Pathology of Calcific Aortic Valve Disease: The Role of … · 2013. 12. 18. · Calcific aortic...
Transcript of Pathology of Calcific Aortic Valve Disease: The Role of … · 2013. 12. 18. · Calcific aortic...
Pathology of Calcific Aortic Valve Disease: The Role of Mechanical and Biochemical Stimuli in Modulating the
Phenotype of and Calcification by Valvular Interstitial Cells
by
Cindy Ying Yin Yip
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Graduate Department of the Institute of Biomaterials and Biomedical Engineering and Cardiovascular Collaborative Sciences Program
University of Toronto
© Copyright by Cindy Ying Yin Yip 2010
ii
Pathology of Calcific Aortic Valve Disease: The Role of Mechanical
and Biochemical Stimuli in Modulating the Phenotype of and
Calcification by Valvular Interstitial Cells
Cindy Ying Yin Yip
The Degree of Doctor of Philosophy
Institute of Biomaterials and Biomedical Engineering and
Cardiovascular Sciences Collaborative Program
University of Toronto
2010
Abstract
Calcific aortic valve disease (CAVD) occurs through multiple mutually non-exclusive
mechanisms that are mediated by valvular interstitial cells (VICs). VICs undergo pathological
differentiation during the progression of valve calcification; however the factors that regulate
cellular differentiation are not well defined. Most commonly recognized are biochemical factors
that induce pathological differentiation, but little is known regarding the biochemical factors that
may suppress this process. Further, the contribution of matrix mechanics in valve pathology has
been overlooked, despite increasing evidence of close relationships between changes in tissue
mechanics, disease progression and the regulation of cellular response. In this thesis, the effect of
matrix stiffness on the differentiation of and calcification by VICs in response to pro-calcific and
anti-calcific biochemical factors was investigated. Matrix stiffness modulated the response of
VICs to pro-calcific factors, leading to two distinct calcification processes. VICs cultured on the
more compliant matrices underwent calcification via osteoblast differentiation, whereas those
cultured on the stiffer matrices were prone to myofibroblast differentiation. The transition of
iii
fibroblastic VICs to myofibroblasts increased cellular contractility, which led to contraction-
mediated, apoptosis-dependent calcification. In addition, C-type natriuretic peptide (CNP), a
putative protective molecule against CAVD, was identified. CNP supressed myofibroblast and
osteoblast differentiation of VICs, and thereby inhibited calcification in vitro. Matrix stiffness
modulated the expression of CNP-regulated transcripts, with only a small number of CNP-
regulated transcripts not being sensitive to matrix mechanics. These data demonstrate the
combined effects of mechanical and biochemical cues in defining VIC phenotype and responses,
with implications for the interpretation of in vitro models of VIC calcification and possibly
disease devleopment. The findings from this thesis emphasize the necessity to consider both
biochemical and mechanical factors in order to improve fundamental understanding of VIC
biology.
iv
Acknowledgments
I would not have made it this far in academia without years of encouragement from two excellent
high school teachers: Dr. Doug Edward Burt – a dedicated and patient chemistry teacher – and
Mrs. Linda Willey – an enthusiastic biology teacher who supervised me on my first experiment
ever! I would also like to thank the members of the Cvitkovitch laboratory, especially Elena
Voronejskaia, Kristen Krastel, Richard Mair, Prahsath Suntharalingam and Celine Levesque, for
teaching me molecular biology techniques and many laboratory “tricks” during my graduate
study at the University of Toronto. In particular, Dr. Dennis Cvitkovitch, Dr. Celine Levesque
and Dr. Richard Ellen provided endless support during my Master’s degree, and they continue to
be amazing mentors throughout my Ph.D. study.
Most importantly, this Ph.D. work was made possible with the support and guidance of my
supervisor, Dr. Craig Simmons. I sincerely thank Dr. Simmons for providing the opportunity,
and with many risks (and presumably some faith), taking me on as a Ph.D. student. His
optimistic attitude kept me going during the difficult times and motivated me when exciting
research problems were encountered. I really appreciate the level of trust and respect he has
given me over the years. His patience to listen and willingness to consider countless scientific
(and non-scientific) ideas made my graduate experience particularly enjoyable. I am honored to
have had the opportunity to facilitate the establishment of and to exercise my “bossiness” in
managing the Simmons laboratory. I am grateful we shared this working experience and I feel
privileged to have had you as my supervisor.
I would also like to acknowledge the members of the Simmons group, who have continuously
worked together as a dynamic team to build the Simmons laboratory from an empty room on the
fourth floor of Rosebrugh Building to what it is today. I especially thank Jan-Hung Chen,
Christopher Moraes, Derek Watt, Kristine Wyss and Edmond Young, who were a part of the
Simmons group from the very beginning and contributed hours in setting up our research facility.
Please remember to take the “Simmons lab time capsule” if you move to another research facility
in the future! In addition, I would like to thank: Ruogang Zhao, for offering an endless supply of
pig hearts from the slaughterhouse regardless of the weather conditions – without Ruogang, I
would not be able to conduct all my experiments with freshly isolated primary cells; Jan-Hung
Chen, for organizing birthday lunches, the annual Centre Island BBQ, the Christmas party and
v
most importantly, for providing all the intense, but valuable scientific discussions, including the
endless arguments regarding the definition of “bone nodules”; Kelly Chen, for yelling and
screaming in the laboratory all of the time to make sure everyone did their laboratory chores;
Christopher Moraes, for organizing lab meetings and getting CO2 tanks for the incubators –
without you my “cells” will not go on; Mark Blaser, for help with the siRNA transfection
experiments and for putting up with my lousy supervision; Zahra Mirzaei, for keeping the lab “in
one piece” and being the world’s best “lab mom”; Edmond Young, for always providing
alternative perspectives to life and hours of fun during our trip in New York; Kristine Wyss, for
being a great collaborator, a reliable scuba diving buddy and an adventurous travel buddy. To
Krista Sider, Morakot Likhitpanichkul, Bogdan Beca, Suthan Srigunapalan and Wing-Yee
Cheung – thank you for working together to create the Simmons Group. Also I would like to
thank the high school, undergraduate, summer and work-study students who worked with me. In
particular, Susie Ferrante, Melissa Filice and Xiao Zhong for their help with the C-type
natriuretic peptide project and Stephanie Ting for her participation in the matrix stiffness study.
