g. Wen & Zimmer

1996, Mitchell & Wagstaff 1997, Costello & Motley 2001, Eibl, Plunkett & Lowry 2001).

Although studies have been done on some of the more horticulturally (Hedera L., ivy) or

ethnobotanically (Panax L., ginseng) important genera, little attention has been given to

other genera within Araliaceae, particularly Cheirodendron Nutt. ex Seem.

The phylogenetic relationships among species of Cheirodendron are currently

unknown. To date, only a few taxonomical studies have assessed species relationships.

However, speciation is not always accompanied by clear morphological differentiation

2

(Kenfack 2011). The importance of phylogenetics in discovering species relationships of

Cheirodendron will sort out the taxonomy of the genus. My proposed research aims to

uncover species relationships by sequencing various regions of both chloroplast and nuclear

DNA. Using a molecular approach, genetic differences will be assessed, rather than

morphological characters which can be influenced by the environment and highly plastic.

Family Araliaceae

The Araliaceae consists of about 50 genera (Liu et al. 2012) and 1500 species that are

widely distributed in the tropics and subtropics of Asia, the Pacific Islands, and the

Neotropics (Wen et al. 2001, Yi et al. 2004). Most members of Araliaceae are woody with

variable leaf morphologies (simple, palmately compound and pinnately compound), but

maintain conserved floral characteristics (5-merous flowers with inferior ovaries in a

compound umbel) (Wen et al. 2001, Yi et al. 2004, Liu et al. 2012). Some well-known

species in Araliaceae include medicinal herbs such as Panax ginseng C. A. Meyer (ginseng),

and ornamentals including Hedera helix L. (English ivy) and Schefflera actinophylla (Endl.)

Harms (umbrella tree) (Liu et al. 2012).

Molecular studies of Araliaceae agree on a phylogeny with multiple polytomies and

poorly resolved basal lineages (Figure 1.1) (Mitchell & Wagstaff 1997, Plunkett, Wen &

Lowry 2004). Poorly resolved genera that are basal in Araliaceae include Schefflera J. R.

Forster & G. Forster, Cheirodendron Nutt. ex. Seem., Raukaua Seem., Cussonia Thunb.,

Osmoxylon Miq., and Hydrocotyle L. (Plunkett, Wen & Lowry 2004).

Implications about the origins of these taxa and explanations about the unresolved

basal polytomies suggest that there was a rapid diversification and radiation in Gondwana

(Mitchell & Wagstaff 2000, Plunkett, Wen & Lowry 2004). These findings corroborate with

3

Couper (1960) and Lee, Lee & Mortimer (2001) who place the origin of Araliaceae in New

Zealand during the Lower Eocene. These studies also suggest that the closest relative of

Cheirodendron is Raukaua, a genus of six species with a “Gondwanan distribution,” endemic

to New Zealand, Chile, Argentina, and Tasmania (Mitchell, Frodin & Heads 1997).

Taxonomic history of the genus Cheirodendron

The taxonomic history of Cheirodendron is convoluted. The first collections of

Cheirodendron were made by Gaudichaud, who named the plant Aralia trigyna in 1830

(Herat 1981). In his description, he noted the glabrous and opposite leaves of the plant and

its triangular fruit (Herat 1981). De Candolle (1830) placed Gaudichaud’s Aralia trigyna into

the genus Panax as P. gaudichaudii DC. Soon after, with collections made on Captain

Beechey’s voyage around the Pacific, Hooker & Arnott (1832) added two new species to De

Candolle’s Panax: P. ovatum and P. platyphyllum.

Later, well-known botanist at the time Asa Gray (1854) changed the genus to Hedera.

However, when the revision of Hederaceae occurred, Berthold Seemann took up the name

Cheirodendron from Nuttall’s manuscripts and published it as a new genus in his Revision of

the Natural Order Hederaceae (Seemann 1868). In his classification, he grouped five species

with ranges around the Pacific: C. gaudichaudii (DC) Seem. and C. platyphyllum (Hook. &

Arnott) Seem. of the Hawaiian Islands; C. laetivirens (Gay) Seem. and C. valdiviense (Gay)

Seem. of Chile; and C. samoense (A. Gray) Seem. of the Samoan Islands (Seemann 1868).

However, since then, the Chilean and Samoan species were removed from Cheirodendron,

leaving only two species (C. gaudichaudii and C. platyphyllum) in the genus.

Looking closer at Seeman’s Hawaiian species, Hillebrand (1888) was the first to

describe different forms among the Hawaiian species. Hillebrand (1888) saw five forms in C.

4

gaudichaudii, distinguished as: α, β, γ, δ, and ε. However, Heller (1897) recognized that C.

gaudichaud was the same taxon as Gaudichaud’s Aralia trigyna which had priority and

created the new combination Cheirodendron trigynum (Gaud.) Heller (Sherff 1954).

Cheirodendron fauriei Hochreutiner was described by Hochreutiner (1925) and C. dominii

Krajina, found only on Kauai, was described by Krajina (1931). Sherff (1954) later

recognized 14 subspecies of C. trigynum. (Table 1.1).

A Marquesan species, C. marquense Brown, was described in 1935, but was later

found to have been previously described in 1864 as Aralia bastardiana Decaisne (Frodin

1990). Frodin (1990) made a new combination: Cheirodendron bastardianum (Decne.)

Frodin.

Thus far, there have been three treatments classifying all species and subspecies of

Cheirodendron (Table 1.1). Sherff (1954) examined leaflet shape, carpel number, fruit size

and number of flowers per umbellule. He recognized six species, along with associated

variations and forms within the Hawaiian Islands. Although he takes note of a species in the

Marquesas, it was not included in his revision.

Herat examined the morphological and anatomical traits for many different

characters. These include traits involving the petiole and petiolule, lamina, young stem,

wood, pollen, and fruit characteristics (Herat 1981). In his taxonomic delineation, he

recognized six species of Cheirodendron in Hawaii and one species in the Marquesas (Herat

1981) (Table 1.1). His treatment greatly reduced the number of subspecific categories that

Sherff (1954) recognized.

The most recent revision of Cheirodendron was by Lowry (1990) as published in the

Manual of Flowering Plants of Hawaii. Lowry (1990) recognized five Hawaiian species and

5

one Marquesan species, making C. keakuense Kraj. var. forbesii Sherff its own species, C.

forbesii (Sherff) Lowry, and lumping C. helleri Sherff with C. trigynum (Gaud.) A. Heller.

This current taxonomy recognizes C. dominii, C. forbesii, C. fauriei, C. platyphyllum and C.

trigynum as the Hawaiian taxa and C. bastardianum as the Marquesan taxon (Lowry 1990)

(Table 1.1).

In his revision, Lowry suggests that a number of taxa in Sherff’s (1954) classification

may warrant proper species recognition. Although not noted in Table 1.1, Sherff (1954)

recognized slight population differences in distinct island locations (e.g. Northwest Kauai,

Northernmost tip of Hawaii, etc.) where each subspecies was found. Lowry’s suspicions, as

well as suspicions of others who have worked in the field, lead me to believe that these

differences represent genetically distinct taxa. However, more evidence must be presented, in

which this research intends to do.

Traditional uses

This leaf structure is indicative of the name, Cheirodendron, which is derived from

the Greek word cheiros meaning “hand” and dendron meaning “tree,” referring to its five

leaflets fixed at a common point (Rock 1913). In Hawaiian, Cheirodendron (spp.) is called

ʻōlapa or lapalapa which may have gotten its name from the similarities between the plant’s

fluttering leaves in the slightest of wind and the movements of the skirt of a hula dancer of

rank ʽōlapa (Lowry 1990). In the Marquesan language, Cheirodendron is called pimata

(Wagner & Lorence 2002).

Cheirodendron spp. was used traditionally in Hawaii for lei-making (leaves), dye-

making (fruit), and weaponry such as spears (branches) (Abbott 1992). The leaves and bark

of Cheirodendron spp. are recorded to have a carrot-like scent when crushed and, when

6

extracted, provide a fragrance for traditional materials, such as kapa (Abbott 1992, Wagner

& Lorence 2002). Branches would also be slathered with gum from sticky Pisonia L. spp.

seeds to ensnare birds (Abbott 1992). Traditional uses of C. bastardianum in the Marquesas

Islands included utilizing the leaves in lei-making (Wagner & Lorence 2002).

PROPOSED RESEARCH AND HYPOTHESES

The taxonomical work done by Sherff (1954), Herat (1981), and Lowry (1990) are

helpful in discerning species relationships in Cheirodendron. However, genetic data were

unavailable to clarify relationships among the populations and or species. My research will

help to discern these relationships by comparing regions in the nuclear and chloroplast

genomes. Phylogenies based on these regions will show if the current taxonomic

classification corresponds or may show distinct genetic taxa that warrant species recognition.

Discovering the species relationships among Cheirodendron will also elucidate

biogeographic implications regarding the source of the species in Hawaii and Marquesas, its

closest relatives, and biogeographic patterns of dispersal within Hawaii. Three specific

hypotheses have been established:

Hypothesis one: Phylogenetic analysis does not support the current taxonomic

classification based on morphological data.

Based on herbaria specimen and personal field observations, vast morphological

differentiation within the species, especially C. trigynum, causes me to believe that some taxa

were left out of the classification.

Hypothesis two: Cheirodendron is monophyletic.

Mitchell et al. (2012) evaluated the phylogenetic relationships of Raukaua, a

paraphyletic group whose New Zealand species share a sister relationship with

7

Cheirodendron. However, this study only included a single species, C. trigynum, to represent

the genus Cheirodendron (Mitchell et al. 2012). The proposed study will evaluate the

monophyly of Cheirodendron by including all taxa in analyses.

Hypothesis three: The Pacific biogeography of Cheirodendron involves an Austral

origin with long distance dispersal to Hawaii and then to the Marquesas.

Fosberg (1948) suggested the origin of Cheirodendron to be from a single

introduction from an Austral origin. This claim was later supported with phylogenetic

analyses evaluating generic relationships within Araliaceae (Wen et al. 2001, Plunkett, Wen

& Lowry 2004) and studies of Raukaua (Mitchell & Wagstaff 1997, Mitchell & Wagstaff

2000, Mitchell et al. 2012), the genus whose shares a sister relationship to Cheirodendron.

