Phylogenetic analysis of hydrocarbon degrading bacteria ...
Transcript of Phylogenetic analysis of hydrocarbon degrading bacteria ...
Nig. J. Biotech. Vol. 36(2): 62 – 76 (Dec 2019)
ISSN: 0189 1731
Available online at
http://www.ajol.info/index.php/njb/index
and www.biotechsocietynigeria.org
DOI: https://dx.doi.org/10.4314/njb.v36i2.8
62
Phylogenetic analysis of hydrocarbon degrading bacteria associated with crude oil polluted soil from Mesogar
community, Delta State, Nigeria.
Olukunle, O. F. Department of Biotechnology, Federal University of Technology, P. M. B. Akure, Nigeria
Abstract This study was carried out to isolate hydrocarbon-degrading bacteria associated with oil
polluted soil samples collected from Mesogar community of Delta State, Nigeria. The
samples were aseptically collected and the bacteria isolated according to standard microbiological techniques. The isolates with hydrocarbon biodegradative ability were
screened on MSM supplemented with 2% crude oil using spectrophotometric method. The amount of crude oil degraded by the highest hydrocarbon degrader was determined
using gas chromatographic (GC) assay. A total of seven bacterial isolates were
molecularly identified using the 16S rRNA gene sequencing method. The sequences were compared to those deposited in NCBI using the basic local alignment tool (BLAST)
algorithm. Phylogenetic analysis of 16S rRNA gene sequences was carried out to determine the evolutionary relationships of the isolated bacterial species. The isolates
were identified to have remote similarities with Alcaligenes faecalis SH179a, Alcaligenes faecalis subsp. Phenolicus, Bacillus thuringiensis serovar konkukian, Ochrobactrum anthropi, Alcaligenes faecalis SH179b, Uncultured soil bacterium clone and Alcaligenes faecalis IVN45. Strain OFBR 4 had the highest degrading ability. The use of molecular methods for rapid and accurate detection of diverse strains of hydrocarbon-degraders is
of utmost necessity in bioremediation.
Keywords: Phylogenetic analysis, oil polluted soil, biodegradative, hydrocarbon degrader, 16S rRNA
gene and crude oil.
Introduction
The wide spread contamination of most
natural environments with petroleum products in the Niger Delta region of Nigeria is as a
result of daily increasing petroleum exploration, refining and other related
activities (Romanus et al. 2015). This area is particularly endowed with crude oil and natural
gas deposits which are the main source of
energy and foreign exchange earnings in Nigeria (Oboh et al. 2006; Oyetunji, 2013). Oil
spill occur both on-shore and offshore (Olukunle, 2013) during exploration and
transportation. Transportation of oil from
points of exploitation and refinery to consumption locations involves the risk of
accidental oil spills, which can cause severe
damage to ecosystems (Chang et al. 2014).
Offshore oil spills contaminate coastal
environments and affect aquatic life (Osuagwu & Olaifa, 2018). It causes constant threat to
farmlands, forest trees, crop plants and other vegetations by adversely affecting soil fertility
and altering of soil physicochemical and microbiological properties (Boboye et al.
2010). Surface and underground water are
also polluted causing damage to humans and the ecosystem as a result of contamination of
drinking water, poisoning and killing of aquatic life. Presence of oil in water reduces the
amount of dissolved oxygen available. Shift in
microbial populations are noticeable at polluted sites (Hamzah et al. 2010). The
hydrocarbons spread on the ground water
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
63
surface and partition into groundwater. During
raining season, polycyclic aromatic hydrocarbons (PAHs) in crude oil towards
water bodies and enter into human food chain. PAHs are hazardous compounds which can
cause serious diseases such as cancer, asthma
and hormonal diseases. Some species have their population either increased or decreased
while others go into extinction, leading to ecological imbalance (El Hanafy et al. 2015).
It is an emerging environmental challenge
arising from the activities of petrochemical
industries and other anthropogenic activities (Unimke et al. 2018). Three major methods
are widely known to be employed for cleaning up oil spill. These methods are physical,
chemical and biological techniques. Physical
and chemical techniques such as volatilization, leaching, chemical and photo-oxidation have
been used in the past. They are often effective in reducing the environmental level of
polyaromatic hydrocarbons. However, they are usually expensive and labor intensive and
often involve the risk of spreading the
pollution since the waste would require being disposed elsewhere. Also, the chemicals used
in the process may harm the surrounding environment (Saleh et al. 2003) and also
affect the natural biological communities.
Biological technique (bioremediation) appears to be the most promising of all methods
employed for cleaning oil spill. According to Willey et al. (2008),
bioremediation is the use of microorganisms to
remove pollutants. Olukunle & Boboye (2012), defined bioremediation as the application of
living organisms or their enzymes to provide an effective alternative to restore the
environment altered by contaminants to its original condition. It provides an effective and
efficient strategy to speed up the clean-up
process (Hamzah et al. 2011) because the occasional oil spill forms a source of carbon
surplus for hydrocarbon degraders. Hydrocarbons are energy-rich compounds
(Varjani, 2017). Moreover, bioremediation
methods are characterized by low cost, high efficiency, environmental friendliness and
simplicity technology for long term restoration of oil contaminated sites (Asadirad et al.
