Proc. Natl. Acad. Sci. USAVol. 92, pp. 6200-6204, June 1995Microbiology

The penicillin gene cluster is amplified in tandem repeats linkedby conserved hexanucleotide sequencesFRANcISco FIERRO*, JOSE Luis BARREDOt, BRUNO DfEZt, SANrIAGo GUTIERREZ*, FRANcISco J. FERNANDEZ*,AND JUAN F. MARTIN*:*Section of Microbiology and Institute of Biotechnology (INBIOTEC), University of Le6n, Faculty of Biology, 24071 Le6n, Spain; and tAntibi6ticos, S.A.,Avenida de Antibi6ticos, 56, Le6n, Spain

Communicated by Arnold L. Demain, Massachusetts Institute of Technology, Cambridge, MA, February 13, 1995 (received for review,September 26, 1994)

ABSTRACT The penicillin biosynthetic genes (pcbAB,pcbC,penDE) ofPenicillium chrysogenum AS-P-78 were locatedin a 106.5-kb DNA region that is amplified in tandem repeats(five or six copies) linked by conserved TTTACA sequences.The wild-type strains P. chrysogenum NRRL 1951 and Peni-cillium notatum ATCC 9478 (Fleming's isolate) contain asingle copy of the 106.5-kb region. This region was borderedby the same TTTACA hexanucleotide found between tandemrepeats in strain AS-P-78. A penicillin overproducer strain, P.chrysogenum El, contains a large number of copies in tandemof a 57.9-kb DNA fragment, linked by the same hexanucleotideor its reverse complementaryTGTAAA sequence. The deletionmutant P. chrysogenum npelO showed a deletion of 57.9 kb thatcorresponds exactly to the DNA fragment that is amplified inEl. The conserved hexanucleotide sequence was reconstitutedat the deletion site. The amplification has occurred within asingle chromosome (chromosome I). The tandem reiterationand deletion appear to arise by mutation-induced site-specificrecombination at the conserved hexanucleotide sequences.

Amplification of DNA sequences occurs in a variety of eu-karyotic organisms (1-4). In some cases, repeated genes are anormal component of the genome (e.g., ribosomal RNAgenes), whereas in others amplifications are due to mutationsthat increase expression of genes conferring resistance tometals (5, 6) or to antibiotics (7). Very few examples of geneamplification have been studied in filamentous fungi (8, 9).The penicillin biosynthetic genes (pcbAB,pcbC, andpenDE)

are clustered in a region of Penicillium chrysogenum DNAextending for - 15 kb (10, 11). A large amplification of a DNAregion of at least 35 kb was found in three high producingstrains of P. chrysogenum by two groups (12, 13). The genes forthe penicillin cluster were found to be amplified between 6 and16 copies in different strains. However, it was impossible toconclude whether the amplification was tandemly repeated ordispersed throughout one or more chromosomes. The peni-cillin gene cluster of P. chrysogenum was located in the largestchromosome (chromosome I, 10.4 megabases in the wild type).No hybridization was observed in the other chromosomes ofP.chrysogenum AS-P-78 with probes internal to the pcbAB gene(14), suggesting that the amplification occurred within a singlechromosome. Chromosomes of the high penicillin producingstrains have undergone considerable changes in size (14), butit is unknown whether these chromosomal reorganizationsaffect penicillin biosynthesis.We report in this article that the amplified region (hereafter

named AR) in AS-P-78 consists of tandem repeats of a unit of106.5 kb. An industrial strain P. chrysogenum El contained12-14 tandemly repeated copies of a 57.9-kb unit that over-lapped with the 106.5-kb unit of AS-P-78.

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

MATERIALS AND METHODSStrains. P. chrysogenum NRRL 1951 (wild-type strain) and

Penicillium notatum ATCC 9478, the initial isolate of Fleming,were used. P. chrysogenum npelO is a deletion mutant that lacksthe entire penicillin gene cluster (15). P. chrysogenum AS-P-78is an early high penicillin producing strain provided by Anti-bioticos, S.A. P. chrysogenum P2, an initial strain of thePanLabs series (16), was donated by J. Lein (Panlabs, DeerHarbor, WA). P. chrysogenum El, a high penicillin producer,was developed at Antibioticos, S.A.Gene Libraries, Southern Blot Analysis, Hybridizations,

and Sequencing. A genomic DNA library of P. chrysogenumAS-P-78 was made in AEMBL3, and libraries of genomic DNAof the wild-type P. chrysogenum NRRL 1951 and the highpenicillin producer P. chrysogenum El were constructed inAGEM-12. Southern blot analysis, hybridizations, and se-quencing were carried out by standard procedures (17).

