Pharmacogenomics Experiments Application Guide (Pub. No ...

For Research Use Only Not for use in diagnostic procedures

Pharmacogenomics ExperimentsAPPLICATION GUIDE

TaqManreg Genotyping and Copy Number Assays

for use withQuantStudiotrade 12K Flex Real-Time PCR System with OpenArraytrade Block(with AccuFilltrade System)TaqManreg OpenArraytrade Genotyping PlatesTaqManreg Genotyper SoftwareCopyCallertrade SoftwareAlleleTypertrade Software

Catalog Numbers 4475395 4471090 4486060Publication Number MAN0009612

Revision C0

The information in this guide is subject to change without noticeDISCLAIMER TO THE EXTENT ALLOWED BY LAW LIFE TECHNOLOGIES ANDOR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL INCIDENTALINDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING YOURUSE OF ITImportant Licensing Information These products may be covered by one or more Limited Use Label Licenses By use of these products you acceptthe terms and conditions of all applicable Limited Use Label Licenses

Revision history Revision history of Pub No MAN0009612

Revision Date DescriptionC0 28 September 2016 bull Ordering information incorporated into Chapter 2

bull DNA isolation procedures moved into Chapter 3

bull gDNA preamplification moved to new Appendix B

bull Prepare run and analyze OpenArraytrade PGx experiments split into two chapters

bull New troubleshooting sections

B0 August 2014 bull DNA sample preparation procedures in Chapter 4 updated for use of the MagMAXtrade DNAMulti-Sample Ultra Kit Users referred to a new Appendix A for complete procedures

bull ldquoPerform analysis in TaqManreg Genotyper Softwarerdquo topic in Chapter 5 reorganized forbetter workflow

bull Sample quantification procedure using the RNase P Detection Reagents Kit added to anew Appendix B

bull Corrections and clarifications made to Appendix C Troubleshooting

A0 January 2014 New document

Corporate entity Life Technologies Corporation | Carlsbad CA 92008 USA | Toll Free in USA 1 800 955 6288

Trademarks All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified TaqMan is a registeredtrademark of Roche Molecular Systems Inc used under permission and license AmpliTaq Gold is a trademark of Roche Molecular Systems IncOnline Mendelian Inheritance in Man and OMIM are trademarks of Johns Hopkins University NanoDrop is a trademark of NanoDrop TechnologiesLLC Puritan and PurFlock are trademarks of the Puritan Medical Products Company LLC

copy2016 Thermo Fisher Scientific Inc All rights reserved

Contents

CHAPTER 1 About pharmacogenomics experiments 8

Introduction 8

Workflow for OpenArraytrade plate PGx experiments 9

CHAPTER 2 Background and tools for assay selection 10

DME allele nomenclature 10

TaqManreg Drug Metabolism Genotyping Assays 11Genotyping assay context sequences 12TaqManreg Drug Metabolism Genotyping Assay for genotyping triallelic SNPs 13TaqManreg Drug Metabolism Genotyping Assays for genotyping adjacent SNPs 14

TaqManreg Copy Number Assays 15DME genes and copy number variation 15CYP2D6 copy number variation and CYP2D6CYP2D7 hybrid alleles 17CYP2A6 copy number variation and CYP2A6CYP2A7 hybrid alleles 18GSTM1 and GSTT1 DME assays and CNV 20

Special assays 20Gender assays 20Clinical research targets 20PGx targets not amenable to TaqManreg design 20Custom TaqManreg SNP Genotyping Assays 21TaqManreg Copy Number Assays 21

Tools for finding PGx TaqManreg DME SNP and Copy Number Assays 21Assay Search tool 22Search for TaqManreg SNP Genotyping Assays 22Search for TaqManreg Copy Number Assays 24The TaqManreg Drug Metabolism Genotyping Assays Index 25The PharmaADME Core Marker Set 25The PGx Common Markers file 26

Plate products and formats 26Fixed TaqManreg OpenArraytrade PGx panel plates 26Order custom OpenArraytrade plates 26

Single tube products and formats 27Order single-tube TaqManreg assays 27Formats for DME and CNV assays 27

Options for master mixes 29

Pharmacogenomics Experiments Application Guide 3

CHAPTER 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra Kit 30

Kit contents and storage 30

Required materials not supplied 31

Download the KingFishertrade Flex program (if needed) 33

Set up the sample layout 33

Isolate DNA from buccal swabs 34Guidelines for buccal swab preparation 34Before first use of the kit 34Before each use of the kit 35Digest the samples with Proteinase K 35Set up the processing plates 36Add Multi-Sample DNA Lysis Buffer isopropanol and DNA Binding Bead Mix 36Process samples on the instrument 36

Isolate DNA from whole blood 37Sample collection and storage 37Guidelines for whole blood preparation 37Before first use of the kit 38Before each use of the kit 38Digest the samples with Proteinase K 38Set up the processing plates 39Add Multi-Sample DNA Lysis Buffer isopropanol and BeadRNase A Mix 39Process samples on the instrument 40

Prepare a DNA stock solution for OpenArraytrade experiments 41

Normalize DNA samples for copy number analysis 41

CHAPTER 4 Prepare and run OpenArraytrade PGx SNPgenotyping experiments 42

Workflow 43

Materials required OpenArraytrade plate workflow 43

Recommended Run OpenArraytrade SNP genotyping experiments in real-time mode 44

Generate 384-well sample plate layouts in the OpenArraytrade Sample Tracker Software 46

Set up the AccuFilltrade instrument 47

Set up the PCR reactions in an OpenArraytrade 384-well Sample Plate 48

Transfer reactions to the OpenArraytrade plate (AccuFilltrade instrument) 49

Seal the OpenArraytrade plate 50

Run the OpenArraytrade plate(s) on the QuantStudiotrade 12K Flex instrument 51

Check the QC Images 52

One-time procedures 53Set up default folders and software preferences 53

Download SPF Files 54

Contents

4 Pharmacogenomics Experiments Application Guide

CHAPTER 5 Analyze OpenArraytrade PGx SNPgenotyping experiments 55

Before you begin analysis (each time) 56Transfer files from QuantStudiotrade 12K Flex Software with a network connection 56Transfer files from QuantStudiotrade 12K Flex Software without anetwork connection 56

Analysis options for genotyping data 57

Analyze data in QuantStudiotrade 12K Flex or Thermo Fisher Cloud software 57

Analyze data with TaqManreg Genotyper Software 58Before you begin TaqManreg Genotyper Software analysis 58Analyze results in TaqManreg Genotyper Software 59Review call rates and other QC parameters 60

Analysis guidelines sex chromosome targets 60

Analysis guidelines DME genotyping assays for genes in copy numbervariation regions 61

Analysis guidelines SNP genotyping assays for triallelic SNPs 61

Analysis guidelines DME genotyping assays for adjacent SNPs 63

Related documentation 65

CHAPTER 6 Prepare run and analyze PGx copynumber experiments 66

Introduction to copy number analysis 67

How TaqManreg Copy Number Assays work 67

Procedural guidelines 68

Before you begin 68

Set up PCR reactions 68

Run the reactions 69

Analyze the run in the instrument software and export the results 70

Analyze results in CopyCallertrade Software 71CopyCallertrade Software analysis options 71

Review the copy number analysis data 72

CHAPTER 7 Perform translation analysis inAlleleTypertrade Software 74

Introduction to AlleleTypertrade Software 74

PGx translation tables 75

Sources of PGx translation information and example translation tables 75

Contents


APPENDIX A Troubleshooting 76

Troubleshoot with cycling and imaging run images 76

AccuFilltrade instrument plate loading errors 77

OpenArraytrade plate assembly and handling errors 79

Recover from layout errors in the 384-well sample plate 80

Troubleshooting unexpected genotyping results 81(Optional) Rerun samples that fail to cluster 83

Troubleshooting genotype calls for assays with merging clusters 83

Expected versus unexpected noamp and undetermined calls 84TaqManreg Drug Metabolism Genotyping Assays for genes in copy numbervariation regions 84TaqManreg Drug Metabolism Genotyping Assays for triallelic SNPs andadjacent SNP targets 85

APPENDIX B Preamplification of low-concentration gDNA 86

Overview 86

Guidelines for starting DNA sample concentration 87

Required materials 87

Perform the preamplification 88

Dilute and store the preamplified product 89

APPENDIX C RNase P quantification forgenotyping experiments 90


Before you begin 90

Set up and run the PCR then quantify the DNA 91

APPENDIX D Expected performance and system specifications 92

APPENDIX E Controls for genotyping and copynumber experiments 93

Overview 93

Sources of reference materials 93TaqManreg Drug Metabolism Genotyping Assays test data 93NCBI dbSNP genotype data 94Centers for Disease Control and Prevention (CDC) reference materials 94TaqManreg Copy Number Assays for DME genes 94

Plasmid controls 95

Contents


APPENDIX F Good PCR practice 96

Prevent contamination and non-specific amplification 96

PCR good laboratory practices 96

APPENDIX G Safety 97

Chemical safety 98

Biological hazard safety 99

Documentation and support 100


Customer and technical support 101

Limited product warranty 101

References 102

Index 103

Contents


About pharmacogenomicsexperiments

Introduction 8


WARNING Read the Safety Data Sheets (SDSs) and follow the handlinginstructions Wear appropriate protective eyewear clothing and gloves SafetyData Sheets (SDSs) are available from thermofishercomsupport

Introduction

Pharmacogenomics (PGx) is the study of genetic variation as it relates to drugresponse PGx studies involve testing samples for multiple variants in drugmetabolism enzyme (DME) and transporter genes This guide describes proceduresfor the sample‑to‑result PGx workflow solution using the QuantStudiotrade 12K FlexReal‑Time PCR System

Variant testing uses TaqManreg SNP Genotyping Assay or TaqManreg Copy NumberAssays targeting DME genes

bull The TaqManreg Drug Metabolism Genotyping Assay collection has ~2700 assaysthat detect potentially causative polymorphisms in 221 drug metabolism enzymeand associated transporter genes

bull TaqManreg Copy Number Assays examine copy number variation (CNV) in DMEgenes

bull There are 7 million predesigned TaqManreg SNP Genotyping Assay and customTaqManreg SNP Genotyping Assay available for other targets of interest

1


Workflow for OpenArraytrade plate PGx experiments

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra Kit

(Optional) Appendix B Preamplification of low-concentration gDNA

Chapter 4 Prepare and run OpenArraytrade PGxSNP genotyping experiments

Chapter 6 Prepare run and analyze PGxcopy number experiments

Chapter 5 Analyze OpenArraytrade PGx SNPgenotyping experiments

Chapter 7 Perform translation analysis in AlleleTypertrade Software

Note See Appendix D for expected throughput rates of OpenArraytrade plates andother system specifications

Chapter 1 About pharmacogenomics experimentsWorkflow for OpenArraytrade plate PGx experiments 1


Background and tools for assayselection


TaqManreg Drug Metabolism Genotyping Assays 11

TaqManreg Copy Number Assays 15

Special assays 20

Tools for finding PGx TaqManreg DME SNP and Copy Number Assays 21

Plate products and formats 26

Single tube products and formats 27


DME allele nomenclature

SNPs within drug metabolism genes are often identified by their standardized allelename or star () allele nomenclature (Sim 2010) Star alleles are gene‑level haplotypes(a set of DNA polymorphisms that are often inherited together on the samechromosome) Often these haplotypes have been associated with DME activity levels(for example functional decreased function or nonfunctional variants) Thecombination of star allele haplotypes (that is the diplotype) within a sample can beused to predict its drug metabolizer phenotype (for example ultrarapid extensiveintermediate or poor) Genetic variants within a haplotype can include SNPs InDelsand CNVs The allele nomenclature for a specific gene family is maintained andstandardized by an affiliated group of scientists that curate each site independentlyThis nomenclature is complicated because many alleles contain more than onepolymorphism (that is they are haplotypes) and conversely many polymorphismscan be associated with several alleles

The star allele nomenclature contains the DME gene name such as CYP2D6 followedby a numeric allele name such as 3 A star allele conventionally contains at least onecausative variant (for example a frameshift mutation) Variants are given referencegene andor cDNA coordinates such as g2549delA (full variant name CYP2D63 g2549delA) The causative star allele variant can be associated with other nucleotidevariants in different haplotypes groups such sub‑alleles are denoted by lettersfollowing the numeric allele identifier (for example 3A) On the Cytochrome P450(CYP) Allele Nomenclature web site the defining causative variant for a star allele isoften in bold font

Note 1 refers to the reference gene sequence which produces an enzyme withnormal function The reference gene sequence is not necessarily equivalent to thereference genome assembly sequence and it does not necessarily contain the major

2


allele for a given SNP (which can vary between populations particularly for highlypolymorphic SNPs)

The defining variant for a given DME gene star allele may be the only variant neededto identify that particular star allele The defining allele is sometimes referred to as thePrimetag SNPPrime Common allele names are provided for many DME variants in the PGxCommon Markers file See ldquoThe PGx Common Markers fileldquo on page 26

The DME Assay collection variants have been mapped for the genes having publicallele nomenclature sites This allele nomenclature is searchable on the DME assayproduct pages and in the downloadable TaqManreg Drug Metabolism GenotypingAssays Index file available at wwwthermofishercompgx The public allelenomenclature websites provide information on DME gene star allele haplotypes thedefining polymorphisms for these alleles and links to the NCBI dbSNP website forvariants having an reference SNP (refSNP) identifier or rs ID

Table 2 DME allele nomenclature websites

Gene family Allele nomenclature website

CYPmdashCytochrome P450 (CYP) genes wwwcypalleleskise

NAT1 and NAT2mdashArylamineN‑Acetyltransferase genes

httpnatmbgduthgr

UGTmdashUDP Glucuronosyltransferase genes wwwpharmacogenomicsphaulavalcaugt-alleles-nomenclature

Note Other DME gene variants have allele nomenclature reported in the literaturebut no public nomenclature web site exists For key variants allele nomenclature isfound in the Very Important PGx (VIP) gene summary pages on thePharmacogenomics Knowledge Base web site wwwpharmgkborg

Where possible such allele nomenclature is provided for non‑ CYP ‑NAT and ‑UGTvariants in the PGx Common Markers file See ldquoThe PGx Common Markers fileldquo onpage 26

TaqManreg Drug Metabolism Genotyping Assays

The TaqManreg Drug Metabolism Genotyping Assay a collection of approximately2700 assays detect potentially causative SNP MNP or InDel polymorphisms in 221drug metabolism enzyme (DME) and associated transporter genes The DME assayswere designed using an optimized DME assay design algorithm that uses a high levelof bioinformatics to ensure a lack of underlying polymorphisms and high targetspecificity (that is gene family members and pseudogenes will not amplify) Assaysto more difficult targets underwent manual design All DME Assays underwentstringent wet‑lab testing including running with 180 unique DNA samples from fourdifferent populations (African American Caucasian Chinese and Japanese)

The TaqManreg SNP Genotyping Assays were designed using a related highlyvalidated SNP assay design algorithm The SNP assays are functionally tested (that isfor amplification and clustering capabilities) when first manufactured on 20 unrelatedgDNA samples from three populations (African American Caucasian and Japanese)In addition over 300 high value TaqManreg DME and SNP assays were tested with 44African American and Caucasian samples and synthetic templates representing each

Chapter 2 Background and tools for assay selectionTaqManreg Drug Metabolism Genotyping Assays 2


genotype on OpenArraytrade plates run on the QuantStudiotrade 12K Flex Real‑Time PCRSystem to ensure assay performance on this platform

All TaqManreg SNP Genotyping Assays Drug Metabolism Genotyping Assays andCustom SNP Genotyping Assays contain sequence‐specific forward and reverseprimers to amplify the polymorphic sequence of interest and two TaqManreg MGBprobes with non‐fluorescent quencher (NFQ)

bull One probe labeled with VICtrade dye detects the Allele 1 sequencebull One probe labeled with FAMtrade dye detects the Allele 2 sequence

TaqManreg DME and SNP Genotyping Assay data is analyzed by cluster plot analysisFAMtrade dye signal is plotted on the Y‑axis and VICtrade dye signal is plotted on the X‑axisSamples homozygous for the FAMtrade‑ or VICtrade‑labeled alleles form clusters along theY‑ or X‑axis respectively whereas heterozygous samples contain both FAMtrade andVICtrade dye signal and will cluster roughly along the diagonal position between thehomozygous clusters

The reporter dye information for TaqManreg Drug Metabolism and SNP GenotypingAssays is represented in the assay context sequence found at thermofishercom andprovided in the Assay Information File (AIF) that you can download from the web at wwwlifetechnologiescomOA‐platefiles The context sequence is the nucleotidesequence surrounding the SNP site It is provided in the (+) genome strand orientationrelative to the NCBI reference genome The SNP alleles are included in bracketswhere the order of the alleles corresponds to the association with probe reporter dyeswhere [Allele 1 = VICtrade dye Allele 2 = FAMtrade dye]

Genotyping assaycontext sequences

Chapter 2 Background and tools for assay selectionTaqManreg Drug Metabolism Genotyping Assays2


Example C__27102431_D0 assay

For C__27102431_D0 assay targets the CYP2D64 g1846GgtA SNP rs3892097 and hasthe following context sequence

AGACCGTTGGGGCGAAAGGGGCGTC[CT]TGGGGGTGGGAGATGCGGGTAAGGG

The VICtrade dye probe is associated with the C allele and the FAMtrade dye probe isassociated with the T allele

In this example the SNP alleles (CT) are the reverse complement of those given in thestar allele nomenclature CYP2D64 g1846GgtA This is because the context sequencealleles are provided in the (+) reference genome strand orientation whereas the starallele nucleotide changes are provided with respect to the CYP2D6 gene referencesequence that maps to the (ndash ) genome strand

Several important DME gene variants are triallelic SNPs wherein 3 bases occur at thesame genomic location Triallelic SNP targets can be interrogated using a pair ofTaqManreg assays Each assay contains one probe for the major SNP allele which islabeled with the same reporter dye (VICtrade dye) in both assays and one probe for oneof the minor alleles which is labeled with the second reporter dye (FAMtrade dye) Togenerate accurate sample genotypes the two assays must be run independently onthe same panel of samples and the resulting allelic discrimination plots must beanalyzed in concert comparing the genotype cluster positions from both assays to amap of the true sample genotypes See Table 15 on page ldquoAnalysis guidelines SNPgenotyping assays for triallelic SNPsldquo on page 61 for analysis

Table 3 TaqManreg Drug Metabolism Genotyping Assays to triallelic SNPs

Gene rs ID TaqManreg DME Assay Allele name Assay alleles[VICtradeFAMtrade]

ABCB1 rs2032582 C_11711720C_30 ABCB1 c3095GgtT CA

C_11711720D_40 ABCB1 c3095GgtA CT

CYP2C9 rs7900194 C__25625804_10 CYP2C98 c449GgtA AG

C_25625804D_20 CYP2C927 c449GgtT TG

CYP2D6 rs5030865 C_30634117C_K0 CYP2D68 g1758GgtT AC

C_30634117D_M0 CYP2D614 g1758GgtA TC

CYP1A1 rs41279188 C_30634152C_70 CYP1A15 g2461CgtA GT

C_30634152D_80 CYP1A19 g2461CgtT GA

CYP2C8 rs72558195 C_72650009C_10 CYP2C87 c556CgtT GA

C_72650009D_20 CYP2C88 c556CgtG GC

TaqManreg DrugMetabolismGenotyping Assayfor genotypingtriallelic SNPs



For certain DME targets two SNPs are located adjacent to one another Thiscomplicates the SNP genotype analysis because for each assay the probes will fail tobind target sequences when the adjacent SNP is present However when the adjacentSNPs are present in only 3 haplotypes these SNPs can be interrogated similarly totriallelic SNPs using two assays (see ldquoTaqManreg Drug Metabolism Genotyping Assayfor genotyping triallelic SNPsldquo on page 13)

Assay sets to two highly studied SNPs that have an adjacent less frequently detectedSNPs are available In each case the minor alleles of each SNP are not found togetherin the same haplotype