Thank you all and thank you for putting up with me! I wish you all the best with much success
and happiness in the future.
I was also fortunate to receive technical assistance from other laboratories. I thank Brent Steer
for his technical advice on molecular biology techniques. I thank Justin Parreno from the Kandel
laboratory for teaching me the hydroxyproline assay. I thank Jian Wang and Robert Chernecky
for their help with scanning electron microscopy. In addition, Jian Wang helped with tensile
testing of aortic valve leaflets and I always enjoyed our conversations about his garden. I thank
the Stanford laboratory, especially Wing Yan Chang and Tammy Reid for their help with
Western blots. I also thank Kelly Jackson at the University Health Network Microarray Center
for answering all my questions regarding microarray experiments. I thank Dr. Mete Civelek at
the University of California Los Angeles for his advice on microarray data analysis. And I thank
Dr. Michelle Bendeck, Dr. Christopher McCulloch, Dr. Christopher Yip, Dr. Lidan You and Dr.
Linda Demer for serving on my committee and providing insightful feedback.
I wish to thank all my friends for their support and lending an ear during the tough times. Special
thanks to: Seema Nagaraj, for her support and for lending me her quiet apartment to write my
thesis; Scott Brehm, for always pushing me to see life through the eyes of the optimist; Frederick
Suen, for providing a shoulder to lean on when needed; Alan Wong, for all the endless
vi
discussions about calcium – I hope we will have a chance to work on the calcium solid state
NMR project in the future; and many others who provided endless laughter. Without you all, I
would have been a complete “lab rat” and not have had a life outside of the lab.
Finally, I am thankful that my parents did not force me into another career path and allowed me
to pursue a Ph.D. degree.
vii
Table of Contents
ACKNOWLEDGMENTS .......................................................................................................... IV
TABLE OF CONTENTS ......................................................................................................... VII
LIST OF TABLES .................................................................................................................... XII
LIST OF FIGURES .................................................................................................................XIII
LIST OF ABBREVIATIONS ................................................................................................. XVI
CHAPTER 1.................................................................................................................................. 1
1. INTRODUCTION ................................................................................................................ 1
1.1. MOTIVATION ..................................................................................................................... 1
1.2. CURRENT RESEARCH PROBLEM......................................................................................... 1
1.3. OBJECTIVES....................................................................................................................... 3
1.4. THESIS ORGANIZATION ..................................................................................................... 3
CHAPTER 2.................................................................................................................................. 5
2. LITERATURE REVIEW.................................................................................................... 5
2.1. INTRODUCTION.................................................................................................................. 5
2.2. AORTIC VALVE FUNCTION AND STRUCTURE ..................................................................... 5
2.3. AORTIC VALVE PATHOLOGY: SCLEROSIS AND CALCIFICATION ....................................... 6
2.3.1. Economic and Clinical Burden of Calcific Aortic Valve Disease ............................. 6
2.3.2. Pathogenesis of CAVD............................................................................................... 7
2.3.3. Cellular and Molecular Mechanisms of CAVD ......................................................... 9
2.3.3.1. Valvular Endothelial Cells and Side-Dependent Susceptibility ............................ 9
2.3.3.2. Valvular Interstitial Cells and Phenotypes............................................................. 9
2.3.3.3. Calcification by Valvular Interstitial Cells .......................................................... 11
2.3.3.4. Pathological Extracellular Matrix Remodeling ................................................... 13
2.3.3.5. Extracellular Signals: Cytokines and Growth Factors ......................................... 15
2.3.3.6. Intracellular Signal: Transcription Factors .......................................................... 16
2.3.3.7. Natriuretic Peptides and Cardiovascular Disorders ............................................. 17
2.3.3.8. Progress in Therapeutic Development ................................................................. 19
2.4. MECHANOBIOLOGY ......................................................................................................... 20
2.4.1. Definition of stiffness ................................................................................................. 21
viii
2.4.2. Stiffness Sensing ........................................................................................................ 22
2.4.3. Test Systems: Engineering the Stiffness of Culture Substrata ................................... 24
2.4.4. Effect of Matrix Stiffness on Cell Response .............................................................. 25
2.4.4.1. Cell Shape and Spreading .................................................................................... 25
2.4.4.2. Cell Growth and Death ........................................................................................ 26
2.4.4.3. Cell Phenotype and Differentiation ..................................................................... 29
2.4.5. Matrix Stiffness and Pathologies................................................................................ 31
CHAPTER 3................................................................................................................................ 34
3. HYPOTHESES, OBJECTIVES AND CONTRIBUTIONS........................................... 34
3.1. RATIONALE ..................................................................................................................... 34
3.2. THESIS HYPOTHESES ....................................................................................................... 34
3.3. OBJECTIVES AND SPECIFIC AIMS ..................................................................................... 35
3.4. OVERVIEW OF CONTRIBUTIONS....................................................................................... 35
CHAPTER 4................................................................................................................................ 37
4. IMPLEMENTATION AND CHARACTERIZATION OF THE CELL CULTURE
SYSTEM………………………………………………………………………………………...37
4.1. MATERIALS AND METHODS............................................................................................. 38
4.1.1. Fabrication of Collagen Matrices ............................................................................. 38
4.1.2. Scanning Electron Microscopy for Topographic Evaluation ................................... 38
4.1.3. Determination of Matrix Mechanics ........................................................................ 39
4.1.4. Measurement of Collagen Content ........................................................................... 39