With precedence of other groups with Pacific distributions, Gillett (1972) suggested

that Cheirodendron is likely to have spread from an Austral origin to Hawaii, and then to the

Marquesas. An in depth morphological assessment of the group suggested the same

biogeographic pattern, as the leaf morphology of the Marquesan species, C. bastardianum,

resembles an intermediate form between two Hawaiian species, C. platyphyllum and C.

trigynum (Herat 1981). In addition, the fruit anatomy of the Marquesan species resembles C.

platyphyllum (Herat 1981).

MATERIALS AND METHODS

Taxon sampling, outgroup sampling and DNA extraction

To ensure proper taxon sampling, collection will include all taxa mentioned in the

current revision (Lowry 1990), including samples of the same taxon from different islands. If

personal collection is not possible, collection by collaborators or herbarium specimen will

supplement my personal collection. For all collections made, a voucher will be collected for

8

reference, along with a tissue sample that will be extracted of DNA. Outgroup taxa chosen

for this study will be Raukaua anomalus (Hook.) A. D. Mitch., Frodin & Heads, R. edgerleyi

(Hook. f.) Seem., R. simplex (G. Forst.) A. D. Mitch., Frodin & Heads and Schefflera digitata

J. R. & G. Forst.; all shown to be monophyletic with Cheirodendron in a previous study

(Mitchell et al. 2012). Total genomic DNA will be extracted using a modified CTAB

protocol (Doyle & Doyle 1987) and purified with phenol and chloroform.

DNA sequencing and analysis

Primers will be chosen on the basis of having enough variability. Polymerase chain

reaction will be performed to amplify DNA regions of interest. PCR products will be

visualized on 1% agarose gel stained with EtBr to confirm amplification before being

cleaned with ExoSAP –IT (USB, Cleveland, Ohio, USA). Cleaned PCR products will be sent

to the Greenwood Molecular Biology Facility at the University of Hawaii at Manoa. PCR

products will be sequenced in both the forward and reverse directions to confirm sequences,

and completed sequences will be edited and assembled in Sequencher 3.0 (Gene Codes

Corporation, Ann Arbor, Michigan, USA). Sequences will be aligned using ClustalW in

MEGA version 6 (Tamura et al. 2013) and trimmed to be the same number of base pairs.

Molecular evolutionary analyses using maximum parsimony (MP) will be conducted

using MEGA version 6 (Tamura et al. 2013). Maximum likelihood (ML) analyses will be

carried out on a web-based server, molecularevoution.org, using GARLI version 2.0

(Bazinet, Zwickl & Cummings 2014). Bayesian inference will be carried out using MrBayes

version 3 (Hueselenbeck & Ronquist 2001). If there is congruence among gene regions, a

combined dataset will be analyzed under the phylogenetic methods mentioned above.

9

Preliminary data

Thus far, primer screening for variable regions has been ongoing. The problem has

been finding regions that have enough variability to resolve a phylogenetic tree. At present,

both nuclear and chloroplast regions have been sequenced, including gene, spacer and intron

regions of the genome. Nuclear regions sequenced include Phytochrome C (gene), Nitrate

reductase (intron) and the internal transcribed spacer (ITS) (spacer). Chloroplast regions

include atpB-rbcL (spacer), rbcL (gene), trnL-trnF (spacer), and ndhF-rpl32 (spacer). All

regions tested to date have resulted in little to no variability

Future directions

Regions that show more genetic variation need to be found. Since regions used in

many other phylogenetic studies (ie: trnL-trnF intergenic spacer) do not show variation in

Cheirodendron, faster-evolving regions need to be sequenced. Other chloroplast regions will

be tested as described by Shaw et al. (2005, 2007). Nuclear regions described in Zimmer &

Wen (2012) can also be looked into. Good samples that are representative of the different

taxa around Hawaii need to be analyzed. Thorough collection around all the main Hawaiian

Islands needs to be done.

Table 1.1. Comparison of revisions of Cheirodendron. For location, K=Kauai, O=Oahu, Mo=Molokai, L=Lanai, M=Maui, H=Hawaii,

Marq=Marquesas Islands

Sherff

(1954)

Herat

(1981)

Lowry

(1990)

Species Subspecies Form Location Species Subspecies Location Species Subspecies Location

platyphyllum O platyphyllum platyphyllum O platyphyllum platyphyllum O

kauaiense keakuense K kauaiense K kauaiense K

forbesii K keakuense keakuense K forbesii K

dominii K forbesii K dominii K

trigynum subcordatum H dominii K trigynum trigynum O, Mo,

L, M, H

fosbergii O trigynum trigynum H helleri K

mauiense M acuminatum H fauriei K

oblongum latius M fosbergii O bastardianum Marq

molokaiense angustius Mo, M hillebrandii O, L, Mo

osteostigma Mo mauiense Mo, M

halawanum O, M, L fauriei K

hillebrandii O helleri K

confertiflorum M marquesense Marq

rockii L

skottsbergii L, M

ilicoides H

acuminatum H

degeneri pauciflorum H

fauriei macdanielsii K

10

Table 1.1. (Continued) Comparison of revisions of Cheirodendron. For location, K=Kauai, O=Oahu, Mo=Molokai, L=Lanai,

M=Maui, H=Hawaii, Marq=Marquesas Islands

Sherff

(1954)

Herat

(1981)

Lowry

(1990)

Species

Subspecies Form Location Species Subspecies Location Species Subspecies Location

helleri microcarpum K

multiflorum K

sodalium K

11

12

Figure 1.1. Infrafamilial phylogenetic relationships of Araliaceae. Consensus from maximum

parsimony analysis of combined ITS and trnL-trnF data. (from Plunkett, Wen & Lowry

2004).

13

CHAPTER 2. PHYLOGENETIC AND BIOGEOGRPAHIC RELATIONSHIPS OF

CHEIRODENDRON NUTT. EX. SEEM. (ARALIACEAE)

ABSTRACT

Cheirodendron is a genus of six arboreal species in the family Araliaceae, distributed

in the Hawaiian and Marquesas Islands. Previous and current revisions were assessed using

morphological characteristics, resulting in the present taxonomy that consists of five species

and two subspecies in Hawaii and one species in the Marquesas. For the first time, molecular

phylogenetic analyses were carried out to determine species and biogeographic relationships

using sequences from the internal and external transcribed spacer regions of nuclear

ribosomal DNA, and the ndhF-rpl32 chloroplast spacer region. The results suggest that

Cheirodendron is a monophyletic group with Marquesan species C. bastardianum sister to

the Hawaiian Cheirodendron. Within the Hawaiian Cheirodendron, a clade of non-Kauai

taxa was well-supported and a clade of Kauai taxa was weakly supported. However, species

relationships within the Hawaiian clades were unresolved. Phylogenetic differences among

subspecies suggest the recognition of two previously-recognized species, C. helleri Sherff

and C. kauaiense Kraj. Results suggest two possible biogeographic patterns of

Cheirodendron in the Pacific: (1) a stepping stone pattern of dispersal from New Zealand to

Marquesas, and Marquesas to Hawaii or (2) a simultaneous colonization of both Hawaii and

Marquesas. Understanding species relationships and the biogeography of Cheirodendron

adds to our knowledge of the evolution and speciation of Pacific island groups. Long

distance dispersal, along with in situ speciation on island archipelagos provides interesting

evolutionary and biogeographic patterns to be discussed.

14

INTRODUCTION

Cheirodendron Nutt. ex. Seeman is a genus of six arboreal species in the family

Araliaceae. Araliaceae is composed of about 50 genera and 1500 species widely distributed

in the tropics and subtropics of Asia, the Pacific Islands, and the Neotropics (Wen et al. 2001,

Yi et al. 2004). Most members of Araliaceae are woody with variable leaf morphologies, but

maintain conserved floral characteristics (Wen et al. 2001, Yi et al. 2004, Liu et al. 2012).

Some well-known species in Araliaceae include medicinal herbs such as ginseng (Panax

ginseng C. Meyer), and ornamentals including English ivy (Hedera helix L.) and the

umbrella tree (Schefflera actinophylla (Endl. Harms) (Liu et al. 2012).

Cheirodendron has a tropical distribution in the Pacific Ocean with species occurring

in the Hawaiian Islands and the Marquesas Islands. Mature individuals stand at 2-15 meters

and are one of the dominant canopy constituents in mesic forests, wet forests and bogs from

600-1500 meters in elevation (Lowry 1990). All species have compound leaves, with 3-5(-7)

leaflets with margins toothed to entire (Lowry 1990). Flowers are perfect and arranged in

oppositely branched umbels, with carpel numbers varying from two to five (Frodin 1990,

Lowry 1990). When broken or crushed, plant parts emit a strong carrot-like odor (Frodin

1990, Lowry 1990). Fruits are small fleshy drupes that, when ripe, exude a deep purple liquid

which traditional Hawaiians used for dyes.

The current taxonomy recognizes six species distinguishable by morphological

characteristics of leaflet shape and carpel number (Lowry 1990). Cheirodendron trigynum

(Gaud.) A. Heller is the most common species and is known from all the high Hawaiian

Islands except Kahoolawe. It has been reported from Niihau (Hooker & Arnott 1832), but has

since been extirpated (St. John 1959). This species is distinguished from the others by

15

having leaflets longer than wide, ovate to elliptic; margins entire or serrate-crenate and teeth

curved upward and inward (Lowry 1990). The species maintains two morphological forms

recognized as distinct subspecies, C. trigynum ssp. trigynum and ssp. helleri (Sherff) Lowry.

Subspecies helleri is only found on the island of Kauai and flowers have two (occasionally 3)

styles and carpels, while ssp. trigynum is only present on the younger islands (Oahu, Maui,

Lanai, Molokai, and Hawaii) and has three to four (rarely 2) styles and carpels.