Table 4 DME Assays for genotyping adjacent SNPs

Gene SNP ID TaqManreg DME assay Allele name

CYP2C19 rs4244285 C__25986767_70 CYP2C192 681GgtA

rs6413438 C__30634128_10 CYP2C1910 c680CgtT

CYP2C9 rs1057910 C__27104892_10 CYP2C93 c1075AgtC

rs56165452 C__30634131_20 CYP2C94 c 1076TgtC

CYP2C19210 adjacent SNP assays

Only 3 haplotypes have been observed for the CYP2C19 2 and 10 SNPs(wwwcypalleleskisecyp2c19htm) the rare 10 c680T allele and the 2 c681A donot occur on the same chromosome Thus these adjacent SNPs can be analyzedsimilarly as for triallelic SNPs When the 2 assay is run on a sample containing a 10allele the probes will fail to detect the 10‑containing allele the converse is true whenthe 10 assay is run on a sample containing a 2 allele The context sequences for eachassay are shown below After running paired assays for adjacent SNPs in separatereactions on the same gDNA samples examine the cluster plots in TaqManreg

Genotyper Software Sample calls may need to be adjusted and the results of eachassay compared to determine the true sample genotype as detailed in ldquoAnalysisguidelines DME genotyping assays for genes in copy number variation regionsldquo onpage 61

CYP2C192 c681GgtA C__25986767_70

TTCCCACTATCATTGATTATTTCCc[AG]GGAACCCATAACAAATTACTTAAAACYP2C1910 c680 CgtT C__30634128_10

TTTCCCACTATCATTGATTATTTCC[CT]gGGAACCCATAACAAATTACTTAAA 10 2

TTTTCCCACTATCATTGATTATTTCC[CT][GA]GGAACCCATAACAAATTACTTAAA

TaqManreg DrugMetabolismGenotyping Assaysfor genotypingadjacent SNPs



TaqManreg Copy Number Assays

Copy number variation must be assessed for DME genes known to exhibit copynumber variation (see ldquoPre‑tested TaqManreg Copy Number Assays for select DMEgenesldquo on page 16) TaqManreg Copy Number Assays are run simultaneously with aTaqManreg Copy Number Reference Assay in a duplex real‑time polymerase chainreaction (PCR) TaqManreg Copy Number Assays detect the target gene or genomicsequence of interest and the TaqManreg Copy Number Reference Assay detects asequence known to exist in two copies in a diploid genome (for example the humanRNase P H1 RNA gene) Relative quantitation (RQ) using the comparative Ct (ΔΔCt)method is used to determine the number of copies of the target sequence in each testsample

bull TaqManreg Copy Number Assays contain two primers and a FAMtrade dye‑labeledMGB probe to detect the genomic DNA target sequence

bull TaqManreg Copy Number Reference Assays contain two primers and a VICtrade

dye‑labeled TAMRAtrade probe to detect the genomic DNA reference sequence

TaqManreg Copy Number Assays are ordered as single tube assays (see ldquoSingle tubeproducts and formatsldquo on page 27) and run on 96‑well and 384‑well plates onApplied Biosystemstrade Real‑Time instruments including the QuantStudiotrade 12K FlexReal‑Time PCR System There are currently no copy number assays developed for theOpenArraytrade plate

Several DME genes exhibit copy number variation (CNV) or other structuralalterations due to recombination and gene conversions events between highly relatedloci (He 2011)

For DME gene variants that are associated with copy number variation run bothDME genotyping assays and copy number assays to determine sample genotypes

For DME assays that target a deleted or duplicated gene (for example CYP2D6)bull samples that contain 0 copies of the gene will not amplifybull samples with 1 or more gene copies that are homozygous for the SNP allele will

cluster togetherbull samples with more than 2 gene copies that are heterozygous may run within the

2‑copy heterozygous cluster or between it and one of the homozygous clusters

To discern the sample genotype copy number quantitation of the gene target must bedone to determine which samples carry gene deletions or duplications Additionallyuse of multiple copy number assays for a gene may be required for hybrid geneanalysis

Note The copy number assays are not SNP allele‐specific and cannot be used todetermine which SNP allele is duplicated when a sample is heterozygous and hasthree gene copies

A protocol has been developed for determining allele‐specific copy number ofCYP2D6 alleles by digital PCR For more information see CYP2D6 Allele-specific CopyNumber Analysis Quick Reference (Pub No MAN0011114)

DME genes andcopy numbervariation

Chapter 2 Background and tools for assay selectionTaqManreg Copy Number Assays 2


Pre-tested TaqManreg Copy Number Assays for select DME genes

Pre‑tested TaqManreg Copy Number Assays are available for the DME genes in CNVregions are shown in Table 5 These assays were run on 90 Coriell gDNA samplesfrom African American and Caucasian populations (the same panel used for DMEAssay validation)

Table 5 Pre-tested DME gene TaqManreg Copy Number Assays for CNV and hybrid gene analysis

Gene symbol Assay ID Gene location Major alleles detected

CYP2D6 Hs00010001_cn[1] Exon 9 CYP2D6 Deletion (5) Duplications (for example 1xN2xN 4x2 9x210x2 17xN 35x2)

CYP2D6 Hs04083572_cn Intron 2 CYP2D6 Deletion (5) Duplications (for example 1xN2xN 4x2 9x210x2 17xN 35x2) 2D62D7 hybridalleles with 2D7 exon 9 sequences (for example 3683)


CYP2A6 Hs07545273_cn Exon 1 CYP2A6 Deletion (4) Duplication (1x2)

CYP2A6 Hs07545274_cn Intron 1 CYP2A6 Deletion (4) Duplication (1x2)

CYP2A6 Hs04488984_cn Intron 2 CYP2A6 Deletion (4) Duplication (1x2) hybrid allelewith 2A7 exons 1-2 and 2A6 exons 3-9 (12)


CYP2A7 Hs07545276_cn Exon 1 CYP2A6 hybrid allele with 2A7 exons 1-2 and 2A6 exons3-9 (12)

CYP2A7 Hs04488016_cn Intron 2 CYP2A6 hybrid allele with 2A7 exons 1-2 and 2A6 exons3-9 (12)

CYP2A7 Hs07545277_cn Intron 7 No CYP2A6 alleles

CYP2E1 Hs00010003_cn Promoter CYP2E1 Duplication (1x2)

GSTM1 Hs02575461_cn Exon 1 GSTM1 Deletion (0) Duplication

GSTT1 Hs00010004_cn Intron 1 GSTT1 Deletion (0)

SULT1A1 Hs03939601_cn Intron 2 SULT1A1 Deletion Duplication

UGT2B17 Hs03185327_cn Exon 1 UGT2B17 in 150 kb Deletion (2)

[1] Assays in boldface type are those most frequently used for CNV and hybrid gene analysis

Chapter 2 Background and tools for assay selectionTaqManreg Copy Number Assays2


The CYP2D6 gene is the most highly polymorphic and complex of the DME genesOver 100 star allele groups have been identified by the Cytochrome P450Nomenclature Committee (wwwcypalleleskise) At least 4 of these groups give riseto alleles with substrate‑dependent reduced enzyme activity and more than 20 do notencode functional enzymes

The CYP2D6 alleles are composed of SNP and InDel variants CNVs and hybridalleles formed by recombination between CYP2D6 and highly related upstreampseudogene CYP2D7 sequences Individuals may carry null alleles (5) or extracopies of CYP2D6 (1 2 4 910 17 35) Some CYP2D6 alleles contain sequencesderived from the highly homologous CYP2D7 pseudogene for example CYP2D636as well as 4N 57 and 83 contains a gene conversion to CYP2D7 sequences in exon9 associated with negligible CYP2D6 enzyme activity (Gaedigk 2006)

Three different copy number assays to CYP2D6 sequences are available fordetermining CYP2D6 gene copy number and to aid identification of some hybridalleles (see ldquoPre‑tested TaqManreg Copy Number Assays for select DME genesldquo onpage 16)

Table 6 Pre-tested TaqManreg Copy Number Assays to CYP2D6 detection of CYP2D7exon 9 conversion alleles

Gene Assay ID Genelocation

CYP2D6 fulllengthalleles

CYP2D636[2D62D7hybrid][1]


CYP2D6 Hs00010001_cn Exon 9 Yes No No

Hs04083572_cn Intron 2 Yes Yes No


[1] Other alleles with conversions to CYP2D7 sequences in exon 9 4N 57 83

The primary copy number assay for CNV analysis is the exon 9 Hs00010001_cn assaywhich predominantly detects full‑length CYP2D6 alleles and not hybrid allelescontaining the exon 9 conversion to CYP2D7 sequences Usually it is not necessary todetect these nonfunctional hybrid alleles as they not contribute to CYP2D6metabolizer status (see category A samples in Table 7)

The intron 2 andor intron 6 assays should be run in addition to the exon 9 assaywhen information for both CYP2D6 and hybrid alleles is needed (see Table 7) forexample to characterize samples that are

bull Category Bmdash0 copies for the exon 9 assay but show amplification by SNP assaysupstream of exon 9 may carry a 36 allele

bull Category Cmdashsingle copy for the exon 9 assay but are heterozygous for SNPsupstream of exon 9 may carry a 36 allele

bull Category Dmdashsingle copy for the exon 9 assay but 5rsquo located SNP assays do notamplify and may carry a 13 allele

bull Category Emdash2 copies for the exon 9 assay and carry a 13 allele Such sampleswhich are relatively rare are difficult to detect unless all 3 CYP2D6 CNV assaysare routinely run

CYP2D6 copynumber variationandCYP2D6CYP2D7hybrid alleles



Table 7 Example CYP2D6 SNP and copy number assay results for samples carrying hybrid alleles with CYP2D7sequences

Category DiplotypeSNP assay results (cDNA alleles) copy number assay results Translation with

exon 9 resultonly[1]100CgtT 1846GgtA 2850CgtT 4180GgtC exon 9 intron 6 intron 2

A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4

CT GA CC GC 2 3 3 14

B 536 TT GG CC no amp 0 1 1 und (= 55)

C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)

D 513F no amp no amp no amp GG 1 0 0 und (= 55)

E 1013E TT GG CC CC 2 1 1 1010

[1] und= undetermined

See The Human Cytochrome P450 (CYP) Allele Nomenclature Database CYP2D6 webpage (wwwcypalleleskisecyp2d6htm) or the PharmGKB web page(wwwpharmgkborg) plus associated references for more details about these alleles

IMPORTANT Always use the CYP2D6 exon 9 copy number assay to detect true geneduplication events CYP2D6 intron 2 or intron 6 copy number assays should not beused alone to detect CYP2D6 duplications as they will also detect nonfunctionalhybrid alleles that do not represent duplications and that do not contribute toCYP2D6 metabolizer status

CYP2A6 alleles defined by the Cytochrome P450 Nomenclature Committee(wwwcypalleleskise) include at least four non‑functional alleles and severalreduced function alleles The genotyping of CYP2A6 alleles is complicated by thepresence of copy number variant deletion (4) and duplication (1) alleles and hybridalleles formed by recombination with upstream pseudogene CYP2A7 sequences forexample the reduced function 12 allele contains exons 1‑2 of CYP2A7 origin andexons 3‑9 of CYP2A6 origin (Oscarson 2002)

CYP2A6 copynumber variationandCYP2A6CYP2A7hybrid alleles



Several copy number assays to CYP2A6 and CYP2A7 sequences are available forexamining copy number variants and hybrid alleles (see ldquoPre‑tested TaqManreg CopyNumber Assays for select DME genesldquo on page 16 for the complete list)

Table 8 Pre-tested TaqManreg Copy Number Assays to CYPAD6 and CYP2A7 detectionof hybrid alleles


CYP2A6 fulllength alleles

CYP2A612[2A72A6

hybrid]


CYP2A6 Hs07545273_cn Exon 1 Yes No No

Hs07545274_cn Intron 1 Yes No No



CYP2A7 Hs07545276_cn Exon 1 No Yes Yes

Hs04488016_cn Intron 2 No Yes Yes

Hs07545277_cn Intron 7 No No Yes

At least two assays are required to detect copy number variation in CYP2A6bull The CYP2A6 intron 7 assay can be used to detect 4 deletion and 1 duplication

alleles This assay will amplify both full length CYP2A6 and the partially activeCYP2A6CYP2A7 hybrid allele CYP2A612 but will not be able to discern them

bull The intron 1 assay can also be used to detect 4 deletion and 1 duplicationalleles This assay will amplify full length CYP2A6 but will not be able to amplifythe CYP2A612 hybrid allele

bull If both CYP2A6 assays are run samples containing 12 alleles can bedistinguished from those containing full‑length alleles For example a 112sample will give 2 copies using the intron 7 assay and 1 copy using the intron 1assay whereas a 11 sample will give 2 copies with both assays

Additionally CYP2A7 assays can be used to corroborate the presence of CYP2A612alleles The CYP2A7 exon 1 assay will amplify the hybrid CYP2A612 allele whereasthe intron 7 assay will not amplify intact CYP2A6 or the CYP2A612 allele



The GSTM1 and GSTT1 genes have a very high frequency of deletion and are entirelymissing in a substantial number of individuals in multiple populations DMEgenotyping assays to variants within these genes will not amplify samples that arehomozygous for the gene deletion samples that are heterogyous for the deletion willrun as a homozygous sample

Special assays

Gender‐specific assays in PGx studies can aid sample tracking The TaqManreg SNPGenotyping Assay C_990000001_10 targets a gender‐specific polymorphic region inthe amelogenin gene that is commonly used in forensic sex determination tests TheVICtrade dye probe detects a 6 base deletion which occurs in the X‐specific amelogeningene whereas the FAMtrade dye probe detects Y‑chromosome sequences In genotypingexperiments male samples run in the heterozygous cluster position and femalesamples run in the VICtrade homozygote cluster Some males lack the Y‐specificamelogenin gene and will type as female Run the C_990000001_10 assay incombination with a Y‑chromosome assay to identify any mistyped samples For moreinformation go to wwwcstlnistgovstrbaseAmelogeninhtm

An example of a genotyping bar code Y‑chromosome assay is the C___1083232_10assay to the polymorphic rs2032598 SNP in USP9Y Only male samples amplify withthis assay female samples will cluster with the no template controls (NTCs)

TaqManreg SNP Genotyping Assays for non‑ADME PGx targets and clinical researchtargets are often included in PGx studies These assays are found within thepredesigned TaqManreg SNP Genotyping Assays collection and are searchable on theThermo Fisher Scientific web site by NCBI dbSNP rs ID Note that common names fordisease‑associated alleles (for example Factor V Leiden) are not yet searchable termsPublic web sites that can be used to identify the rs ID for common disease allelesinclude

bull Pharmacogenomics Knowledge Base (PharmGKB) wwwpharmgkborgbull Online Mendelian Inheritance in Mantrade (OMIMreg) httpomimorgbull SNPedia (a wiki investigating human genetics) httpsnpediacom

In addition TaqManreg SNP Genotyping Assays for commonly tested clinical researchtargets are included in the PGx Common Markers file Download the PGx CommonMarkers file from wwwthermofishercompgx

TaqManreg SNP Genotyping Assays are an ideal technology for interrogation of mostDME and clinical research target polymorphisms offering highly specific targetamplification and allele discrimination However there are some polymorphisms thatare not well‑suited for TaqManreg Assay development These include targets that

bull Reside in highly polymorphic genomic regions (polymorphisms interfere withamplification in some samples)

bull Share high sequence identity with another genomic region (base differences arenot available for specific assay development)

bull Are microsatellite polymorphismsbull Are base deletions within a homopolymer sequence

GSTM1 and GSTT1DME assays andCNV

Gender assays

Clinical researchtargets

PGx targets notamenable toTaqManreg design

Chapter 2 Background and tools for assay selectionSpecial assays2


The PGx Common Markers file (wwwthermofishercompgx) contains a list ofcommonly requested DME and clinical research targets that are not good candidatesfor TaqManreg Assay design and suggestions for alternative technologies to use (see theNo TaqMan Assays tab)

Targets of interest that are not covered by the current TaqManreg SNP GenotypingAssay collection can be submitted for Custom TaqManreg SNP Genotyping Assaysdesign

The Custom TaqManreg Assays Design Tool (CADT) is available at wwwthermofishercomtaqmansnpdesign

Order Custom TaqManreg SNP Genotyping Assays by first entering a sequence with theSNP in brackets for example [AG] then submitting the chosen target sites for assaydesign See wwwthermofishercomtaqmansnpdesign

CADT is used to design assays targeting biallelic SNPs or insertiondeletionpolymorphisms and multi‑nucleotide polymorphisms (MNPs) that are 6 bases orfewer in length

Sequences must be SNP and repeat‑masked before submission to CADT Additionallythe genome‑uniqueness for assays must first be established because custom assaysare not compared to the genome (for example by BLAT or BLASTn) to determinetarget specificity Do not submit targets from the ldquoNo TaqMan Assaysrdquo tab (see ldquoPGxtargets not amenable to TaqManreg designldquo on page 20) as assays can be designed thatdo not function properly

For targets that present assay design challenges contact our fee‑for‑design customassay design service at customsolutionslifetechcom

Targets of interest that are not covered by the extensive human TaqManreg CopyNumber Assays collection can be submitted to TaqManreg Copy Number Assaysdesign The GeneAssisttrade Copy Number Assay Workflow Builder is available at wwwthermofishercomordercustom-genomic-productstoolscopy-number-variation

Tools for finding PGx TaqManreg DME SNP and Copy Number Assays

bull Assay search tool available at wwwthermofishercomordertaqmanbull TaqManreg Drug Metabolism Genotyping Assays Index available at

wwwlifetechnologiescomtaqmanandmebull PharmaADME Core Marker Set available at httptoolslifetechnologiescom

contentsfsbrochurescms_082106xlsbull PGx Common Markers file available at wwwthermofishercompgx

Custom TaqManreg

SNP GenotypingAssays

TaqManreg CopyNumber Assays

Chapter 2 Background and tools for assay selectionTools for finding PGx TaqManreg DME SNP and Copy Number Assays 2


The Thermo Fisher Scientific web site provides an easy‑to‑use assay search tool to aidselection of TaqManreg DME SNP and Copy Number Assays The search tool can beaccessed from the Real‑Time PCR Assays page or any of the specific product pages at thermofishercom

1 Go to wwwthermofishercomordertaqman

2 Select SNP Genotyping

3 Select All SNP Genotyping4Human (includes the DME Assays) or just thevalidated Drug Metabolism Assays collection

4 Enter target information then click Search to search the complete assay setOptionally specify other search terms (including allele nomenclature rs ID andAssay ID) or specify chromosome position Use the EnterUpload MultipleTargets option to specify multiple search terms

Note If allele nomenclature is used as a search term (for example CYP2D64)all DME assays to variants within all associated sub‑alleles will be returned Ifneeded review the variants on the associated allele nomenclature website to

Assay Search tool

Search forTaqManreg SNPGenotyping Assays

Chapter 2 Background and tools for assay selectionTools for finding PGx TaqManreg DME SNP and Copy Number Assays2


determine which are important to evaluate in your study (for example only theallele‐defining variants may be of interest)

IMPORTANT Read any Important Information notes associated with the assay(select Important Information beside the Assay ID on the assay search resultsbar to open a pop‑up window) These notes provide information required formaking ordering decisions For example a copy number assay may be requiredin addition to the DME assay for sample genetic analysis or the DME assay maybe one of a pair of assays interrogating a triallelic SNP

5 To review the information for each assay click View Assay on Map ViewDetails and View Allele Frequency (if available)Note the following

bull Read any Important Information notes associated with the assay (selectImportant Information next to the Assay ID) Notes provide informationrequired to make ordering decisions and analyze data

bull The annotation for triallelic SNP assays is associated with the SNP ID andnot to the assay Review the Important Information or the assay contextsequence to determine the target alleles of each assay

bull Click View Details to review allele nomenclature for CYP UGT and NATgenes

6 To prepare a list of assays for ordering select the assays of interest then clickExport (at the top of the page)The exported results contain the Assay ID and annotations (catalog number SNPgene context sequence genomic location and allele nomenclature)