RESULTS

Cloning of the Right End oftheAR in Strain AS-P-78. Basedon the different intensity of hybridization of restriction frag-ments in strains AS-P-78 and P2 obtained with probes internalor external to the AR, we searched for the right end of the AR.Estimation by densitometry after hybridization of serial dilu-tions of total DNA of AS-P-78 with probes internal to thepebAB gene indicated that strain AS-P-78 contained five or sixcopies of the penicillin biosynthetic genes. By chromosomewalking from phage F6A and F16A that contained the peni-cillin gene cluster, we cloned the region downstream of thepenDE gene (phage F56) (Fig. 1). By using as probe a 1.4-kbSal I-BamHI fragment corresponding to the distal end (withregard to the pen cluster) of phage F56, we observed that theDNA fragment was already out of the AR.To define precisely the junction between the amplified and

the nonamplified DNA, several small probes corresponding toDNA fragments of phage F56 were made. One of these probes(probe C, a 1.1-kb Sal I-EcoRI fragment, Fig. 2) showed ahigh-copy-number hybridization pattern with strains AS-P-78and P2 (Fig. 3), indicating that this fragment was located insidethe AR. A different probe (probe D, a 0.88-kb Sal I-HindIIIfragment, Fig. 2) hybridized with a DNA fragment locatedoutside of the AR. In this way, a 1.42-kb Sal I band was definedthat contained the right end border (REB) of the AR (down-stream from the penDE gene). This fragment was mapped indetail and sequenced.

Cloning ofthe Union Fragment Between Tandem Repeats inStrain AS-P-78. If the five or six copies of the repeated unit inAS-P-78 are organized in tandem, probe C (that is internal tothe right end of the AR, Fig. 2) should hybridize also with the

Abbreviations: AR, amplified region; REB, right end border; TRU,tandem repeats union; LEB, left end border; SF, shift fragment.*To whom reprint requests should be addressed.

6200

Dow

nloa

ded

by g

uest

on

Mar

ch 1

, 202

0

Proc. Natl. Acad. Sci. USA 92 (1995) 6201

LEB TRU_ L-iP76 F36

F76

N43 _N57 F64

N40 N61

AS-P-78

TRU

N32

TRU

F83

F6

.20

TRUr-i

REBl-

F56

Ni

N5

F16AF6A F56

pcbAB pcbC penDE IREBI

E E j E E R BE E E EM ! . E B E ,}4**5EsSX2=;.SE' j~I'

H ES S S~~~~~~~~~~~~~~~~~~~~~~S ~~~ ~ ~ ~sss s s SsS s Is s Si$Bs S S

WiS.I54-1255 nPe1O Pllboxes). B BnRBfBmtBBib T BB~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

ii I '~ ~ ~~~~s

by~~~ ~ ~~~thahdln nbakt ntelwrpato h iue ,SlI ,BmI ,EcRI

'I~ ~ ~ ~~~i

El 54.8Kb ~~~~~~~~~~~~~~~~~pcbABpcbCpenDE!iAL1O5 ~~~~~AL64 AL99 B4

D Kb ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~114.5 KbAL92 AL70 AL85

P11 Pi11Wis. 54-1255 npel1-FIG. 1. Restriction map of the 106.5-kb unit that is amplified in P. chrysogenum AS-P-78 and the 57.9-kb unit of P. chrysogenum El (stippled

boxes). The LEB and REB fragments are indicated by solid boxes. The arrangement of the five TRUs in AS-P-78 is indicated in the upper partof the figure. DNA fragments cloned in the different phage are indicated by thin lines. Phage of the F and N series correspond to DNA fragmentsof AS-P-78 and NRRL 1951, respectively. Phage of the AL series contain DNA fragments of the penicillin-overproducing El strain. Phage P11contains DNA from the nonproducer mutant npelO. The DNA region deleted in mutant npelO (which coincides with the AR in strain El) is indicatedby the dashed line in brackets in the lower part of the figure. S, Sal I; B, BamHl; E, EcoRI.