4.1.5. Statistical Analysis ................................................................................................... 40
4.2. RESULTS.......................................................................................................................... 40
4.2.1. Collagen Matrices with Tunable Stiffness ............................................................... 40
4.2.2. Substrate Topography............................................................................................... 43
4.2.3. Collagen Content and Stiffness of Matrices Over Culture Duration........................ 43
4.3. DISCUSSION..................................................................................................................... 44
CHAPTER 5................................................................................................................................ 48
5. EFFECT OF SUBSTRATE STIFFNESS ON CALCIFICATION BY VICS............... 48
5.1. MATERIALS AND METHODS............................................................................................. 49
5.1.1. Valve Interstitial Cell Culture .................................................................................. 49
ix
5.1.2. Measurement of Cellular Proliferation..................................................................... 49
5.1.3. Determination of Cell Shape and Spreading ............................................................ 50
5.1.4. Staining of Viable, Dead and Apoptotic Cells ......................................................... 50
5.1.5. Polymerase Chain Reaction for Expression of Osteogenic Markers........................ 51
5.1.6. Measurement of Runt-Related Transcription Factor 2 (Runx2) Protein .................. 52
5.1.7. Alkaline Phosphatase and Alizarin Red S Staining.................................................. 53
5.1.8. Osteocalcin Immunohistochemical Staining ............................................................ 53
5.1.9. Immunofluorescent Staining of Cytoskeletal Proteins ............................................. 53
5.1.10. Disruption of Cytoskeleton Assembly...................................................................... 54
5.1.11. Response to TGF-1................................................................................................. 54
5.1.12. Expression of TGF-1.............................................................................................. 54
5.1.13. Contraction-Dependent Apoptosis and Akt Activation............................................ 55
5.1.14. Statistical Analysis ................................................................................................... 56
5.2. RESULTS.......................................................................................................................... 56
5.2.1. Morphological Changes, Proliferation and Cell Spreading...................................... 56
5.2.2. More Compliant Matrices Promote Osteogenic Differentiation of VICs ................ 56
5.2.3. Stiffer Matrices Promote Calcification Through Apoptosis..................................... 62
5.2.4. Aggregate Formation on Stiffer Matrices is Mediated by Cytoskeletal Tension..... 62
5.2.5. Response to TGF-β and the Expression of its Receptors Are Matrix Stiffness
Dependent................................................................................................................. 66
5.3. DISCUSSION..................................................................................................................... 68
CHAPTER 6................................................................................................................................ 73
6. EFFECT OF CNP ON PATHOLOGICAL DIFFERENTIATION OF VICS.............. 73
6.1. MATERIALS AND METHODS............................................................................................. 74
6.1.1. Animal Model and Valve Interstitial Cell Isolation ................................................. 74
6.1.2. Cell Culture .............................................................................................................. 74
6.1.3. Histological Analysis................................................................................................ 75
6.1.4. Dose Response of CNP ............................................................................................ 75
6.1.5. Cellular Proliferation ................................................................................................ 76
6.1.6. Evaluation of Osteogenic Differentiation................................................................. 76
6.1.7. Evaluation of Myofibroblast Differentiation............................................................ 77
x
6.1.8. Statistical Analysis ................................................................................................... 77
6.2. RESULTS.......................................................................................................................... 78
6.2.1. Expression of Pathological Markers and CNP in Normal and Sclerotic Aortic
Valves ....................................................................................................................... 78
6.2.2. Molecular Components of CNP Signaling ............................................................... 78
6.2.3. Dose Response of CNP ............................................................................................ 78
6.2.4. Cellular Proliferation and Morphological Changes.................................................. 80
6.2.5. CNP Inhibits Calcification and Osteogenic Differentiation of VICs ....................... 81
6.2.6. Inhibition of Myofibroblast Differentiation by CNP................................................ 83
6.3. DISCUSSION..................................................................................................................... 87
CHAPTER 7................................................................................................................................ 93
7. THE COMBINED EFFECTS OF MECHANICAL AND BIOCHEMICAL CUES ON
THE TRANSCRIPTIONAL REGULATION OF VICS ........................................................ 93
7.1. MATERIALS AND METHODS............................................................................................. 94
7.1.1. Cell Culture .............................................................................................................. 94
7.1.2. Sample Preparation................................................................................................... 94
7.1.3. Microarray Experiments ........................................................................................... 95
7.1.4. Data Analysis............................................................................................................ 95
7.1.5. Partial Annotation Mapping and Identification of Biological Processes ................. 95
7.1.6. Venn Diagram Analysis ........................................................................................... 96
7.2. RESULTS.......................................................................................................................... 96
7.2.1. Sample Characterization........................................................................................... 96
7.2.2. Differential Gene Expression by Matrix Stiffness ................................................... 97
7.2.3. Differential Gene Expression by CNP ................................................................... 100
7.2.4. The Combined Effect of Matrix Stiffness and CNP on Transcriptional Regulation
103
7.3. DISCUSSION................................................................................................................... 110