2 Select Copy Number4Human

3 Enter target information Search terms include gene symbol Assay ID andDatabase of Genomic Variants (DGV) variation IDs

bull Under Narrow Your Results (to the left of the results) select the Gene nameand Pre-tested Assay filters

bull Use the EnterUpload Multiple Targets option to specify multiple searchterms

bull Specify chromosome position

Note Copy Number Assays must be run in duplex PCR with a TaqManreg CopyNumber Reference Assay RNase P (default assay) and TERT (alternate assay)assays are available

IMPORTANT Read any Important Information notes associated with the assay(select Important Information beside the Assay ID on the assay search resultsbar to open a pop‑up window) These notes provide information required formaking ordering decisions For example information on the particular staralleles that an assay detects

4 Click Search to search the complete assay set

Search forTaqManreg CopyNumber Assays



5 When applicable narrow results by selecting Pre-Tested Assays to view assayspre‑tested on 90 Coriell gDNAs

6 Review the information for each assay click View Assay on Map and ViewDetailsNote the following

bull Read any Important Information notes associated with the assay (click theImportant Information box next to an Assay ID) Notes provide informationrequired to make ordering decisions then analyze data

bull View Details provides target location within gene and targeted known copynumber variants

7 If you need a list of assays for ordering select the assays of interest then clickExport (at the top of the page)The exported results contain the assay ID and annotations (catalog number genegenomic location and DGV targets)

Note TaqManreg Copy Number Assays must be run in duplex PCR with aTaqManreg Copy Number Reference Assay RNase P (default assay) and TERT(alternate assay) assays are available

The TaqManreg Drug Metabolism Genotyping Assays Index contains a comprehensivelist of the DME assays along with the annotations listed below This file can facilitatelooking for DME assays to polymorphisms of interest given the extensive annotationinformation within it which includes

bull Gene symbol and namebull NCBI SNP reference (if applicable)bull Polymorphism (for example AG)bull Amino acid change (if applicable)bull Allele nomenclature (if available)bull Polymorphism (for example AG)bull SNP type (for example missense mutation)bull Context sequence [VICtradeFAMtrade] (in (+) strand orientation with SNP alleles in

brackets)bull Applied Biosystemstrade minor allele frequency data (Caucasian African American

Japanese Chinese populations)

The PharmaADME consortium (wwwPharmaADMEorg) created a consensus list ofknown and putative functional variants in key genes involved in the absorptiondistribution metabolism and excretion (ADME) of drugs The PharmaADME CoreMarker Set contains a list of variants considered most likely to impact drugmetabolism and is composed of 184 variants in 33 key ADME genes

Thermo Fisher Scientific developed TaqManreg Assays to the PharmaADME CoreMarkers (gt 95 coverage) This assay set is comprised of both TaqManreg DME andCopy Number Assays to 172 SNP InDel and CNV targets

bull 164 DME assays include 10 assays to genotype 5 triallelic SNPs (paired assays)bull 10 copy number assays cover deletions and duplications in 6 total DME genes

The TaqManreg DrugMetabolismGenotyping AssaysIndex

The PharmaADMECore Marker Set



Thermo Fisher Scientific has pretested over 300 TaqManreg DME and SNP Assays tohighly studied important DME and other PGx gene variants on OpenArraytrade platesrun on the QuantStudiotrade 12K Flex Real‑Time PCR System All assays on this list weretested on this system with 44 Coriell gDNAs (22 each African American andCaucasian samples a subset of the DME Assay 90 sample validation panel) and mostwere also tested with synthetic plasmid constructs representing each genotype ThePGx Common Markers file contains a list of the most commonly requested assaysfrom this set

The file includes common allele names context sequences and other usefulannotations

Note A presentation called TaqManreg Drug Metabolism Genotyping Assays onOpenArraytrade Plates contains screen shots of the test data for the most commonlyrequested PGx Marker Assays (download from wwwthermofishercompgx)

Plate products and formats

There are two fixed TaqManreg OpenArraytrade PGx panels available for use on theQuantStudiotrade 12K Flex Real‑Time PCR System

bull TaqManreg OpenArraytrade PGx Panel QuantStudiotrade 12K Flex (Cat No 4475395bull TaqManreg OpenArraytrade PGx Express Panel QuantStudiotrade 12K Flex (Cat No

4488847

1 Go to wwwthermofishercomordercustom-array

2 For array type select TaqManreg OpenArraytrade Genotyping Plates

3 Click View Layout to display the assay format in a plate

4 Click Select to configure a plate

The PGx CommonMarkers file

Fixed TaqManreg

OpenArraytrade PGxpanel plates

Order customOpenArraytrade

plates

Chapter 2 Background and tools for assay selectionPlate products and formats2


5 Click Import Your Assay List then provide assay information

bull Under Upload a list of Assay IDs click Choose File then select a tab‑delimited text file (txt) containing Assay IDsor

bull Under Enter a list of Assay IDs paste the Assay IDs then click ImportEntered List

6 Follow the screen instructions to configure the assays on the plate

7 (Optional) Click Save Your Array at any time to save the array configuration toyour Thermo Fisher Scientific account

8 When the plate is configured click Complete Your Design then follow thescreen instructions to complete the order

Single tube products and formats

Order single‑tube assays in two ways

bull Search for TaqManreg Assays add assays to the shopping cart then complete theorder

bull If you have already obtained catalog numbers and IDs (Assay IDs) click QuickOrder at the top of any page at thermofishercom

TaqManreg SNP Genotyping Assays

Table 9 Single-tube TaqManreg SNP Genotyping Assays

Item ScaleNumber of reactions Assay mix

formulation

Cat No

384‑well 96‑well Human Non-human

PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691

Custom SNP Small 1500 300 40X 4331349 4332077

Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076

Note For more detailed instructions on running SNP genotyping experiments withsingle tube assays see the TaqManreg SNP Genotyping Assays User Guide (Pub NoMAN0009593)

Order single-tubeTaqManreg assays

Formats for DMEand CNV assays

Chapter 2 Background and tools for assay selectionSingle tube products and formats 2


DME assays are available only as small scale inventoried product Predesigned andcustom SNP assays are made‑to‑order and are available in multiple scales

Assays with human part numbers undergo functional testing on a panel of 20unrelated Coriell cell line gDNA samples from 3 populations (African AmericanCaucasian and Japanese) before shipment upon first order

Custom non‑human part numbers can be applied to assays for human targets thatwould fail the human assay functional test (for example Y chromosome SNP assaysfail as 8 of 20 samples are female and will not amplify GSTT1 and GSTM1 SNP assayswill also fail due to the high frequency of gene deletion)TaqManreg Copy Number Assays

Table 10 Made‑to‑order assays

Scale

Number ofreactions Assay mix

formulation

Cat No (Human)

384‑well 96‑well Pre‑designedassays

CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296

Table 11 Inventoried assays

ItemNumber of reactions Assay mix

formulation Cat No384‑well 96‑well

TaqManreg Copy Number Reference AssayRNase P (1 tube)

1500 750 20X 4403326

TaqManreg Copy Number Reference AssayRNase P (4 tubes)

6000 3000 20X 4403328

TaqManreg Copy Number Reference AssayTERT (1 tube)

1500 750 20X 4403316

TaqManreg Copy Number Reference AssayTERT (4 tubes)

6000 3000 20X 4403315

Chapter 2 Background and tools for assay selectionSingle tube products and formats2


Options for master mixes

TaqManreg OpenArraytrade Genotyping Master Mix is required for use with OpenArraytrade

plates TaqPathtrade ProAmptrade Master Mix is recommended for optimal performancewith TaqManreg Copy Number Assays for pharmacogenomics applications

Item Use Cat No

TaqManreg OpenArraytrade GenotypingMaster Mix

OpenArraytrade genotyping 4404846

TaqPathtrade ProAmptrade Master Mix Copy numberexperiments

A30865

(ROXtrade)

Chapter 2 Background and tools for assay selectionOptions for master mixes 2


Isolate DNA using the MagMAXtrade

DNA Multi-Sample Ultra Kit





Isolate DNA from buccal swabs 34

Isolate DNA from whole blood 37



Kit contents and storage

ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage

Proteinase K[3] 4 mL 5 times 4 mL ndash25degC to ndash15degC

PK Buffer 96 mL 5 times 96 mL

15degC to 30degCMulti-Sample DNA LysisBuffer 100 mL 5 times 100 mL

RNase A[4] 2 times 125 mL 10 times 125 mL ndash25degC to ndash15degC

DNA Binding Beads[3] 8 mL 5 times 8 mL 2degC to 8degC

Nuclease-free Water 100 mL 5 times 100 mL

15degC to 30degCWash Solution 1Concentrate 80 mL[5] 5 times 80 mL[5]

Wash Solution 2Concentrate 162 mL[5] 5 times 162 mL[5]

3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage

DNA Elution Buffer 1 25 mL 5 times 25 mL15degC to 30degC

DNA Elution Buffer 2 25 mL 5 times 25 mL

[1] Also available as Cat No A25919 containing Cat No A25597 with one additional tube each of Proteinase K (4 mL) and DNA Binding Beads (8 mL)

[2] Also available as Cat No A25920 containing Cat No A25598 with 5 additional tubes of Proteinase K (4 mL each) and 5 additional tubes of DNA Binding Beads (8 mL each)

[3] Proteinase K is also available as Cat no A25561 and DNA Binding Beads are also available as Cat No A25562 [4] Not used for DNA isolation from buccal swabs [5] Final volume see ldquoBefore first use of the kitldquo on page 34

Required materials not supplied

Unless otherwise indicated all materials are available through thermofishercomMLS Fisher Scientific (fisherscientificcom) or other major laboratory supplier

Table 12 Required materials and equipment not included with the kit

Item Source

One of the following instruments

(Recommended) KingFishertrade Flex Magnetic Particle Processor 5400630

MagMAXtrade Express‑96 Magnetic Particle Processor mdash[1]

Equipment

Plate shaker capable of shaking plates at a minimum of 900 rpm 88880023

Analog Vortex MixerFisher Scientific

02-215-365

Adjustable micropipettors MLS

Multi-channel micropipettors MLS

(Optional) Magnetic Stand-96 AM10027

Plates and combs

Deep Well Plates one of the following

KingFishertrade Flex Microtiter Deepwell 96 plates sterile 95040460

MagMAXtrade Express-96 Deep Well Plates 4388476

Standard Well Plates one of the following

KingFishertrade 96 KF microplates 97002540

MagMAXtrade Express-96 Standard Plates 4388475

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitRequired materials not supplied 3


Item Source

Tip Combs one of the following

KingFishertrade 96 tip comb for DW magnets 97002534

MagMAXtrade Express-96 Deep Well Tip Combs 4388487

Other consumables

MicroAmptrade Clear Adhesive Film 4306311

RNase-free Microfuge Tubes (20 mL) AM12425

Conical tubes (15 mL) AM12500


Aerosol-resistant pipette tips MLS

Reagent reservoirs MLS

(Optional) Paraffin film MLS

Reagents

Ethanol 200 proof (absolute) MLS

Isopropanol 100 (molecular grade or higher) MLS

[1] Not available for sale

Table 13 Additional materials and equipment required for processing buccal swabs

Item Source

Laboratory incubator with slatted shelves capable of maintaining65degC MLS

One of the following types of buccal swabs or equivalent buccal swabs with foam tips

Puritantrade PurFlocktrade Ultra Flocked SwabsFisher Scientific

22-025-192

Puritantrade HydraFlocktrade Swabs standard tipPuritan

25ndash3306ndashH

Sterile Foam Tipped SwabsPuritan

25-1506 1PF

4N6FLOQSwabstrade regular tip 4473979

(Optional) Proteinase K 500 reactions (4 mL) A25561

(Optional) DNA Binding Beads 500 reactions (8 mL) A25562

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitRequired materials not supplied3


Table 14 Additional materials and equipment required for processing whole bloodsamples

Item Source




Download the KingFishertrade Flex program (if needed)

The program required for this protocol is not pre‑installed on the KingFishertrade FlexMagnetic Particle Processor

1 On the MagMAXtrade DNA Multi‑Sample Ultra Kit web page scroll down to theProduct Literature section

2 Click A25597_Blood_Buccal to download the program to your computer

3 See Thermo Scientifictrade KingFishertrade Flex User Manual (Cat No N07669) andBindIttrade Software User Manual (Cat No N07974) for instructions for installing theprogram on the instrument

Set up the sample layout

Set up the sample plate layout using either of the following tools which providesample tracking from the 96‑well plate used for DNA isolation to the 96‑well sampleplate csv file used for import into OpenArraytrade Sample Tracker Software

Include at least 2 no template controls (NTCs) per plate

Tool Obtain from Description

OA_Genotyping_CalcSheet thermofishercomoaqrc Contains a sample layouttab additional sampletracking tabs andinstructions for using anadjustable pipettor totransfer samples from the96-well plate to the 384-wellsample plate

96-well Sample Plate 1csvtemplate

On the computer on whichthe Sample TrackerSoftware is installed

CProgram FilesAppliedBiosytemsSample TrackingUtilityexamples

Contains a sample layouttab

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitDownload the KingFishertrade Flex program (if needed) 3


Isolate DNA from buccal swabs

This section contains brief procedures For detailed information refer to MagMAXtrade

DNA Multi-Sample Ultra Kit (human buccal swabs) User Guide (Pub No MAN0010293)

Refer to Best Practices for Collection of Buccal Swabs Quick Reference (GenotypingExperiments) (Pub No MAN0014348) for sample collection instructions

bull Perform all steps at room temperature (20ndash25degC) unless otherwise notedbull Equilibrate buccal swabs to room temperature to maximize DNA recoverybull Remove the buccal swabs from the lysate

ndash Option 1 (Preferred) Transfer the lysate to a new plateThis option eliminates contamination risks and saves time To transferlysates set a multi‑channel micropipettor to ~300 microL and transfer one row atthe time Each well should contain 200ndash250 microL after transfer

ndash Option 2 Remove the swabs from the plate using forcepsRinse the forceps in 70 ethanol between samples to prevent cross‑contamination Press the swabs against the side of the well when removingthem to prevent sample loss

bull Cover the plate during the incubation and shaking steps to prevent spill‑over andcross‑contamination The same MicroAmptrade Clear Adhesive Film can be usedthroughout the procedure unless it becomes contaminated

bull If you use a plate shaker other than the recommended shaker verify thatndash The plate fits securely on your plate shakerndash The recommended speeds are compatible with your plate shaker Ideal

shaker speeds allow for thorough mixing without splashingbull Per‑plate volumes for reagent mixes are sufficient for one plate plus overage To

calculate volumes for other sample numbers refer to the per‑well volume andadd 5 overage

bull (Optional) To prevent evaporation and contamination cover the preparedprocessing plates with paraffin film until they are loaded into the instrument

(Optional) Guidelines for improving yields

bull This procedure is optimized for processing of one swab per well It is possible toprocess two swabs in one well when a higher concentration of DNA is required

bull If the DNA yield is lower than expected extend the Proteinase K digestion to45 minutes

bull To further improve recovery digest with Proteinase K overnight at 50degC

Prepare the Wash Solutions from the concentratesbull Add 25 mL of isopropanol to Wash Solution 1 Concentrate mix and store at

room temperaturebull Add 132 mL of ethanol to Wash Solution 2 Concentrate mix and store at room

temperature

Guidelines forbuccal swabpreparation

Before first use ofthe kit

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitIsolate DNA from buccal swabs3


bull Preheat the incubator to 65degC

bull Vortex DNA Binding Beads thoroughly then combine with Nuclease‑free Wateraccording to the following table

Component Volume per well Volume per plate

DNA Binding Beads 16 microL 16 mL

Nuclease-free Water 24 microL 24 mL

Total DNA Binding Bead Mix 40 microL 4 mL

Store DNA Binding Bead Mix at room temperature for up to 24 hours

Ensure that the incubator is preheated to 65degC

1 Place the swab swab‑head down in a deep‑well plate (one per well)If two swabs were collected store the second swab as a backup sample

2 Break enough of the stick off the swabs so that the swabs sit in the wells withoutprotruding

3 Prepare sufficient PK Mix according to the following table then invert severaltimes to thoroughly mix components

IMPORTANT Prepare the PK Mix just before use Do not place the PK Buffer orthe PK Mix on ice to avoid precipitation


Proteinase K 8 microL 800 microL

PK Buffer 192 microL 192 mL

Total PK Mix 200 microL 20 mL

4 Add 200 microL of PK Mix to each sample well of a deep‑well plate (PK Plate)containing a swab

IMPORTANT Do not touch any part of the swab with the pipet tip whenpipetting the PK Mix in the sample wells

5 Seal the plate with a clear adhesive film then shake the sealed plate for 5 minutesat 900ndash950 rpm

6 Incubate for 20ndash45 minutes at 65degC

IMPORTANT Arrange plates in the incubator to allow adequate flow around theplate wells to ensure that samples quickly reach and maintain the incubationtemperature

Before each use ofthe kit

Digest thesamples withProteinase K

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitIsolate DNA from buccal swabs 3


1 While the samples are incubating at 65degC set up the Wash Elution and TipComb Plates outside the instrument as described in the following table

Plate ID Plate position[1] Plate type Reagent Volume per well

Wash Plate 1 2 Deep Well Wash Solution 1 150 microL



Elution Plate[2] 5 Standard DNA Elution Buffer 1 50 microL

Tip Comb 6 Deep Well Place a tip comb in the plate

[1] Position on the instrument[2] The instrument prompts the user to add DNA Elution Buffer 2 to the Elution Plate after incubation with DNA Elution Buffer 1

2 (Optional) To prevent evaporation and contamination cover the preparedprocessing plates with paraffin film until they are loaded into the instrument

1 (Optional) If condensation is present at the end of the 65degC incubation brieflycentrifuge the plate for 1ndash2 minutes at 1500 times g

2 Add 200 microL of Multi‑Sample DNA Lysis Buffer to each sample

3 Seal the plate with a clear adhesive film then shake for 5 minutes at 900ndash950 rpm

4 Transfer lysates to the wells of a new deep‑well plate and discard the platecontaining the buccal swabs

5 Add 240 microL of isopropanol to each sample seal the plate then shake for5 minutes at 900ndash950 rpm

6 Vortex DNA Binding Bead Mix at moderate speed to ensure thorough mixingadd 40 microL to each sample then proceed immediately to DNA isolation (nextsection)If you see that the beads in the DNA Binding Bead Mix are settling vortex themix again briefly before continuing to pipette

1 Select the program on the instrument

bull KingFishertrade Flex Magnetic Particle Processor A25597_Blood_Buccalbull MagMAXtrade Express‑96 Magnetic Particle Processor 4413021 DW blood

2 Start the run remove the temporary paraffin plate seals (if present) then load theprepared processing plates in their positions when prompted by the instrument

3 Load the PK plate (containing lysate isopropanol and DNA Binding Bead Mix)at position 1 when prompted by the instrument

4 When prompted by the instrument (approximately 28ndash30 minutes after initialstart)

a Remove the Elution Plate from the instrument

Set up theprocessing plates

Add Multi-SampleDNA Lysis Bufferisopropanol andDNA Binding BeadMix

Process sampleson the instrument



b Add 50 microL of DNA Elution Buffer 2 to each sample well

IMPORTANT Add DNA Elution Buffer 2 immediately after the prompt toprevent excessive drying of any beads that are still captured on the TipComb

c Load the Elution Plate back onto the instrument and press Start

5 At the end of the run (approximately 30ndash35 minutes after initial start) removethe Elution Plate from the instrument and seal immediately with a new clearadhesive film

bull (Optional) Eluates can be transferred to a new storage plate after collectionbull If precipitated DNA is visible pipet up and down 5ndash10 times before sealing

the plate to ensure complete resuspensionbull If you see excessive bead residue in the wells place the Elution Plate on the