end of repeated units near the border between tandem repeats.As expected, several phage were obtained from the AS-P-78library (e.g., phage F36, Fig. 1) by hybridization with probe Cthat showed a restriction map identical to that of F56 up to apoint located inside the REB but different thereafter. In thisway, a 1.47-kb Sal I fragment was identified that contained theend of the identical sequence ofphage F56 and F36 (Fig. 2) andcorresponds to the tandem repeats union (TRU). As shown in

S S H EV EV EVB 'B'SS EV S

>~~~-= left endA 1j4 2.58 5._63

probe A LEB probe B

H H S Sa EV EV EVSa E B C B /S EV

..i~jI i ~~~~~~~~~~~~~~~~~~. .... .. ..Q 2.4 3'5 3,

probe C TRU

H H S Sa

S

Z2 tandem repeat6.55 union

probe B

Sai.S H E C

Sa E \ B C B B EV S

fj I -,l,-W -right endI.3 2.4 3503R2 47 6.4

probe C REB probe D

B1-'GCTCGAGGGTGTAGCC C-C CCGGGCTCCtI'TTACAICCATCAA1GC'TA'I'GTC TlGC-A'CACCCCTCCA LEBTCTCCATGGTTGTGATATGTTGGTCMAAT TTACACCATCAATCTATGTCTGGAT'CCCCTCCA TRUTCTCCATGGTTGTCATATGTTGTCAAG TTTACAIACTAGAATATCGGAACCTGTGGGATTGA REB

FIG. 2. (A) Detailed restriction maps of the LEB, TRU, and REBof the AR in P. chrysogenum AS-P-78 (stippled boxes). S, Sal I; Sa, SacI; E, EcoRI; EV, EcoRV; B, BamHI; C, Cla I; and H, HindIII. ProbesA, B, C, and D, used for hybridization studies to determine the endsof the AR, are shown by arrows. A double line indicates AR DNA anda thin line indicates the non-AR DNA. The junction points inside theLEB, TRU, and REB are indicated by vertical bars. (B) Nucleotidesequences of the LEB, TRU, and REB. Note the conservation of thehexanucleotide TTTACA in the borders and the junction zone.

Fig. 2, the region labeled as probe C was identical to that foundat the REB of the AR, up to the Sac I site inside the TRU.

Cloning of the Left End Border (LEB) of the AR in StrainAS-P-78. If the five or six repeats are organized in tandemwithout stretches of single-copy DNA between them, the leftend of the AR should show the same restriction map as thesequence at the left end of the repeats. Indeed, when a 2.73-kbSal I fragment (probe B, Fig. 2) of phage F36 contiguous to theTRU was used as probe, the pattern of hybridization of strainsAS-P-78 and P2 showed that this fragment is located within theAR (Fig. 3, probe B). Several phage (e.g., F76) selected byhybridization with this probe showed a restriction map iden-tical to that of F36 up to a point inside the TRU sequence, butdifferent thereafter. The fragment enclosing the end of theARdistal from the pen cluster (a 1.5-kb Sal I fragment) has beennamed the LEB (Fig. 2).To confirm that this region corresponds to the left end of the

AR, the DNA of the different strains was digested andhybridized with probeA (1.4-kb Sal I fragment) contiguous butexternal to the LEB. As shown in Fig. 3, probe A, only thenonamplified 6.9-kb EcoRI fragment was observed in allstrains including AS-P-78 and P2.The Wild-Type P. chrysogenum NRRL 1951 Contains a

Single Copy of the Pen Region. Phage carrying thepen regionfrom a genomic library of the wild-type were selected byhybridization with probes corresponding to the REB and LEBfragments. None of the phage cloned from strain NRRL 1951corresponded to the TRU region found in strain AS-P-78,indicating that the wild type contains a single copy of the penregion.Mapping of a Single Unit of the AR. A complete unit of the

