Indwiani AstutiDept. of Pharmacology & Toxicology

Fac. of MedicineUniversitas Gadjah Mada

Prescribed drugs based on facts and test results

Only 30-60% of drugs are effective for patients

The rest of the population experiences *no effect or *raise their changes of adverse drug reactions.

? ? ?

wrong prescription.

•Genetics•Age•Gender•Disease•Drugs

GENETIC POLYMORPHISMS

Pharmacokinetic Pharmacodynamic

•Transporters•Plasma protein binding•Metabolism

•Receptors•Ion channels•Enzymes•Immune molecules

Efficacy & Safety

History of PharmacogeneticsThe first report of an inherited difference in response to a

chemically the inability to taste phenylthiourea-was reported in the early 1930s (Snyder 1932).

In the late 1950s, Motulsky reported that certain adverse reactions to drugs are due to genetically determined variations in enzymatic activity (Motulsky 1957).

Pseudocholinesterasev ariants were associated with suxamethonium sensitivity, and inherited abnormalities in red cell glutathione metabolism were identified as causes of primaquine sensitivity.

At about the same time, genetic differences in the acetylation Of isoniazid were discovered (Evans et al. 1960).

Vogel first proposed the term pharmacogenetics (Yogel 1959), and in 1962, Kalow wrote the first monograph on the topic (Kalow 1962).

The field of pharmacogenetics was stimulated in the 1970s when Vesell and colleagues demonstrated that plasma half-lives of many drugs are less divergent among monozygotic twin pairs than among dizygotic twin pairs (for a review, see Vesel 1990).

The implication was that multifactorial inheritance, or multiple genes, may determine individual drug metabolism (multigenic inheritance

Pharmacogenomics pharmacology and genetics.

Pharmacogenomics: use of genomics (microarray technology, for example) to identify one or more genes with altered expression or activation as a result of exposure to a given drug

Pharmacogenetics: study of how variation in a single gene or limited subset of genes leads to variation in action, absorption, or distribution of drugs (drugs response)

A gene codes for a protein

Protein

mRNA

DNA

transcription

translation

CCTGAGCCAACTATTGATGAA

PEPTIDE

CCUGAGCCAACUAUUGAUGAA

The central dogma of molecular biologyThe flow of the expression of genetic

information in cells is almost exclusively one way: DNA RNA Protein

Modified “Central Dogma”Genome (Genomics)

Transcriptome (Transcriptomics)

Proteosome (Proteomics)

Metabalome (Metabolomics)

Drugs MetabolismPhase I metabolism (functionalisation

reactions) Cytochrome P450 enzymes (CYP450)Polymorphisms resulting in poor (PM),

intermediate (IM), normal (EM) or rapid metabolizers (UM)

isoenzymes CYP2D6 and 2C19.

Phase I• Slow metabolisers

have mutations which inactivate members of the CYP450 family,

• normal metabolisers carry 2 normal copies of the CYP450 gene,

• fast metabolisers carry more than 2 genes (gene duplication) causing high levels of CYP450 expressionPharmacogenomic Frontiers in Medicine and RaceTony Tu, 2006

Phase II metabolism (conjugation reactions) (Daly, J Mol Med (1995) 73: 539-553)

Uridine diphosphate glucuronyl-transferases (UGTs),

Sulfonyl transferases (SULTs), Thiopurine methyltransferases (TPMTs). N-acetyltransferase genes, NAT1 and NAT2.

There are at least 3 major slow acetylator NAT2 alleles, 2 of which are common in Caucasians and one in Mongoloids.

From: Evans WE, Relling MV. Pharmacogenomics: Translating functional genomics into rational therapeutics. Science 286:487-491, 1999.

Genetic polymorphisms in drug metabolizing enzymes

Genetic polymorphisms in drug metabolizing enzymes

Dehydropyrimidine dehydrogenase (DPD) is the initial rate limiting enzyme in the catabolism of 5 fluorouracil (5FU) located on chromosome 1p22 as a single copy and

consists of 23 exons for a total lenght of 950 kb 1 splice-site mutation, 2 deletions and 4 missense

mutations. Thiopurine S-methyltransferase (TPMT) is a

cytosolic enzyme that preferentially catalyzes the S-methylation of mercaptopurine (6MP), azothioprine and thioguanine hematopoietic toxicity (leucopenia, anaemia, pancytopenia) located to human chromosome 6 and several mutant

alleles have been isolated from TPMT-deficient patients.

Glutathione S--transferases catalyze the conjugation of electrophilic compounds to cellular glutathione absence of GSTm 1 in children with acute

lymphoblastic leukemia is associated with a 82% remission versus only 52% in children positive for GSTm .

Busulfan is an alkylating agent

Genetic polymorphisms in drug metabolizing enzymes

N-acetyltransferases exist as two isoforms respectively termed NAT1 and NAT2 and have been initially described as the enzymes responsible for the acetylation of isoniazid and caffeine (conversion of 1-methylxanthine into 5-acetylamino 6-amino 3-methyl uracil).NAT2 is located on human chromosome 8q11.

Amonafide (NSC308847) fast acetylators defined by their caffeine phenotype of NAT2 have significantly greater leukopenia than slow acetylators, as well as higher bone marrow toxicity at the standard dose of 300mg/m2 daily for 5 days.