Magnetic Stand‑96 to capture any residue prior to downstream use of theDNA

IMPORTANT Do not allow the purified samples to sit uncovered at roomtemperature for more than 10 minutes to prevent evaporation andcontamination

The purified samples are ready for immediate use Alternatively store the coveredElution Plate

bull At 2ndash6degC for up to 24 hoursbull At ndash20degC or ndash80degC for long‑term storage

Isolate DNA from whole blood


DNA Multi-Sample Ultra Kit (whole blood) User Guide (Pub No MAN0010294)

bull Sample collection Collect blood samples using proper venipuncture collectionand handling procedures in EDTA or sodium citrate anticoagulant tubes Invertthe tube to ensure thorough mixing

Note Heparin is not recommended as an anti‑coagulant since it can causeinhibition of PCR

bull (Optional) Sample storage Store samples between minus20degC and minus80degC Werecommend storing samples in smaller volumes to prevent multiple freezethawcycles

bull If the whole blood is frozen prior to use thaw the sample at 25ndash37degC in a waterbath until it is completely liquid then place on ice until needed

bull Perform all steps at room temperature (20ndash25degC) unless otherwise notedbull When mixing samples by pipetting up and down avoid creating bubblesbull Cover the plate during the incubation and shaking steps to prevent spill‑over and

cross‑contamination The same MicroAmptrade Clear Adhesive Film can be usedthroughout the procedure unless it becomes contaminated

Sample collectionand storage

Guidelines forwhole bloodpreparation

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitIsolate DNA from whole blood 3








temperature

Preheat the incubator to 65degC








2 Add 200 microL of PK Mix to each sample well of a deep‑well plate (PK Plate)

3 Transfer 50 microL of whole blood to the appropriate well containing PK Mix

IMPORTANT Invert the tube containing the blood sample before pipetting toensure homogenous mixing







Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitIsolate DNA from whole blood3













3 Seal the PK plate with a clear adhesive film then shake for 5 minutes at 900ndash950 rpm

4 Prepare BeadRNase A Mix according to the following table

IMPORTANT Prepare the BeadRNase A Mix no more than 20 minutes beforeuse Prolonged storage at room temperature can reduce its efficiency

Vortex the DNA Binding Beads at moderate speed to form a uniform suspensionbefore preparing the BeadRNase A Mix



RNase A 5 microL 500 microL


Total BeadRNase A Mix 40 microL 40 mL

5 Vortex the BeadRNase A Mix at moderate speed to ensure thorough mixingthen add 40 microL to each sample and pipet up and down 5 times using amulti‑channel micropipettorIf you see that the beads in the BeadRNase A Mix are settling vortex the mixagain briefly before continuing to pipette

6 Seal the PK plate with the clear adhesive film then shake for 5 minutes at 900ndash950 rpm

7 Add 240 microL of isopropanol to each sample then proceed immediately to DNAisolation (next section)


Add Multi-SampleDNA Lysis Bufferisopropanol andBeadRNase A Mix






3 Load the PK plate (containing lysate isopropanol and BeadRNase A Mix) atposition 1 when prompted by the instrument
















Prepare a DNA stock solution for OpenArraytrade experiments

The recommended input for OpenArraytrade plates is 825 pg of DNA per 33‑nL reaction

1 Quantify DNA by any of the following methods Before quantifying mix thesamples well to ensure sample homogeneity especially if samples have beenstored

bull RNase P Ct value method (recommended)mdashSee Appendix C ldquoRNase Pquantification for genotyping experimentsldquo

bull Fluorometric analysismdashUse a Qubittrade dsDNA BR or HS Assay Kit

2 Prepare a 50 nguL DNA stock solution to use in the PCR setupSamples with low concentration (lt10 ngmicroL) andor low quality may requirepreamplification See Appendix B ldquoPreamplification of low‑concentrationgDNAldquo

Normalize DNA samples for copy number analysis

The required input for each 10‑microL PCR is 10 ng of DNA

Run each sample in quadruplicate for each copy number assay

1 Dilute a portion of each gDNA sample to 5 ngmicroL Prepare sufficient DNA for therequired number of reactions( of assays) times (Vol of 5 ngmicroL DNA per 10 microL reaction) times ( of replicates) times 120(for dead volume)For example if you are running 5 copy number assays prepare at least(5 Assays) times (2 microL) times (4 replicates) x 120= 48 microL of each sample at a concentration of 5 ng microL

2 Store the diluted samples at 4degC for immediate use or at ndash 25degC to ndash15degC forlong‑term storage

Chapter 3 Isolate DNA using the MagMAXtrade DNA Multi-Sample Ultra KitPrepare a DNA stock solution for OpenArraytrade experiments 3


Prepare and run OpenArraytrade PGxSNP genotyping experiments

Workflow 43


Recommended Run OpenArraytrade SNP genotyping experiments in real‑time mode 44

Generate 384‑well sample plate layouts in the OpenArraytrade SampleTracker Software 46


Set up the PCR reactions in an OpenArraytrade 384‑well Sample Plate 48





One‑time procedures 53


This chapter contains brief procedures For detailed procedures refer to

Title Pub No

QuantStudiotrade 12K Flex Real-Time PCR SystemOpenArraytrade Experiments User Guide

4470935

OpenArraytrade Sample Tracker Software Quick Reference 4460657

OpenArraytrade AccuFilltrade System User Guide 4456986

OpenArraytrade SNP Genotyping Experiments MAN0014351

TaqManreg OpenArraytrade Genotyping Troubleshooting Guide MAN0011115

TaqManreg Genotyper Software Getting Started Guide 4448637

4


Workflow

ldquoGenerate 384-well sample plate layouts in the OpenArraytrade SampleTracker Softwareldquo on page 46

q

ldquoSet up the PCR reactions in an OpenArraytrade 384-well Sample Plateldquo onpage 48

q

ldquoSet up the AccuFilltrade instrumentldquo on page 47

q

ldquoTransfer reactions to the OpenArraytrade plate (AccuFilltrade instrument)ldquo onpage 49

q

ldquoSeal the OpenArraytrade plateldquo on page 50

q

ldquoRun the OpenArraytrade plate(s) on the QuantStudiotrade 12K Flexinstrumentldquo on page 51

q

ldquoCheck the QC Imagesldquo on page 52

Materials required OpenArraytrade plate workflow


Item Source

Genomic DNA 50 ngmicroL From Chapter 3 ldquoIsolate DNA using the MagMAXtrade DNAMulti-Sample Ultra Kitldquo

OpenArraytrade 384-well Sample Plate 4482221

OpenArraytrade plates with PGx assays Custom ordered

TaqManreg OpenArraytrade Genotyping Master Mix 4404846

Biomek Seal and Sample Foil Lids (for pre‑plating step) Beckman Coulter 538619

OpenArraytrade AccuFilltrade System Tips 4458107

QuantStudiotrade 12K Flex OpenArraytrade Accessories Kit(contains the items needed to assemble up to 10 plates12 lids and plugs 12 immersion fluid syringes and2 carriers)

4469576

OpenArraytrade Sample Tracker Software Download from thermofishercom

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsWorkflow 4


Item Source

QuantStudiotrade 12K Flex OpenArraytrade Plate Press 20 A24945

QuantStudiotrade 12K Flex instrument with OpenArraytrade

block (AccuFilltrade System)Contact your local customer service representative

Recommended Run OpenArraytrade SNP genotyping experiments inreal-time mode

We recommend running all OpenArraytrade plates on a QuantStudiotrade instrument in real‑time experiment mode This recommendation allows observation of genotyping dataover time to evaluate the accuracy of genotype calls by observing the location of agiven sample relative to others throughout all cycles

The following example shows how calls based on end‑point reads could be incorrectwhen the DNA concentration is higher than the recommended amount

Note Generally a CT value of ~25 indicates that the sample input is approximately250 haploid copies which is the recommended input amount per 33‑nL reaction forOpenArraytrade genotyping plates This corresponds to 825 pg of DNA per PCR reactionusing a stock solution of 50 ngmicroL

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsRecommended Run OpenArraytrade SNP genotyping experiments in real-time mode4


The default run type for genotyping experiments is real‑time mode indicated by theselection of Include Amplification in the Setup OpenArray Run window The defaultsettings also include the selection of Include Pre-read this setting is stronglyrecommended to correct for background fluorescence on the plate

For additional information about genotyping experiments see the QuantStudiotrade 12KFlex Real-Time PCR System OpenArraytrade Experiments User Guide (Pub No 4470935)

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsRecommended Run OpenArraytrade SNP genotyping experiments in real-time mode 4


Generate 384-well sample plate layouts in the OpenArraytrade SampleTracker Software

The software maps samples from the 96‑well layout used for DNA isolation to a384‑well sample plate layout as csv files that are used by OpenArraytrade AccuFilltrade

software

See ldquoOne‑time proceduresldquo on page 53 tobull Set up optimized folder locations and software preferences before performing

this procedure for the first timebull Download the spf file(s) for the OpenArraytrade plate(s) before starting

1 Generate the 96‑well sample plate csv file using the OA_Genotyping_CalcSheetor 96‑Well Sample Plate 1csv template then save it to the Sample Tracker 96‑wellInput folderThe 96‑Well Sample Plate 1csv file is provided in the AccuFilltrade softwareinstallation Enter or copy the sample names in 96‑Well Sample Plate 1csv thenSave as a new csv‑format fileThe OA_Genotyping_CalcSheet automatically generates the sample csv file

2 In the Sample Tracker Software Properties screen select Genotyping forExperiment Type then select the appropriate settings for OpenArraytrade Plate andPipettor

3 In the Samples screen click Import then select and import the sample csvfile

4 In the Sample Mapping screen confirm that the samples for a singleOpenArraytrade plate are assigned to one colorIf necessary correct the OpenArraytrade Plate and Pipettor settings in the Propertiesscreen

5 In the Sample Mapping screen click the 384-Well Plate tab then clickExport4Export csv

6 Select 384-Well Plate (for AccuFill) then save the exported file

Plate layouts for the 384‑well sample plates are saved to individual csv files in theSample Tracker 384‑well CSV Files folder

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsGenerate 384-well sample plate layouts in the OpenArraytrade Sample Tracker Software4


Set up the AccuFilltrade instrument

IMPORTANT Before proceeding check the tip expiration date (shown on the outerbox that contains the trays of tips) Do not use tips that exceed the expiration date

1 In the OpenArraytrade AccuFilltrade software click Setup and Load

2 In the Setup Load Information window verify that the Use Sample Integrationcheckbox is selected

3 Click Browse to the right of Sample Plate then select the 384‑well sample platecsv file that was generated with the OpenArraytrade Sample Tracker Software

4 Click Browse to the right of the plate holder position corresponding to theOpenArraytrade of interest then select the spf file corresponding to the desiredOpenArraytrade plate

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsSet up the AccuFilltrade instrument 4


5 Click the corresponding 4 times 12 area of the 384‑well plate then click Next to openthe Setup Deck window

6 Ensure thatbull Tip boxes are loaded in the AccuFilltrade instrument in the displayedconfiguration

bull Lids are removed from the tip boxesbull The waste bin in the instrument is emptied

7 In the Setup Deck window selectbull The tips are configured as shown abovebull The Waste Bin is empty

Set up the PCR reactions in an OpenArraytrade 384-well Sample Plate

For best results dilute DNA samples to 50 ngmicroL before setting up the PCR reactions

IMPORTANT The 4 times 12 area(s) of the 384‑well plate being filled must match thearea(s) designated in the OpenArraytrade Sample Tracker Software for that set ofsamples

1 Remove the OpenArraytrade plate from the freezer allow it to come to roomtemperature in its unopened sleeve (~15 minutes)The OpenArraytrade plate must be completely thawed before transferring reactionsto it from the 384‑well sample plate

2 Mix the 2X Master Mix gently Do not invert the bottle

3 Vortex the Assay Working Stock then centrifuge briefly

4 Following the plate layout designated in the OpenArraytrade Sample TrackerSoftware add master mix then UltraPuretrade DNaseRNase‑Free Distilled Water(NTCs) or DNA samples to an OpenArraytrade 384‑well Sample Plate

Note Include 2 NTCs on each plate

ComponentOpenArraytrade Genotyping Plate Format

16 32 64 +

TaqManreg OpenArraytrade

Genotyping Master Mix 15 microL 20 microL 25 microL

One of the following

bull UltraPuretrade DNaseRNase-Free Distilled Water (NTCs)

bull DNA sample

15 microL 20 microL 25 microL

Total reaction volume 30 microL 40 microL 50 microL

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsSet up the PCR reactions in an OpenArraytrade 384-well Sample Plate4


5 Seal the plate with an aluminum foil seal remove the foil flap mark the edges ofthe filled 4 times 12 area with a pen then score the foil along those linesDo not remove the foil from the scored area at this time

6 Centrifuge the plate at 1000 rpm for 1 minute

If you make a sample layout errorbull Before the AccuFilltrade procedure ndash Repeat ldquoGenerate 384‑well sample plate layouts

in the OpenArraytrade Sample Tracker Softwareldquo on page 46 with a correctedsamplecsv file

bull After the AccuFilltrade procedure ndash See ldquoRecover from layout errors in the 384‑wellsample plateldquo on page 80

Transfer reactions to the OpenArraytrade plate (AccuFilltrade instrument)

Ensure that the OpenArraytrade plate is thoroughly thawed before starting thisprocedure

1 Prepare the items needed to seal the OpenArraytrade plate (next section)

Note The OpenArraytrade plate must be sealed promptly after being loaded withthe reactions (this section)

a Ensure that the QuantStudiotrade 12K Flex OpenArraytrade Plate Press 20 is ready

b Gather and remove from packaging an OpenArraytrade lid plug syringe withOpenArraytrade Immersion Fluid and syringe tip

c Attach the syringe tip to the syringe and carefully push some of the fluidthrough the tip to remove air bubbles then lay the syringe aside

2 Remove the OpenArraytrade plate from its sleeve and place it in the plate holder ofthe AccuFilltrade instrumentEnsure that the bar code on the OpenArraytrade plate is facing left and the serialnumber is facing right

3 Using forceps peel the foil from the filled area of the OpenArraytrade 384‑wellSample Plate

4 Close the instrument door

5 In the AccuFilltrade software Setup Deck window select the followingconfirmations then click Load

bull The OpenArray Plate is in the Plate Holderbull Remove foil from the highlighted section of the Sample Plate

6 As soon as the Remove OpenArray Plate window appears open the instrumentdoor then remove the loaded OpenArraytrade plate

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsTransfer reactions to the OpenArraytrade plate (AccuFilltrade instrument) 4


7 Proceed immediately to seal the OpenArraytrade plate (next section)

Note For best results seal the OpenArraytrade plate within 90 seconds ofcompletion of loading to prevent evaporation

Seal the OpenArraytrade plate

IMPORTANT Handle the OpenArraytrade plate and case only by the edges throughoutthis procedure

1 Place the filled OpenArraytrade plate in the QuantStudiotrade 12K Flex OpenArraytrade

Plate Press 20Ensure that the bar code is facing left and the serial number is facing right

2 Remove the clear plastic sheets from the top and the bottom of the lid removethe red protective film around the edge of the OpenArraytrade lid then seat the lidon the OpenArraytrade case in the plate press

4

2

3

1

1 Protective film (remove)2 Adhesive3 Protective film (remove)4 Notched end (align with serial number)

3 Engage the press mechanism until the green flashing light changes to a steadygreen light (~20 seconds)

4 Disengage the press then remove the OpenArraytrade case

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsSeal the OpenArraytrade plate4


5 While holding the OpenArraytrade case by the edges insert the prepared syringe tipinto the port in the case then carefully inject immersion fluid until the case isfilled

Note Minimize creation of air bubbles when you dispense the fluid one smallair bubble in the case is acceptable

The syringe tip must be in front of the array when filling the case with immersion fluid

6 While holding the case vertically remove the syringe tip insert the screw end ofthe OpenArraytrade plug into the port and rotate clockwise until the black handlebreaks off

IMPORTANT To avoid leaking of immersion fluid hold the case vertically androtate the plug slowly

7 Clean the case with a laboratory wipe that has been thoroughly sprayed withethanol then dry the case with a clean laboratory wipe

Run the OpenArraytrade plate(s) on the QuantStudiotrade 12K Flexinstrument

1 On the instrument touchscreen touch to extend the loading arm and placethe OpenArraytrade plates on the plate adapterEnsure that the plate barcode and serial number are facing the front of theinstrument

2 Touch to retract the loading arm

3 In the Home screen of the QuantStudiotrade 12K Flex Software selectRun4OpenArray

4 In the Select Instrument pane select your QuantStudiotrade instrument

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsRun the OpenArraytrade plate(s) on the QuantStudiotrade 12K Flex instrument 4


5 Click Get Plate IDs to import the barcode(s) of the OpenArraytrade plate(s)Once the OpenArraytrade serial numbers appear the loaded spf filescorresponding to each plate should appear in the Setup File fieldIf not click Browse then select the correct loaded spf file from the Loaded SPFfolder

6 (Optional) Click Browse to change the QuantStudiotrade Experiment File Location

7 (Optional) Change the software‑determined Experiment File Name

8 Click Start Run

Note The instrument pauses at 41 or 42 seconds prior to the end of the run Waitfor the system to complete the run before opening the eds file

9 Transfer the eds file from the instrument to an accessible location for analysis inTaqManreg Genotyper Software

Check the QC Images

Check the QC images before analysis in TaqManreg Genotyper Software For additionalinformation see TaqManreg OpenArraytrade Genotyping Troubleshooting Guide(Pub No MAN0011115)

1 In the QuantStudiotrade 12K Flex Software Export screena Click Browse to create a uniquely‑named folder for the QC images export

b Click Export QC Images (bottom of screen)

IMPORTANT Create a new folder for images each time exporting a second runto the same folder overwrites the images

2 View the following ROXtrade image to check for loading quality issuesbull POST‐READ_CHANNEL_4tiff

3 Check for leaks or other displaced sample issuesa View the following spotfinding images

bull s03_c001_t03_p0001_m2_x3_e1_cp_spotfindtiffbull s04_c001_t02_p0001_m2_x3_e1_cp_spotfindtiff

Note The ldquocprdquo in the image file name refers to the array position (1ndash4)within the instrument

b If a problem is found view the following pre‑run spotfinding image todetermine if the issue existed even before cycling (this is useful fortroubleshooting)

bull s00_c001_t01_p0001_m2_x3_e1_cp_spotfindtiff

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsCheck the QC Images4


4 View the following FAMtrade and VICtrade images to check for any fluorescentabnormalities and to confirm any problem seen in the spotfinding images

bull STAGE4_CYCLE1_CHANNEL_1tiffbull STAGE4_CYCLE1_CHANNEL_2tiff

5 Note any abnormalities found as well as all other potentially relevantinformation related to the setup of the run

One-time procedures

This procedure simplifies the file locations used in the OpenArraytrade AccuFilltrade

instrument software

Set up the default file locations and preferences before using the OpenArraytrade

AccuFilltrade system for the first time You must be logged in as an administrator

1 Create the following four folders in a convenient location on the same computerdrive as the AccuFilltrade software

bull SPF Filesbull Sample Tracker 96‑well Inputbull Sample Tracker 384‑well CSV Filesbull Loaded SPF Files

2 (Optional not required if using the OA_Genotyping_CalcSheet) Navigate toltdrivegtProgram files(x86)AppliedBiosystemsOpenArraySample TrackerExamples copy the 96‑Well Sample Plate 1csv file thenpaste it in the Sample Tracker 96‑well Input folder

3 In OpenArraytrade Sample Tracker Software select View4Preferences then enterthe following preferences

Field Selection

Experiment type Genotyping

OpenArraytrade Plate Select the OpenArraytrade format that will be run mostoften for example Genotyping ndash 64