2016). Harmless products such as CO2, H2O, and other inorganic compounds are released
as a result of mineralization of hydrocarbons
(Fathepure, 2014). Microbial degradation appears to be the most environmentally
friendly method of removing oil spill since
other methods such as surfactant washing and incineration lead to introduction of more toxic
compounds to the environment. It had been known to be carried out by diverse bacterial
populations, especially by the Pseudomonas spp. (Jyothi et al. 2012) and fungi. Mostly reported genera of hydrocarbon-degraders
include Pseudomonas, Acinetobacter, Nocardia, Vibrio, Achromonobacter, Bacillus and Micrococcus (Saleh et al. 2003). Microbial hydrocarbon degradation involves the
manipulation of environmental parameters to
allow microbial growth and degradation activities to proceed at a faster rate (Ainon et
al. 2010). Using indigenous microorganisms for bioremediation of polluted sites is more
effective than introducing foreign
microorganisms to degrade hydrocarbons. The reason is not far-fetched. The indigenous
microorganisms are already adapted for survival and proliferation in that environment
(Gopinathan et al. 2012). As a result, there is a well-established direct correlation between
microbial diversity and the presence of
hydrocarbons in any oil-contaminated sites (Kachienga et al. 2018). The activities of
biodegraders in a bioreactor can be monitored through gas chromatography coupled with
mass spectrometry. The gas chromatography
separates the compounds from each other, while the mass spectrometer helps to identify
them based on their fragmentation pattern (JeromeJeyakumar, 2013).
The development of molecular techniques to
investigate ecological microbial communities has provided microbiologist with new
techniques to study microorganisms. The increased ease with which molecular analysis
can be carried out has led to an explosion in sequencing of ribosomal DNA (rDNA) and
ribosomal RNA (rRNA) from different bacterial
species and strains from different environments. This has allowed the
construction of relevant sequence databases (Vivek & Debajit, 2011). The identity of novel
sequences and diversity in environmental
samples are discovered through molecular identification that involves 16SrRNA (Olukunle
& Boboye, 2012). Microbes from sediments previously
contaminated with oil are able to metabolize oil faster than those from sediments that had
never been contaminated. The inheritance of
oil-degrading ability is explained in a concept known as ‘genetic adaptation’. This means
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
64
that if a species of bacteria is exposed to oil
and metabolizes it, the next generations inherit that ability. This has been reported in a
particular species of Vibrio in the Northwestern Gulf of Mexico (Biello, 2010). This has led to
genetic diversity and development of new
strains. The gene encoding for hydrocarbon degradation is present in all biodegraders of oil
(Boboye et al. 2010) hence, a degree of closeness or relatedness in their genome.
Phylogenetic analysis generates branching, treelike diagrams that represent an estimated
pedigree of the inherited relationship among
molecule, organism or both. Phylogenetic tree shows how the families have been deriving
during evolution (Gautum & Vimal, 2014). In this study, indigenous oil degrading bacteria
from oil polluted sites in Delta State, Nigeria,
were isolated and identified using molecular techniques which involves DNA isolation, PCR
amplification of 16S rRNA gene, sequencing and phylogenetic analysis of partial 16S rRNA
fragments.
Materials and Methods
Sampling sites and collection of samples Oil-contaminated soil samples were collected from Mesogar Community, Warri South Local
Government Area of Delta State, Nigeria and
an uncontaminated soil sample that serves as control. The soil samples (S1 – S4) were
collected aseptically into sterile cellophane bags and transported to the Microbiology
Laboratory of the Federal University of
Technology, Akure, Nigeria.
Enumeration of bacteria from soil samples Serial dilution was carried out on the soil
samples. An aliquot of the diluent was seeded into growth medium in sterile Petri dishes
containing nutrient agar (NA). The plates were
then incubated at 37°C for 24hours for the NA plates. Counting was done using colony
counter (TT-02 colony counter, Techmel and Techmel, USA).
Sub culturing for pure microbial isolates From the mixed culture on the plates, each
microbial colony was sub cultured on sterile Petri dishes containing nutrient agar. This was
done by using a sterile inoculating loop to transfer each colony onto the fresh sterile NA
plates using the streak technique. The plates
were incubated at 37°C for 24 hours.
Biochemical and morphological identification of bacterial isolates Individual colonies were identified by
morphological and biochemical features using the Bergey's Manual of Determinative
Bacteriology.
Preservation of stock culture The slant technique of culture preservation was used to preserve the stock culture. Double
strength culture media was prepared and poured into McCartney bottles. The bottles
were set in a slanting position where they
were allowed to gel. Then, with the aid of a sterile inoculating loop, an inoculum of each
isolate was carefully transferred onto the solidified agar slant. This procedure was then
carried out for all the pure cultures of isolates.
The bottles were then incubated at 28° C for 24 hours and kept in the refrigerator until they
were required.
Enumeration of oil-degrading bacteria The mineral salt medium (MSM) as described
by Jyothi et al. (2012) was used. The
composition of the MSM is as follows: K2HPO4 (1.8 g/L); NH4C1 (4 g/L); MgSO4.7H2O (0.2
g/L); NaCl (0.1 g/L); Na2SO4.7H2O (0.01 g/L); agar (20 g/L); and distilled water (1L) with pH
7.2. The medium was sterilized by autoclaving
at 121°C for 15 min. The medium was supplemented with 2% (v/v) filter sterilized
crude oil to serve as the only carbon and energy source (Ijah & Abioye, 2003). The
samples were serially diluted and 1 ml aliquots
was seeded in the MSM agar using the pour plate method. The medium was incubated at
room temperature for 7 days. Counting was done using colony counter (TT-02 colony
counter, Techmel and Techmel, USA).