Cheirodendron platyphyllum (Hook. & Arnott) Seem. is characterized by broadly

ovate to depressed ovate leaflets that are wider than they are long. This species is known

from Kauai and Oahu, where two subspecies are present, differing in carpel number and

leaflet shape. Subspecies kauaiense (Kraj) Lowry from Kauai has two carpels and rounded

leaflet apices, while subspecies platyphyllum from Oahu maintains five (rarely 4) carpels and

acuminate leaflet apices (Lowry 1990). Three other species, C. dominii Kraj., C. fauriei

Hochr. and C. forbesii (Sherff ) Lowry are restricted to Kauai each having differences in the

degree of dentations on their leaflet margins, carpel numbers and locality. The characteristics

of C. dominii include three broadly ovate leaflets longer than wide, margins caudate-dentate

and spiny in appearance, and three to four (sometimes 2 or 5) styles and carpels (Lowry

1990). This taxon is also quite rare, occurring only in wet forest at 1525-1550 m in elevation

near the slopes of Mount Waialeale (Lowry 1990). Similarly, C. fauriei has leaflets with the

same spiny appearance as C. dominii; however they are more orbicular in shape. The ovary

contains two (sometimes 3) carpels and is widely distributed in diverse mesic to wet forests

at 650-1250 m in elevation (Lowry 1990). Cheirodendron forbesii is distinguished by its

leaflets that are nearly twice as long as they are wide, margins entire, and five (sometimes 4)

carpels (Lowry 1990). Cheirodendron bastardianum is the only species that occurs outside

16

Hawaii and it shares similar morphological characteristics with the Hawaiian taxa (Frodin

1990). It is distinguished from Hawaiian Cheirodendron by morphological characteristics

including leaves as long as or slightly longer than broad and rounded, truncate or slightly

cordate at the base, longer pedicels, and smaller fruit (Brown 1935, Wagner & Lorence

2002).

Previous studies and revisions of Cheirodendron (Sherff 1954, Herat 1981, Lowry

1990) focus only on morphological distinctions of the group. However, these defining

features often overlap. Speciation is not always accompanied by clear morphological

differentiation (Kenfack 2011), and it is important to also look at genetic relationships in an

evolutionary perspective. Studies that focus on infrageneric relationships and species

delimitation are important because species are the basic fundamental unit in other disciplines,

including biogeography, ecology, macroevolution, systematics and conservation (Sites &

Marshall 2004).

To date, no molecular work has been done to assess species relationships and the

biogeographic relationships within Cheirodendron. However, several recent studies have

focused on generic relationships within the family Araliaceae. Plunkett, Wen & Lowry

(2004) showed that there were three major clades within the family (Asian palmate group,

Polyscias J. R. Forst. & G. Forst.-Pseudopanax K. Koch group, and Aralia L. group),

although these clades along with numerous other taxa form an unresolved polytomy. These

unresolved groups were attributed to rapid diversification during the Gondwana break up,

which led to the widespread distribution of these groups (Plunkett, Wen & Lowry 2004).

Cheirodendron, along with a close relative, Raukaua Seem., are placed within this polytomy

(Plunkett, Wen & Lowry 2004). Much attention has been given to the biogeographic

17

implications of Raukaua because of its “Gondwanan distribution” in Chile, Argentina, New

Zealand and Tasmania (Mitchell & Wagstaff 1997, Mitchell & Wagstaff 2000). Recently,

Mitchell et al. (2012) demonstrated that Raukaua is paraphyletic based on chloroplast and

nuclear DNA sequence analysis because of the placement of Cephalaralia cephalobotrys (F.

Muell.) Harms, Motherwellia haplosciadea F. Muell., Cheirodendron trigynum (Gaud.) A.

Heller and Schefflera digitata J. R. Forst. intermixed within the Raukaua clade.

Raukaua is a genus of six species with distribution of extant taxa in South America,

New Zealand and Tasmania. The Raukaua taxa closest to Cheirodendron are those from New

Zealand [R. anomalus (Hook.) A. D. Mitch., Frodin & Heads, R. simplex (G. Forst.) A. D.

Mitch., Frodin & Heads, R. edgerleyi (Hook. f.) Seem.], which form a monophyletic clade in

previous analyses (Mitchell & Wagstaff 1997, Mitchell & Wagstaff 2000, Mitchell et al.

2012). Cheirodendron and New Zealand Raukaua share several synapomorphies including

stipules or ligules reduced or absent, coriaceous adult leaf texture, pedicel articulating below

the flower, wood intervessel pitting scalariform or opposite (Mitchell & Wagstaff 2000), fruit

with laterally compressed endocarps, paniculate inflorescences with opposite umbellules,

pentamorous flowers with 2-5 carpels, and palmately compound leaves (in Raukaua mostly

in juvenile leaves) (Lowry, Plunkett & Wen 2004). This supports the idea that

Cheirodendron is a recent relative of an ancestor that probably originated in New Zealand

(Fosberg 1948) and that the current distribution of Cheirodendron is due to a long distance

dispersal event (Mitchell & Wagstaff 2000).

The biogeographic patterns of Cheirodendron across the Pacific have not been well-

studied. However, molecular phylogenetics has been a useful tool in discerning species

relationships and the biogeographic patterns in many Pacific taxa, such as the Hawaiian

18

Silverswords (Carlquist, Baldwin & Carr 2003), Cyrtandra J. R. Forst. & G. Forst.

(Gesneriaceae) (Cronk et al. 2005), Plantago L. (Plantaginaceae) (Dunbar-Co, Wieczorek &

Morden 2008), Astelia s.l. (Asteliaceae) (Birch & Keeley 2013), amonfelsenstieng many

others. The evolution and speciation of these groups is especially interesting because the

islands that they are native to lie miles from the nearest continental land mass and are

resultant from a single, or sometimes, multiple events of long-distance dispersal (Wagner &

Funk 1995).

There has been one study assessing the biogeographic patterns of Cheirodendron.

Based on morphological analyses, Herat (1981) suggests an Austral origin for Cheirodendron

with dispersal overseas to Hawaii, and subsequent dispersal to the Marquesas. This “stepping

stone” dispersal pattern from island to island in the Pacific is well-known among other

indigenous groups such as Metrosideros Banks ex Gaertn. (Myrtaceae) (Wright et al. 2001),

Astelia (Asteliaceae) (Birch & Keeley 2013), Coprosma J. R. Forst. & G. Forst. (Rubiaceae)

(Cantley et al. 2014) and many others. What is also interesting about Herat’s (1981) findings

is that he concludes a Hawaiian species to be the progenitor of the single Marquesan species,

Cheirodendron bastardianum, a claim that Gillett (1972) also made, although his ideas were

merely speculation on the basis that there were similarities between Hawaiian and Marquesan

floras. Hawaii, being one of the Pacific archipelagos most distant from any continental

landmasses, has often been assumed to be a sink for dispersal, rather than a source (Carlquist

1974). However, recent molecular analyses have found that Hawaiian groups such as

Melicope J. R. Forst. & G. Forst. (Rutaceae) (Harbaugh et al. 2009a) and Santalum L.

(Santalaceae) (Harbaugh & Baldwin 2007) have been the source of colonization on other

Pacific archipelagos.

19

The mode of seed dispersal in Cheirodendron across the Pacific is thought to be from

ingestion by birds (Herat 1981) as with many other groups that have Pacific distributions and

fleshy fruits (eg: Howarth & Baum 2005, Harbaugh et al. 2009a, Cantley et al. 2014). The

importance of birds in carrying seeds over long distances is apparent, as a number of

Hawaiian taxa were brought to the islands by birds (Price & Wagner 2004).

The current study used molecular phylogenetics as a tool to determine species

relationships and the biogeography of Cheirodendron by addressing the following questions:

(1) What are the species relationships in Cheirodendron? (2) Does the molecular phylogeny

support the current taxonomy of five species distributed within the Hawaiian Islands? and (3)

Does the molecular data support a colonization of Cheirodendron to the Marquesas Islands

via Hawaiian Islands as Gillett (1972) and Herat (1981) suggest or was there a stepping stone

colonization across the Pacific from the Marquesas Islands to Hawaii? The following study

includes molecular sequence data of two nuclear regions (ETS and ITS) and one chloroplast

region (ndhF-rpl32) to construct a phylogenetic tree for Cheirodendron.

MATERIALS AND METHODS

Sampling and DNA extraction

Leaf tissue of all currently recognized taxa (Lowry 1990) was sampled. A total of 22

samples were analyzed, including at least two samples from each taxon in Cheirodendron,

except C. bastardianum, in order to account for possible population differences (Table 2.1).

Although C. bastardianum persists on multiple islands in the Marquesas, only one sample

was available for study from Hiva Oa. However, C. bastardianum has been found to be

morphologically consistent among islands (Steve Perlman, National Tropical Botanical

20

Garden, personal communication). Outgroup taxa chosen for this study were Raukaua

anomalus, R. edgerleyi, R. simplex and Schefflera digitata; all shown to be monophyletic

with Cheirodendron (Mitchell et al. 2012).

Total genomic DNA was extracted from fresh or silica-preserved leaves or herbarium

specimens using a modified CTAB protocol (Morden, Caraway & Motley 1996) and purified

with phenol/chloroform. DNA from Hawaiian taxa were accessioned into the Hawaiian Plant

DNA library and stored at -20°C for future use (Morden, Caraway & Motley 1996).

Vouchers of each individual collected were deposited into the Joseph Rock Herbarium

(HAW).

DNA amplification and DNA sequencing

Each PCR reaction contained a total of 25 µL of 1X GoTaq Flexi Buffer (Promega,

Madison, Wisconsin, USA), 2 mM MgCl2 (Promega), 0.25 µg/µL bovine serum albumin

(Amresco, Solon, Ohio, USA), 0.1 µmol/L of each primer (forward and reverse, see Table

2.2), 0.2 mM each dNTP, 1U GoTaq Flexi DNA polymerase (Promega) and 1 µL of DNA

diluted to 20 ng/µL. PCR was performed using a DNA Thermocycler (MJ Research, St.

Bruno, Quebec, Canada) programed for an initial denaturation at 95°C for 2 min, followed by

30 cycles of 93°C for 1 min, 45-55°C for 1 min, and 72°C for 2 min, followed by an

extended elongation on the final step of 72°C for 3 min. When necessary, PCR products were

cloned using the StrataClone PCR Cloning Kit with associated protocols (Agilent

Technologies, La Jolla, California, USA).

PCR products were visualized on 1% agarose gel stained with EtBr to confirm

amplification before being cleaned with ExoSAP –IT (USB, Cleveland, Ohio, USA).

21

Table 2.1. Voucher information and locality of specimen used in this study. Stars indicate

samples used in primer screening.