Pipettor Fixed or Adjustable

Import Data Directory Sample Tracker 96-well Input folder

Export Data Directory Sample Tracker 384-well CSV Files folder

4 In the AccuFilltrade software select Instrument4Edit Preferences thena Select Require Sample Integration

Set up defaultfolders andsoftwarepreferences

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsOne-time procedures 4


b Select the indicated folders

For this AccuFilltrade

folder Select this folder Folder contents

OpenArraytrade PlateFile Input Folder

SPF Files spf files for yourOpenArraytrade plates containassay name and location

Sample Plate FileFolder

Sample Tracker 384-wellCSV Files

csv 384-well sample platelayout files

Loaded OpenArraytrade

Plate File FolderLoaded SPF Files Integrated spf files that

are generated duringprocessing with theAccuFilltrade software

5 In the QuantStudiotrade 12K Flex instrument software selectTools4Preferences4OpenArray then select the Loaded SPF Files folder for thesoftware Setup Folder

Note If the instrument software is not on same computer as the AccuFilltrade

software transfer the loaded spf files to the computer running the instrumentsoftware

Download SPF Files

Set up the optimized folder locations and software preferences before downloadingspf files See ldquoSet up default folders and software preferencesldquo on page 53

For custom OpenArraytrade plates you need the Lot and the Serial from the packagingof each OpenArraytrade plate

1 At wwwthermofishercomOA‐platefiles select TaqManreg OpenArraytrade CustomGene ExpressionGenotyping Plates in the Select Your Product dropdown list

2 Select a download option

bull I want to download all available SPF amp AIF filesbull I want to download a specific SPF file

3 Enter the Lot and the Serial then click Submit

Note The Serial is case‑sensitive

4 Save the spf files to the desktop SPF Files folder

Note Do not create sub‑folders in the SPF Files folder The software cannotaccess sub‑folders

Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experimentsDownload SPF Files4


Analyze OpenArraytrade PGx SNPgenotyping experiments

Before you begin analysis (each time) 56



Analyze data with TaqManreg Genotyper Software 58







Title Pub No


4470935






5


Before you begin analysis (each time)

1 In the Home screen of the QuantStudiotrade 12K Flex Software click InstrumentConsole

2 In the Instrument Console select the desired QuantStudiotrade 12K Flex Instrumentfrom the list of instruments on the network then click Add to My Instruments

3 After the QuantStudiotrade 12K Flex Instrument is added to your list select it thenclick Manage Instrument

4 In the Instrument Manager click Manage Files then click File Manager

5 In the File Manager screen transfer the file(s) from the QuantStudiotrade 12K FlexInstrument

a In the Folders field select the folder that contains the files that you want todownload

b In the Experiments field select the files to download To select multiple filesCtrl‑click or Shift‑click files in the list

c When you have selected the files that you want to download clickDownload

d In the Send experiment to instrument dialog box select the folder to whichyou want to download the selected file(s) then click Open

For more details on file transfers please refer to the networking chapter in theQuantStudiotrade 12K Flex Real-Time PCR System Maintenance and Administration Guide(Pub No 4470689)

Download and save files in one of the following ways

bull Connected computerndash Browse for the folder containing the runndash Select run names and download the file to storage media

bull Instrument onlyndash Insert a USB storage device into one of the USB ports in the front panelndash Use the touchscreen and press Collect Resultsndash Select run names and press Save to USB

Transfer files fromQuantStudiotrade 12KFlex Software witha networkconnection

Transfer files fromQuantStudiotrade 12KFlex Softwarewithout a networkconnection

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsBefore you begin analysis (each time)5


Analysis options for genotyping data

Analyze allelic discrimination plots for genotyping data using any of these tools

Software Features

QuantStudiotrade 12K Flexsoftware

bull Desktop software

bull View real-time trace data to aid genotype calling

Thermo Fisher CloudGenotyping Application

bull Cloud software

bull Create studies

bull Overlay data from multiple plates


TaqManreg GenotyperSoftware


bull Create studies


Analyze data in QuantStudiotrade 12K Flex or Thermo Fisher Cloudsoftware

For non‑standard assays review the data for both assays together to ensure accurategenotyping results

To use the QuantStudiotrade 12K Flex software or related instrument software

1 In the analysis settings select Analyze Real-Time Rn ndash Median (Rna to Rnb)This setting will normalize for any run and system noise to improve dataaccuracy

2 Select Analysis4 Allelic Discrimination Plot

To use the Thermo Fisher Cloud GT Analysis module

1 Go to thermofishercomcloud2 Create a project and import one or more OpenArraytrade experiment files (eds)3 Access the Genotyping (GT) application4 Analyze data

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis options for genotyping data 5


Analyze data with TaqManreg Genotyper Software

Create a study template

If using a reference panel generate the reference panel before creating the studytemplate so that the reference panel can be imported into the template

If necessary first download the Assay Information File (AIF) from httpwwwthermofishercomOA‐platefiles

1 In the TaqManreg Genotyper Software Home screen click Create Study

2 In the Workflow Menu pane select Setup4Properties then enter the studyproperties

bull For Instrument Type select QuantStudiotrade 12K Flex Real-Time PCRSystem

bull For Experiment Type select Real-time

3 In the Workflow Menu pane select Setup4Assays

4 Click Import then select and import the Assay Information File (AIF)

5 (Optional) Import the reference panela In the Workflow Menu pane select Setup4References

b Click Import then select and import the reference panel file of interest

6 Select File4Generate Template enter a template name (edt) then save thetemplate in the desired location

(Optional) Generate a reference panel

A reference panel consists of high‑quality data for all the assays in the study The datacan be chosen from multiple OpenArraytrade plates

For best results generate a new reference panel for each lot of OpenArraytrade plates

If necessary first create a study containing data that will be used as reference samplesFor the study properties options set QuantStudiotrade 12K Flex Real-Time PCR Systemfor Instrument Type and Real-time for Experiment Type

1 In the TaqManreg Genotyper Software open the study that contains data points tobe used as reference samples

2 In the Workflow Menu pane select Analysis4Results

3 Click‑drag in the scatter plot to select one or more data pointsSelect data points for each homozygous genotype (FAMtrade dye‑labeled or VICtrade

dye‑labeled) and the heterozygous genotypeThe non‑selected data points will fade

4 Right‑click in the scatter plot then select Tag for Ref Panel

5 Repeat the selection and tag steps for additional data points

Before you beginTaqManreg

GenotyperSoftware analysis

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalyze data with TaqManreg Genotyper Software5


6 Confirm that the correct samples have been tagged as reference samples in theResults tableIn the Results tab Reference Sample must be selected in the View dropdownlist to view the tags

7 Repeat the data point selection tagging and confirmation steps for each SNPassay of interest

8 Select File4Save

9 Select File4Generate Reference Panel enter a name for the panel then save thefile (lap) to the desired location

(Optional) Add samples to an existing reference panel

During analysis in TaqManreg Genotyper Software you can add samples to an existingreference panel

The reference panel must already be imported into the study containing samples thatwill be added to the reference panel

1 In the scatter plot of the study select data points for the samples of interest right‑click in the plot then select Tag for Ref Panel

2 Select File4Save


1 In TaqManreg Genotyper Software click Create Study from Template then selectand open the desired template (lat)

Note If you have not created a template see ldquoCreate a study templateldquo onpage 58

2 In the Workflow Menu pane select Setup4Experiments

3 Click Import then select and import one or more OpenArraytrade experiment files(eds)

4 Click Analyze

5 Inspect the call data for the SNP assay in the scatter plotRefer to the TaqManreg Genotyper Software Getting Started Guide (Pub No 4448637)for detailed instructions

6 (Optional) To manually assign the genotype select the sample(s) right‑click thenselect the genotype

7 Select Inspected next to the assay then click Save

8 Repeat the inspection for each SNP assay

9 In the Workflow Menu pane select Export4Analysis Data

Analyze results inTaqManreg

GenotyperSoftware

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalyze data with TaqManreg Genotyper Software 5


10 In the Export Study Properties panea Select Analysis Results4Advanced

b Select One File

c Enter the filename and location and select (txt)

11 Click Export preview then click Start Export in the new window

Select the appropriate tab to review call rates and other QC parameters in TaqManreg

Genotyper Software

To Do this

Review samplecall rates and QCdata

1 Select Analysis4Quality Control

2 Select the Samples tab to review the sample call rates andother QC parameters Samples with low call rates are anindication of poor sample quality or concentration and it isadvisable to omit those samples from the study

3 (Optional)To omit samples with poor quality or concentrationright click the sample name select Omit from the dropdownmenu then reanalyze the data

Review plate callrates and QC data


2 Review call rates and QC data in the Experiments tab

Review assay callrates and QC data


2 Review call rates and QC data in the Assay tab

For detailed instructions see the TaqManreg Genotyper Software Getting Started Guide(Pub No 4448637)

Analysis guidelines sex chromosome targets

In most cases Use Hardy-Weinberg for Analysis is selected X and Y chromosome‐specific SNP targets do not follow a Hardy‑Weinberg distribution

To improve the accuracy of genotype calls for SNP targets on the X and Ychromosomes

bull Deselect Use Hardy-Weinberg for Analysisbull Select Disallow in Males from the Heterozygote drop‑down list

Note If you select Disallow in Males for other types of targets the genotype callaccuracy may be negatively impacted

SNP targets located in the PAR region of the X and Y chromosomes behave likeautosomal SNP targets and males can be heterozygotes The gender assay(C_990000001_10) target Xndash and Yndash chromosome specific sequences in the amelogeningene males run as heterozygotes and females run as VICtrade homozygotes Do notselect Disallow in Males with these assay types

Review call ratesand other QCparameters

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis guidelines sex chromosome targets5


Analysis guidelines DME genotyping assays for genes in copynumber variation regions

Some TaqManreg DME Assays target polymorphisms in genes that exhibit copy numbervariation including CYP2D6 CYP2A6 CYP2E1 GSTM1 GSTT1 and SULT1A1 Copynumber variation analysis must be done in addition to genotyping with DME assaysThe frequency of the CYP2D6 CYP2A6 CYP2E1 and SULT1A1 gene deletions arelow and samples that carry no copies of these genes will be rare However thefrequency of deletion of GSTM1 and GSTT1 genes is very high in a number ofpopulations and complete absence of these genes in individuals is common

For a given DME assay that targets a gene that can be deleted or duplicated thefollowing genotyping results are possible

bull If both copies of a gene are deleted in a sample (copy number of 0) samples willnot be amplified and will run with NTCs If a sample running near the NTCs hasbeen called as undetermined that call can be manually adjusted to PrimenoampPrime

bull If a sample contains 1 2 or more than 2 copies of the gene and only one SNPallele is present the samples will cluster together in a homozygous alleleClusters will sometimes show some splitting samples containing less target canrun closer to the NTCs than those containing more copies of the target

bull If a sample carries more than 2 copies of a gene and both SNP alleles are presentit will fall within the heterozygous cluster or off to one side or the other of thecluster (that is the heterozygous cluster may exhibit some spreading) If a sampleclose to the heterozygous cluster has been called as undetermined manuallyadjust the call to heterozygous

Analysis guidelines SNP genotyping assays for triallelic SNPs

Triallelic SNPs are interrogated using two TaqManreg assaysExample

bull Assay 1 Major SNP allele (labeled with VICtrade dye) and first minor allele (labeledwith FAMtrade dye)

bull Assay 2 Major SNP allele (labeled with VICtrade dye) and second minor allele(labeled with FAMtrade dye)

Expected results

bull Samples that are heterozygous for the detected SNP alleles will run asheterozygous with the assay designed to that mutant allele

bull Samples running in or near a homozygous cluster can be a true homozygote forthe reported allele or the sample can be a heterozygote for a reported allele andfor the unreported SNP allele of a given assay Samples with one reported allelein an assay can sometimes run together or close to those carrying two reportedhomozygous alleles If a sample close to a homozygous cluster is called asundetermined manually change the call to homozygous

bull Samples that are homozygous for the unreported SNP allele may cluster withNTCs or may exhibit weak amplification due to probe nonspecific activity If aweakly amplifying sample is called as undetermined manually adjust the call tonoamp

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis guidelines DME genotyping assays for genes in copy number variation regions 5


(Optional) Export the TaqManreg Genotyper Software results then import the files intoAlleleTypertrade Software for translation using a biallelic translation specific for thetriallelic SNP assay pair

Manually determining genotype

If AlleleTypertrade Software is not available use the table below to manually determinethe sample genotypes Note that the alleles reported by the ABCB1 SNP assays aregiven in the (+) strand genome orientation whereas the ABCB1 gene maps to the (minus)genome strand Thus the reported SNP assay alleles and the SNP cDNA annotationsare the reverse complement of one another

Table 15 Translation table for the ABCB1 c3095GgtTA triallelic SNP rs2032582assays

GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT

Figure 1 Triallelic SNP rs2032582 assay resultsLeft ABCB1 c3095GgtA assay (C_11711720D_40) to the plus strand C wild type and T mutant allele Right ABCB1 c3095GgtTassay ( C_11711720C_30 ) to the C wild type and A mutant allele

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis guidelines SNP genotyping assays for triallelic SNPs5


Analysis guidelines DME genotyping assays for adjacent SNPs

Pairs of assays are available for some adjacent SNP targets for which only threehaplotypes are noted For a given assay to one SNP allele

bull Samples that are heterozygous for the detected haplotypes will run asheterozygous with the assay designed to that haplotype

bull Samples running in or near a homozygous cluster can be a true homozygote forthe reported haplotype or the sample can be a heterozygote for a reportedhaplotype and an unreported haplotype of a given assay Samples having just onereported haplotype may run together with or close to those carrying tworeported homozygous haplotypes If a sample close to a homozygous cluster iscalled as undetermined manually change the call to homozygous

bull Samples that are homozygous for the unreported haplotype may cluster withNTCs or may exhibit weak amplification due to probe nonspecific activity If aweakly amplifying sample is called as undetermined manually adjust the call toPrimenoampPrime

Table 16 Translation table for the CYP2C19210 adjacent SNP assays

HaplotypeHaplotype Diplotypes[1] 2 assay 681 GA - 680C 10 assay 681G - 680 CT

mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC

G-TG-T 1010 noamp TT

GndashTAndashC 210 AA TT

AndashCAndashC 22 AA noamp

[1] Since the 2 and 10 alleles have not been observed to occur on the same chromosome diplotypes containing A-T haplotypes are not included

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis guidelines DME genotyping assays for adjacent SNPs 5


2222

Figure 2 CYP2C192 and 10 assay OpenArraytrade resultsLeft rs4244285 CYP2C192 681GgtA assay ( C__ 25986767_70 ) to the G wild type and A mutant allele Right rs6413438CYP2C1910 c680CgtT assay (C__30634128_10) to the C wild type and T mutant allele Samples Coriell gDNAs NA17263 hasa 22 diplotype that cannot be detected by the 10 assay


HaplotypeHaplotype Diplotypes[1] 3 assay 1075 AC

-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC

[1] Since the 3 and 4 alleles have not been observed to occur on the same chromosome diplotypes containing A‑A haplotypes are not included

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsAnalysis guidelines DME genotyping assays for adjacent SNPs5


33 33

Figure 3 CYP2C93 and 4 assay OpenArraytrade resultsLeft rs1057910 CYP2C93 c1075AgtC assay (C__27104892_10) to the A wild type and C mutant allele Right rs56165452CYP2C94 c 1076TgtC assay (C__30634131_20) to the T wild type and C mutant allele Samples Coriell gDNAs NA17247 hasa 33 diplotype that cannot be detected by the 4 assay Note that the 3 heterozygous samples run in the lower portion ofthe split wild type FAM cluster in the 4 assay

Related documentation

Title Pub No



Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experimentsRelated documentation 5


Prepare run and analyze PGx copynumber experiments




Before you begin 68




Analyze results in CopyCallertrade Software 71



Title Pub No

TaqManreg Copy Number Assays Protocol 4397425

CYP2D6 Allele-specific Copy Number Analysis QuickReference

MAN0011114

CopyCallertrade Software v20 User Guide 4400042

6


Introduction to copy number analysis

Copy number variation must be assessed for DME genes that are known to exhibitcopy number variation For full details on running TaqManreg Copy Number Assayexperiments refer to the TaqManreg Copy Number Assays Protocol (Pub No 4397425)The protocol provides step‑by‑step instructions for performing and analyzing copynumber variation quantitation experiments using TaqManreg Copy Number Assays andTaqManreg Copy Number Reference Assays for the ViiAtrade 7 Real‑Time PCR System Thesame instructions apply for running experiments on the QuantStudiotrade 12K Flex Real‑Time PCR System

How TaqManreg Copy Number Assays work

TaqManreg Copy Number Assays are run simultaneously with a TaqManreg CopyNumber Reference Assay in a duplex real‑time PCR reaction The TaqManreg CopyNumber Assay detects the target gene or genomic sequence of interest and theTaqManreg Copy Number Reference Assay detects a sequence that is known to exist intwo copies in a diploid genome (for example the human RNase P H1 RNA gene)

The number of copies of the target sequence in each test sample is determined byrelative quantification (RQ) using the comparative CT (ΔΔCt) method This methodmeasures the Ct difference (ΔCt) between target and reference sequences thencompares the ΔCt values of test samples to a calibrator sample(s) known to have twocopies of the target sequence The copy number of the target is calculated to be twotimes the relative quantity because the human genome is diploid

In a copy number quantification reaction purified genomic DNA is combined withbull The TaqManreg Copy Number Assay containing two primers and a FAMtrade

dye‑labeled MGB probe to detect the genomic DNA target sequencebull The TaqManreg Copy Number Reference Assay containing two primers and a

VICtrade dye‑labeled TAMRAtrade probe to detect the genomic DNA referencesequence

bull One of the following master mixesndash (Recommended) TaqPathtrade ProAmptrade Master Mixndash TaqManreg Genotyping Master Mix

Reactions are run on an Applied Biosystemstrade Real‑Time PCR System Afteramplification data files containing the sample replicate CT values for each reporterdye can be exported from the real‑time PCR instrument software and imported into asoftware analysis tool Applied Biosystemstrade CopyCallertrade Software is recommendedfor post‑PCR data analysis of copy number quantification experiments

Chapter 6 Prepare run and analyze PGx copy number experimentsIntroduction to copy number analysis 6


Procedural guidelines

bull Use 10 ng of high‑quality DNA per reactionbull Run quadruplicate reactions for each DNA sample The

OA_Genotyping_CalcSheet assumes quadruplicate reactions in 384‑well platesbull For quality metrics calculations each plate should contain enough samples such

that there will be at least 7 samples with the same copy numberbull Include a no template control (NTC) reaction in each plate In place of the DNA

sample use the same diluent used to dilute the DNAbull Include one or more samples of known copy number as controls (reference or

calibrator sample)

Before you begin

bull Normalize the DNA samples dilute each DNA sample to 5 ngmicroL in nuclease‑free water or 1X TE buffer in a total of 10 microLUse the OA_Genotyping_CalcSheet to calculate the dilutions based on theconcentration determined from the RNase P assay

bull Generate the CNV Sample txt file from the OA_Genotyping_CalcSheet

Set up PCR reactions

1 Prepare the reagentsa Completely thaw the assays gently vortex then briefly centrifuge to bring

the contents to the bottom of the tube

b (Large-scale copy number assays (60X) only) Dilute the assay 13 (finalconcentration 20X) with 1X TE pH 80For example combine 10 microL of 60X assay with 20 microL of TE

c Swirl the master mix to mix contents thoroughly

Chapter 6 Prepare run and analyze PGx copy number experimentsProcedural guidelines6


2 Prepare the reaction mix combine the following components invert or flick thetube to mix then centrifuge briefly to bring the contents to the bottom of tube

a Combine the components according to the table

Note We recommend using four replicates of each sample

Component Volume per 10-microLreaction[1]

TaqPathtrade ProAmptrade Master Mix[2] 50 microL

TaqManreg Copy Number Assay (20X) 05 microL

TaqManreg Copy Number Reference Assay (20X) 05 microL

Nuclease-free water 20 microL

Total volume 80 microL

[1] Use the OA_Genotyping_CalcSheet to calculate volumes for multiple reactions[2] TaqManreg Genotyping Master Mix (2X) can also be used

b Invert or flick the tube to mix then centrifuge briefly

3 Transfer 8 microL of the reaction mix to the sample and control wells of a 384‑wellreaction plate

4 Vortex the normalized gDNA samples (5 ngmicroL) add 2 microL of each sample orcontrol to the appropriate wells of the plate then mix by pipetting up and downseveral times