AR of strain AS-P-78 was cloned and mapped by "chromo-some walking" from the LEB (phage N43) toward the right andfrom phage F83 toward the left. Phage from the AS-P-78 andNRRL 1951 strains were used for this purpose. The restrictionmaps of phage from one or the other P. chrysogenum strainswere identical. The unit, which is repeated in tandem, ex-tended for 106.5 kb between the LEB and the REB. Therestriction map of the pen region was identical in NRRL 1951(single copy) and in AS-P-78 (five or six units) as shown by

iL-7i H H

Microbiology: Fierro et aL

Dow

nloa

ded

by g

uest

on

Mar

ch 1

, 202

0

Proc. Natl. Acad. Sci. USA 92 (1995)

probe A1 2 3 4 5 6

6.9 am_m____m a

probe C1 2 3 4 5 6

prol1 2 3

prol1 2 3

6.3- 0 o

4.35

3.4

FIG. 3. Hybridizations of total DNA ofP. chrys(lane 1), P2 (lane 2), npelO (lane 3), NRRL 195:and AS-P-78 (lane 5) and P. notatum ATCC 9478A, B, C, and D as indicated (see Fig. 2). DNAsEcoRI for probes A-C and with BamHI for probeappears in all the strains (except in the deletionhybridized with probes C and D, which are interA second thick band corresponding to theAR (uniis seen in strains P2 and AS-P-78 when hybridizeC (internal to the AR) but not with probes A anAR). Note that the hybridizing bands with probeWis54-1255 and P2 (lanes 1 and 2) are different frtype, AS-P-78, and P. notatum (lanes 4-6) diorientation of the SF.

digestion with several restriction enzymeswith DNA of phage N40, N57, N61, F20, a

Hybridization ofP. chrysogenum P2 DNA 1B (of the LEB) and with probes C and Ishowed that the AR of strain P2 is almost iAS-P-78 extending also for 106.5 kb. A smobserved, however, between different P. chnear the right end of the AR. As shown in FiD, hybridization results indicated that the1951 and AS-P-78 strains showed an identicthe right end region, but it was different frcthe Wis54-1255 and P2 strain. P.notatum (Ishowed the same restriction fragments in thas the wild-type P. chrysogenum NRRL 1strains.

Nucleotide Sequence of the Borders oftheBetween Repeats.A region of -0.8 kb ofREwas sequenced in both strands. A 6-nt sequeifound in the junctions of the REB and LEB(Fig. 2) and in the regions correspondinibetween repeats. This suggests that a recomienon resulting in tandem repeats has occuREB and LEB of the wild type. The crossioccurred between any two nucleotides of t}

be B Industrial Strains Show a More Complex Amplification4 5 6 Pattern. The organization of the AR was also studied in a very

high penicillin producing strain P. chrysogenum El. This strainwas shown to contain 12-14 copies of the penicillin genecluster. By using the same strategy described for P. chrysoge-num AS-P-78, we found that the REB in El was close to that

Om _D4m 6.9 found in AS-P-78 although not at the same point (Figs. 1 and5 6.3 4). In contrast, the LEB of the industrial El strain was located

57.9 kb from the REB, inside the 106.5-kb unit of the wild type;i.e., the repeated unit in strain El is only 57.9 kb long,corresponding to the right part of the 106.5-kb unit of the P2and AS-P-78 strains.A detailed map of the ends of the 57.9-kb unit and the TRU

of El is shown in Fig. 4. An internal 3.4-kb fragment adjacentbe D to the REB has shifted its orientation in some of the copies of4 5 6 the AR of strain El. This fragment, named shift fragment (SF),

is present in strain AS-P-78 (and in the wild type) adjacent tothe REB but outside of the AR (Fig. 1); i.e., the AR in P.chrysogenum El extends 3.4 kb from the REB of strainAS-P-78, corresponding exactly to the SF. The orientation ofthe SF existing in the wild-type and AS-P-78 strains occurs onlyin a minority (1 or 2 copies) of the 57.9-kB units of the highproducer strain El, whereas most units of this strain (10-12copies) contain the SF in orientation opposite to that of the

___ -- 2.1 wild type.Comparative Analysis of the Junctions in the Different

Strains. The different junctions between the units (TRU) andthe SF are shown schematically in Fig. 5. The sequence