Taxon

Voucher number, associated

herbaria

Location collected

Cheirodendron trigynum

(Gaud.) A. Heller ssp.

helleri (Sherff) Lowry

K. R. Wood 14168 (PTBG,

BISH, MBK)

Laau, Kauai, HI, USA

Cheirodendron trigynum

(Gaud.) A. Heller ssp.

helleri (Sherff) Lowry

K. R. Wood 15220 (PTBG,

BISH, MO)

Waiakoali, Kauai, HI, USA

* Cheirodendron trigynum

(Gaud.) A. Heller ssp.

helleri (Sherff) Lowry

C. Osaki 52 (HAW, PTBG,

BISH)

Kokee, Kauai, HI, USA

* Cheirodendron trigynum

(Gaud.) A. Heller ssp.

trigynum

C. Morden (HAW) Puulalaau, Hawaii, HI, USA

Cheirodendron trigynum

(Gaud.) A. Heller ssp.

trigynum

C. Osaki 72 (HAW) Manana trail, Oahu, HI, USA

Cheirodendron trigynum

(Gaud.) A. Heller ssp.

trigynum

S. Walsh (HAW) Munroe trail, Lanai, HI, USA

Cheirodendron trigynum

(Gaud.) A. Heller ssp.

trigynum

S. Walsh (HAW) Waihee trail, Maui, HI, USA

* Cheirodendron

platyphyllum (Hook. &

Arnott) Seem. ssp.

kauaiense (Kraj.) Lowry

C. Osaki 56 (HAW, PTBG,

BISH)

Circle Bog, Kauai, HI, USA

Cheirodendron

platyphyllum (Hook. &

Arnott) Seem. ssp.

kauaiense (Kraj.) Lowry

K. R. Wood 14170 (PTBG,

BISH, K, MBK)

Laau, Kauai, HI, USA

Cheirodendron

platyphyllum (Hook. &

Arnott) Seem. ssp.

platyphyllum

C. Osaki 32 (HAW) Konahuanui, Oahu, HI, USA

*Cheirodendron dominii

Kraj.

K. R. Wood 12284 (PTBG,

BISH, UC)

Waialeale, Kauai, HI, USA

Cheirodendron dominii

Kraj.

C. Osaki 70 (HAW, PTBG,

BISH)

Kilohana vista, Kauai, HI,

USA

Cheirodendron fauriei

Hochr.

K. R. Wood 15185 (PTBG,

BISH, UC, US)

Kalalau rim, Kauai, HI, USA

22

Table 2.1. (Continued) Voucher information and locality of specimen used in this study.

Stars indicate samples used in primer screening.

Taxon

Voucher number, associated

herbaria

Location collected

Cheirodendron fauriei

Hochr.

K. R. Wood 14203 (PTBG,

MBK, MO, UBC, US)

Kamooloa, Kauai, HI, USA

Cheirodendron fauriei

Hochr.

C. Osaki 42 (HAW, PTBG,

BISH)

Wahiawa bog, Kauai, HI,

USA

Cheirodendron forbesii

(Sherff) Lowry

C. Osaki 61 (HAW, PTBG,

BISH)

Powerline trail, Kauai, HI,

USA

Cheirodendron forbesii

(Sherff) Lowry

C. Osaki 49 (HAW, PTGB) Makaleha, Kauai, HI, USA

Cheirodendron

bastardianum (Decaisne)

Frodin

Jon Price 205 (PTBG, US,

PAP, P, BISH)

Hiva Oa, Marquesas Islands,

French Polynesia

Raukaua anomalus (Hook.)

A. D. Mitch., Frodin &

Heads

A. Mitchell CHR 529088

(CHR)

Banks Penninsula, Prices

Valley, New Zealand

Raukaua edgerleyi (Hook. f.)

Seem.

D. Grinstead, C. Jones CHR

553730 (CHR)

Eastern Nelson, Hira Forest,

New Zealand

Raukaua simplex (G. Forst.)

A. D. Mitch., Frodin &

Heads

P.I. Knightbridge 70

(CHR)

Mount Wilberg, New

Zealand

Schefflera digitata J. R. & G.

Forst.

P. B. Heenan CHR 610132 B

(CHR)

Cultivated, Christchurch,

New Zealand

23

Cleaned PCR products were sent to the Greenwood Molecular Biology Facility at the

University of Hawaii at Manoa. PCR products were sequenced in both the forward and

reverse directions to confirm sequences, and completed sequences were edited and assembled

in Sequencher 3.0 (Gene Codes Corporation, Ann Arbor, Michigan, USA). Sequences were

aligned using ClustalW in MEGA version 6 (Tamura et al. 2013) and trimmed to be the same

number of base pairs.

Primer screening and analysis

Before choosing which regions to analyze, primers were screened based on their

ability to amplify and the number of indels among individuals of the genus. To identify

variable gene regions for analysis, four samples representing 3 species from different

locations were used: C. trigynum ssp. helleri (Kauai), C. trigynum ssp. trigynum (Hawaii), C.

dominii (Kauai) and C. platyphyllum ssp. kauaiense (Kauai) (See Table 2.1, taxa used for

screening indicated with a star *). In total, 15 chloroplast and 9 nuclear regions were

examined (Table 2.2). However, only three regions had enough variation where all samples

amplified, and these were then sequenced for all individuals. ITS sequences for outgroup

taxa (Schefflera digitata, Raukaua simplex, R. anomalus, and R. edgerleyi) were taken from

GenBank identified by the following respective accession numbers: JX106299.1, U63180.2,

U63164.1, U63171.1.

Before performing phylogenetic analysis, JModel Test 2 (Darriba et al. 2012,

Guindon & Gascuel 2003) was used to determine the best parameters for each region

separately and combined according to the Akaike information criterion (AIC).

Molecular evolutionary analyses using maximum parsimony (MP) were conducted

using MEGA version 6 (Tamura et al. 2013). All characters were equally weighted and gaps

Table 2.2. List of primers and references.

Locus Genome

origin, type of

DNA

Primer names, sequences (5’-3’) and reference Approximate

length of

region (base

pairs)

Number

of indels

Percent

variability

(%)

Internal

transcribed

spacer (ITS)

Nuclear,

spacer

ITS 5: GGAAGTAAAAGTCGTAACAAGG

ITS 4: TCCTCCGCTTATTGATATGC

(Baldwin 1992)

600 9 1.5

Phytochrome C

(PHYC)

Nuclear, gene Phy C F: GAYTTRGARCCWGTDAAYC

Phy C R: GRATKGCATCCATYTCMAYRTC

(Matthews & Donoghue 1999)

600 1 0.2

Nitrate

reductase (NIA)

Nuclear, gene NIA F5: GCTGAACTTGCTAACGCTGA

NIA i2R: CCATGTCTCTCCTCCATCCA

(Levin, Blanton & Miller 2009)

600 5 0.8

Nitrate

reductase (NIA)

Nuclear,

intron

NIA i3 F:

AARTAYTGGTGYTGGTGYTTYTGGTC

NIA i3 R: GAACCARCARTTGTTCATCATDCC

(Howarth & Baum 2002)

1300 22

1.7

Alcohol

dehydrogenase

(Adh)

Nuclear, gene Adhx2-1 F: CTTCACTGCTTTATGTCACACT

Adhx8-1 R: GGACGCTCCCTGTACTCC

(Small & Wendel 2000)

Did not

amplify

- -

Phytochrome A

(PHYA)

Nuclear, gene Phy A F: CCYTAYGARGRNCCYATGACWGC

Phy A R: GDATDGCRTCCATYTCRTAGTC

(Matthews & Donoghue 1999)

Did not

amplify

- -

5S-Non-

transcribed

spacer

Nuclear,

spacer

5SFUL: TTAGTGCTGGTATGATCGCA

5SR: CACCGGATCCCATCAGAACT

(Udovicic, McFadden & Ladiges 1995)

Did not

amplify

- -

External

transcribed

spacer (ETS)

Nuclear,

spacer

ETS 18S: GAGCCATTCGCAGTTTCACAG

(Wright et al. 2001)

jkETS 9: CGT WMA GGY GYA TGA GTG GT

(Mitchell, Heenan & Patterson 2009)

500 4

0.8

24

Table 2.2. (Continued) List of primers and references.

Locus Genome

origin, type of

DNA

Primer names, sequences (5’-3’) and reference Approximate

length of

region (base

pairs)

Number

of indels

Percent

variability

(%)

Xanthine

dehydrogenase

(Xdh)

Nuclear, gene X502F: TGTGATGTCGATGTATGC

X1599R: G(AT)GAGAGAAA(CT)TGGAGCAAC

(Gorniak, Paun & Chase 2010)

1000 3 0.3

trnL-trnF Chloroplast,

spacer

E: GGTTCAAGTCCCTCTATCCC

F: ATTTGAACTGGTGACACGAG

(Taberlet et al. 1991)

400 1 0.3

trnL Chlroplast,

intron

C: CGAAATCGGTAGACGCTACG

D: GGGGATAGAGGGACTTGAAC

(Taberlet et al. 1991)

535 2 0.4

psbA-trnH Chloroplast,

spacer

psbA: GTTATGCATGAACGTAATGCTC

trnH: CGCGCATGGTGGATTCACAATCC

(Shaw et al. 2005)

450 2 0.4

ndhA Chloroplast,

intron

ndhAx1:

GCYCAATCWATTAGTTATGAAATACC

ndhAx2: GGTTGACGCCAMARATTCCA

(Shaw et al. 2007)

Did not

amplify

- -

atpB-rbcL Chloroplast,

spacer

atpB: GAAGTAGTAGGATTGATTCTC

rbcL: ATGTCAACAGGTACATGGTC

(Manen, Natali & Ehrendorfer 1994)

800 0 0

rbcL Chloroplast,

gene

ESRBCLF:

ATGTCACCACAAACGGAGACTAAAGC

ESRBCL1361R:

TCAGGACTCCACTTACTAGCTTCACG

(Schuettpelz & Pryer 2007)

1200 0 0

ndhF-rpl32 Chloroplast,

spacer

ndhF: GAAAGGTATKATCCAYGMATATT

rpl32r: CCAATATCCCTTYYTTTTCCAA

(Shaw et al. 2007)

1200 8 0.7

25

Table 2.2. (Continued) List of primers and references.