CHAPTER 8.............................................................................................................................. 115
8. CONCLUSIONS AND RECOMMENDATIONS ......................................................... 115
8.1. CONCLUSIONS ............................................................................................................... 115
8.2. FUTURE WORK .............................................................................................................. 116
xi
8.2.1. Determination of Changes in Valve Matrix Mechanics in vivo ............................. 116
8.2.2. Improvement of the Cell Culture System............................................................... 117
8.2.3. Effect of CNP treatment at Different Stages of Disease Progression .................... 118
8.2.4. Identification of Transcriptional Pathways that Regulate Pathological
Differentiation of VICs........................................................................................... 118
REFERENCES.......................................................................................................................... 120
APPENDIX A............................................................................................................................ 142
A. PROTOCOLS................................................................................................................... 142
A.1. FABRICATION OF TYPE I COLLAGEN MATRICES............................................................... 142
A.2. SCANNING ELECTRON MICROSCOPY................................................................................ 143
A.3. HYDROXYPROLINE ASSAY ............................................................................................... 144
A.4. VALVULAR INTERSTITIAL CELL ISOLATION ..................................................................... 147
A.5. CRYOPRESEVATION OF VICS ........................................................................................... 149
A.6. RELEASING CELLS FROM COLLAGEN MATRICES.............................................................. 150
A.7. CELLULAR PROLIFERATION ASSAY.................................................................................. 151
A.7. CELL VIABILITY ASSAY ................................................................................................... 152
A.8. ALKALINE PHOSPHATASE STAINING ................................................................................ 153
A.9. INDIRECT IMMUNOSTAINING PROTOCOL .......................................................................... 155
A.10. WESTERN BLOT ............................................................................................................. 157
A.11. PRIMER SEQUENCES FOR PCR AND QRT-PCR............................................................... 166
APPENDIX B ............................................................................................................................ 167
B. PRELIMINARY DATA ...................................................................................................... 167
B.1. THE EFFECT OF STATINS ON THE EXPRESSION OF CNP BY VICS ..................................... 167
B.2. CULTURING PRIMARY VICS ON POLYACRYLAMIDE SUBSTRATES.................................... 169
B.3. ISOLATION OF VICS FROM MOUSE AORTIC VALVE.......................................................... 172
xii
List of Tables
Table 2.1. VIC phenotypes and functions in normal and diseased aortic valves.......................... 10
Table 2.2. A comparison of the cellular characteristics between calcification by VICs in vivo and
in vitro .......................................................................................................................... 11
Table 2.3. Biochemical factors in valve sclerosis and calcification ............................................. 16
Table 2.4. Compliance of culture materials and tissues................................................................ 22
Table 2.5. Matrix stiffness mediated cellular responses ............................................................... 27
Table 2.6. Advantages and disadvantages of various culture systems for studying the effect of
substrate stiffness ......................................................................................................... 28
Table 7.1. A subset of transcripts with higher expression in VICs cultured on compliant matrices
relative to those cultured on stiff matrices ................................................................. 100
Table 7.2. A subset of transcripts with lower expression in VICs cultured on compliant matrices
relative to those cultured on stiff matrices ................................................................. 101
Table 7.3. A subset of transcripts with higher expression in CNP-treated VICs relative to
untreated cells when cultured on compliant matrices. ............................................... 103
Table 7.4. A subset of transcripts with lower expression in CNP-treated VICs relative to
untreated cells when cultured on compliant matrices. ............................................... 104
Table 7.5. A subset of transcripts with higher expression in CNP-treated VICs relative to
untreated cells when cultured on stiff matrices.......................................................... 105
Table 7.6. A subset of transcripts with lower expression in CNP-treated VICs relative to
untreated VICs cells when cultured on stiff matrices ................................................ 106
Table 7.7. A partial list of CNP-regulated, mechanically-insensitive genes .............................. 109
xiii
List of Figures
Figure 2.1. Porcine aortic valve. ..................................................................................................... 7
Figure 2.2. Cellular and extracellular matrix of the aortic valve. ................................................... 8
Figure 2.3. Morphology and molecular content of multicellular aggregates formed by cultured
VICs ............................................................................................................................ 13
Figure 2.4. The interplay of physical and biochemical signals in a dynamic feedback system
involving the interactions of ECM, surface receptors and cytoskeleton (adapted
from154) ....................................................................................................................... 24
Figure 2.5. Change in arterial wall stiffness in rabbit fed a high cholesterol diet to induce
atherosclerosis............................................................................................................. 33
Figure 4.1. Type I collagen matrices ............................................................................................ 41
Figure 4.2. Mechanical properties of thick and thin collagen matrices ........................................ 42
Figure 4.3. Microstructure of collagen matrices........................................................................... 43
Figure 4.4. Collagen content and effective stiffness of the two matrices over the ....................... 45
Figure 5.1. Proliferation and morphology of VICs cultured in DMEM ....................................... 57
Figure 5.2. Proliferation and morphology of VICs cultured in calcifying media......................... 58
Figure 5.3. Cell shape and spreading 48 hours after initial seeding ............................................. 59
Figure 5.4. Calcification by VICs on the two matrices................................................................. 60
Figure 5.5. Compliant matrices promote osteogenic phenotypes. ................................................ 61
Figure 5.6. Stiffer matrices promote dystrophic calcification associated with VIC apoptosis..... 63