Extraction of genomic DNA from bacteria Genomic DNA was extracted from 1ml of 18 hours old bacterial culture using DNA
extraction kit (Zymo research) following the manufacturer’s instructions. The purity of DNA
was determined by recording its UV absorption
(260/280) spectrum on a spectrophotometer and running on 1% agarose gel
electrophoresis stained with ethidium bromide to view the bands of DNA under UV light. DNA
concentration was determined using a Nanodrop machine (Thermo Fisher Scientific).
Polymerase chain reaction (PCR) The purified bacterial DNAs were used for PCR
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
65
amplification. The 16SrRNA genes were
amplified by polymerase chain reaction using universal primers. PCR amplification was
performed with the help of the following primer set (16SF-5’CCG
AATTCGTCGACAACAGAGTTTGATCCTGGCTCA
G-3’ and 16SR:5’CCCGGGATCCAAGCTTACGGCTACCTTG
TTACGACTT-3’). Gel purification kit was used to purify the
amplified 16S rRNA gene products. The amplified products were subsequently
subjected to gel electrophoresis, stained with
ethidium bromide and documented by gel documentation system.
Sequence determination of 16SrRNA The amplified 16S rRNA gene products were
sequenced for identification of bacterial strain at molecular level. The clean PCR products
were subjected to cycle sequencing using universal primers. The sequence of the 16S
rRNA was determined with a Dye terminator sequencing kit. The product was analyzed with
an ABI Prism DNA sequencer (ABI). The gene
sequences of each isolate obtained were compared with known 16SrRNA gene
sequences in the NCBI GeneBank database using the basic local alignment search tool
(BLAST) algorithm (Jyothi et al. 2012).
Phylogenetic analysis The systematic phylogenetic tree of the isolates with high homology was constructed.
The bacterial 16S rRNA gene sequences
obtained coupled with the sequences retrieved from the NCBI database were aligned using
Phylo F3 software.
Measurement of Degradative Activity of the isolates on crude oil The degradative activities of each isolates
were obtained by using mineral salt broth (MSB) supplemented with 2% (v/v)
hydrocarbon (crude oil) sterilized using 0.22µm membrane filter were inoculated with
each isolate and incubated for 14 days at 30oC
in a shaking water bath (Boboye et al. 2010). The optical density (OD600nm) of each cultured
medium was measured with spectrophotometer at 600nm (Olukunle &
Boboye, 2012).
Hydrocarbon Extraction
The isolate that shows the highest growth rate
was inoculated into a fresh MSB medium supplemented with 2% (v/v) filter sterilized
hydrocarbon (crude oil) and a control medium was left uninoculated. The hydrocarbon in the
broth medium was extracted from the
inoculated medium and control on Day 1 and Day 15 using solvent extraction (diethyl
ether). A 10ml of diethyl ether was introduced into the culture broth and allowed to stand for
10 min. With the aid of a pipette, the hydrocarbon was carefully extracted into a
sterile Petri dish and air-dried overnight at
room temperature to aid the evaporation of the solvent, leaving the hydrocarbon.
Gas chromatography analysis of petroleum degradation The homogenized extract sample was transferred to 100ml separating funnel, and
10ml of the redistilled mixture of hexane: dichloromethane in ratio 3:1 was added. The
separating funnel was shaken vigorously for about 2 min with periodic venting to release
vapour pressure. The organic layer was
allowed to separate for 10 min and was recovered into the 100ml beaker. The extract
was dried by passing through the funnel containing the anhydrous sodium sulphate.
The dried extract was concentrated with a
steam of nitrogen gas. The concentrated extract was purified by passing the extract
through the silica gel packed column after several rinsing with redistilled hexane. The
mixture was concentrated to about 1.0ml by
the steam of nitrogen gas before injecting into the entrance of the gas chromatography
column.
Results
Enumeration of bacteria from soil samples Table 1 shows the total bacterial count (Cfu/g) and count of hydrocarbon degraders (Cfu/g) in
the soil sample collected from four sites. The highest total viable counts were obtained from
site 4 (17.0 x 104 ± 2.0 Cfu/g) while the least
total viable counts were obtained from site 1 (9.0 x 104 ± 1.7 Cfu/g). The highest number
of hydrocarbon degrader was obtained from site 2 (11.62 x 104 ±1.52 Cfu/g) while the
least was from site 1 (6.33 x 104 ± 0.58 Cfu/g).
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
66
Table 1: Population of bacteria isolated from crude oil contaminated and uncontaminated (control)
soil samples
Identification of bacterial isolates (Conventional and Molecular identification) Based on the morphological and biochemical
tests carried out on the bacterial isolates, seven (7) bacteria were identified as
Pseudomonas frederiksbergensis, Alcaligenes sp. Bacillus thuringiensis, Ochrobactrum anthropi, Pseudomonas flavensces, Bacillus sp.
and Pseudomonas guineae. This is presented in table 2.
Table 2: Morphological and biochemical characteristics of bacteria isolated from oil-contaminated soil
Probable
Bacteria
Pseudomonas frederiksbergensis
Alcaligenes sp.
Bacillus thuringiensis
Ochrobactrum anthropi
Pseudomonas flavensces
Bacillus sp.
Pseudomonas guineae
Characteristic
Gram stain - - + - - + -
Shape Rod Rod Rod Rod Rod Rod Rod
Catalase + + + + + + +
Motility + + + + + + +
Spore
staining
- - + - + -
Indole - - - - -
Citrate + + + + + - +
Starch
hydrolysis
- + + - - + -
Oxidase + + + + +
Glucose - - + - - + -
Lactose - - - A - - -
Galactose A AG A A A A A
Mannitol A AG - AG A - -
Fructose A - A A A A -
Sucrose A AG - - A A -
Pigmentation Yellow Yellow Cream Yellow Cream Cream Yellow
KEY: + Positive, - Negative, A- Acid Production, AG - Acid and Gas Production,
Extraction of genomic DNA from bacteria The result for the concentration and purity of
samples were presented in figure 1. The concentrations of genomic DNA extracted from
bacterial isolates were between 74.8 and
737.4ng/µl and the purified DNAs have an
A260/A280 ratio between 1.88 to 2.06. Strain
OFBR 4 had the highest DNA concentration as shown in figure 1.