Locus Genome

origin, type of

DNA

Primer names, sequences (5’-3’) and reference Approximate

length of

region (base

pairs)

Number

of indels

Percent

variability

(%)

trnQ-rps16 Chloroplast,

spacer

trnQ: GCGTGGCCAAGYGGTAAGGC

rps16-1: GTTGCTTTYTACCACATCGTTT

(Shaw et al. 2007)

2000 21 1

rpl16 Chloroplast,

gene

rpL16F71:GCTATGCTTAGTGTGTGACTCGTTG

rpl16R1516: CCCTTCATTCTTCCTCTATGTTG

(Shaw et al 2005)

Did not

amplify

- -

trnS-trnG Chloroplast,

spacer

trnS: AACTCGTACAACGGATTAGCAATC

trnG: GAATCGAACCCGCATCGTTAG

(Shaw et al. 2007)

1000 4

0.4

ndhF Chloroplast,

portion of

gene

536F: TTGTAACTAATCGTGTAGGGGA

1603R:

GCATAGTATTGTCCGATTCAT(A/G)AGG

(Olmstead & Sweere 1994)

800 1 0.1

ndhC-trnV Chloroplast,

spacer

ndhC:

TATTATTAGAAATGYCCARAAAATATCA

TATTC

trnVx2: GTCTACGGTTCGARTCCGTA

(Shaw et al. 2007)

1000 4 0.4

trnT-trnL Chloroplast,

spacer

trnT: CAAATGCGATGCTCTAACCT

trnL: GGGGATAGAGGGACTTGAAC

(Shaw et al. 2005)

800 4 0.5

rpl32-trnL Chloroplast,

spacer

rpl32F: CAGTTCCAAAAAAACGTACTTC

trnL: CTGCTTCCTAAGAGCAGCGT

(Shaw et al. 2007)

950

5

0.5

petL-psbE Chloroplast,

spacer

petL: AGTAGAAAACCGAAATAACTAGTTA

psbE: TATCGAATACTGGTAATAATATCAGC

(Shaw et al. 2007)

Did not

amplify

- -

26

27

or missing data were treated as complete deletion. Heuristic searches were conducted using

the tree-bisection reconnection method. A consensus of equally parsimonious trees was

constructed where branches of less than 50% consensus were collapsed into a polytomy. A

total of 1000 bootstrap replicates were carried out to construct the tree. Maximum likelihood

(ML) analyses were carried out on a web-based server, molecularevoution.org, using GARLI

version 2.0 (Bazinet, Zwickl & Cummings 2014). An optimal tree was inferred from 2000

non-parametric bootstrap replicates. If the best-fit model identified in JModel Test was not

available, the general time-reversible (GTR) model was chosen. Bootstrap resampling in both

MP and ML (reported as percentages below) were used to estimate the robustness of the

nodes (Felsenstein 1985). Bayesian inference (BI) was carried out using MrBayes version 3

(Hueselenbeck & Ronquist 2001). The GTR+I+G substitution model and default priors were

used in analysis. Markov chain Monte Carlo (MCMC) sampling was done with two

replicates of four chains (three cold, one hot). 10,000,000 generations were run with a subset

sampling every 1000 generations. A burn-in period excluding the first 25% of trees was set.

Posterior probabilities (reported below as BI) for tree nodes give an overestimate of branch

support (Suzuki, Glazco & Nei 2002) and were interpreted with caution. FigTree version 1

(Rambaut 2012) was used to view trees. Adobe Illustrator CS version 3 (Adobe Systems

Incorporated, San Jose, California, USA) was used to format and edit final trees.

RESULTS

In total, 15 chloroplast and 9 nuclear primer pairs were used to screen for possible

regions for phylogenetic analysis (Table 2.2). Assessment of the percentage of indels within

the region and the ability to amplify resulted in choosing two nuclear and one chloroplast

28

region for phylogenetic analysis: a portion of the external transcribed spacer (ETS), the

internal transcribed spacer (ITS) and ndhF-rpl32 (Table 2.2). There was no genetic variation

among the Hawaiian Cheirodendron species for the other 21 regions examined. When

aligned and trimmed, the total combined dataset included a total of 2365 characters including

the nuclear regions ETS (510 bp), ITS (641 bp) and the chloroplast region ndhF-rpl32

intergenic spacer (1214 bp). JModel Test (Darriba et al. 2012, Guindon & Gascuel 2003)

estimated the best fit model for each region to be HKY (ETS), TPM1uf+I (ITS), TVM+I

(ndhF-rpl32), and TPMuf+I+Γ (combined).

Comparison of each gene region under different phylogenetic methods (parsimony,

maximum likelihood and Bayesian inference) produced similar topologies. Among trees

constructed from the ETS region, maximum likelihood and Bayesian phylogenies showed

weak support for C. bastardianum and C. forbesii as basal to the rest of Cheirodendron

(Figure 2.1) although the relationship among all Cheirodendron spp. is collapsed into a

polytomy in the parsimony analysis. Among ITS trees (Figure 2.2), parsimony, maximum

likelihood and Bayesian analyses agree on an unresolved, but well-supported monophyletic

Cheirodendron clade. Within this larger clade, three subclades were shared among all

analyses: C. forbesii (from Kauai) and C. trigynum ssp. trigynum (from Hawaii) (MP: 75%,

ML: 57%, BI: 0.86), C. trigynum ssp. trigynum (from Maui) and C. trigynum ssp. trigynum

(from Lanai) (MP: 100%, ML: 55%, BI: 0.94), and two of the three collections of C. fauriei

(from Kauai) (MP: 100%, ML: 72%, BI: 0.99). Parsimony and Bayesian inference showed an

additional relationship between two collections of C. trigynum ssp. helleri (MP: 100%, BI:

0.74) that was not inferred in maximum likelihood analysis. Phylogenetic analyses of the

chloroplast region ndhF-rpl32 were congruent (Figure 2.3). In all analyses, C. bastardianum

29

Figure 2.1. ETS phylogeny of Cheirodendron. Bootstrap values and posterior probabilities

are listed near each node as MP (%), ML (%), BI (probability), respectively. Collapsed

branches are denoted as * for any particular analysis. If analysis does not support a particular

relationship, a dash (-) is indicated. The location of where each taxon was collected is in

parentheses next to each name. K=Kauai; O=Oahu; M=Maui; L=Lanai; H=Hawaii;

Marq=Marquesas; NZ=New Zealand.

30

Figure 2.2. ITS phylogeny of Cheirodendron. Bootstrap values and posterior probabilities are

listed near each node as MP (%), ML (%), BI (probability), respectively. Collapsed branches

are denoted as * for any particular analysis. If analysis does not support a particular

relationship, a dash (-) is indicated. The location of where each taxon was collected is in

parentheses next to each name. K=Kauai; O=Oahu; M=Maui; L=Lanai; H=Hawaii;

Marq=Marquesas; NZ=New Zealand.

31

Figure 2.3. ndhF-rpl32 phylogeny of Cheirodendron. Bootstrap values and posterior

probabilities are listed near each node as MP (%), ML (%), BI (probability), respectively.

Collapsed branches are denoted as * for any particular analysis. If analysis does not support a

particular relationship, a dash (-) is indicated. The location of where each taxon was collected

is in parentheses next to each name. K=Kauai; O=Oahu; M=Maui; L=Lanai; H=Hawaii;

Marq=Marquesas; NZ=New Zealand.

32

Figure 2.4. Combined phylogeny comparing MP, ML, and BI methods. Bootstrap values and

posterior probabilities are listed near each node as MP (%), ML (%), BI (probability),

respectively. Collapsed branches are denoted as * for any particular analysis. If analysis does

not support a particular relationship, a dash (-) is indicated. The location of where each taxon

was collected is in parentheses next to each name. K=Kauai; O=Oahu; M=Maui; L=Lanai;

H=Hawaii; Marq=Marquesas; NZ=New Zealand.

33

was closely associated with the outgroup species of Raukaua. The remaining species of

Cheirodendron form two clades, one consisting of the Kauai taxa and the other of non-Kauai

taxa. The Kauai clade formed a polytomy that was strongly supported in MP analysis but

weakly-supported in maximum likelihood and Bayesian inference (MP: 100%, ML: 65%, BI:

0.52). The non-Kauai clade was strongly supported in all three analyses (MP: 100%, ML:

100%, BI: 1).

Though individual genetic regions showed some inconsistencies, the combined

analysis shows strong support for Cheirodendron as a monophyletic lineage, with C.

bastardianum as sister to the Hawaiian species, and the Hawaiian species consisting of two

clades representing Kauai and non-Kauai taxa. Bayesian analysis (Figure 2.4) shows branch

support for C. bastardianum as sister to the rest of the Hawaiian species with a posterior

probability of 1.0 and strong support for a Hawaiian clade (BI: 1). Within the Hawaiian

group, the unresolved Kauai clade shows low support in Bayesian analysis (0.52), which is

reflected in the ML and MP tree that shows all the Hawaiian taxa in a single large clade with

the non-Kauai clade included as a strongly supported subclade within. The MP analysis was

similar to the ML with the exception that the two C. forbesii collections group together and

were sister to the remainder of the Hawaiian Cheirodendron (MP: 100%).

DISCUSSION

Results from this study indicate that Cheirodendron is a monophyletic group that

shares a common ancestor with Schefflera digitata and a sister relationship to New Zealand

Raukaua. Though Raukaua is paraphyletic with the placement of Cheirodendron trigynum,

Schefflera digitata, Motherwellia haplosciadea and Cephalaria cephalobotrys intermixed

34

within the clade (Mitchell et al. 2012), New Zealand Raukaua and Cheirodendron share

many similarities including laterally compressed endocarp fruits, paniculate inflorescences

with opposite umbellules, pentamorous flowers with 2-5 carpels and an articulated pedicel,

and palmately compound leaves (mostly in juvenile leaves in Raukaua) (Lowry, Plunkett &

Wen 2004). The current study also demonstrates a close relationship between Cheirodendron

and Raukaua. In particular, the chloroplast phylogeny has C. bastardianum nested within

(BI) or sister to (MP and ML) Raukaua. Although analysis of the chloroplast region resulted

in Cheirodendron being paraphyletic, combined analysis showed strong support for

monophyly of Cheirodendron and for C. bastardianum as the sister group to the Hawaiian

clade. Consistent with this relationship, C. bastardianum shares many morphological

characteristics with Hawaiian Cheirodendron, rather than Raukaua (Brown 1935) and looks

almost identical to C. trigynum (Frodin 1990).