5 Briefly centrifuge the plate to ensure the reaction mixes are at the bottom of eachwell and to minimize air bubbles

6 Seal the plate with MicroAmptrade Optical Adhesive Film ensuring that all 4 edgeshave a tight seal

Run the reactions

1 Create an experiment in the instrument software with these properties

Property Setting

Experiment type Standard Curve

Reagents TaqManreg Reagents

Run speed Standard

2 In the Define screen enter the Target name then select the appropriate Reporterand Quencher for the target

Assay Reporter Quencher

TaqManreg Copy NumberAssay

FAMtrade MGB-NFQ

TaqManreg Copy NumberReference Assay

VICtrade TAMRAtrade

Chapter 6 Prepare run and analyze PGx copy number experimentsRun the reactions 6


3 In the Assign screenbull Import the CNV Sample txt file generated from the

OA_Genotyping_CalcSheet or manually assign sample names to theappropriate wells

bull Assign both assays to each well

4 In the Run Method screenbull Set the reaction volume to 10 microLbull Confirm the following thermal cycling parameters

Stage Step Temperature Time

Hold Step 1 95degC 10 min

PCR(40 cycles)

Step 1 95degC 15 sec


5 Save the experiment load the sealed plate into the instrument then start the run

Analyze the run in the instrument software and export the results

1 In the Analysis tab of the experiment click Analyze

2 In the Amplification Plot for each target deselect Auto Threshold then set theCt threshold to 02 Alternatively use 01 as needed to ensure that the threshold isin the middle of the log phaseKeep Auto Baseline selected

3 Click Analyze then save the experiment

Chapter 6 Prepare run and analyze PGx copy number experimentsAnalyze the run in the instrument software and export the results6


4 In the Export screen ensure that the only Results is selected

5 Select a location and file name select txt in the File Type dropdown list thenclick Start Export

Analyze results in CopyCallertrade Software

The recommended settings in CopyCallertrade Software are described See ldquoCopyCallertrade

Software analysis optionsldquo on page 71 for other analysis options

1 In the software select File4Import select the file that was exported from theinstrument software then click Open

2 In the Assay Selection Table click row(s) to select one or more assays then click (Analysis Settings)

3 In the Analysis Settings windowbull Select With calibrator samplebull For Calibrator Sample select Median Ct

bull For Calibrator sample copy number enter 2

Note Enter 1 for GSTT1 and GSTM1 assays

4 Click ApplyThe data are analyzed using the selected analysis settings

Analysis method Description How to select

RecommendedMedian Ct

Copy number results are basedon the copy number of thesample with the median Ct ormedian Ct value This methodworks well when most sampleshave the same copy number

1 Select With CalibratorSample

2 In the Calibrator SampleName drop‐down listselect Median Ct

Most frequent copynumber

Copy number results are basedon the assumption that mostsamples have the same copynumber

1 Select Without CalibratorSample

2 In the Most FrequentSample Copy Numberfield enter the expectedvalue (Usually 2 Enter 1for GSTM1 amp GSTT1)

CopyCallertrade

Software analysisoptions

Chapter 6 Prepare run and analyze PGx copy number experimentsAnalyze results in CopyCallertrade Software 6



Calibrator Copy number results are basedon the copy number designatedfor one calibrator sample

Include a calibrator sample oneach plate

IMPORTANT The calibratorshould be of the same sampletype as the test samples


2 In the Calibrator SampleName drop‐down listselect or enter a sampleto use as the calibrator

3 (Optional) ChangeCalibrator Sample CopyNumber (default = 2)

Review the copy number analysis data

1 In the Assay Selection Table select the checkbox to the left of the analyzed assayto display the copy number analysis data

2 Review the copy number analysis data to confirm that it meets the followingcriteria

Criteria Viewing tool

Samples have comparable VICtrade Ct values Well and Results tables

Standard deviation is low for replicates (lt015) Results table

Calculated copy number values are close to integervalues

Results table and CopyNumber Plot

Confidence and |Z-score| values are acceptable for thepredicted copy number calls

Results table

Copy number of control samples is as expected Results table and CopyNumber Plot

Copy number variation frequency is within the expectedrange


Samples cluster into well-defined well-separated copynumber groups

ΔCt plot

3 Review the quality metricsFor sample copy number callshaving confidence values sup395consider passing or failing the callbased on the |Z‑score| value asshown in the table |Z‑score| is onlyevaluated for high confidence samplesPassing the default 95 confidence threshold and |Z‑score| of lt175 is veryachievable for good quality samples having 1ndash3 copies and is more difficult toachieve for lower quality samples carrying duplications or for higher copysamples

|Z-score| Status

lt 175 Pass

265 gt z sup3 175 Pass with caution

sup3 265 Fail

Chapter 6 Prepare run and analyze PGx copy number experimentsReview the copy number analysis data6


Consider passing samples with calls of sup33 copies that fall below the 95confidence level if

bull The calculated copy numbers are close to integer values andbull The samples cluster with passing samples of the same copy number group

in the ΔCt plot

Chapter 6 Prepare run and analyze PGx copy number experimentsReview the copy number analysis data 6


Perform translation analysis inAlleleTypertrade Software




Introduction to AlleleTypertrade Software

AlleleTypertrade Software is an automated data analysis application that translatesgenetic pattern information from TaqManreg SNP Genotyping Assay andor TaqManreg

Copy Number Assay results to user‐defined genotype or diplotype nomenclature Forcomplete instructions on how to use AlleleTypertrade Software and to create user‐definedtranslation tables see the AlleleTypertrade Software User Guide (Pub No 4486002)

AlleleTypertrade Software is a flexible tool used for conversion of sample genotypeinformation for single or multiple genes or loci to the desired nomenclature forexample the PGx gene‑level star () allele nomenclature to describe SNP InDel orcopy number variant genotypes (for example for the Cytochrome P450 genes) Staralleles are haplotypes that can contain multiple variants these are associated withfunctional or nonfunctional gene products AlleleTypertrade Software can translate thegenotype results for special cases including triallelic or adjacent SNP interrogationusing two TaqManreg SNP Assays or the software can simply provide a name for aparticular genetic outcome for a given SNP or copy number assay

Before creating a translation table or translator consider all of the TaqManreg SNPGenotyping Assays (includes TaqManreg DME Genotyping Assays) and TaqManreg CopyNumber Assays that will be used in your project and which of these you want toinclude in a translation table for reporting sample genotype results using specificnomenclature SNP assay and copy number assay experiment data generated on anApplied Biosystemstrade real‑time PCR system must be analyzed by TaqManreg GenotyperSoftware and CopyCallertrade Software respectively because results files exported fromthese software systems are input files for AlleleTypertrade Software

AlleleTypertrade Software aids creation of translation tables by automatically convertingmonoallelic translation tables containing haplotype patterns to biallelic translatorscontaining diplotype or genotype patterns After examining biallelic translators forcompleteness and accuracy they are imported into AlleleTypertrade Software along withTaqManreg Genotyper Software data files andor CopyCallertrade Software data filesAlleleTypertrade Software then matches the sample genetic pattern data to patterns in thebiallelic translator and reports back the designated nomenclature for each matchingpattern on a gene‑by‑gene basis when a multigene translator is used

7


PGx translation tables

The translation tables provided by both Thermo Fisher Scientific and PharmGKB usethe convention whereby the variant alleles are provided in the (+) strand orientationof the reference genome Likewise TaqManreg SNP and DME Genotyping Assayscontext sequences are provided in the (+) genome strand orientation In contrast the allele nomenclature for many PGx genes does not follow this convention the variantalleles might map to the (ndash) strand of the reference genome and thus are given in thereverse complement orientation (for example CYP2D6 which maps to the (ndash) genomestrand)

For successful translation of sample genotyping results by AlleleTypertrade Software thebase alleles used in the translation table must match the base alleles used in theTaqManreg Genotyper Software results files In addition the assay identifiers mustmatch between the translation table and the TaqManreg Genotyper Software andorCopyCallertrade Software results files

Sources of PGx translation information and example translationtables

Thermo Fisher Scientific provides example AlleleTypertrade Software translation tabletemplate files and translation tables (including monoallelic and biallelic tables singlegene and multigene translators) for commonly tested drug metabolism gene variantsThese files can be downloaded from the AlleleTypertrade Software web page at wwwthermofishercompgx and used as templates for creating translators specific toa TaqManreg Assays panel

The PharmGKB website (wwwpharmgkborg) provides comprehensive haplotypetranslation tables for CYP gene variants found in the Human Cytochrome P450 (CYP)Allele Nomenclature Database (wwwcypalleleskise) as well as for other drugmetabolism gene variants These tables can be used as reference tables for creatingAlleleTypertrade Software translation tables

Chapter 7 Perform translation analysis in AlleleTypertrade SoftwarePGx translation tables 7


Troubleshooting


Troubleshoot with cycling and imaging run images

Many problems with OpenArraytrade results can be diagnosed by examining the qualitycontrol (QC) images taken at various points during a cyclingimaging run

The QC images are fluorescent or reflected light images taken before during andafter cycling They may require adjustment to make image features visible To viewthe images we recommend that you install the free software program ImageJ whichallows you to easily manipulate the images in ways that other image viewers cannot

1 In the QuantStudiotrade 12K Flex Software Export screena Click Browse to select a uniquely‑named folder for the QC images export


IMPORTANT Select a new folder for images each time exporting a second runto the same folder overwrites the images

2 Use ImageJ to view the images of interest

To View image Image description

Confirm the identity ofimages within a folder

BARCODE IMAGEtiff Reflected light image of the entireOpenArraytrade plate

Evaluate the loadingquality

PRE-READ_CHANNEL_4tiffPOST-READ_CHANNEL_4tiff

Pre- and post-ROXtrade images

Check for existingcontamination on thecase andor heatedcover

s00_c001_t01_p0001_m2_x3_e1_cp_spotfindtiff[1] Pre-run reflected light spotfindingimage (used by the software todetermine the location of the holes)

Identify potential leaksor other contamination

s03_c001_t03_p0001_m2_x3_e1_cp_spotfindtiff[1] Mid-run reflected light spotfindingimage

A




s04_c001_t02_p0001_m2_x3_e1_cp_spotfindtiff[1] Post-run reflected light spotfindingimage

Look at patterns in thefluorescent data (forexample gradients)

STAGEx_CYCLEy_CHANNEL_ztiff FAMtrade (z=1) or VICtrade (z=2) images at aparticular cycle (y) of a particularstage (x) of the run

[1] The ldquocprdquo in the image file name refers to the array position (1ndash4) within the QuantStudiotrade 12K Flex instrument

3 (Optional) Adjust the images for brightness andor contrast to make imagefeatures visible

a Open the image in ImageJ

b Select Image4Adjust BrightnessContrast (or press Ctrl+Shift+C)

c Click Auto or adjust the sliders until the features of interest in the image arevisible

AccuFilltrade instrument plate loading errors

Observation Possible cause Recommended action

There are empty through-holes Insufficient sample wasadded to the 384-well sampleplate

Use proper pipettingtechniques Ensure that thereare no air bubbles in thepipette tips after sampleaspiration

Reaction mix (sample +master mix) is not at thebottom of the 384-wellsample plate

Centrifuge the sample plateat 1000 rpm for 60 seconds

Appendix A TroubleshootingAccuFilltrade instrument plate loading errors A



Turn-holes are repeatedly missed AccuFilltrade instrument isaligned too far to the left or tothe right

Systematic loading problemscan occur with the AccuFilltrade

instrument which indicates aneed for service For examplewhen turn-holes arerepeatedly missed acrossmultiple subarrays service isrequired Turn‑holes arewhere the AccuFilltrade

instrument changes directionduring sample loading

Start pointsStop points

Turn holes

Contact your local fieldservice engineer

Entire subarrays are missing The samplemaster mix notadded to particular wells inthe 384-well sample plate

Visually inspect the sampleplate to ensure that the wellshave samplemaster mix

Stuck tip mandrel onAccuFilltrade instrument mayneed cleaning


Pipette tip not loaded onmandrel

Contact your local fieldservice engineer for frequentoccurrences (infrequentoccurrences can be due to apoorly molded tip)

Appendix A TroubleshootingAccuFilltrade instrument plate loading errorsA


OpenArraytrade plate assembly and handling errors


Case leaks and bubbles inside the case

Improper sealing of theOpenArraytrade plate in theOpenArraytrade Case can lead to immersion fluidleaks or bubble formation inside the case leadingto uneven heating and imaging throughout PCRand to poor quality genotyping data

The images above are examples of OpenArraytrade

plates that have been affected by immersion fluidleaks The images show where leaked fluid hascondensed on the underside of the heated coverwindows and obscured the view of the through‐holes

The best image in which to detect leaks is thes03_c001_t03_p0001_m2_x3_e1_cp_spotfindtiffimage This image is taken at the start of cyclingwhich is where most leaks occur See ldquoTroubleshoot with cycling and imaging runimagesldquo on page 76

Plate press was not engagedfor at least 20 seconds

Fully engage the plate pressfor at least 20 seconds

Damaged lid adhesive Remove the liner and visuallyinspect the lid adhesives fordefects Ensure that adhesiveis not damaged or warped

Damaged fill port screwgasket

Visually inspect the screw toensure that the orange gasketis present and not damaged

Damaged fill port screwassembly Breaks off tooeasily

The screw may be mis-threaded Unscrew it and usea new screw assembly

Oily lid or case fromimmersion fluid overflow

Wipe off excess overflow ofimmersion fluid from the lidcase bottom and creviceswith 70 isopropyl alcoholusing a lint-free cloth (thecloth included with theOpenArraytrade plate isacceptable)

Immersion fluid exposed toair for too long

Do not remove the immersionfluid syringe cap or draw airbubbles into the syringe untilyou are ready to load Do notdraw air bubbles into thesyringe

Too large of a bubble insidethe OpenArraytrade case aftersealing

Minimize the size of thebubble by tilting theOpenArraytrade case so that thefill port is at the highest pointSlowly fill the case withimmersion fluid until only asmall air bubble remainsAttach the screw and wipe offany excess oil that may havespilled onto the case

Damaged plate press leadingto uneven pressure

Contact your field serviceengineer if you suspect thatyour plate press may bedamaged

Appendix A TroubleshootingOpenArraytrade plate assembly and handling errors A



Sample blow out during the addition of immersionfluid

The reactions in A12 werecompromised during theaddition of immersion fluidInjecting the immersion fluidtoo quickly can actually purgethe sample out of thethrough-holes near the fillport Often this is caused bythe user not purging thesyringe slightly before use

Dispense a small amount ofimmersion fluid onto a papertowel before use to ensuresmooth operation of thesyringe

Evaporation of reaction mixture in through-holes Too much time elapsed beforeplate was sealed with lid andimmersion fluid In thisexample the top half of eachsubarray was intentionally leftopen to the environment todemonstrate the effect ofevaporation ldquoDonutsrdquo are aresult of the evaporated fluidin the though-holes

Add immersion fluid as soonas the case is removed fromthe plate press to minimizethe likelihood of evaporationthen seal the case with thelid

Recover from layout errors in the 384-well sample plate

After the AccuFilltrade procedure you can recover from plate layout errors that weremade during setup of the reactions in the 384‑well sample plate See the OpenArraytrade

Sample Tracker Software Quick Reference (Pub No 4460657) for additional information

1 Create a corrected sample csv file

2 Repeat ldquoGenerate 384‑well sample plate layouts in the OpenArraytrade SampleTracker Softwareldquo on page 46 but select OpenArray Plate X (for QuantStudio)when exporting from the OpenArraytrade Sample Tracker Software

3 Import the corrected csv file into the QuantStudiotrade 12K Flex Software

Note You can import either before starting the run or after the run is complete

Appendix A TroubleshootingRecover from layout errors in the 384-well sample plateA


Troubleshooting unexpected genotyping results

The following table pertains to TaqManreg SNP Genotyping Assays run onOpenArraytradesystems For a comprehensive guide to troubleshooting SNP assayperformance refer to ldquoAppendix A Troubleshootingrdquo in the TaqManreg SNP GenotypingAssays User Guide (Pub No MAN0009593)


Diffuse clusters loss ofheterozygosity andor non-amplification for manysamples in a dataset

Insufficient amount ofstarting DNA andor PCRinhibitors present in thesample preparation

We recommend using 50 ngmicroL starting DNAconcentration If it is not possible to increase theconcentration of the starting material or removeinhibitors from the sample preparation preamplify thesample See the TaqManreg OpenArraytrade GenotypingSample Preamplification User Bulletin (Pub NoMAN0011116)

The images show poor quality SNP data (top) that isimproved by preamplifying the samples (bottom)

Appendix A TroubleshootingTroubleshooting unexpected genotyping results A



Amplification plot is missingexpected cluster

Signal saturation causedsoftware to call homozygousalleles as heterozygous (orvice versa)

Use real-time traces to manually call alleles See ldquoRecommended Run OpenArraytrade SNP genotypingexperiments in real-time modeldquo on page 44 for moreinformation

Incorrect genotype called Real-time traces were notused to identify outlier datapoints

Use real-time traces to identify outlier data points and tomanually call alleles

Real-time traces can be viewed in the QuantStudiotrade 12KFlex Software or the Thermo Fisher Cloud GenotypingModule which is accessed from thermofishercomcloud

See ldquoRecommended Run OpenArraytrade SNP genotypingexperiments in real-time modeldquo on page 44 for moreinformation

Appendix A TroubleshootingTroubleshooting unexpected genotyping resultsA


If a sample fails to cluster well with other samples or fails to amplify properly withone or more assays (that is there are UND and NOAMP calls in the run) rerun suchsamples using single tube DME assays on 96‑well or 384‑well plates We recommendrunning control gDNA samples along with the unknown samples or use a referencepanel (see ldquo(Optional) Generate a reference panelldquo on page 58) The controls will helpto provide more accurate genotype calling of the unknown samples

Troubleshooting genotype calls for assays with merging clusters

It can be difficult for the secondary analysis software (for exampleTaqManreg

Genotyper Software) to make distinct genotype calls for assays with merging clusters(see example below) In these cases use the real‑time traces from the QuantStudiotrade

12K Flex Software to review the data by assay and manually call data as necessaryManually adjust the end‑point cycle number to an earlier cycle using the RevealTraces scroll bar the clusters will have a greater degree of separation Use thisadjustment if any real‑time traces do not show a smooth progression in signalthroughout the run

To manually adjust the the end‑point cycle number

1 Open the experiment

2 Select Analysis4Allelic Discrimination Plot from the Experiment Menu paneon the left

3 Select the Options icon (circled in red)

4 Select Reveal traces

5 Use the slider to adjust the end‑point cycle number and optimize allelediscrimination between genotype clusters

6 Click Analyze to update genotype calls

(Optional) Rerunsamples that failto cluster

Appendix A TroubleshootingTroubleshooting genotype calls for assays with merging clusters A


7 Save the run Take note of the cycle number for each assay that has beenadjusted These numbers can later be entered into the TaqManreg GenotyperSoftware

Note A lower call cycle presently does not transfer to the TaqManreg GenotyperSoftware The software will re‑set the cycle number to 50 cycles Set up a separatestudy with the lower cycle number

8 (Optional) Select Analysis4QC Summary from the Experiment Menu pane toview the QC flags for the runClick each flag to display its meaning and a troubleshooting link appears in theright‑side pane

Note Ignore the CTFAIL flag for genotyping data Some samples do not haveboth alleles present This flag displays the amplification curve from the absentallele does not meet quality metrics but the amplification will be poor if an alleleis absent

Expected versus unexpected noamp and undetermined calls

For certain assays it is expected that there will be some samples that legitimately failto amplify or have an undetermined genotype call These include samples run withassays that interrogate gene variants that are associated with copy number variationand with assays that detect triallelic SNPs or adjacent SNPs See ldquoAnalysis guidelinesDME genotyping assays for genes in copy number variation regionsldquo on page 61 and ldquoAnalysis guidelines SNP genotyping assays for triallelic SNPsldquo on page 61 for detailson how to analyze the data for such assays