0.8 TTTACA found initially in AS-P-78 was also observed in the_ 0.52 junctions EG' and EF (as expected) of strain El. It is inter-

esting that the junctions CD and F'H and the TRU sequencesogenum Wis54-1255 (F'D) of the high producer El contain the sequence TG-1 wild type (lane 4), TAA(A), which is inverse complementary to the previously(lane 6) with probes found TTTACA, suggesting that the borders in the highwere digested with producer strain have been made de novo by using the sameD. A common band TTTACA sequence that occurs (in the opposite strand) 3.4 kbmutant npelO when downstream of the amplified unit in the wild type.nal to the deletion). The Deletion in Mutant npelO Coincides with the Borders

di with probes B and of the AR in the High Producer El. The deletion in mutantLd D (external to the npelO was delimited by hybridizations with a set of probes ofs C and D in strains*om those of the wildue to the different

and hybridizationnd F83 as probes.with probes A and) (REB) (Fig. 3)dentical to that ofiall difference wastrysogenum strainsig. 3, probes C andwild-type NRRLal organization of)m that existing inFleming's isolate)[e right end region951 and AS-P-78

AR and the UnionB, LEB, and TRUnce TTTACA waswith the non-ARg to the junctionibination phenom-irred between theng-over may havehis sequence.

B C EV H E HS \ EV EV H \ H X C / B

4.6

left end

E B C Sa BSa H \ 1I S Sa S. \ \ I 3 'l

1;l:::::d l; 1--8.0

tandem union 1(1-2 copies)

E B C Sa C ESa H H S Sa EV B H

1i 349I' ': I-.I

8.0

tandem union II(10-12 copies)

E B C Sa C ESa H H ' S Sa EV B H

3.49

7t, 7-7i |~~...-~:!.........__

E C E HH B .;EV Sa H C B*I"I \ 6;9 "

A

B Sa E HS H C B

6.969!

B SaS B EV S

8A2

right end

FIG. 4. Restriction map of the left end, tandem union type I,tandem union type II, and right end of the high producing strain El.Symbols are as in Fig. 2. SF, stippled box. The junction points areindicated by the vertical dashed line.

6202 Microbiology: Fierro et aL

Dow

nloa

ded

by g

uest

on

Mar

ch 1

, 202

0

Proc. Natl. Acad. Sci. USA 92 (1995) 6203

P. chrysogenumNRRL 1951

P. chrysogenumWis 54-1255

P. chrysogenumnpel0

P. chrysogenumAS-P-78 L

P. chrysogenumP2

P. chrysogenum _El

SHIFTFRAGMENT

AB C,D E,F GIH

A,B C,D EjG' F:H

AB C H! ~ ~~~ ----------

left endEB EB

tandem repeatEF G1H

ARB rightendAB

left endEB EB

W tandem repeatsEG' F'H

right endA,B CD

left end

D EFGDttandem repeat T4(1-2 copies)

JUNCTIONS

GAGTTr-TAAAT cH

GCTCC~ CCATC

TCAAdf?qZCATC

TCAA CTAG

GAGT7AAACG

GACCAg~AACGTCAAQX3CTAG

D EG'FD TCAA(P3rC'-tandem repeat II CG(10-12 copies) EG, F

right end

EB

EF

CDFIG. 5. (Left) Comparative organization

of the ARs in strains AS-P-78, P2, and ElED relative to the wild-type NRRL 1951 (single

copy) and to the low-producer Wis54-1255(single copy but with the fragment FG

FGD shifted to G'F'). Note the different orien-tation of the SF (FG and G'F', solid boxes)in the type I and type II tandem repeats of

F'H strain El. (Right) Nucleotide sequence(boxed) at each junction site.

the AR. The two sides of the deletion corresponded to thenonamplified DNA fragments flanking the 57.9-kb AR of El.A 4.9-kb Sal I fragment of strain npelO including the junctionat the deletion site was cloned from phage Pll (Fig. 1) and 0.3kb was sequenced. The nucleotide sequence (Fig. 6) at thedeletion site showed the sequence TGTAAT that seems tohave originated by recombination between the two identicalsequences located at the borders of the 57.9-kb unit, aftermutation with nitrosoguanidine (see Discussion).