Sample site
Mean of total viable counts (x104 Cfu/g)
Hydrocarbon degrader (x104 Cfu/g)
Site 1 9.0 ± 1.7 6.33±0.58
Site 2 14.0 ±3.6 11.67±1.52 Site 3 12.0 ± 2.0 8.33±1.52
Site 4 17.0 ± 2.0 6.67±1.53
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
67
Figure 1: Bacterial DNA concentration and purity
Legend
L1 – OFBR 1- Pseudomonas frederiksbergensis L5 – OFBR 5 - Pseudomonas flavensces L2 - OFBR 2 - Alcaligenes sp. L6 – OFBR 6 - Bacillus sp.
L3 – OFBR 3 - Bacillus thuringiensis L7 – OFBR 7 - Pseudomonas guineae L4 – OFBR 4 - Ochrobactrum anthropi PCR Amplification The universal primers successfully amplified
the 16S rRNA gene from all the bacteria isolated from the oil-contaminated soil. The
size of the 16SrRNA gene products obtained for all the seven isolates were the same as
there were no conspicuous variations
noticeable amongst them. (Plate 1). The size
of the PCR products of all isolated bacteria was approximately 1500bp relative to the
molecular size marker.
Plate 1: PCR amplification of genomic DNA targeted to amplify the 16S rRNA gene of the oil degrading bacterial isolates in Delta State.
Legend L0 – Molecular ladder LC – Control (E. coli) L1 – OFBR 1- Pseudomonas frederiksbergensis L5 – OFBR 5 - Pseudomonas flavensces L2 - OFBR 2 - Alcaligenes sp. L6 – OFBR 6 - Bacillus sp.
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
68
L3 – OFBR 3 - Bacillus thuringiensis L7 – OFBR 7 - Pseudomonas guineae
L4 – OFBR 4 - Ochrobactrum anthropi
Alignments of the nucleotide sequences from the Genebank The 16S rRNA sequences of the bacteria
obtained after sequencing were aligned with the genes (16S rRNA) from the other bacteria
on the NCBI data bank. The complete nucleotides blast of genes from the oil-
degrading bacteria isolated from oil polluted soil were presented in table 3. Alignments of
these sequences showed significant similarity
to previously identified bacteria and an
uncultured bacterium present in oil polluted soil sample. The sequences aligned have
similarity with Alcaligenes faecalis strain
SH179, Alcaligenes faecalis Sub sp. Phenolicus, Bacillus thuringiensi serovar
konkukian, Ochrobactrum anthropi ATCC 49188, Alcaligenes faecalis strain SH179,
uncultured bacterium clone and Alcaligenes faecalis strain IVN45. These results highlight
different group of bacterial genera involved in
hydrocarbon degradation.
Table 3: Complete nucleotide blast of 16SrRNA genes from oil-degrading bacteria isolated from oil-
polluted soil in Delta State.
Bacterial isolates
Number of Bases
Homologous genes
% identity Accession.
number
Organism Description
L1
OFBR 1
1118
16S
ribosomal RNA gene,
partial
sequence
93%
KC172O62.
1
Alcaligenes faecalis strain SH179a
Alcaligenes faecalis strain SH179 16S ribosomal RNA gene,
partial sequence.
L2
OFBR 2
1118 whole
genome shotgun
sequence
93%
NZ_AUBT0
1000026.1
Alcaligenes faecalis sub sp. Phenolicus
Alcaligenes faecalis subsp. phenolicus DSM 16503
G456DRAFT_scaffold00024.24_C, whole
genome shotgun
sequence.
L3 OFBR 3
947 chromosomecomplete
genome
92% NC_005957.1
Bacillus thuringiensis serovar
konkukian
Bacillus thuringiensis serovar konkukian
str. 97-27
chromosome, complete genome.
L4 OFBR 4
486 16S ribosomal
RNA gene,
partial sequence
92% NC_009668.1
Ochrobactrum anthropi ATCC
49188
Ochrobactrum anthropi ATCC
49188 16S
ribosomal RNA gene, partial sequence.
L5
OFBR 5
1118 16S
ribosomal RNA gene,
partial sequence
93% KC172O62.
1
Alcaligenes faecalis strain SH179b
Alcaligenes faecalis strain SH179 16S ribosomal RNA gene,
partial sequence.
L6 239 16S 79% JF361296.1 Uncultured soil Uncultured soil
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
69
Conventional and Molecular Characterization The identities of oil degrading bacteria obtained from Mesogar community, Delta
State, Nigeria are presented in table 4. It was observed that the conventional and molecular
identities of isolates OFBR 2, OFBR 3 and
OFBR 4 were the same, OFBR 1, OFBR 5 and OFBR 7 were at variance while OFBR 6 was
assigned to uncultured bacterium clone from environmental sample.
Table 4: The identities of oil degrading bacteria by conventional and molecular characterization
Isolates Conventional Identity Molecular Characterization
OFBR 1 Pseudomonas frederiksbergensis
Alcaligenes faecalis strain SH179a
OFBR 2 Alcaligenes sp.