Relationships among taxa

Phylogenetic analysis revealed Cheirodendron as monophyletic, with C.

bastardianum (from Marquesas) sister to the Hawaiian species. Within the Hawaiian species,

two clades are supported, a Kauai taxa clade and a non-Kauai taxa clade. Both the Kauai

clade and non-Kauai clade are unresolved, representing little or no gene sequence divergence

among these taxa. Thus, fine-tuned phylogenetic relationships cannot be inferred at this time.

Further study at the population level might be of help in sorting out infraspecific

relationships. However, within the scope of this project, this is not possible.

Short-branching polytomies within the Kauai clade and non-Kauai clade agree with a

similar pattern of evolution found in other Pacific Island groups. Many Hawaiian radiations

35

exhibit great degrees of morphological diversity with little genetic variation (Wagner & Funk

1995). For example, the Hawaiian Cyrtandra (Gesneriaceae) is composed of 58 species, all

resultant from a single ancestor and exhibits little infraspecific genetic variation (Cronk et al.

2005). Hawaiian Bidens L. (Asteraceae) is one of the most species-rich radiations within the

genus, but has little differentiation in both nuclear and chloroplast regions (Knope et al.

2012). Many other examples, including the Hawaiian mints (Lindqvist et al. 2003),

Silverswords (Carlquist, Baldwin & Carr 2003), Lobeliads (Givnish et al. 2009) and

Coprosma (Cantley et al. 2014) have demonstrated great morphological diversity with little

genetic differentiation.

The lack of genetic divergence within Kauai taxa and non-Kauai taxa, despite

morphological differentiation, could be explained by a recent and rapid radiation of the

group. Previous analyses have estimated the divergence rates of angiosperms to range from

0.078 to 0.091 net speciation events per million years (Magallon & Castillo 2009) which is

considerably slower than other Hawaiian groups. Hawaiian Bidens was estimated to have a

diversification rate of 0.3-2.3 species per million years (Knope et al. 2012). Baldwin &

Sanderson (1998) estimate the diversification rate of the Hawaiian Silverswords to be 0.56 ±

0.17 species per million years. Rapid speciation rates seen in other groups within Hawaii

could be mirrored in Cheirodendron, although no analyses have estimated the age and rate of

diversification of the genus. Further study using a molecular clock might give some insight

as to the time frame and diversification rate of Cheirodendron.

Unresolved species relationships and poor branch support could suggest that

Cheirodendron is composed of only a few species with a great deal of morphological

variation and that phenotypic plasticity might be the cause of variation in form. Phenotypic

36

plasticity is described as “the ability of an individual to express different features under

different environmental conditions” (Travis 2009). To some extent, different morphologies

might be the result of phenotypic plasticity in Cheirodendron, especially in C. trigynum,

which exhibits local population differences (see Sherff 1954). However, phenotypic plasticity

does not explain the morphological differences in taxa on Kauai that persist adjacent to one

another. On Kauai, C. trigynum ssp. helleri can be found in lowland bogs to mesic forests

(440-1250 m) (Lowry 1990), overlapping with most Kauai species, including C. fauriei,

which also occurs in low-elevation bogs (Lowry 1990). Although these two species can be

found in the same ecological conditions, they still maintain separate morphologies. If

plasticity relies heavily on environmental pressure to produce phenotypic differences,

different morphological taxa would not be present next to each other.

The study by Knope et al. (2012) on Hawaiian Bidens revealed that these species

consisted of closely related individuals with a great degree of morphological differences

among them. Common garden experiments showed that these differences were not plastic

traits, and forms held true to their phenotypes (Knope et al. 2012). Common garden

experiments to rule out phenotypic plasticity have not been done with Cheirodendron before,

thus phenotypic plasticity cannot be ruled out. However, it is more likely that the consistent

differences found among individuals in similar or the same habitats are genetically based

rather than a plastic response to ecological pressures, although genetic differences among

them were not detected with the methods used in this study.

37

Current taxonomy vs. phylogenetic relationships

Phylogenetic analysis suggests that two taxa of Cheirodendron presently regarded as

subspecies (Lowry 1990) are to be recognized as distinct species. Cheirodendron trigynum

ssp. helleri and C. platyphyllum ssp. kauaiense (both in the Kauai clade) are polyphyletic

relative to their respective species (in the non-Kauai clade). This strongly supports the

reclassification of subspecific taxa presently recognized in either C. trigynum or C.

platyphyllum that they do not belong to the same species. As such, C. trigynum ssp. helleri

(Sherff) Lowry is now recognized as C. helleri Sherff and C. platyphyllum ssp. kauaiense

(Kraj.) Lowry is now recognized as C. kauaiense Kraj.

As far as the assessments of Sherff (1954), Herat (1981) and Lowry (1990), each

hinted that the vast morphological diversity present within the Hawaiian Cheirodendron

could represent more taxa. In his revision, Lowry (1990) takes note of the many different

varieties seen by Sherff, stating that “some of these [populations] may represent genetically-

based differences and could warrant taxonomic recognition.” This statement is supported for

some taxa in the current study (see above), but is not supported for other species differences

as Lowry (1990) suggests due to the lack of resolution within the Kauai and non-Kauai

clades.

Disagreement between the molecular phylogeny and taxonomy could be caused by

certain traits being convergent within Cheirodendron, the result masking the true

evolutionary relationships. Convergent evolution is the process whereby similar characters

arise independently in different lineages rather than as a result of common ancestry (Grande

& Rieppel 1994). These certain characters are said to be homoplasic, and can result from

adaptive responses to similar selection pressures (Wake, Wake & Specht 2011). Homoplasy

38

and convergent evolution present a problem in phylogenetics because it gives a false sense of

what the true relationships are. For example, thorns, spines and prickles are evolutionarily

and ontogenetically different structures, though they arose from the same selective pressure

to serve the same purpose—defense. If, then, this characteristic (having sharp protrusions for

protection) was used to infer phylogentic relationships, Rosaceae (with prickles), Cactaceae

(with spines) and Rutaceae (with thorns), would infer a close relationship, however, this is

definitely not the case (see Soltis et al. 2005).

Convergence in morphology could also be occurring in Cheirodendron. If the

characters used to classify species were homoplasic due to convergent evolution, species

delineations would not agree with phylogenetic relationships. Lowry’s (1990) classification

of C. trigynum with two subspecies was based on indistinguishable characteristics in leaf

morphology. Lowry’s (1990) ssp. helleri and ssp. trigynum are readily distinguished from

each other based on carpel number, with ssp. helleri having two carpels and ssp. trigynum

usually having three or occasionally four, although ssp. helleri is found to have three carpels

in some individuals. This gives additional credibility to the separation of these as distinct

species as noted above.

The question of why certain characters such as leaf morphology converged in

different taxa is an interesting question that cannot be answered within the scope of this

project. All C. trigynum share the same leaflet morphology (the most commonly recognized

features being leaflets usually 3 to 5 and longer than wide, a large central leaflet, and margins

thickened), and occur in similar habitats on their respective islands. Perhaps convergence on

this particular leaf morphology has provided some ecological advantage to allow this form to

occur in different lineages.

39

Biogeographic relationships

Fosberg (1948) was the first to suggest that the origins of Cheirodendron were from a

single colonization event from the Austral region. Decades later, his ideas were confirmed

with molecular data, supporting that Cheirodendron had an Austral origin and had moved

northward via long-distance dispersal (Wen et al. 2001, Plunkett, Wen & Lowry 2004).

Recent studies have also shown that Raukaua, a paraphyletic group distributed in New

Zealand, Chile, Argentina and Tasmania, is Cheirodendron’s closest relative. The species

sister to Cheirodendron are the New Zealand species of Raukaua: R. edgerleyi, R. anomalus,

and R. simplex (Mitchell et al. 2012). Although there has been much recent information about

the infrafamilial biogeographic relationships within Araliaceae, as well as the infrageneric

biogeographic relationships of Raukaua, there has been no detailed phylogenetic work to

assess these relationships within Cheirodendron until the present study.

Herat (1981) suggested a single colonization event from New Zealand to Hawaii with

a subsequent dispersal event to the Marquesas (based on morphological similarities).

Although much less commonly seen, dispersal events originating from Hawaii have been

confirmed through molecular work (see Harbaugh & Baldwin 2007, Harbaugh et al. 2009a).

However, this pattern of dispersal does not follow traditional ideas about biogeography in the

Pacific. Hennig (1966) proposed the concept of stepping stone biogeography patterns, where

a given organism with a continental origin disperses to the next closest landmass (sometimes

islands), evolutionarily “stepping” from landmass to landmass. This concept is especially

embraced in Pacific biogeography when life on island archipelagos would have occurred via

long distance dispersal along with in situ speciation. Evidence of this is well-supported by

40

many Pacific examples including Metrosideros (Wright et al. 2001), Astelia (Birch & Keeley

2013), and Coprosma (Cantley et al. 2014).

The biogeographic relationships of Cheirodendron inferred from this study suggest a

stepping stone pattern of dispersal from New Zealand to Marquesas, and Marquesas to

Hawaii. As C. bastardianum and the Hawaiian clade have a sister relationship, an alternative

could be that the most recent common ancestor could have colonized both the Marquesas and

Hawaiian Islands simultaneously. However, the previous hypothesis of Herat (1981) that C.

bastardianum is descended from a colonist from the Hawaiian Islands can be discarded.

The biogeographic relationships implications of seven endemic species in the

Hawaiian Islands cannot be fully resolved at this time. Two Hawaiian clades, the Kauai clade

and non-Kauai clade are sister to each other and could represent two simultaneous dispersal

events from Marquesas to Hawaii. The biogeography of Cheirodendron within the Hawaiian

Islands cannot be inferred from this study, although Herat (1981) suggested that

Cheirodendron in Hawaii originated on Kauai, since Kauai appears to be the center of

diversity and has the highest number of species. The lack of resolution within the two

Hawaiian clades suggests a recent and rapid radiation of these species.

Future directions

Although this study has shed light on the evolution and biogeography of

Cheirodendron, there are many questions that still remain. Are the forms of Cheirodendron a

result of phenotypic plasticity? What are the phylogenetic relationships among Hawaiian

species? What are the biogeographic implications of species within the Hawaiian Islands?