AS-P-78AB CD EF GH

GCTCcffCATC TCAALOMMACTAG

GCTCC=EKCATC CD EF GHARB TQAA%CTAGA4,

AR CD EB CD Ev CT 14GCTCC TT CATC TCAAL CTC

DISCUSSIONWild-type strains of P. chrysogenum are believed to be haploidsince recessive auxotrophic mutants are easily obtained (18).Similarly, mutants blocked in penicillin production are readilyobtained from the wild-type or early strains of the genealogicaltree of improved penicillin producers (15, 19). By cloning andmapping the entire 106.5-kb region containing the penicillingene cluster, we observed that this region is present in a singlecopy per genome in the wild-type strain NRRL 1951.Many of the improved penicillin producers contain several

copies of the region carrying the penicillin gene cluster (12,13). As shown here, the AR in AS-P-78 corresponds to astretch of 106.5 kb of contiguous DNA that is amplified 5- or6-fold in tandem repeats. The AR is not identical in thedifferent high producing strains tested, although the mecha-

S EVB / C / EV EV

ji(S

HH B

3.5

S

EV

Wss.54-1255 npelO5.02

ATTTACCTTTCTGCGTGCCCTTTTTGAGTTTA TAAATTTCTGTTCAACGCAGCAAATATT

FIG. 6. Restriction map and nucleotide sequence of the regions onboth sides of the deletion (vertical bar) of mutant npelO. Enzymes areas in Fig. 2. The sequence TGTAAT (boxed) at which the deletion hasoccurred corresponds exactly to the sequences at junctions CD andF'H of P. chrysogenum El (Fig. 5).

AB CD EG' FHGAGT AACG CTAGTAAAT

ARBCAGT~T ACG EG' FH

CD CTAGTAATAAAT

A.B CD EG'7 FYD EG' FH

GAGT TIM91AACG CTAG10LU ACG CTAGTME MAAAT

Wis. 54-1255 npelOAB CD EG' FH

GAGTT~ kACG CTAG1MTAAAT

AB CDGAGTTITggACG

CTAG AAATF'H

G'E

4,A B C.H

FIG. 7. Proposed model for recombination events that originatetandem repeats in P. chrysogenum AS-P-78 and P. chrysogenum El.Symbols are as in Fig. 5. Model for the deletion in P. chrysogenumnpelO by crossing-over at the TGTAA sequences.

TCAAMTVM%CTAG

M1 a

Microbiology: Fierro et aL

Dow

nloa

ded

by g

uest

on

Mar

ch 1

, 202

0

Proc. Natl. Acad. Sci. USA 92 (1995)

nism of amplification is probably similar. Thus, the highpenicillin producer El contains an AR of 57.9 kb that overlaps(except for a 3.4-kb fragment) with the AR of AS-P-78. This3.4-kb SF is present in both orientations in the AR of strain El.The mechanism of gene amplification is intriguing. Indus-

trial strains have been subject to strong mutagenic treatments(16). Chromosome instability resulting in chromosomal dupli-cation (9) or gene amplification (20, 21) was reported inAspergillus nidulans; gene duplications have been also ob-served in Neurosporoa crassa (22). However, the geneticmechanism underlying gene amplification in all these casesremains unknown. Gene amplification in P. chrysogenumoccurs within the same chromosome I, differing from thetransposition phenomenon described in A. nidulans where alarge terminal segment of chromosome IR was duplicated andattached terminally to chromosome IIR (9). The tandemamplification observed in P. chrysogenum is similar to thatreported in a few examples in Saccharomyces cerevisiae. In-dustrial yeast strains resistant to copper contain a tandemamplification of the CUP-4 region (6, 7). Resistance to anti-mycin A in S. cerevisiae takes place by 50-fold amplification ofthe nuclear geneADH4 as linear extrachromosomal molecules42 kb long that can be separated from chromosomal DNA (7).In P. chrysogenum, the AR remains chromosomal (chromo-some I).A possible model to explain the formation of tandem repeats

is recombination at the conserved TTTACA sequences lo-cated at the borders of the single-copy 106.5-kb unit in the wildtype after mutation. As shown in Fig. 7, misaligned pairingbetween homologous chromosomes or between sister chroma-tids may occur (6). A reciprocal crossover in this paired butmisaligned region generates a tandem repeat. The mechanismof formation of tandem repeats by recombination at theTTTACA sequences is strongly supported by the loss of the57.9-kb unit in the deletion mutant npelO. Apparently thisregion has looped out by recombination between homologoussequences at its ends.The TTTACA sequence and its inverse complement

TGTAAA may be hot spots for site-specific recombinationafter mutation with nitrosoguanidine, since our data suggestthat crossing-over for amplification or deletions always occurswithin this motif. The recombination process might be part ofa fungal SOS system similar to that existing in Escherichia colifor repairing damaged fragments of DNA that is likely to beinduced after mutagenic treatments. E. coli responds to DNAdamage with the expression of a set of genes regulated by theRecA and LexA proteins (the SOS response) (23). Similarexcision repair and postreplication repair mechanisms appearto occur in yeasts and filamentous fungi (24).