Alcaligenes faecalis sub sp. Phenolicus
OFBR 3 Bacillus thuringiensis Bacillus thuringiensis serovar konkukian
OFBR 4 Ochrobactrum anthropic
Ochrobactrum anthropi ATCC 49188
OFBR 5 Pseudomonas flavensces
Alcaligenes faecalis strain SH179b
OFBR 6 Bacillus sp
Uncultured soil bacterium clone
OFBR 7 Pseudomonas guineae Alcaligenes faecalis strain IVN45
Phylogenetic Analysis The partial 16S rRNA gene sequence from the
bacterial isolates when compared with the sequences from the database revealed that
they belong to three taxonomic lineages
(Figure 2). Two species belong to the beta subdivisions of Proteobacteria (A and B), one
species belong to the alpha subdivisions of Proteobacteria, one specie belong to the
division Firmicutes (Gram positive bacteria). One of the isolates could not be assigned to
any known phylum because it has only 79% similar to the closest sequence in GeneBank
(Accession No. JF361296.1), which was
derived from an uncultured soil bacterium clone detected from environmental sample. All
of them are members of the domain Eubacteria with gamma Proteobacteria (60%)
OFBR 6 ribosomal
RNA gene, partial
sequence
bacterium clone bacterium clone
GO0VNXF07IJ3W4 16S ribosomal RNA
gene, partial sequence.
L7
OFBR 7
456 16S
ribosomal RNA gene,
partial sequence
89% KT254066.
1
Alcaligenes
faecalis strain IVN45
Alcaligenes faecalis strain IVN45 16S
ribosomal RNA
gene, partial sequence.
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
70
being the dominant division and alpha
Proteobacteria and Firmicutes having a smaller proportion. Sequences from five (5) isolates
had a similarity equal or higher than 92% with other 16S rRNA sequences from the database
and the remaining had less than 90%
similarity. The 16S rRNA analysis revealed that all isolates had similarities with the genera
Alcaligenes, Ochrobactrum, Bacillus and an uncultured bacterium clone.
Figure 2: Phylogenetic tree based on partial 16S rRNA gene sequence of oil-degrading bacteria
Degradative ability of the isolates All the seven bacteria isolated from contaminated soil were able to grow in the
MSB medium. Strain OFBR 4 was observed to demonstrate the greatest ability to utilize
crude oil. Figure (3) shows the ability of the
bacterial isolates to degrade crude oil based on the optical density. The degradative activity
of the seven isolates revealed that they are capable of degrading crude oil although there
are variations in the rates of degradation.
Under similar conditions, there were differences in the degradative activity of the
isolates in 2% crude oil. The incubation period had effect on the degrading activity of the
isolates. All the seven isolates degraded crude
oil, suggesting that they have similar gene that encodes for hydrocarbon degradation in their
genetic make-up.
[Type a quote from the
document or the
summary of an
interesting point.
You can position
the text box
anywhere in the
document. Use the
Text Box Tools tab
to change the
formatting of the
pull quote text
box.]
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
71
Figure 3: Oil-degrading activity of bacterial growth on mineral salt medium supplemented with 2%
crude oil. Legend
A – OFBR 1 E – OFBR 5 B - OFBR 2 F – OFBR 6
C – OFBR 3 G – OFBR 7
D – OFBR 4
Gas chromatography analysis of hydrocarbon degradation The total petroleum hydrocarbon (TPH) in the control was determined to be 9.88134e5 with
twenty different hydrocarbons. The retention
time for the first eluted hydrocarbon was 8.993 min and the amount of hydrocarbon
eluted was 2.982964mg Kg-1 (figure 4). After the first day of biodegradation, the total
petroleum hydrocarbon (TPH) had reduced to
9.30857e5 and a reduced retention time with a reduction in the amount of hydrocarbon that
eluted the column at that particular time (figure 5). The different types of aromatic
hydrocarbon present had been reduced to
eighteen. After the fifteen day of biodegradation, Strain OFBR 4 had been able
to degrade up to 75.3% of the total petroleum hydrocarbon (figure 6).
Figure 4: Chromatogram of control (MSM + crude oil)
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
72
Figure 5: Chromatogram of oil after 24hours of Strain OFBR 4 on MSM + oil
Figure 6: Chromatogram of crude oil after 15 days of Strain OFBR 4
Discussion
The population of bacteria and hydrocarbon
degraders in oil polluted and non-polluted soils
in Mesogar community, Delta State confirms
the ubiquity of bacteria. The presence of these oil-
degrading bacteria in the polluted soil shows
clearly that the indigenous bacteria were
carrying out their metabolic activity using the oil supplemented in the growth medium as the
sole source of carbon and energy. The
activities of these bacteria could be
responsible for the bioremediation of the
environment which is in agreement with the findings of Ojo (2006).
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
73
The conventional methods of identification
revealed seven (7) bacteria in the soil samples from Mesogar community, Delta State. They
were: Pseudomonas frederiksbergensis, Alcaligenes sp., Bacillus thuringiensis, Ochrobactrum anthropic, Pseudomonas flavensces, Bacillus sp. and Pseudomonas guineae. Previous studies have reported
species of Pseudomonas sp., Alcaligenes, and Bacillus to be implicated in hydrocarbon
degradation by a group of researchers (Oboh et al. 2006; Boboye et al. 2010). The identity
of only seven (7) isolates seemed ridiculously
small in number. This could be adduced to the fact that not all bacteria are amenable to
laboratory conditions and may find it difficult to be cultured.
The molecular technique of identification of bacteria used in this study was based on the
conserved sequence of the 16S rRNA genes of various bacteria according to Farrelly et al.