Can species relationships be resolved or are there underlying factors that limit our

41

understanding of the group? Perhaps Cheirodendron is part of a species complex, much like

the unresolved species relationships of Metrosideros (see Harbaugh et al. 2009b).

The many challenges in sorting out species relationships have also been opportunities

in deepening our understanding of the evolution of Cheirodendron. New techniques and

methods to help answer these questions such as next generation sequencing, microsatellites,

and restriction site associated DNA (RAD) sequencing may help in sorting out these

relationships. Not only will these answers contribute to our understanding of Cheirodendron,

but will advance our knowledge about the radiation and speciation of other Pacific groups.

Ultimately, this knowledge will provide valuable information for discerning relationships

among all living things.

42

CHAPTER 3. SYNTHESIS- HYPOTHESES REVISITED

The conclusions of this study allow for the acceptance of two hypotheses and

rejection of one hypothesis. The following discusses these conclusions as they relate to each

individual hypothesis:

Hypothesis one: The molecular phylogeny does not support the current taxonomy of

Cheirodendron.

Conclusion: Accept hypothesis

Results of this study found disagreement between the molecular phylogeny and

current taxonomy based on the placement of two Hawaiian subspecies. Based on these

results, it is evident that species with subspecies recognized on different islands are not

closely related and it is necessary to elevate the subspecies C. trigynum ssp. helleri to C.

helleri Sherff and C. platyphyllum ssp. kauaiense to C. kauaiense Kraj. There are seven

Hawaiian species and one Marquesan species that should be recognized, as opposed to the

current classification with five Hawaiian species and one Marquesan species.

Hypothesis two: Cheirodendron is monophyletic.

Conclusion: Accept hypothesis

This study shows evidence that Cheirodendron is a monophyletic lineage, consisting

of C. bastardianum of the Marquesas along with Hawaiian species, C. trigynum, C. helleri,

C. platyphyllum, C. kauaiense, C. forbesii, C. fauriei and C. dominii. Cheirodendron has a

sister relationship to New Zealand species of Raukaua, a paraphyletic genus with species in

New Zealand, Tasmania, Chile and Argentina.

43

Hypothesis three: The Pacific biogeography of Cheirodendron involves an Austral origin

with long distance dispersal to Hawaii and then to the Marquesas.

Conclusion: Reject hypothesis

Phylogenetic analyses show Cheirodendron as a monophyletic clade of Austral

origin. However, C. bastardianum has a sister relationship to the Hawaiian species rather

than being derived from Hawaiian species. This infers that either two dispersal events

simultaneously occurred from an Austral origin to Hawaii and the Marquesas, or dispersal

occurred to Hawaii via Marquesas. There is no supporting data that suggests colonization of

Marquesas via Hawaii.

44

LITERATURE CITED

Abbott, I. A. 1992. Lāʻau Hawaiʻi: Traditional Hawaiian Uses of Plants. Bishop Museum

Press, Honolulu.

Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear

ribosomal DNA in plants: An example from the Compositae. Molecular

Phylogenetics and Evolution 1(1): 3-16.

Baldwin, B. G. & M. J. Sanderson. 1998. Age and rate of diversification of the Hawaiian

silversword alliance (Compositae). Proceedings of the National Academy of Sciences

95(16): 9402-9406.

Barraclough, T. G. & S. Nee. 2001. Phylogenetics and Speciation. Trends in Ecology and

Evolution 16(7): 391-399.

Bazinet, A. L., D. J. Zwickl & M. P. Cummings. 2014. A gateway for phylogenetic analysis

powered by grid computing featuring GARLI 2.0. Systematic Biology. Advance

Access published online April 30, 2014. doi:10.1093/sysbio/syu031

Birch, J. L. & S. C. Keeley. 2013. Dispersal pathways across the pacific: the historical

biogeography of Astelia s.l. (Asteliaceae, Asparagales). Journal of Biogeography 40:

1914–1927.

Brown, F. B. H. 1935. Flora of southeastern Polynesia III. Dicotyledons. Bernice P. Bishop

Museum Bulletin 130: 1–386.

Cantley, J. T., N. G. Swenson, A. Markey & S. C. Keeley. 2014. Biogeographic insights on

Pacific Coprosma (Rubiaceae) indicate two colonizations to the Hawaiian Islands.

Botanical Journal of the Linnaean Society 174(3): 412-424.

Carlquist, S. 1974. Island Biology. Columbia University Press, New York.

45

Carlquist, S., B. G. Baldwin & G. D. Carr. (Eds.) 2003. Tarweeds and silverswords:

evolution of the Madiinae (Asteraceae). Missouri Botanical Garden Press, Saint

Louis.

Costello, A. & T. Motley. 2001. Molecular systematics of Tetraplasandra, Munroidendron

and Reynoldsia sandwicensis (Araliaceae) and the evolution of superior ovaries in

Tetraplasandra. Edinburgh Journal of Botany 58: 229–242.

Couper, R. A. 1960. New Zealand Mesozoic and Cainozoic plant microfossils. New Zealand

Geological Survey Paleontological Bulletin 32: 1-87.

Cronk, Q.C.B., M. Kiehn, W. L. Wagner & J. F. Smith. 2005. Evolution of Cyrtandra

(Gesneriaceae) in the Pacific Ocean: The origin of a supertramp clade. American

Journal of Botany 92(6): 1017-1024.

Darriba, D., G. L. Taboada, R. Doallo & D. Posada. 2012. jModelTest 2: more models, new

heuristics and parallel computing. Nature Methods 9(8): 772.

De Candolle, A. P. 1830. Araliaceae. Prodromus systematis naturalis regut vegetabilis 4:

251-266. Paris.

Doyle, J. J. & J. L. Doyle. 1987. A rapid DNA isolation procedure for small amounts of fresh

leaf tissue. Phytochemistry Bulletin, Botanical Society of America 19: 11–15.

Dunbar-Co, S., A. M. Wieczorek & C. W. Morden. 2008. Molecular phylogeny and adaptive

radiation of the endemic Hawaiian Plantago species (Plantaginaceae). American

Journal of Botany 95(9): 1177-1188.

Eibl J., G. M. Plunkett & P. P. Lowry II. 2001. Phylogenetic relationships in Polyscias sect.

Tieghemopanax (Araliaceae) based on DNA sequence data. Adansonia 3(23): 23–48.

46

Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap.

Evolution 39: 783-791.

Fosberg, F. R. 1948. Derivation of the flora of the Hawaiian Islands. In E. C. Zimmerman

(Ed.), Insects of Hawaii, vol. 1, pp. 107-119. University Press Hawaii, Honolulu.

Frodin, D. G. 1990. Identity of Aralia bastardiana Decaisne. Pacific Science 44(3): 265-276.

Gillett, G. W. 1972. Genetic affinities between Hawaiian and Marquesan Bidens

(Asteraceae). Taxon 21(4): 479-483.

Givnish, T. J., K. C. Millam, A. R. Mast, T. B. Patterson, T.J. Theim, A. L. Hipp, J. M.

Henss, J. F. Smith, K. R. Wood & K. J. Sytsma. 2009. Origin, adaptive radiation and

diversification of the Hawaiian lobeliads (Asterales: Campanulaceae). Proceedings of

the Royal Society B: Biological Sciences 1656: 407–416.

Gorniak, M., O. Paun & M. W. Chase. 2010. Phylogenetic relationships within Orchidaceae

based on a low-copy coding gene, Xdh: Congruence with organellar and nuclear

ribosomal DNA results. Molecular Phylogenetics and Evolution 56: 784-795.

Grande, L. & O. Rieppel. 1994. Interpreting the hierarchy of nature. Academic Press, San

Diego.

Gray, A. 1854. United States Exploring Expedition under the command of Charles Wilkes,

U.S.N. Vol. 15. Botany Phanerogamia. Putnam & Co, New York.

Guindon, S. & O. Gascuel. 2003. A simple, fast and accurate method to estimate large

phylogenies by maximum-likelihood. Systematic Biology 52: 696-704.

Harbaugh, D. T. & B. Baldwin. 2007. Phylogeny and biogeography of the Sandalwoods

(Santalum, Santalaceae): Repeated dispersals throughout the Pacific. American

Journal of Botany 94(6): 1028- 1040.

47

Harbaugh, D. T., W. L. Wagner, G. J. Allan, & E. A. Zimmer. 2009a. The Hawaiian

Archipelago is a stepping stone for dispersal in the Pacific: an example from the plant

genus Melicope (Rutaceae). Journal of Biogeography 36: 230–241.

Harbaugh, D. T., W. L. Wagner, D. M. Percy, H. F. James, & R. C. Fleischer. 2009b. Genetic

Structure of the Polymorphic Metrosideros (Myrtaceae) Complex in the Hawaiian

Islands Using Nuclear Microsatellite Data. PLoS ONE 4(3): e4698.

Harrison, R. G. 1998. Linking evolutionary pattern and process: the relevance of species

concepts for the study of speciation. In: D. J. Howard, S. H. Berlocher (Eds.), Endless

Forms: Species and Speciation. Oxford University Press, New York.

Heller, A. A. 1897. Observations on the ferns and flowering plants of the Hawaiian Islands.

Minnesota Botanical Studies 58: 760-922.

Hennig, W. 1966. Phylogenetic Systematics. University of Illinois Press, Urbana.

Henwood, M. J. & J. M. Hart. 2001. Towards an understanding of the phylogenetic

relationships of Australian Hydrocotyloideae (Apiaceae). Edinburgh Journal of

Botany 58: 269–289.

Herat, R. M. 1981. A systematic study of the genus Cheirodendron (Araliaceae). Ph.D.

dissertation, University of Hawaii at Manoa, Honolulu, 246 pp.

Hillebrand, W. F. 1888. Flora of the Hawaiian Islands. Hafner Publishing Co. Reprint

edition, New York.

Hochreutiner, B. P. G. 1925. Plantae Hochreutineranae II. Candollea 2: 317-513.

Hooker, W. J. & W. G. Arnott. 1832. The Botany of Captain Beechey's Voyage. London.

Howarth, D. G. & D. A. Baum. 2002. Phylogenetic utility of a nuclear intron from

48

nitrate reductase for the study of closely related plant species. Molecular

Phylogenetics & Evolution 23: 525–528.