Some TaqManreg Drug Metabolism Genotyping Assays target polymorphisms in genesthat exhibit copy number variation Copy number variation analysis must be done inaddition to genotyping with DME assays

bull If both copies of a gene are deleted in a sample (copy number of 0) samples willnot be amplified and will run near or with the NTCs

bull If a sample contains more than 2 copies of a gene and both SNP alleles arepresent it will fall within the heterozygous cluster or occasionally to one side orthe other of it in which case it may be called as undetermined These should bemanually called as heterozygous for data analysis purposes

TaqManreg DrugMetabolismGenotyping Assaysfor genes in copynumber variationregions

Appendix A TroubleshootingExpected versus unexpected noamp and undetermined callsA


Triallelic SNP and adjacent SNP targets can be interrogated using a pair of CustomTaqManreg SNP Genotyping Assays Each assay contains one probe for the major SNPallele or haplotype and one probe for one of the minor alleles or haplotypes Afterrunning paired assays in separate reactions on the same genomic DNA samplescompare the results of the two assays to determine the sample genotype For a givenassay it is expected that

bull Samples containing one reported allele may run close to or within a homozygouscluster Any samples running close to homozygous clusters that are called asundetermined should be manually called as homozygous for data analysispurposes

bull Samples that are homozygous for the unreported allele may cluster with NTCs ormay exhibit weak amplification due to probe nonspecific activity If a weaklyamplifying sample is called as undetermined manually adjust the call tonoamp

TaqManreg DrugMetabolismGenotyping Assaysfor triallelic SNPsand adjacent SNPtargets

Appendix A TroubleshootingExpected versus unexpected noamp and undetermined calls A


Preamplification of low-concentration gDNA

Overview

Preamplification in OpenArraytrade experiments helps to ensure sufficient templatecopies in the 33‑nL qPCR reaction At low template copy numbers stochastic effectscan dominate the reaction because the random events at each template moleculerepresent a large portion of the potential extension events Stochastic events in qPCRreactions are generally dominant at levels of lt10 template copies and negligible atlevels of gt100 template copies

The standard OpenArraytrade protocol for human SNP assays recommends starting with50 ngmicroL of genomic DNA When diluted 50 in master mix and loaded into a33‑nL reaction chamber the final template amount is 825 pg This converts to250 genomic copies (125 genomic copies for each allele in a heterozygote)

Preamplification can also be used to dilute PCR inhibitors from sample preparationsthat are of sufficient DNA concentration but contain impurities and therefore do notamplify well with the TaqManreg OpenArraytrade Genotyping Master Mix

This protocol describes targeted multiplex preamplification of 1 to 256 SNP locilocated in human genomic DNA samples A multiplex pool of TaqManreg SNPGenotyping Assays is used to simultaneously preamplify up to 256 targetpolymorphisms in a single reaction using a reduced amount of input DNA sample

The preamplification product can be used as the sample template input for SNPgenotyping reactions with any of the individual TaqManreg SNP Genotyping Assaysincluded in the multiplex preamplification assay pool Perform genotypingexperiments using the individual TaqManreg SNP Genotyping Assays following thestandard protocol except substituting preamplified product for genomic DNAsample It is not necessary to quantify or normalize preamplified product Thepreamplified sample can be added directly into the reaction plate or further diluted in1X TE Buffer to the desired concentration

For specific applications a custom OpenArraytrade Preamp Pool specific for yourTaqManreg SNP assay panel can be ordered along with your OpenArraytrade plate (contactyour sales representative for details)

Note The protocol is compatible with TaqManreg SNP Genotyping Assays but is notrecommended for use with TaqManreg Copy Number Assays

B


Guidelines for starting DNA sample concentration

DNA sample concentration Preamplification Recommendation

lt04 ngμL Not recommended Preamplification of DNA at concentrations lt04 ngμL isnot recommended due to the potential for stochasticevents arising from low target number in the early roundsof the preamplification and qPCR reactions

04 ngμL to 40 ngμL Ideal preamplificationrange

The preamplification protocol was developed usinggenomic DNA samples within a starting concentrationrange of 04 ngμL to 40 ngμL and a total of 05 ng to5 ng in the preamplification reaction

Optimal performance will be achieved if the startingconcentration of genomic DNA samples is near themiddle of the working range (25 ngμL) Ourrecommended protocol for accurate quantification ofhuman gDNA samples using the RNase P DetectionReagents Kit can be found in Appendix B of thePharmacogenomics Experiments User Guide

4 ngμL to 25 ngμL User discretion Samples at these concentrations may be preamplifiedwithout dilution but these are out of the optimal range

gt25 ngμL Not recommended Samples with DNA sample concentrations gt25 ngμL donot require preamplification If samples at theseconcentrations do not amplify well with SNP assays theylikely contain PCR inhibitors If this is the case highconcentration DNA samples may yield good results afterdilution and preamplification of these samples may beunnecessary

Note 1 ng of human genomic DNA = 300 genomic copies or 150 copies of each allelein a heterozygote

Required materials


Reagent Cat No

TaqManreg PreAmp Master Mix 4391128

OpenArraytrade PreAmp Pool 4485255[1]

Genomic DNA Samples Supplied by user

1X TE Buffer pH 80 12090015

Nuclease-free water MLS

[1] Cannot be ordered online For information on ordering an OpenArraytrade Preamp Pool contact your sales representative

Appendix B Preamplification of low-concentration gDNAGuidelines for starting DNA sample concentration B


Perform the preamplification

1 Prepare the individual preamplification reactions as shown in the followingtable

Note It is convenient to use plates with well volumes that can accommodate a20X larger volume than the reaction for the 20‑fold dilution step afterpreamplification

Note TaqManreg PreAmp Master Mix and OpenArraytrade PreAmp Pool can beprepared as a single reaction mix and distributed to the plate in 375‑microL aliquotsThese volumes can be increased 2‑fold if more preamplified product is needed

Component Stock concentration Finalconcentration Volume

TaqManreg PreAmpMaster Mix

2X 1X 25 μL

OpenArraytrade PreAmpPool

4X (020X eachassay)

1X (005X eachassay)

125 μL

Genomic DNA Sample 04 ngμL to 4 ngμL 01 ngμL to1 ngμL(versus

150-1500 copiesper μL)

125 μL

Total mdash mdash 50 μL

2 Firmly seal the reaction plate with a MicroAmptrade Clear Adhesive Film

3 Vortex the reaction plate for 10 seconds and centrifuge briefly

4 Run the preamplification cycling program on a GeneAmptrade PCR System 9700(silver or gold block) or Verititrade Thermal Cycler using the following thermalcycling conditions

Stage Step Temp Time

Hold Activate 95degC 10 min

Cycling (10to14 cycles)

Denature 95degC 15 sec

AnnealExtend 60degC 4 min

Hold Inactivate 999degC 10 min

Hold mdash 4degC up to 1 h or overnight

5 Transfer the reaction plate from the thermal cycler to a container with ice Keepthe plate on ice until you are ready to dilute the preamplified product

Appendix B Preamplification of low-concentration gDNAPerform the preamplificationB


Dilute and store the preamplified product

1 Centrifuge the reaction plate briefly prior to removing the film

2 Remove the film then add 95 microL of 1X TE Buffer to each well containing apreamplified product to create a 120 dilution

3 Seal the reaction plate with a new MicroAmptrade Clear Adhesive Film


5 Store the preamplified product at minus25degC to minus15degC

Appendix B Preamplification of low-concentration gDNADilute and store the preamplified product B


RNase P quantification forgenotyping experiments

In this procedure the quantification method uses TaqManreg Control Genomic DNA(human) as a calibrator instead of a standard curve The OA_Genotyping_CalcSheetcalculates the concentration of test DNA samples with this calibrator method

Note The OA_Genotyping_CalcSheet assumes duplicate RNase P reactions in a 384‑well plate layout

Download the OA_Genotyping_CalcSheet from thermofishercomoaqrc

Required materials


Item Source

TaqManreg Copy Number Reference Assay human RNase P(20X)

4403326

TaqManreg Control Genomic DNA (human ready for use) 4312660

TaqPathtrade ProAmptrade Master Mix[1] 4371357

[1] Any TaqManreg Master Mix including the TaqManreg Genotyping Master Mix can be used but ensure that the run mode on the instrument is appropriate for the master mix

Before you begin

bull Dilute test DNA samples 110 in Nuclease‑Free Water

bull Determine the total number of reactions required by includingndash Diluted test DNA samplesndash Calibrator DNA samplendash No template control (NTC) reactions use Nuclease‑Free Water in place of

DNA sample

Note We recommend a minimum of two reactions for each sample TheOA_Genotyping_CalcSheet is set up for duplicate reactions

bull Generate the RNase P Sample txt file from the OA_Genotyping_CalcSheet

C


Set up and run the PCR then quantify the DNA

1 Prepare a reaction mix for the required number of reactions plus 10 overage

Component Volume per reaction[1]

TaqPathtrade ProAmptrade Master Mix 5 microL

TaqManreg RNase P Assay (20X) 05 microL

Nuclease-free Water 25 microL

Total 8 microL

[1] See the OA_Genotyping_CalcSheet to calculate volumes for multiple reactions

2 Transfer 8 microL of the reaction mix to the wells of a 384‑well PCR reaction plate

3 Add 2 microL of sample DNA control DNA or Nuclease‑Free Water to theappropriate wells

4 Seal the plate with optical film

5 Set up the real‑time instrument with the following settingsbull Experiment type Standard Curvebull Mode Standardbull Reporter VICtrade

bull Quencher TAMRAtrade

bull Passive reference included

6 To assign the sample names import the RNase P Sample txt file generated fromthe OA_Genotyping_CalcSheet

7 Load the plate then start the run

8 After the run is complete deselect all but the Results tab select a file locationthen export the results

9 Remove duplicate sample IDs from the exported data by opening the exporteddata file in Exceltrade then

a Copy‑paste sample names and their corresponding Ct mean values into anew sheet

b Select both columns and use the Remove Duplicates function

10 Calculate the concentration of test DNA samplesa Copy‑ paste the Sample Names and Mean Ct values into the

OA_Genotyping_CalcSheet

b Enter the dilution factor of the test DNA samples into theOA_Genotyping_CalcSheet

Appendix C RNase P quantification for genotyping experimentsSet up and run the PCR then quantify the DNA C


Expected performance and systemspecifications

See the QuantStudiotrade 12K Flex System Product Bulletin (Pub No CO23802) for moredetail on performance and specifications

Table 18 Specifications for the QuantStudiotrade 12K Flex OpenArraytrade AccuFilltrade System

Description Specification

Fill rate 9925

Maximum allowable sample carryover lt1

Maximum allowable assay carryover lt1

Maximum number of through hole data points lost due toevaporation

lt5

Table 19 Specifications for QuantStudiotrade 12K Flex TaqManreg OpenArraytrade GenotypingPlates


Assay conversion rate from a 7900HT Real-Time PCR system gt95[1]

Concordance with assays run on a 7900HT Real-Time PCRsystem

997[1]

Call rate 95[1]

Number of haploid copies of gDNAthrough‑hole 250

TaqManreg OpenArraytrade Genotyping Plate capacity per 8 hour dayby a single person

12

Time from purified DNA to genotyping data ~5 hours

Throughput of one technician in one day 110000

[1] Individual performance is dependent on the integrity and purity of samples

D


Controls for genotyping and copynumber experiments

Overview

Laboratories can verify the performance of selected TaqManreg SNP Genotyping Assaysand TaqManreg Drug Metabolism Genotyping Assays on OpenArraytrade plates by usingsamples that represent all three genotypes (homozygous major allele homozygousminor allele and heterozygous) to test for both amplification and cluster separationA laboratory may prefer to use samples that represent at least two genotypes(homozygous major and minor alleles or homozygous major allele and heterozygous)to test that both assay probes function Ideally gDNA samples of known genotypesare used for such experiments However for rare DME variants that are notwell‑represented in populations it may be necessary to use synthetic templates

This Appendix includes information on sources of control cell line sample DNAs forDME and SNP genotyping assays as well as for copy number assays It also includesinformation on ordering synthetic template DNAs in plasmids

Sources of reference materials

This section describes some publicly available sources for reference or controlmaterials that can be used in genetic testing and assay performance experiments

All TaqManreg Drug Metabolism Genotyping Assays were run on 180 unique DNAsamples from four different populations in assay performance and reproducibilitytesting Samples tested included a panel of 45 African American and 45 Caucasiansamples obtained from the Coriell Cell Repositories and a panel of 45 Japanese and 45Chinese samples provided by a collaborator The minor allele frequencies determinedfor each assay are provided at thermofishercom (assay search results) and in theDME Index

Note Many of the polymorphisms interrogated by this assay collection have verylow minor allele frequencies (MAFs) of less than 1 thus the minor allele was notdetected for all assays within the 180 test samples

For TaqManreg Drug Metabolism Genotyping Assays having a reported AppliedBiosystemstrade MAF in the African American or Caucasian populations heterozygousor minor allele homozygous samples may be used as reference or control samples ingenetic testing and assay performance studies A complete list of the samples usedand their genotypes is available at thermofishercom

E

TaqManreg DrugMetabolismGenotyping Assaystest data


Order the gDNA samples from the Coriell Cell Repositories at httpccrcoriellorgPlease note that the genotypes of these samples were for the most part not verifiedby sequence analysis

Another source of DME assay control samples is the refSNP submissions in the NCBIdatabase of Short Genetic Variations (dbSNP) at wwwncbinlmnihgovSNP

Search the database by rs ID to navigate to specific refSNP pages that may havegenotype information for variants of interest noted in the Allele summary box or thePopulation Diversity table Cell line gDNA samples are available from the CoriellInstitute biorepositories (httpscatalogcoriellorg) for samples sequenced in the 1000Genomes project or genotyped in the International HapMap project

bull 1000g controls if the Allele summary box contains MAFMinorAlleleCountinformation from the 1000 Genomes project navigate to the 1000 Genomesbrowser (wwwncbinlmnihgovvariationtools1000genomes) and search by rsID This will return a genotype results table for the SNP and neighboring SNPsfor all 2500 samples used in the project grouped by population Expand apopulation to view individual samples and their genotypes

bull HapMap controls if the Population Diversity table contains genotypeinformation from the HapMap project the sample genotypes can be found byclicking on the submission ss to navigate to the submission details page ForHapMap samples the sample genotypes can also be found at the HapMap website (httphapmapncbinlmnihgov) A subset of the HapMap samples weresequenced by the 1000g project

Clinical Laboratory Improvement Amendments (CLIA)

wwwncdcgovcliaResourcesGETRMdefaultaspx

The Centers for Disease Control and Prevention (CDC) provides genetic informationon cell line DNAs that can be used as reference materials for genetic testing and assayvalidation Some of these cell lines were characterized by the Genetic TestingReference Materials Coordination Program (GeT‑RM) One major focus category is theprimeGenetic Inherited Disease amp Pharmacogeneticsprime section Download tables of referencesamples that contain PGxDME or disease allele variants many of which have beenconfirmed by multiple labs and genetic testing technologies can be downloadedfromwwwncdcgovcliaResourcesGETRMMaterialsAvailabilityaspx

Several DME genes occur in CNV regions (see ldquoDME genes and copy numbervariationldquo on page 15) In addition the CYP2D6 and CYP2A6 genes are known torecombine with related pseudogene sequences to generate hybrid genes many ofwhich have decreased or null gene activity TaqManreg Copy Number Assays can beused to detect deletions duplications and hybrid gene alleles TaqManreg CopyNumber Assays for the major known DME genes that exhibit CNV have been pre‑tested on a panel of 45 each African American and Caucasian (the same samples aswere used for TaqManreg Drug Metabolism Genotyping Assay validation studies) Acomplete list of the samples used and their genotypes is available at wwwthermofishercompgx

The gDNA samples can be ordered from the Coriell Cell Repositories website (httpccrcoriellorg)

NCBI dbSNPgenotype data

Centers forDisease Controland Prevention(CDC) referencematerials

TaqManreg CopyNumber Assaysfor DME genes

Appendix E Controls for genotyping and copy number experimentsSources of reference materialsE


Plasmid controls

We have successfully used synthetic major and minor allele template DNAs clonedinto plasmids to test the performance of over 300 TaqManreg DME Assays In additionto major or minor allele sequences plasmids carry the RNase P RPPH1 gene foraccurate quantitation of plasmids by the standard curve analysis before use ingenotyping experiments Equal quantities of major and minor allele plasmids aremixed together to create heterozygous controls Use the homozygous andheterozygous plasmid controls to demonstrate amplification and detection of all threegenotypes by a given assay Plasmid control samples will often but not alwayscluster with gDNA samples Review example data in the TaqManreg Drug MetabolismGenotyping Assays on OpenArraytrade Plates ppt file from wwwthermofishercompgx

For information on ordering TaqManreg DME and SNP Genotyping Assay plasmidcontrols email QuantStudioFrontDesklifetechcom

Appendix E Controls for genotyping and copy number experimentsPlasmid controls E


Good PCR practice

Prevent contamination and non-specific amplification

PCR assays require special laboratory practices to avoid false positive amplificationsThe high throughput and repetition of these assays can lead to amplification of oneDNA molecule

PCR good laboratory practices

When preparing samples for PCR amplificationbull Use a positive‑displacement pipette or aerosol‑resistant pipette tipsbull Follow proper pipette‐dispensing techniques to prevent aerosolsbull Wear clean gloves and a clean lab coat (not previously worn while handlingamplified PCR products or used during sample preparation)

bull Change gloves whenever you suspect that they are contaminatedbull Maintain separate areas and dedicated equipment and supplies for

ndash Sample preparationndash PCR setupndash PCR amplificationndash Analysis of PCR products

bull Do not bring amplified PCR products into the PCR setup areabull Open and close all sample tubes carefully Centrifuge tubes before opening

Avoid splashing or spraying PCR samplesbull Keep reactions and components capped as much as possiblebull Clean lab benches and equipment periodically with 10 bleach solution Use

DNAZaptrade PCR DNA Degradation Solutions Cat No AM9890)

F


Safety

WARNING GENERAL SAFETY Using this product in a manner not specifiedin the user documentation may result in personal injury or damage to theinstrument or device Ensure that anyone using this product has receivedinstructions in general safety practices for laboratories and the safetyinformation provided in this document

middot Before using an instrument or device read and understand the safetyinformation provided in the user documentation provided by themanufacturer of the instrument or device

middot Before handling chemicals read and understand all applicable Safety DataSheets (SDSs) and use appropriate personal protective equipment (glovesgowns eye protection etc) To obtain SDSs see the ldquoDocumentation andSupportrdquo section in this document