(1995). The results obtained from the
conserved sequence of the 16S rRNA coupled with the nucleotide sequence, revealed that
the isolated bacteria are Alcaligenes faecalis strain SH179a, Alcaligenes faecalis sub sp.
Phenolicus, Bacillus thuringiensis serovar konkukian, Ochrobactrum anthropi ATCC
49188, Alcaligenes faecalis strain SH179b,
Uncultured soil bacterium clone and Alcaligenes faecalis strain IVN45. The bacteria
identified from the same samples using conventional methods are Pseudomonas frederiksbergensis, Alcaligenes sp., Bacillus thuringiensis, Ochrobactrum anthropi, Pseudomonas flavensces, Bacillus sp. and
Pseudomonas guineae. Wackett (2003) reported that Pseudomonas species is the
most extensively studied owing to their ability
to degrade so many different contaminants. In this study, Pseudomonas species was not
detected by molecular characterization but was found to have remote identity with
Alcaligenes species (Table 4). This corroborates the findings of Pace (1997) that
molecular techniques will reveal information
about metabolic life style of microorganisms which are not amenable to pure cultures.
Alcaligenes faecalis SH179a and Alcaligenes faecalis SH179b are similar even to the strain
level but exhibit different phenotypic
characteristics. This may be due to phenotypic adjustments for adaptation in the polluted
environment. Three of the isolates have the same number bases hence, their species
identity was similar but of different strains.
Adesanya et al. (2004) isolated Bacillus thuringiensis from Bitumen contaminated
sediments. Bhattacharya et al. (2015) reported to have isolated Ochrobactrum sp. with the
capability of degrading hydrocarbons in
different waste lubricant oil sources. They also show that Ochrobactrum sp. could degrade
several kinds of hydrocarbon like naphtalene, xylene, diesel, and kerosene. Ibrahim (2016)
also reported biodegradation of used engine oil by novel strains of Ochrobactrum anthropi HM-1 isolated from oil-contaminated soil. The
low percentage similarities (79% - 93%) that the bacterial isolates have with the blast mean
that they have remote homologous to each other. The remote identity scores obtained in
this study cannot really place the bacteria at
both the genus and species level). They may therefore be regarded as novel bacteria
(Olukunle et al. 2019). This is evident in the genus of bacteria obtained from the molecular
characterization and the conventional identification in this study.
In constructing the phylogenetic tree, the tree
was rooted by assigning a root to the tree to show the evolutionary pathway. The tree
showed the closeness of the isolates based on
similarity in the nucleotide sequences. The molecular method of identifying bacteria to
gene level have been found to be more reliable than the conventional approaches
because the technique relies on examination
of genetic diversity of isolates. Molecular data generated in this research have shown to be
more suited to phylogenetic studies than phenotypic data. The partial 16S rRNA gene
sequence from the bacterial isolates when
compared with the sequences from the database revealed that they belong to three
taxonomic lineages (Figure 2). Two species belong to the beta subdivisions of
Proteobacteria (A and B), one species belong to the alpha subdivisions of Proteobacteria,
one specie belong to the division Firmicutes
(Gram positive bacteria). One of the isolates could not be assigned to any known phylum
because it has only 79% similar to the closest sequence in GeneBank (Accession No.
JF361296.1), which was derived from an
uncultured soil bacterium clone detected from environmental sample. All of them are
members of the domain Eubacteria with gamma Proteobacteria (60%) being the
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
74
dominant division and alpha Proteobacteria
and Firmicutes having a smaller proportion. Sequences from five isolates had a similarity
equal or higher than 92% with other 16S rRNA sequences from the database and the
remaining had less than 90% similarity. The
16S rRNA analysis revealed that all isolates had similarities with the genera Alcaligenes, Ochrobactrum, Bacillus and an uncultured bacterium clone. The test for the degrading capabilities of these
bacteria on crude oil showed that the bacteria
isolated from the soil samples were able to multiply within the days of study, indicating
their ability to utilize the oil for their growth and development, hence the concomitant
increase in the turbidity of the mineral salt
broth (MSB). This gradual increase in the turbidity of the broth indicates bacterial
growth and activities (Olukunle & Boboye, 2012). At day 6, all the isolates were
effectively in their exponential growth phase and optical density was very high. At day 10,
all isolates tend to have reached the peak of
their exponential phase as shown in Figure 2. At day 12, all isolates had entered the
stationary phase where there was no longer multiplication of cells, with the exception of
isolate D (OFBR 4) and isolate E (OFBR 5) that
continued to multiply. At day 14, the optical density value for all isolates decreased with an
exception to isolate D (OFBR 4) that continued to increase. The degradation of crude oil,
mostly between days 2 and 10 and gradual
decline in the concentration of the broth suggests decrease in the bacterial population
and that some components of the oil had been degraded, mostly between days 12 and 14.
OFBR 4 shows the highest degrading capability while OFBR 1 shows the lowest degree of
degradation. Doan et al. (2017) reported the
degradative ability of Ochrobactrum sp. while Ezekoye et al. (2018) demonstrated that
Proteobacteria played a key role in the remediation of a polluted site with a shift in
the bacterial community during the
remediation process in a study on field metagenomics of bacterial community involved
in bioremediation of crude oil polluted soil.