We thank F. Salto, E. Bernasconi, A. Vitaller, and A. Collados forsupport and fruitful discussions, and M. I. Corrales and R. Barrientosfor excellent technical assistance. This work was supported by grantsfrom Antibioticos s.p.a. (Milan) and the BIOTEC Program of theEuropean Community (BI02-CT94-2100). F.F. was supported by afellowship from the Junta de Castilla y Le6n (Spain), and F.J.F.received a fellowship from the University of Le6n.

1. Long, E. 0. & Dawid, I. B. (1980) Annu. Rev. Biochem. 49,727-764.

2. Schimke, R. T. (1982) in Gene Amplification, ed. Schimke, R. T.(Cold Spring Harbor Lab. Press, Plainview, NY), pp. 1-8.

3. Schimke, R. T. (1982) in Gene Amplification, ed. Schimke, R. T.(Cold Spring Harbor Lab. Press, Plainview, NY), pp. 317-333.

4. Stark, G. R. & Wahl, G. M. (1984) Annu. Rev. Biochem. 53,447-491.

5. Welch, J. W., Fogel, S., Cathala, G. & Karis, M. (1983) Mol. Cell.Bio. 3, 1353-1361.

6. Fogel, S. & Welch, J. W. (1982) Proc. Natl. Acad. Sci. USA 79,5342-5346.

7. Walton, J. D., Paquin, C. E., Kaneko, K. & Williamson, V. M.(1986) Cell 46, 857-863.

8. Nga, B. H. & Roper, J. A. (1968) Genetics 58, 193-209.9. Sexton, C. & Roper, J. A. (1984) J. Gen. Microbiol. 130, 583-595.

10. Diez, B., Gutierrez, S., Barredo, J. L., van Solingen, P., van derVoort, L. H. M. & Martin, J. F. (1990) J. Biol. Chem. 265,16358-16365.

11. Smith, D. J., Bumham, M. K. R., Bull, J. H., Hodgson, J. E.,Ward, J. M., Browne, P., Brown, J., Barton, B., Earl, A. J. &Turner, G. (1990) EMBO J. 9, 741-747.

12. Barredo, J. L., Diez, E., Alvarez, E. & Martin, J. F. (1989a) Curr.Genet. 16, 453-459.

13. Smith, D. J., Bull, J. H., Edwards, J. & Turner, G. (1989) Mol.Gen. Genet. 216, 492-497.

14. Fierro, F., Gutierrez, S., Diez, B. & Martin, J. F. (1993) Mol. Gen.Genet. 241, 573-579.

15. Cantoral, J. M., Guti6rrez, S., Fierro, F., Gil-Espinosa, S., vanLiempt, H. & Marin, J. F. (1993) J. Biol. Chem. 268, 737-744.

16. Lein, J. (1986) in Overproduction of Microbial Metabolites, eds.Vanek, Z. & Hostalek, Z. (Butterworths, Boston), pp. 105-139.

17. Gutierrez, S., Velasco, J., Fernandez, F. J. & Martin, J. F. (1992)J. Bacteriol. 174, 3056-3064.

18. Ball, C. (1983) in Antibiotics Containing the ,-Lactam Structure,eds. Demain, A. L. & Solomon, N. A. (Springer, Berlin), Vol. 1,pp. 147-162.

19. Normansell, P. J. M., Normansell, I. D. & Holt, G. (1979) J. Gen.Microbiol. 112, 113-126.

20. Parag, Y. & Roper, J. A. (1975) Mol. Gen. Genet. 140, 275-287.21. Burr, K. W., Roper, J. A. & Relton, J. (1982) J. Gen. Microbiol.

128, 2899-2907.22. Newmeyer, D. & Galeazzi, D. R. (1977) Genetics 85, 461-487.23. Walker, G. W. (1984) Microbiol. Rev. 48, 60-93.24. Bainbridge, B. W. (1981) in The Fungal Nucleus, eds. Gull, K. &

Oliver, S. G. (Cambridge Univ. Press, Cambridge, U.K.), pp.259-275.

6204 Microbiology: Fierro et at

Dow

nloa

ded

by g

uest

on

Mar

ch 1

, 202

0