Figure 5.7. Cytoskeleton expression............................................................................................. 64
Figure 5.8. Aggregate formation by VICs cultured on stiff matrices ........................................... 65
xiv
Figure 5.9. Effect of cytoskeleton disruption on aggregate formation ......................................... 66
Figure 5.10. Molecular factors involved in contraction-induced apoptosis on stiff substrates .... 67
Figure 5.11. Expression of TGF- receptors I and II ................................................................... 68
Figure 6.1. Expression of CNP, -SMA and Runx2/Cbfa-1 in normal and sclerotic porcine aortic
valves .......................................................................................................................... 79
Figure 6.2. Expression of NPR-B and activation of cGMP by CNP ............................................ 80
Figure 6.3. Dose-dependent -SMA expression by VICs ............................................................ 81
Figure 6.4. Proliferation and morphology of cells with or without CNP treatment ..................... 82
Figure 6.5. CNP modulates calcification by VICs........................................................................ 84
Figure 6.6. Expression of bone-related transcripts ....................................................................... 85
Figure 6.7. Expression of bone-related proteins ........................................................................... 86
Figure 6.8. Effect of CNP on osteoprogenitor subpopulation ...................................................... 87
Figure 6.9. CNP inhibits expression of myofibroblast marker ..................................................... 88
Figure 6.10. Quantification of -SMA expression ....................................................................... 89
Figure 6.11. Mutually exclusive expression of CNP and -SMA in cultured VICs. ................... 90
Figure 6.12. CNP affects function associated with activated myofibroblasts .............................. 91
Figure 6.13. Contractility of VICs with or without CNP treatment.............................................. 92
Figure 7.1. CNP inhibites aggregate formation on VICs cultured on compliant and stiff matrices
..................................................................................................................................... 97
Figure 7.2. CNP significantly reduces the total number of aggregates formed by VICs on
compliant and stiff matrices........................................................................................ 98
xv
Figure 7.3. The distribution of sequences differentially expressed with matrix stiffness ............ 98
Figure 7.4. The distribution of sequences differentially expressed with CNP treatment in cultures
on compliant matrices ............................................................................................... 102
Figure 7.5. The distribution of sequences differentially expressed with CNP treatment in cultures
on stiff matrices......................................................................................................... 102
Figure 7.6. Transcript expression modulated by matrix stiffness and/or by CNP in cultures on
compliant matrices .................................................................................................... 107
Figure 7.7. Transcript expression modulated by matrix stiffness and/or by CNP in cultures on
stiff matrices.............................................................................................................. 108
Figure 7.8. A three-way Venn diagram showing the commonly and exclusively modulated genes
by matrix stiffness and by CNP ................................................................................ 111
Figure A.1. Assembly of the protein transfer tank...................................................................... 163
Figure B.1. Expression of CNP transcript after three days of simvastatin treatment ................. 168
Figure B.2. Inhibition of aggregate formation by simavastatin treatment…………………....170
Figure B.3. Calcification by primary VICs on PA substrates with stiffness of 11 kPa, 22 kPa, 50
kPa and 144 kPa ………………………………………...…...……………………..172
Figure B.4. Isolation of mouse aortic valve………………………………………………..…173
Figure B.5. Mouse aortic valve and VICs…………………………………………………….174
xvi
List of Abbreviations
Full name Abbreviation
2-dimensional 2D
3-dimensional 3D
Alkaline phosphatase ALP
Angiotensin converting enzyme ACE
A-type natriuretic peptide ANP
Alizarin red S ARS
Alpha-smooth muscle actin -SMA
Aortic valve AV
Bone morphogenetic protein BMP
B-type natriuretic peptide BNP
Calcific aortic valve disease CAVD
Core-binding factor alpha-1 Cbfa-1
Cyclin-depenent kinases Cdk
Colony forming unit-alkaline phosphatase CFU-ALP
C-type natriuretic peptide CNP
Carbon dioxide CO2
Cardiovascular disease CVD
Cyclic guanosine monophosphate cGMP
Dulbecco's Modified Eagle Medium DMEM
Discoidin domain receptor DDR
Extracellular matrix ECM
Extracellular signal-regulated kinase ERK
Focal adhesion kinase FAK
Fetal bovine serum FBS
False discovery rate FDR
Finite element FE
Fibroblast growth factor FGF
xvii
Full name Abbreviation
Fluoroscein isothiocyanate FITC
Glyceraldehyde-3-phosphate dehydrogenase GAPDH
Gene ontology GO
Guanosine tri-phopshate GTP
Hydrochloride acid HCl
Low-density lipoprotein LDL
Matrix metalloproteinase MMP
Sodium bicarbonate NaHCO3
Sodium hydroxide NaOH
Notch homolog 1 Notch1
Natriuretic peptide receptor B NPR-B
Neutral buffered formalin NBF
Nuclear factor of kappa light polypeptide gene enhancer in B-cells
inhibitor-
NFKBIA
Osteocalcin OC
Osteonectin ON
Osteoprotegerin OPG
Phosphate buffered saline PBS
Receptor activator of nuclear factor κB RANK
Ligand of receptor activator of nuclear factor κB RANKL
RNA integrity number RIN
Runt-related transcription factor 2 Runx2
Scanning electron microscopy SEM
Swinholide A SWA
Tissue cultured treated polystyrene TCPS
Transforming growth factor-beta TGF-
Inhibitor of metalloproteinases TIMP
Valvular interstitial cell VIC
1
Chapter 1 1. Introduction
1.1. Motivation
It is estimated that 17 million people around the world die of cardiovascular disease each year1.
Calcific aortic valve disease (CAVD) is one of the most common cardiovascular diseases,
afflicting more than 25% of the population over age 652 and resulting in a 50% increase risk of
other cardiovascular events3. Surgical valve replacement at the end stage of the disease remains
the only treatment, because to date, there are no effective therapeutics. A strong fundamental
knowledge of valve cell biology will improve our understanding of the etiology of valve disease,
perhaps leading to new treatment options.
1.2. Current Research Problem
Progress in basic research on atherosclerosis, a disease that shares many features with CAVD,
and in vivo and in vitro valve studies have advanced fundamental knowledge of CAVD.
Although in vivo animal experimental models of CAVD are informative and often display
disease characteristics similar to those found in humans4-6, in vitro studies provide fundamental
mechanistic insights that are difficult to dissect otherwise. However the majority of in vitro
valve studies have focused on biochemically regulated cellular responses and overlooked the
potential contributions of mechanical cues, despite increasing evidence of close relationships
between changes in tissue mechanics, disease progression7-9 and the mechanical regulation of
cellular responses in other cell types (reviewed in 10). Moreover, mechanical cues can modulate
cell response to exogenous biochemical factors11, 12, and therefore evaluation of cell response to
biochemical cues in the context of the cellular mechanical environment will provide a more
complete understanding of valve cell biology.