Genetic polymorphisms in drug metabolizing enzymes

PharmacodynamicsStudy of the biochemical and physiologic

processes underlying drug actionMechanism of drug action

Drug-receptor interaction

EfficacySafety profile

Effect of Disease on PDUp regulation of receptorsDown regulation of receptors

Decreased number of drug receptorsAltered endogenous production of a

substance may affect the receptors

Drug Actions

Most drugs bind to cellular receptorsInitiate biochemical reactionsPharmacological effect is due to the alteration

of an intrinsic physiologic process and not the creation of a new process

Drug ReceptorsAgonist

Drugs which alter the physiology of a cell by binding to plasma membrane or intracellular receptors

Partial agonistA drug which does not produce maximal effect

even when all of the receptors are occupied

Drug ReceptorsAntagonists

Inhibit or block responses caused by agonistsCompetitive antagonist

Competes with an agonist for receptorsHigh doses of an agonist can generally

overcome antagonist

Drug ReceptorsNoncompetitive antagonist

Binds to a site other than the agonist-binding domain

Induces a conformation change in the receptor such that the agonist no longer “recognizes” the agonist binding site.

High doses of an agonist do not overcome the antagonist in this situation

Drug ReceptorsIrreversible Antagonist

Bind permanently to the receptor binding site therefore they can not be overcome with agonist

Drug Target PharmacogenomicsDirect protein target of drug

ReceptorEnzyme

Proteins involved in pharmacologic response Signal transduction proteins or downstream

proteinsPolymorphisms associated with

disease risk “Disease-modifying” polymorphisms“Treatment-modifying” polymorphisms

POLYGENIC

Evans WE. NEJM 2003; 348:538-48

* All disrupted by chronic abuse of the short acting opiate, heroin

Role of Mu Opioid Receptor and Related EndorphinSystems in Normal Physiological Functions*

Neuroendocrine Functions Stress responsive systems including

hypothalamic-pituitary-adrenal axis Reproductive function including

hypothalamic-pituitary-gonadal axis Response to Pain Immunological Function Gastrointestinal Function Cardiovascular Function Pulmonary Function ? Mood, Affect; Cognition

Kreek, 2000

SNP — a single nucleotide polymorphism, that is, one nucleotide or base of any base pair that is different from the “usual”, “prototypic”, (or first identified and recorded base)

Coding region — that part of a gene which codes for a peptide (protein)

Allelic Frequency: <1% low or rare1–5%intermediate>5% high or frequent

M.J. Kreek, 2000

Variant Exon Protein Corresponding Allele(nucleotide position) location domain amino acid change frequency

A118G 1 N-terminus Asn 4 Asp (N40D) 10.5%(26 heterozygous;3 homozygous)

C17T 1 N-terminus Ala 6 Val (A6V) 6.6%(14 heterozygous;3 homozygous)

G24A 1 N-terminus Synonymous 2%mutation (6 heterozygous)

G779A 3 CL3 Arg 260 His (R260H) <1%(1 heterozygous)

G942A 3 EL3 Synonymous <1%mutation (1 heterozygous)

* Nucleotide position 1 is first base of the start codon.

Bond et al., 1998

New drugs design (for exz.)

Receptor with intrinsic Tyrosine Kinase ActivityLarge group of receptors for growth factors

(insulin, EGF, PDGF, hepatocyte GF etc)Extracellular domain contains regions bind GF,

Intracellular domain contains a kinase activity capable of phosphorylating proteins on tyrosine residues

Indications

Monotherapy in advanced stage of NSCLC

Gefitinib & Erlotinib:

Gefitinib 250 mg O.D. oral

Erlotinib 150 mg O.D. oral

Cetuximab 400 mg/ m2 i.v.→ 200 mg / m2 i.v. wkly

Cetuximab

Metastatic colorectal cancer with/without Irinotecan

Dose

Signal cascades are useful:1. At each step of the cascade, the signal is amplified 2. The information that arrived at the plasma membrane in the form of a

signal is communicated to the nucleus3. The multitude of steps enables a signal to have different effects in

different cells (because they have different target proteins)

BLOCK EGFR

Tyrosine kinaseinhibitors

The objectives of research in pharmacogenetics the identification of genetically controlled

variations in responses to drugs, the study of the molecular mechanisms causing

these variations,the evaluation of their clinical significance, and the development of simple methods to identify

individuals who may be susceptible to variable responses before drugs are administered.

As a consequence, many of these conditions can now be diagnosed by analyzing samples of genomic DNA

Result: Pharmacogenomics

is the study of how an individual’s genome influences his or her response to a specific drug.

is hoped to boost drug efficacy by guiding physicians to the best drugs and optimal prescriptions for different patients (Vascar et al., 2002)

identify patients at high risk for adverse drug responses and optimize therapy for each patient by tailoring medicine

a near 100% effectiveness in attacking a patient's disease

In the Drug World, One Size Should Not Fit All

Pharmacotherapy

Pharmacogenomic&

PharmacogenomicsThe FutureThe VisionThe right drug, at the rightdose for every patient.

ConclusionUnderstanding the mechanisms of genetic

variation in drug effects is the key to applying pharmacogenetic principles to produce greater efficacy and fewer adverse reactions of numerous drugs.

When the molecular mechanism of a genetic variation is known, simple analyses of genomic DNA can frequenly : identify subpopulations of patients that may be at risk.