G


Chemical safety

WARNING GENERAL CHEMICAL HANDLING To minimize hazardsensure laboratory personnel read and practice the general safety guidelines forchemical usage storage and waste provided below Consult the relevant SDSfor specific precautions and instructions

middot Read and understand the Safety Data Sheets (SDSs) provided by thechemical manufacturer before you store handle or work with any chemicalsor hazardous materials To obtain SDSs see the ldquoDocumentation andSupportrdquo section in this document

middot Minimize contact with chemicals Wear appropriate personal protectiveequipment when handling chemicals (for example safety glasses gloves orprotective clothing)

middot Minimize the inhalation of chemicals Do not leave chemical containers openUse only with adequate ventilation (for example fume hood)

middot Check regularly for chemical leaks or spills If a leak or spill occurs followthe manufacturers cleanup procedures as recommended in the SDS

middot Handle chemical wastes in a fume hoodmiddot Ensure use of primary and secondary waste containers (A primary waste

container holds the immediate waste A secondary container contains spillsor leaks from the primary container Both containers must be compatiblewith the waste material and meet federal state and local requirements forcontainer storage)

middot After emptying a waste container seal it with the cap providedmiddot Characterize (by analysis if necessary) the waste generated by the particular

applications reagents and substrates used in your laboratorymiddot Ensure that the waste is stored transferred transported and disposed of

according to all local stateprovincial andor national regulationsmiddot IMPORTANT Radioactive or biohazardous materials may require special

handling and disposal limitations may apply

Appendix G SafetyChemical safetyG


Biological hazard safety

WARNING BIOHAZARD Biological samples such as tissues body fluidsinfectious agents and blood of humans and other animals have the potential totransmit infectious diseases Conduct all work in properly equipped facilitieswith the appropriate safety equipment (for example physical containmentdevices) Safety equipment can also include items for personal protection suchas gloves coats gowns shoe covers boots respirators face shields safetyglasses or goggles Individuals should be trained according to applicableregulatory and company institution requirements before working withpotentially biohazardous materials Follow all applicable local stateprovincialandor national regulations The following references provide generalguidelines when handling biological samples in laboratory environment

middot US Department of Health and Human Services Biosafety in Microbiologicaland Biomedical Laboratories (BMBL) 5th Edition HHS Publication No (CDC)21‑1112 Revised December 2009 found atwwwcdcgovbiosafetypublicationsbmbl5BMBLpdf

middot World Health Organization Laboratory Biosafety Manual 3rd EditionWHOCDSCSRLYO200411 found atwwwwhointcsrresourcespublicationsbiosafetyBiosafety7pdf

Appendix G SafetyBiological hazard safety G


Documentation and support


Document Pub No

Thermo Scientifictrade KingFishertrade Flex User Manual N07669

MagMAXtrade DNA Multi-Sample Ultra Kit MagMAXtrade

Express-96 Magnetic Particle Processor Protocol4428202

Best Practices for Collection of Buccal Swabs forGenotyping Experiments

MAN0014348

Isolation of DNA for Genotyping Experiments MAN0014561



OpenArraytrade Genotyping Analysis MAN0014352

TaqManregOpenArraytrade Genotyping Troubleshooting Guide MAN0011115


TaqManreg SNP Genotyping Assays User Guide MAN0009593

TaqManreg Drug Metabolism Assays for Triallelic SNPsApplication Note

135AP01-01

AlleleTypertrade Software User Guide 4486002

Copy Number Analysis for PharmacogenomicsExperiments

MAN0014350

RNase P Quantification for Genotyping Experiments MAN0014349

Creating Standard Curves with Genomic DNA or PlasmidDNA Templates for Use in Quantitative PCR ApplicationNote

4371090



MAN0011114


MAN0014350



Document Pub No

Applied Biosystemstrade QuantStudiotrade 12K Flex Real-TimePCR System OpenArraytrade Experiments User Guide

4470935

OpenArraytrade technology on the QuantStudiotrade 12K FlexSystem Product Bulletin

CO23802

QuantStudiotrade 12K Flex Real-Time PCR SystemMaintenance and Administration Guide

4470689

QuantStudiotrade 12K Flex Real-Time PCR SystemOpenArraytrade Plate Quick Reference

4478673

QuantStudiotrade 12K Flex Software Help mdash

Customer and technical support

Visit thermofishercomsupport for the latest in services and support includingbull Worldwide contact telephone numbersbull Product support including

ndash Product FAQsndash Software patches and updatesndash Training for many applications and instruments

bull Order and web supportbull Product documentation including

ndash User guides manuals and protocolsndash Certificates of Analysisndash Safety Data Sheets (SDSs also known as MSDSs)

Note For SDSs for reagents and chemicals from other manufacturerscontact the manufacturer

Limited product warranty

Life Technologies Corporation andor its affiliate(s) warrant their products as set forthin the Life Technologies General Terms and Conditions of Sale found on LifeTechnologies website at wwwthermofishercomusenhomeglobalterms-and-conditionshtml If you have any questions please contact LifeTechnologies at wwwthermofishercomsupport

Documentation and supportCustomer and technical support


References

Gaedigk A Bradford LD Alander SW and Leeder JS (2006) CYP2D636 genearrangements within the cyp2d6 locus association of CYP2D636 with poormetabolizer status Drug Metab Dispos 3563‑569

He Y Hoskins JM and McLeod HL (2011) Copy number variants in pharmacogeneticgenes Trends Mol Med 17244‑251

Oscarson M McLellan RA Asp V Ledesma M Bernal Ruiz ML Sinues B Rautio Aand Ingelman‑Sundberg M (2002) Characterization of a novel CYP2A7CYP2A6hybrid allele (CYP2A612) that causes reduced CYP2A6 activity Hum Mutat 20275‑283

Ramamoorthy A Flockhart DA Hosono N Kubo M Nakamura Y and Skaar TC(2010) Differential quantification of CYP2D6 gene copy number by four differentquantitative real‑time PCR assays Pharmacogenet Genomics 20451‑454

Sim SC and Ingelman‑Sundberg M (2010) The Human Cytochrome P450 (CYP)Allele Nomenclature website a peer‑reviewed database of CYP variants and theirassociated effects Hum Genomics 4278ndash281


Index

spf files download 54

96‑well Sample Plate 1csv template 33

Aadjacent SNP 14allele nomenclature 10allele nomenclature websites 10AlleleTyper Software 74analyze data

options 57QuantStudio software 57TaqMan Genotyper Software 58ThermoFisher cloud software 57

assay search tools Thermo Fisher Scientific 22

Bbiohazard safety 99buccal swab DNA isolation 34buccal swab preparation guidelines 34

CCNV and hybrid gene analysis 16contamination 96controls

genotyping and copy number 93plasmid 95

copy number analysis 67copy number experiments 66copy number variation 15ndash18 20 84 85CopyCaller Software 71Coriell Cell Repositories 93Custom TaqMan Assay Design Tool (CADT) 21Custom TaqMan Copy Number Assays 21Custom TaqMan SNP Genotyping Assays 11 21CYP2A6 18 94CYP2A6CYP2A7 hybrid alleles 18CYP2D6 15 17 94CYP2D6CYP2D7 hybrid alleles 17

DDME Assays collection 8DNA

concentration 41quantify 41 90

documentation related 100download spf files 54download KingFisher Flex program 33

Ggender assays 20GeneAssist Copy Number Assay Workflow Builder

21Genotyping assay context sequences 12Good PCR practice 96GSTM1 20GSTT1 20

KKingFisher Flex program download 33

Llimited product warranty 101

Mmaster mix

TaqMan OpenArray Genotyping Master Mix 29TaqPath ProAmp Master Mix 29

materials required OpenArray plate workflow 43

NNCBI dbSNP database 94normalize DNA samples 41

OOA_Genotyping_CalcSheet 33OpenArray 26OpenArray assays order 26


OpenArray plate products and formats 26OpenArray plates run 51OpenArray SNP genotyping experiments real‑time

mode 44ordering information 26 27

PPGx common markers file 26PGx Common Markers file 20PharmaADME Core Marker Set 21 25

QQC images 52QuantStudio 12K Flex Real‑Time PCR System

expected performance 92system specifications 92

QuantStudio 12K Flex softwaretransfer files with a network connection 56transfer files without a network connection 56

Rrecover from sample layout errors 80reference materials 93reference samples Centers for Disease Control and

Prevention (CDC) 94RNase P quantification 90run OpenArray plates 51

Ssafety biohazard 99sample concentration guidelines 87sample layout errors 80sample preamplification guidelines 86sample tracking 33single tube assays

order 27products and formats 27

special assays 20support customer and technical 101

TTaqMan Copy Number Assays

Inventoried 28Made‑to‑order 28Search Tool 24

TaqMan Copy Number Reference Assay 67TaqMan Drug Metabolism Assays for genotyping ad‑

jacent SNPs 14TaqMan Drug Metabolism Assays for genotyping tri‑

allelic SNPs 13TaqMan Drug Metabolism Genotyping Assays 11TaqMan Drug Metabolism Genotyping Assays Index

21 25TaqMan Genotyper Software

guidelines for assays to adjacent SNPs 63guidelines for genes in copy number variation re‑

gions 61guidelines for sex chromosome targets 60guidelines for triallelic SNP assays 61

TaqMan OpenArray PGx Express Panel 26TaqMan OpenArray PGx Panel 26TaqMan SNP Genotyping Assay

X‐specific 20Y‐specific 20

TaqMan SNP Genotyping Assays Search Tool 22terms and conditions 101translation tables sources 75triallelic SNP 13troubleshooting

Accufill 77cycling and imaging run images 76merging clusters 83OpenArray 79unexpected and undetermined calls 84unexpected genotyping results 81

Wwarranty 101whole blood DNA isolation 37whole blood preparation guidelines 37workflow 9

Index


For support visit thermofishercomsupport or email techsupportlifetechcom

thermofishercom

28 September 2016

Pharmacogenomics Experiments Application Guide (Pub no MAN0009612)

Copyright Page

Contents

Chapter 1 About pharmacogenomics experiments

Introduction


Chapter 2 Background and tools for assay selection



Genotyping assay context sequences

TaqManreg Drug Metabolism Genotyping Assay for genotyping triallelic SNPs

TaqManreg Drug Metabolism Genotyping Assays for genotyping adjacent SNPs


DME genes and copy number variation


CYP2D6 copy number variation and CYP2D6zwjzwjCYP2D7 hybrid alleles

CYP2A6 copy number variation and CYP2A6zwjzwjCYP2A7 hybrid alleles

GSTM1 and GSTT1 DME assays and CNV

Special assays

Gender assays

Clinical research targets

PGx targets not amenable to TaqManreg design

Custom TaqManreg SNP Genotyping Assays



Assay Search tool

Search for TaqManreg SNP Genotyping Assays

Search for TaqManreg Copy Number Assays

The TaqManreg Drug Metabolism Genotyping Assays Index

The PharmaADME Core Marker Set

The PGx Common Markers file


Fixed TaqManreg OpenArraytrade PGx panel plates

Order custom OpenArraytrade plates


Order single-tube TaqManreg assays

Formats for DME and CNV assays










Guidelines for buccal swab preparation

Before first use of the kit

Before each use of the kit

Digest the samples with Proteinase K

Set up the processing plates

Add Multi-Sample DNA Lysis Buffer isopropanol and DNA Binding Bead Mix

Process samples on the instrument


Sample collection and storage

Guidelines for whole blood preparation





Add Multi-Sample DNA Lysis Buffer isopropanol and BeadzwjzwjRNase A Mix




Chapter 4 Prepare and run OpenArraytrade PGx SNP genotyping experiments

Workflow


Recommended Run OpenArraytrade SNP genotyping experiments in real-time mode

Generate 384-well sample plate layouts in the OpenArraytrade Sample Tracker Software





Run the OpenArraytrade plate(s) on the QuantStudiotrade 12K Flex instrument

Check the QC Images

One-time procedures

Set up default folders and software preferences

Download SPF Files

Chapter 5 Analyze OpenArraytrade PGx SNP genotyping experiments


Transfer files from QuantStudiotrade 12K Flex Software with a network connection

Transfer files from QuantStudiotrade 12K Flex Software without a network connection


Analyze data in QuantStudiotrade 12K Flex or Thermo Fisher Cloud software


Before you begin TaqManreg Genotyper Software analysis




Analyze results in TaqManreg Genotyper Software

Review call rates and other QC parameters


Analysis guidelines DME genotyping assays for genes in copy number variation regions




Chapter 6 Prepare run and analyze PGx copy number experiments




Before you begin


Run the reactions



CopyCallertrade Software analysis options





Sources of PGx translation information and example translation tables

Appendix A Troubleshooting






(Optional) Rerun samples that fail to cluster



TaqManreg Drug Metabolism Genotyping Assays for genes in copy number variation regions

TaqManreg Drug Metabolism Genotyping Assays for triallelic SNPs and adjacent SNP targets

Appendix B Preamplification of low-concentration gDNA

Overview


Required materials



Appendix C RNase P quantification for genotyping experiments

Required materials

Before you begin


Appendix D Expected performance and system specifications

Appendix E Controls for genotyping and copy number experiments

Overview


TaqManreg Drug Metabolism Genotyping Assays test data

NCBI dbSNP genotype data

Centers for Disease Control and Prevention (CDC) reference materials

TaqManreg Copy Number Assays for DME genes

Plasmid controls

Appendix F Good PCR practice



Appendix G Safety

Chemical safety






References

Index

The information in this guide is subject to change without noticeDISCLAIMER TO THE EXTENT ALLOWED BY LAW LIFE TECHNOLOGIES ANDOR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL INCIDENTALINDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING YOURUSE OF ITImportant Licensing Information These products may be covered by one or more Limited Use Label Licenses By use of these products you acceptthe terms and conditions of all applicable Limited Use Label Licenses

Revision history Revision history of Pub No MAN0009612

Revision Date DescriptionC0 28 September 2016 bull Ordering information incorporated into Chapter 2

bull DNA isolation procedures moved into Chapter 3

bull gDNA preamplification moved to new Appendix B

bull Prepare run and analyze OpenArraytrade PGx experiments split into two chapters

bull New troubleshooting sections

B0 August 2014 bull DNA sample preparation procedures in Chapter 4 updated for use of the MagMAXtrade DNAMulti-Sample Ultra Kit Users referred to a new Appendix A for complete procedures

bull ldquoPerform analysis in TaqManreg Genotyper Softwarerdquo topic in Chapter 5 reorganized forbetter workflow

bull Sample quantification procedure using the RNase P Detection Reagents Kit added to anew Appendix B

bull Corrections and clarifications made to Appendix C Troubleshooting

A0 January 2014 New document

Corporate entity Life Technologies Corporation | Carlsbad CA 92008 USA | Toll Free in USA 1 800 955 6288

Trademarks All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified TaqMan is a registeredtrademark of Roche Molecular Systems Inc used under permission and license AmpliTaq Gold is a trademark of Roche Molecular Systems IncOnline Mendelian Inheritance in Man and OMIM are trademarks of Johns Hopkins University NanoDrop is a trademark of NanoDrop TechnologiesLLC Puritan and PurFlock are trademarks of the Puritan Medical Products Company LLC

copy2016 Thermo Fisher Scientific Inc All rights reserved

Contents


Introduction 8






















Workflow 43












Contents
















Before you begin 68










Contents











Overview 86







Before you begin 90




Overview 93


Plasmid controls 95

Contents






Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index

Contents


Introduction 8






















Workflow 43












Contents
















Before you begin 68










Contents











Overview 86







Before you begin 90




Overview 93


Plasmid controls 95

Contents






Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index











Workflow 43












Contents
















Before you begin 68










Contents











Overview 86







Before you begin 90




Overview 93


Plasmid controls 95

Contents






Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index















Before you begin 68










Contents











Overview 86







Before you begin 90




Overview 93


Plasmid controls 95

Contents






Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index










Overview 86







Before you begin 90




Overview 93


Plasmid controls 95

Contents






Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index





Chemical safety 98






References 102

Index 103

Contents



Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index


Introduction 8



Introduction






1
















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index















Special assays 20









2









httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index








httpnatmbgduthgr


























C_11711720D_40 ABCB1 c3095GgtA CT


C_25625804D_20 CYP2C927 c449GgtT TG


C_30634117D_M0 CYP2D614 g1758GgtA TC


C_30634152D_80 CYP1A19 g2461CgtT GA


C_72650009D_20 CYP2C88 c556CgtG GC









rs6413438 C__30634128_10 CYP2C1910 c680CgtT


rs56165452 C__30634131_20 CYP2C94 c 1076TgtC




CYP2C192 c681GgtA C__25986767_70






































































A 1036 TT GG CC CC 1 2 2 510

A 236-10

CT GG CT CC 2 3 3 210

A 436-10

TT GA CC CC 2 3 3 410

A 14N-4



C 436 TT GA CC CC 1 2 2 und (= 45)

C 136-36

CT GG CC GG 1 3 3 und (= 51)


E 1013E TT GG CC CC 2 1 1 1010












CYP2A612[2A72A6

hybrid]

















Special assays











Gender assays

















Custom TaqManreg











Assay Search tool
















































4488847






Fixed TaqManreg



plates
















formulation

Cat No


PredesignedSNP

Small 1500 300 40X 4351379 NA

Medium 5000 1000 4351376

Large 12000 2400 80X 4351374

DME Small 750 150 20X 4362691


Medium 5000 1000 4332072 4332075

Large 12000 2400 80X 4332073 4332076










Scale


formulation

Cat No (Human)


CustomPlus assays

Customassays

Small 720 360 20X 4400291 4442487 4400294

Medium 1500 750 4400292 4442520 4400295

Large 5800 2900 60X 4400293 4442488 4400296





1500 750 20X 4403326


6000 3000 20X 4403328


1500 750 20X 4403316


6000 3000 20X 4403315






Item Use Cat No




A30865

(ROXtrade)














ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









3


ComponentCat No

A25597[1]

(500 rxns)

Cat NoA25598[2]

(2500 rxns)Storage









Item Source




Equipment



02-215-365




Plates and combs









Item Source




Other consumables








Reagents





Item Source




22-025-192


25ndash3306ndashH


25-1506 1PF







Item Source






































temperature





















































































temperature
















































































Workflow 43













Title Pub No


4470935






4


Workflow


q


q


q


q


q


q




Item Source








4469576




Item Source
















software

































16 32 64 +





bull DNA sample
































4

2

3

1






















8 Click Start Run



Check the QC Images
















One-time procedures


instrument software







Field Selection
























Download SPF Files























Title Pub No


4470935






5






















Software Features





bull Cloud software

bull Create studies





bull Create studies








































8 Select File4Save






2 Select File4Save






4 Click Analyze







GenotyperSoftware




b Select One File




Genotyper Software

To Do this































Expected results










GenotypeCT assay

c3095GgtA A893S

CA assay

c3095GgtT A893T

ABCB1 c3095GgtTA C_11711720D_40 C_11711720C_30

GG CC CC

GA CT CC

AA TT noamp

GT CC CA

TA TT AA

TT noamp AA

TTTA AA

TA

CTCA

CA CC CT CCAA TT











mdash CYP2C19 C__25986767_70 C__30634128_10

G-CG-C 11 GG CC

G-CG-T 110 GG CT

G-CA-C 12 GA CC







2222




-1076T4 assay 1075A - 1076

TC

mdash CYP2C9 C__27104892_10 C__30634131_20

A-TA-T 11 AA TT

A-TC-T 13 AC TT

A-TA-C 14 AA TC

C-TC-T 33 CC noamp

C-TA-C 34 CC CC

A-CA-C 44 noamp CC




33 33



Title Pub No









Before you begin 68







Title Pub No



MAN0011114


6



















calibrator sample)

Before you begin

























Run the reactions


Property Setting



Run speed Standard




FAMtrade MGB-NFQ


VICtrade TAMRAtrade









PCR(40 cycles)






























CopyCallertrade




















Results table





ΔCt plot


|Z-score| Status

lt 175 Pass


sup3 265 Fail





in the ΔCt plot













7










Troubleshooting



















A


























Turn holes






































































































Overview








B











Required materials


Reagent Cat No















2X 1X 25 μL


4X (020X eachassay)

1X (005X eachassay)

125 μL



125 μL



























Required materials


Item Source


4403326




Before you begin



DNA sample



C








Total 8 microL























Fill rate 9925




lt5





997[1]

Call rate 95[1]



12




D



Overview








E


















Plasmid controls





Good PCR practice










F


Safety




G


Chemical safety






















Document Pub No





MAN0014348









135AP01-01



MAN0014350



4371090



MAN0011114


MAN0014350



Document Pub No


4470935


CO23802


4470689


4478673












References







Index

















Mmaster mix






























Index



thermofishercom

28 September 2016


Copyright Page

Contents


Introduction














Special assays

Gender assays






Assay Search tool








































Workflow









Check the QC Images

One-time procedures


Download SPF Files























Before you begin


Run the reactions





















Overview


Required materials




Required materials

Before you begin




Overview






Plasmid controls




Appendix G Safety

Chemical safety






References

Index

Pharmacogenomics Experiments Application Guide (Pub. No ...

Documents

Transcript of Pharmacogenomics Experiments Application Guide (Pub. No ...