Beyond its relevance for interpreting in vitro models of valve calcification, matrix stiffness may
also contribute to CAVD pathology in vivo. Calcified valve leaflets demonstrate significant
remodeling of the valve extracellular matrix (ECM), which alters matrix protein composition13, 14
and stiffness15. Although the contribution of alterations in the micromechanical properties of the
2
valve matrix to disease development has yet to be determined, changes in local matrix stiffness
of other tissues have been shown to occur prior to abnormal biological alterations. For example,
liver stiffness increases prior to the activation of liver fibroblasts and pathological matrix
deposition7, and changes in the local stiffness of atherosclerotic lesions occur prior to substantial
histological changes in the matrix16. These findings suggest an association between the
biophysical properties of the tissue matrix and disease progression. As atherosclerosis and
CAVD share many disease characteristics, similar early dynamic changes in matrix mechanics
are postulated to occur in sclerotic valves. Thus, the determination of whether VICs sense and
respond to substrate stiffness will not only provide fundamental knowledge of the
mechanobiology of VICs, but also may be relevant to understanding the progression of CAVD.
In addition to the lack of fundamental knowledge regarding valve cell mechanoregulation, there
are limited in vivo and in vitro studies evaluating biochemical factors that protect against the
development of disease-related VIC phenotypes. Clinical trials of statins, one of the most
studied potential therapeutics for CAVD, have so far generated inconclusive and controversial
results (reviewed in 17, 18), suggesting the necessity for an improved understanding of the cellular
and/or molecular mechanisms of statins or alternatively, the identification of other novel
therapeutic targets. Clues to alternative targets to prevent and treat CAVD may originate from
the tendency of calcification to occur more readily in the fibrosa (disease-prone aortic side) of
the leaflets than the ventricularis (disease-protected ventricular side)14. Profiling of gene
expression by normal porcine aortic valve endothelial cells revealed statistically significant side-
dependent differential expression of 584 genes6. Of these, C-type natriuretic peptide (CNP) was
among the most differentially expressed, with higher expression on the disease-protected side of
the leaflet in comparison to the disease-prone side. CNP and its activator, furin, were recently
shown to be distinctly downregulated in human sclerotic valves19, suggesting a putative
protective role of CNP against CAVD. Although CNP has been extensively studied in the
skeletal and reproductive systems, its effect on valvular cells is completely unknown. The study
of CNP-mediated regulation of VIC phenotypic changes will identify the cellular basis
responsible for the putative protective effect of CNP against CAVD, and will provide the
fundamental knowledge essential for mechanistic investigations at the molecular level in the
future. Further, matrix stiffness is known to regulate cellular response to soluble factors13. It is
possible that matrix stiffness may regulate the response of VICs to CNP. If VICs are
3
mechanically regulated, it will be important to investigate the effect of CNP on VICs when
cultured on various substrate stiffnesses. The investigation of substrate stiffness-mediated VIC
responses to anti-sclerotic or anti-calcific factors has yet to be conducted, despite the fact that
VICs populate the valve matrix, which changes its mechanical properties over the progression of
the disease. An in vitro study that incorporates both biochemical and mechanical cues will
provide a concrete foundation for subsequent in vivo testing of CNP, if it is proven to elucidate a
protective effect against VIC calcification in vitro.
1.3. Objectives
The overall goal of this project was to investigate the role of substrate stiffness on modulating
VIC responses to both pro-calcific and anti-calcific biochemical factors. The specific objectives
of this study are as follows:
1. To implement and characterize a cell culture system with tunable stiffness;
2. To investigate if substrate stiffness modulates the response of VICs to pro-calcific
biochemical factors;
3. To identify the cellular basis of CNP, a putative disease-protective agent, in protecting
against VIC sclerosis and calcification; and
4. To evaluate the combined effect of substrate stiffness and CNP on the transcriptional
regulation of VICs.
1.4. Thesis Organization
Chapter One presents the clinical motivation, an overview of the research problem and the thesis
objectives. Chapter Two provides a thorough review of topics specifically related to this
research, including aortic valve structure, CAVD pathology, C-type natriuretic peptide and
mechanobiology. Chapter Three states the hypotheses, objectives and overall approach. A
summary of contributions from my collaborators in completing this Ph.D. thesis is included at
the end of Chapter Three. Chapter Four describes the characterization of the cell culture system
with adjustable stiffness. Chapter Five describes the effect of substrate stiffness on the response
of VICs to pro-calcific biochemical factors. Chapter Six describes the cellular basis responsible
for the protective properties of CNP against sclerosis and calcification. Chapter Seven evaluates
the combined effect of both substrate stiffness and CNP on transcriptional regulation of VICs.
4
Chapter Eight summarizes the results and provides recommendations for future studies. A list of
references, detailed experimental protocols and preliminary data from most recent work are
appended to the end of this document.
5
Chapter 2 2. Literature Review
2.1. Introduction
The interdisciplinary nature of this thesis requires a review of both the biochemical and the
mechanical factors that regulate CAVD and cell behaviour. This chapter is divided into two main
portions. The first part describes the aortic valve structure and functions, the valve extracellular
matrix and the valvular cells, with an in-depth discussion of VICs. A brief summary of the
pathogenic processes associated with valve sclerosis and calcification is included, followed by a
discussion of current pharmacological inventions. The second portion summarizes the recent
findings in mechanobiology, mainly focused on the role of matrix stiffness in modulating cell
phenotype and its association with various diseases. A brief discussion of several technologies
with adjustable substrate stiffness is included.
2.2. Aortic Valve Function and Structure
The aortic valve leaflets open and close more than three billion times within one lifespan to
regulate unidirectional blood flow from the left ventricle to the aorta20. The dynamic operation of
the aortic valve is driven by the pressure gradient between the aortic and the ventricular sides of
the leaflets. Higher pressure in the left ventricle during systole forces the valve to open, thereby
pumping oxygenated blood through the valve to the aorta. The pressure in the left ventricle
decreases as systole ends, leading to a higher pressure on the aortic side during diastole which
forces the aortic valve to close. The closure of the aortic valve prevents retrograde blood flow
back into the left ventricle.