The spectrum of peaks that appeared in the chromatogram shows how the hydrocarbons
are being eluted from the column at different
times. The small reduction in hydrocarbon for the first day indicates that the bacterium is still
adjusting to the new environment. The
chromatogram shows that the relative abundance of the peak had reduced
considerably. There was a depletion of total area of chromatogram of various component
of oil in agreement with the findings of
Dasgupta et al. (2013). The shorter chain hydrocarbon in the crude oil are more easily
degraded more rapidly than the longer ones. This correlates with the study of Shaopeng et
al. (2013) on the characterization of oil-degrading bacteria from oil contaminated soil.
The type of hydrocarbon degraded was not
determined. Further studies may employ the use of Gas Chromatography Mass
Spectrometry (GC-MS). The high rate of hydrocarbon degradation by OFBR 4 could be
as a result of the massive growth and enzyme
production responses during the growth of the isolates (Bogan & Lamar, 1996).
Ochrobactrum anthropi is a de-emulsifying bacterium that has been reported to be
associated with crude oil contaminated soil. Suspension of the strain had been reported by
Mohebali et al. (2015) to be capable of
efficient breaking up of multiple water-oil emulsions containing crude oil. Also, Ibrahim
(2016) reports its ability to produce biosurfactant, a biological surface-active agent
that interacts with oily layers.
Conclusion
In this study, OFBR 4 which has remote homologous with Ochrobactrum anthropi ATCC
49188 shows the highest degrading capability.
It can be established that the identities of the bacteria are more authentic using molecular
identification. The Gas Chromatography analysis revealed that there was depletion of
total area of chromatogram of various component of oil by OFBR 4. The bacteria
isolated in this study are good candidates for
bioremediation of oil polluted sites. The use of molecular methods for rapid and accurate
detection of diverse strains of hydrocarbon-degraders is of utmost necessity in
bioremediation especially in identifying the
exact bacterial strain responsible for oil-degradation. Further research could be done
on metagenomics of oil polluted soils in order to give the bacterial community of the oil
polluted soils. In addition, the type of crude oil degraded could be determined by Gas
Chromatography Mass Spectrometry (GC-MS).
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
75
References
Adesanya O.O., Osho A., Durugbo E., Akinyemi O. and Shokunbi O. (2004).
Hydrocarbon degradation potentials of bacterial species isolated from Bitumen
contaminated water and sediments in Ilubirin,
Temidire camp and Agbabu communities of Ondo state, South West Nigeria. J. Int. Acad.
Res. Multidiscip., 2(5):239-248.
Ainon, H., Amir, R., Raja, F. H., and Noor, A. Y. (2010). Isolation and Characterisation of
Bacteria Degrading Sumandak and South
Angsi. J. Sains Malaysiana, 161-168.
Asadirad, M. H. A., Mazaheri Assadi, M., Rashedi, H. and Nejadsattari, T. (2016).
Effects of Indigenous Microbial Consortium in
Crude Oil Degradation: A Microcosm Experiment. International J. Env. Res.,
10(4):491-498.
Bhattacharya, M., Biswas, D., Sana, S. and Datta, S. (2015). Biodegradation of waste
lubricants by a newly isolated Ochrobactrum
sp. C1. 3 Biotech. 5:807-817.
Boboye, B., Olukunle, O. F., and Adetuyi, F. C. (2010). Degradative activity of bacteria
isolated from hydrocarbon-polluted site in
Ilaje, Ondo State, Nigeria. Afr. J. Micro. Res., 4(23): 2484-2491.
Bogan, B. W. and Lamar R. T. (1996).
Polycyclic aromatic hydrocarbon-degrading
capabilities of Phanerochaetelaevis HHB-1625 and its extracellular ligninolytic enzyme. Appl.
Env. Microb., 62:1597-1603.
Chang, S. E., J. Stone, K. Demes, and M. Piscitelli. (2014). Consequences of oil spills: a
review and framework for informing planning.
Ecol. and Soc., 19(2): 26.
Dasgupta D., Ritabrata G. and Tapaskk (2013). Biofilm mediated enchanced crude oil
degradation by isolated microorganisms. Dept.
Biol. Sci.:1- 13.
Doan, C. D. P., Sano, A., Tamaki, H., Pham, H. N. D., Duong, X. H. and Terashima, Y. (2017).
Identification and biodegradation characteristics of oil-degrading bacteria from
subtropical Iriomote Island, Japan, and
tropical Con Dao Island, Vietnam. Tropics, 25(4):147-159.
El Hanafy, A. A., Anwar, Y., Mohamed, S. A., Al-Garni, S. M. S, Sabir, J. S. M, Abu Zinadah,
O.A.H, and Ahmed, M. M. (2015). Isolation and Molecular Identification of Two Fungal
Strains Capable of Degrading Hydrocarbon
Contaminants on Saudi Arabian Environment. Int. J. Bioeng. and Life Sci., 9(12): 1215-1218.
Ezekoye, C. C., Chikere, C. B. and Okpokwasili,
G. C (2018). Field Metagenomics of Bacterial Community Involved in Bioremediation of
Crude Oil-Polluted Soil. J. Bioremed.
Biodegrad., 9(5):1-10.
Farrelly, V., Rainey, F. A. & Stackebrandt, E. (1995). Effect of genome size and rrn gene
copy number on PCR amplification of 16S
rRNA genes from a mixture of bacterial species. Appl. Env. Microb. 61, 2798-2801.
Fathepure, B. Z. (2014). Recent studies in
microbial degradation of petroleum
hydrocarbons in hypersaline environments. Front. Microb., 5(173):1-16.
Gautam, P. and Vimal, A. (2014). Phylogenetic
Analysis of Selected Lactic Acid Bacteria by
Using Bioinformatic Tools. Int. J. Eng. Tech. Res. (IJETR), 2(8):53-58.