Howarth D. G. & D. A. Baum. 2005. Genealogical evidence of homoploid hybrid speciation

in an adaptive radiation of Scaevola (Goodeniaceae) in the Hawaiian Islands.

Evolution 59: 948–961.

Hueselenbeck, J. P. & F. Ronquist. 2001. MrBayes: Bayesian inference of phylogeny.

Biometrics 17: 754–755.

Kenfack, D. 2011. Resurrection in Carapa (Meliaceae): a reassessment of morphological

variation and species boundaries using multivariate methods in a phylogenetic

context. Botanical Journal of the Linnaean Society 165: 186-221.

Knope, M. L., C. W. Morden, V. A. Funk & T. Fukami. 2012. Area and the rapid radiation of

Hawaiian Bidens (Asteraceae). Journal of Biogeography 39(7): 1206-1216.

Krajina, V. 1931. Generis Cheirodendrum species hawaiiensis ex affinitate Cheirodendron

platyphylli. Pres1ia 10: 91-100.

Lee, D. E., W. G. Lee & N. Mortimer. 2001. Where and why have all the flowers gone?

Depletion and turnover in the New Zealand Cenozoic angiosperm flora in relation to

palaeogeography and climate. Australian Journal of Botany 49: 341–356.

Levin, R. A., J. Blanton & J. S. Miller. 2009. Phylogenetic utility of nuclear nitrate reductase:

A multi-locus comparison of nuclear and chloroplast sequence data for inference of

relationships among American Lycieae (Solanaceae). Molecular Phylogenetics &

Evolution 50: 608-617.

Lindqvist, C., T. J. Motley, J. J. Jeffrey & V. A. Albert. 2003. Cladogenesis and reticulation

in the Hawaiian endemic mints (Lamiaceae). Cladistics 19: 480–495.

49

Liu, Z., X. Zeng, D. Yang, G. Chu, Z. Yuan & S. Chen. 2012. Applying DNA barcodes for

identification of plant species in the family Araliaceae. Gene 499: 76-80.

Lowry, P. P. 1990. Araliaceae. In W. L. Wagner, D. R. Herbst & S. H. Sohmer (Eds.)

Manual of the flowering plants of Hawaii, vol. 1, pp. 224-237. University of Hawaii

Press, Honolulu.

Lowry, P. P., G. M. Plunkett & J. Wen. 2004. Generic relationships in Araliaceae: looking

into the crystal ball. South African Journal of Botany 70(3): 382-392.

Magallon, S. & A. Castillo. 2009. Angiosperm diversification through time. American

Journal of Botany 96: 349–365.

Manen, J. F., A. Natali & F. Ehrendorfer. 1994. Phylogeny of Rubiaceae-Rubieae inferred

from the sequence of a cpDNA intergene region. Plant Systematics & Evolution 190:

195-211.

Matthews, S. & M. J. Donoghue. 1999. The root of angiosperm phylogeny inferred from

duplicate phytochrome genes. Science 286(5441): 947-950.

Mitchell, A. D., D. G. Frodin & M. J. Heads. 1997. Reinstatement of Raukaua, a genus of

Araliaceae centered in New Zealand. New Zealand Journal of Botany 35: 309–315.

Mitchell, A. D. & S. J. Wagstaff. 1997. Phylogenetic relationships of Pseudopanax species

(Araliaceae) inferred from parsimony analysis of rDNA sequence data and

morphology. Plant Systematics & Evolution 208: 121-138.

Mitchell A. D. & S. J. Wagstaff. 2000. Phylogeny and biogeography of the Chilean

Pseudopanax laetevirens. New Zealand Journal of Botany 38: 409-414.

50

Mitchell, A. D., P. B. Heenan, & A. M. Paterson. 2009. Phylogenetic relationships of

Geranium species indigenous to New Zealand. New Zealand Journal of Botany 47:

21-31.

Mitchell, A. D., R. Li, J. W. Brown, I. Schonberger & J. Wen. 2012. Ancient divergence and

biogeography of Raukaua (Araliaceae) and close relatives in the southern

hemisphere. Australian Systematic Botany 25: 432-446.

Morden, C. W., V. Caraway & T. J. Motley. 1996. Development of a DNA library for native

Hawaiian plants. Pacific Science 50: 324-335.

Olmstead, R. G. & J. A. Sweere. 1994. Combining data in phylogenetic systematics: An

empirical approach to using three molecular data sets in the Solanaceae. Systematic

Biology 43(4): 467-481.

Plunkett, G. M. & P. P. Lowry II. 2001. Relationships among ‘‘ancient araliads’’ and their

significance for the systematics of Apiales. Molecular Phylogenetics & Evolution 19:

259–276.

Plunkett, G. M., J. Wen & P. P. Lowry II. 2004. Infrafamilial classifications and characters in

Araliaceae: Insights from the phylogenetic analysis of nuclear (ITS) and plastid (trnL-

trnF) sequence data. Plant Systematics & Evolution 245: 1–39.

Plunkett, G. M., G. T. Chandler, P. P. Lowry II, S. M. Pinney & T. S. Sprenkle. 2004. Recent

advances in understanding Apiales and a revised classification. South African Journal

of Botany 70: 371-381.

Price, J. P. & W. L. Wagner. 2004. Speciation in Hawaiian angiosperm lineages: cause,

consequence, and mode. Evolution 58: 2185–2200.

51

Rambaut, A. 2012. FigTree: Tree figure drawing tool version 1.4.0. Institute of Evolutionary

Biology, University of Edinburgh.

Rock, J. F. 1913. The Indigenous Trees of the Hawaiian Islands. Pacific Tropical Botanical

Gardens, Lawai. Reprint edition.

St. John, H. 1959. Botanical novelties on the island of Niihau, Hawaiian Islands. Hawaiian

plant studies 25. Pacific Science 13: 156-190.

Schuettpelz, E. & K. M. Pryer. 2007. Fern phylogeny inferred from 400 leptosporangiate

species and three plastid genes. Taxon 56: 1037-1050.

Seemann, B. 1868. Revision of the natural order of Hederaceae L. Reeve & Co., London.

Shaw, J., E. Lickey, J. T. Beck, S. B. Farmer, W. Liu, J. Miller, K. C. Siripun, C. T. Winder,

E. E. Schilling & R. L. Small. 2005. The tortoise and the hare II: relative utility of 21

noncoding chloroplast DNA sequences for phylogenetic analysis. American Journal

of Botany 92: 142–166.

Shaw, J., E. B. Lickey, E. E. Schilling & R. L. Small. 2007. Comparison of whole chloroplast

genome sequences to choose noncoding regions for phylogenetic studies in

angiosperms: The tortoise and the hare III. American Journal of Botany 94(3): 275-

288.

Sherff, E. E. 1954. Revision of the genus Cheirodendron Nutt. ex Seem. for the Hawaiian

Islands. Fieldiana Botany: 29(1). Chicago Natural History Museum, Chicago, IL.

Sites, J. W. Jr. & J. C. Marshall. 2004. Operational criteria for delimiting species. Annual

Review of Ecology, Evolution & Systematics 35: 199–227.

52

Small, R. L. & J. F. Wendel. 2000. Phylogeny, duplication, and intraspecific variation of Adh

sequences in new world diploid cottons (Gossypium L., Malvaceae). Molecular

Phylogenetics & Evolution 16(1): 73-84.

Soltis, D. E., P. S. Soltis, P. K. Endress & M. W. Chase. 2005. Phylogeny and evolution of

angiosperms. Sinauer Associates, Inc., Massachusetts.

Suzuki, Y., G. V. Glazco & M. Nei. 2002. Overcredibility of molecular phylogenies obtained

by Bayesian phylogenetics. Proceedings of the National Academy of Science 99:

16138-16143.

Taberlet, P., L. Gielley, G. Pautou & J. Bouvet. 1991. Universal primers for amplification of

three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105–

1109.

Tamura, K., G. Stecher, D. Peterson, A. Filipski & S. Kumar. 2013. MEGA6: Molecular

Evolutionary Genetics Analysis version 6.0. Molecular Biology & Evolution 30:

2725-2729.

Travis, J. 2009. Phenotypic Plasticity. In S. A. Levin (Ed.), The Princeton Guide to Ecology,

pp. 65-71. Princeton University Press, Princeton.

Udovicic, F., G. I. McFadden & P. Y. Ladiges. 1995. Phylogeny of Eucalyptus and

Angophora based on 5S rDNA spacer sequence data. Molecular Phylogenetics &

Evolution 4: 247-256.

Wagner, W. L. & V. A. Funk (Eds.). 1995. Hawaiian biogeography: Evolution on a hot spot

archipelago. Smithsonian Institution Press, Washington D. C.

Wagner, W. L. & D. H. Lorence. 2002. Flora of the Marquesas Islands website.

http://botany.si.edu/pacificislandbiodiversity/marquesasflora/index.htm.

53

Wake, D. B., M. H. Wake, & C. D. Specht. 2011. Homoplasy: From Detecting Pattern to

Determining Process and Mechanism of Evolution. Science 331(6020): 1032-1035.

Wen, J., & E. A. Zimmer. 1996. Phylogeny and biogeography of Panax L. (the ginseng

genus, Araliaceae): Inferences from ITS sequences of nuclear ribosomal DNA.

Molecular Phylogenetics & Evolution 6: 167–177.

Wen, J., G. M. Plunkett, A. D. Mitchell & S. J. Wagstaff. 2001. The Evolution of Araliaceae:

A Phylogenetic Analysis Based on ITS Sequences of Nuclear Ribosomal DNA.

Systematic Botany 26(1): 144-167.

Wright, S. D., C. G. Yong, S. R. Wichman, J. W. Dawson, & R. C. Gardner. 2001. Stepping

stones to Hawaii: A trans-equatorial dispersal pathway for Metrosideros (Myrtaceae)

inferred from nrDNA (ITS + ETS). Journal of Biogeography 28(6): 769-774.

Yi, T., P. P. Lowry, G. M. Plunkett & J. Wen. 2004. Chromosomal evolution in Araliaceae

and close relatives. Taxon 53(4): 987-1005.

Zimmer, E. A. & J. Wen. 2012. Using nuclear gene data for plant phylogenetics: Progress

and prospects. Molecular Phylogenetics & Evolution 65: 774-785.