The aortic valve consists of three half moon shaped leaflets (Figure 2.1) each with similar matrix
structure and composition as illustrated in Figure 2.2.A. The aortic and ventricular surfaces of
the aortic valve are lined with valve endothelial cells (VECs, Figure 2.2: B and C), whereas
valve interstitial cells (VICs, Figure 2.2: B and C) can be found throughout the ECM. The ECM
of a healthy aortic valve is arranged into three highly organized layers each with distinct matrix
protein composition13 and mechanical properties21-23. The fibrosa contains primarily of a dense
6
network of type I collagen; the spongiosa consists of loosely arranged proteoglycans; and the
ventricularis is composed of a dense network of collagen and elastin fibers20, 24. The
composition and the organization of matrix proteins likely govern the mechanical properties of
each layer. For example, collagen fiber orientation determines the ability of the tissue to
withstand tensile stresses. This is evident in biaxial mechanical testing of the ventricularis layer
in which circumferentially oriented collagen fibers dominated its stress-strain response21. Of
note, restoration of collagen fiber orientation between successive loading cycle requires elastin25,
suggesting the role of ECM proteins in maintaining proper valve matrix mechanics to serve its
function. Presumably, the organization and the composition of the ECM regulate VICs
biochemically and mechanically, enabling these cells to withstand continuous physical stresses
and to maintain valve homeostasis through physiologic matrix remodeling. VIC responsiveness
to ECM composition is evident in cell-matrix interactions via cell surface receptors. For instance,
components of the ECM such as fibronectin, fibrin, laminin and collagen have been showed to
modulate VIC calcification26. However, the responsiveness of VICs to ECM mechanics has yet
been evaluated thoroughly. Further discussion of valve cells and ECM in relation to CAVD and
calcification follows in the next section.
2.3. Aortic Valve Pathology: Sclerosis and Calcification
2.3.1. Economic and Clinical Burden of Calcific Aortic Valve Disease
Cardiovascular disease (CVD) costs the Canadian economy about $18 billion27 each year and is
the leading economic burden of illness nationally28. An estimated eight million Canadians suffer
from some form of CVD29 and CVD contributes to one third of all deaths in Canada30. Calcific
aortic valve disease (CAVD) is one of the most common CVDs2. Risk factors of CAVD are
similar to those of atherosclerosis including: increasing age, male gender, hypertension and
elevated serum level of low-density lipoprotein (LDL)31. CAVD increases in prevalence with
age: from 35 percent between 75 and 84 years of age to 50 percent of those over age 802, 32. Life
expectancy is projected to increase globally in the next half century, with an increase of 19
percent and 27 percent of the population at age 60 and 80, respectively33, suggesting that CAVD
will become even more prevalent. Further, CAVD is associated with a 40 percent increase risk of
myocardial infarction34 as well as a 50 percent increase risk of cardiovascular death35. About 50
percent of patients with severe aortic sclerosis that progresses to stenosis (i.e., clinically-
significant valve narrowing) also suffer from coronary artery disease36. Despite the economic
7
and clinical consequences, there is no treatment other than surgical replacement of severely
stenotic valves, in large part because of the poor understanding of the biochemical and
mechanical factors contributing to the disease as well as a lack of fundamental knowledge in
VIC biology.
Figure 2.1. Porcine aortic valve.
(A) The left coronary cusp (L), right coronary cusp (R) and non-coronary (N) cusp of the porcine
aortic valve are similar in shape. (B) The aortic side of a porcine valve leaflet.
2.3.2. Pathogenesis of CAVD
CAVD is characterized by thickening of the leaflets and significant pathological matrix
remodeling, which often leads to calcification that eventually impairs leaflet motion and causes
significant hemodynamic obstruction due to valve stiffening14. CAVD was once considered as a
degenerative process resulted from “wear and tear” with aging. However, findings from recent
studies have identified multiple cell-driven processes contributing to the development of CAVD,
some of which are similar to those found in atherosclerosis37, 38 such as chronic inflammation39,
lipid deposition40 and pathological matrix remodeling41, 42.
L RN
A B
L RN
A B
8
Figure 2.2. Cellular and extracellular matrix of the aortic valve.
(A) Valve extracellular matrix consists of three distinct tissue layers: fibrosa (F), spongiosa (S)
and ventricularis (V). (B and C) show the lining of valve endothelial cells (VECs) on the surface
of the valve leaflet and valve interstitial cells (VICs, nuclei are stained blue) permeates the entire
valve extracellular matrix. (Source: Adapted from 6).
Spatial characteristics of CAVD are evident at both the macro- and micro-scale. Lipoprotein
deposition43 and the formation of fibrocalcific masses6 (also known as “calcific nodules”) are
particularly prominent in the fibrosa, on the aortic side of the leaflets. Macrophage and T-
lymphocyte infiltration, subendothelial thickening, basement membrane disruption, accumulation
of collagen and elastin, and focal calcium deposition are observed on the aortic side of the
leaflets or within the fibrosa layer at the early stage of lesion formation14. The susceptibility of
the aortic side to disease development may result from the differences in the local
microenvironment (e.g., infiltration of inflammatory cells, lipoprotein deposition, hemodynamic
forces44, mechanical stress45, 46, or extracellular matrix composition13) and heterogeneity between
cells from the aortic and the ventricular side of the valve6.
Aortic valves undergo substantial matrix composition and cellular phenotypic changes as CAVD
progresses, including pathological remodeling of the tri-layered extracellular matrix13, an
increase in apoptotic cells5, an increase in myofibroblast content47 and calcium deposition14.
Strikingly, ectopic bone and cartilage are also found in diseased aortic valves48, 49. The
upregulation of several bone-related markers including osteopontin, bone sialoprotein,
osteocalcin, alkaline phosphatase (ALP) and osteoblast-specific transcription factor core binding
9
factor -1/runt-related transcription factor 2 (Cbfa-1/Runx2) has been reported in human
calcified valves49, suggesting that cell-mediated processes are of bone development. The cell
source and the molecular mechanisms leading to these phenotypic alterations have not yet been
fully defined, although various non-mutually exclusive mechanisms have been identified some of
which are described in the next section.