Gopinathan, R., Prakash, M., and
Bharanthirajan, B. (2012). An experimental study for crude oil biodegradation in
contaminated soil. Int. J, Curr. Microb. Appl. Sci., 1(1): 12-16.
Hamzah, A., Rabu, A., Azmy, R. H. and Yussoff, N. A. (2010). Isolation and
Characterization of Bacteria Degrading
Sumandak and South Angsi Oils. J. Sains Malaysiana, 39(2): 161–168
Hamzah, A., Tavakoli, A. and Rabu, A. (2011).
Detection of toluene degradation in bacteria
isolated from oil contaminated soils. J. Sains Malaysiana, 40(11): 1231-1235.
Hugenholtz, P., and Goebel, B. M. (2001). The polymerase chain reaction as a tool to
investigate microbial diversity in environmental samples. In P. A. Rochelle (Ed.), Env. Microb.:
Protocols and Applications (pp. 31-40). Wymondham, UK: Horizon Scientific Press.
Olukunle, O. F./ Nig. J. Biotech. Vol. 36 Num. 2: 62- 76 (December 2019)
76
Ibrahim, H. M. M. (2016). Biodegradation of
used engine oil by novel strains of Ochrobactrum anthropic HM-1 and
Citrobacterfreundii HM-2 isolated from oil-contaminated soil. Biotech., 6:226.
JeromeJeyakumar, J. (2013). A study of
phytochemical constituents in Caralluma umbellate by GC-MS Analysis. Int. J. Phar. Sci.
Inv., 37-41.
Jyothi. K., Babu, S. K., Clara, N. K. and
Kashyap, A. (2012). Identification and Isolation of Hydrocarbon degrading bacteria
by Molecular Characterization. Helix, 2: 105-111.
Kachienga, L., Jitendra, K. and Momba, M.
(2018). Metagenomic profiling for assessing
microbial diversity and microbial adaptation to degradation of hydrocarbons in two South
African petroleum contaminated water aquifers. Scientific Reports, 8:7564
Mohebali, G., Kaytash, A. and Etemadi, N. (2015). Experimental breaking of water/ oil
emulsions aimed at development of a water separation bacterial process in oil industries.
Iran. J. Sci. and Tech., 98: 120-128.
Oboh, B. O, Ilori . M.O., Akinyemi, J. O. and Adebusoye S. A. (2006). Hydrocarbon
Degrading Potentials of Bacteria Isolated from
a Nigerian Bitumen (Tarsand) Deposit. Nat. & Sci., 4(3): 51-57.
Ojo, O. A. (2006): Petroleum-hydrocarbon
utilization by native bacterial population from
wastewater carnal Southwest Nigeria. Afr. J. Biotech. 5 (4) 333-337.
Olukunle O. F. and Boboye, B. (2012).
Phylogenetic analysis of Oil–degrading Bacteria Associated with Polluted Sites in River
State, Nigeria. Arch. Appl. Sci. Res., 4(4): 1600-1608.
Olukunle, O. F. (2013). Characterization of
Indigenous Microorganisms Associated with
Crude Oil Polluted Soils and Water using Traditional Techniques. Microb. J., 3: 1-11.
Olukunle, O. F. (2019). Molecular Identification of Crude Oil-Degrading Bacteria and Screening
for Catechol 2, 3 Dioxygenase (C23O) Gene. Biotech. J. Int., 23(4): 1-14.
Osuagwu, E. Olaifa, E. (2018). Effects of Oil
Spill on Fish Production in the Niger Delta. PLoS ONE, 13 (10): e0205114.
Oyetunji, B. (2013). Oil Price and Exchange
Rate Volatility in Nigeria. Undergraduate
Thesis.
Romanus, A. A., Ekundayo, A. O, Aigere, S. P. and Okwu G. I. (2015). Bacterial degradation
of petroleum hydrocarbons in crude oil
polluted soil amended with cassava peels. Am. J. Res. Comm., 3(7): 99- 118.
Pace, N. R. (1997). A molecular view of
microbial diversity and the biosphere, Science 276: (5313) 734-740.
Saleh, A. B., Ghazali, F.M., Abd Rahman, Z. R.
N. and Basri, M. (2003). Bioremediation of
Petroleum Hydrocarbon Pollution. Ind. J. Biotech., 2: 411-425.
Shaopeng, Y., Qiuyu W., Lina, Q. and Cong, L.
(2013). Characterization of Oil Degrading Bacteria from Oil. Contaminated Soil and
Activity of their Enzyme. Biotech. & Biotech.
Equip., 27:4, 3932-3938
Unimke, A.A, Mmuoegbulam, A. O and Anika, O. C (2018). Microbial Degradation of
Petroleum Hydrocarbons: Realities, Challenges and Prospects. Biotech. J. Int., 22(2):1-10.
Vivek, K. C. and Debajit, B. (2011). Isolation
and Molecular Characterization of Hydrocarbon-degrading bacteria from tannery
effluent. Int. J. Pollut. & Env. Sci., l1(2): ISSN
2231-4490.
Wackett, L. P. (2003). Pseudomonas putida — A versatile biocatalyst. Nat. Biotech., 21:136-
138.
Willey, J. M., Sherwood L. M. and Woolverton
C. J. (2008). Biodegradation and Bioremediation by Microbial Communities.
Prescott, Harley, and Klein’s Microbiology, 7th
ed. McGraw-Hill Companies, New York. Pp. 1060 ISBN 978–0–07–299291–5.
Varjani, S. J (2017). Microbial degradation of
petroleum hydrocarbons. Biores. Tech., 223: 277–286.