2.3.3. Cellular and Molecular Mechanisms of CAVD
2.3.3.1. Valvular Endothelial Cells and Side-Dependent Susceptibility
VECs are anchored to the basal lamina, lining the two surfaces of the leaflets. The VEC
monolayer acts as a semi-permeable boundary that regulates transport of soluble factors from the
circulating blood into the valve interstitium and shields VICs from hemodynamic effects.
Endothelial dysfunction is often found in sclerotic leaflets50 and is associated with the
accumulation of inflammatory cells. Although it has been thought that VECs share similar
characteristics with those in the vasculature, tissue-specific functions have been suggested based
on the observed phenotypic and functional differences between the two EC populations in
culture51. Further, VECs from opposite sides of normal leaflets have been shown to display
distinct gene expression profiles that correlate with side-specific susceptibility of aortic valves to
sclerosis and calcification6, indicating local spatial phenotypic heterogeneity of the EC
population within the aortic valve. Of note, among the 584 differentially expressed genes on the
two sides of normal porcine aortic valves, disease-protective transcripts such as osteoprotegerin
(OPG) and C-type natriuretic peptide (CNP) were expressed at a significantly higher level on the
ventricular (disease-protected) side in comparison to the aortic (disease-prone) side. It has been
postulated that this spatial heterogeneity may be important in regulating autocrine signaling
within the VEC population and paracrine signaling to VICs locally. Biochemical factors
synthesized by VECs may also regulate VICs locally, contributing to the side-dependent
susceptibility of aortic valves to sclerosis and calcification. In this thesis, I was particularly
interested in investigating the response of VICs to CNP.
2.3.3.2. Valvular Interstitial Cells and Phenotypes
The VIC population is not localized to any one region of the leaflet, but resides in all three layers
of the ECM52, 53. VICs regulate valve homeostasis and are primarily responsible for valve
sclerosis and calcification54. The population of VICs in healthy aortic valves is heterogeneous
10
(Table 1), consisting mainly of quiescent fibroblasts, a small population (~1-5 percent) of
myofibroblasts (activated VICs) and smooth muscle cells47, 55-57, and a subpopulation of
progenitor cells with multipotent differentiation potential58. VICs undergo phenotypic changes
in response to the microenvironmental cues, including the extracellular matrix26, biochemical
soluble factors (e.g., cytokines)59 and mechanical forces55 (reviewed in60). In some cases, these
phenotypic alterations can contribute to pathogenesis. For example, activation of quiescent VICs
into myofibroblasts increases the myofibroblast content of sclerotic leaflets to 30 percent of the
total VIC population47, 61. Activated fibroblasts express prominent stress fibres containing -
smooth muscle actin (-SMA)57, 62-64, and are associated with increased collagen synthesis and
cellular contractility65. Pathological myofibroblast activation may lead to an unbalanced matrix
remodeling that subsequently alters the biochemical and mechanical properties of the
microenvironment within the valves. Additionally, osteoblasts-like cells are often found in
calcified aortic valves49 and likely originate from osteogenic differentiation of resident
progenitor VICs58 or bone marrow-derived hematopoietic stem cells66. VICs comprise a
phenotypically dynamic cell population (Table 2.1) and their differentiation into various
phenotypes is closely associated with defined sets of cellular functions, which presumably
modulate the progression of CAVD.
Table 2.1. VIC phenotypes and functions in normal and diseased aortic valves
Phenotype Normal aortic valves
Sclerotic/ calcified AVs
Function(s)
Quiescent VICs Abundant Less abundant than in normal valves.
Maintain valve homeostasis.
Progenitor VICs (Likely a subpopulation of quiescent VICs)
~ 50%58 Data not available
Multipotent differentiation potential. Can differentiate into multiple lineages including chondrocytes, adiopocytes and osteoblasts. If differentiated into osteoblasts, these cells can secret alkaline phosphatase and osteocalcin, and deposit calcium58.
Activated VICs (Myofibroblasts)
~1-5%67 ~ 30%61 -SMA positive contractile cells that participate in active cellular repair processes such as matrix remodeling55.
11
2.3.3.3. Calcification by Valvular Interstitial Cells
The cellular mechanisms by which VICs contribute to calcification are not well defined, largely
because in vivo and ex vivo studies are limited to evaluating the end-stage of the disease.
Although large animal models such as porcine and ovine are excellent disease models with
similar lipoprotein serum levels and hemodynamic profiles to humans, it is difficult to track the
changes of individual molecular signaling pathways over the course of disease progression partly
due to the lack of imaging modalities that can monitor valve pathological development in a time-
dependent manner. Alternatively, ex vivo studies with human aortic valves are often limited to
those at the end-stage rather than at the onset of the disease, and therefore these studies are not
capable of identifing molecular mechanisms responsible for disease initiation. Hence in vitro cell
culture systems are often used to study disease-related molecular and cellular events in hopes of
deciphering the underlying mechanisms of valve calcification, as these cell culture models often
display in vivo characteristics of the disease (Table 2.2).
Table 2.2. A comparison of the cellular characteristics between calcification by VICs in vivo
and in vitro
Characteristics Calcified aortic valves In vitro calcification by VICs
Upregulated49 Upregulated54, 58 Upregulated49 Upregulated58 Upregulated49 Upregulated58
Expression of bone-related markers: Alkaline phosphatase Cbfa-1/Runx2 Osteocalcin Osteopontin Upregulated49 Upregulated68
Hydroxyapatite mineral Present49 Present58
Apoptotic cell content Increased5 Increased69
Expression of - SMA and myofibroblast content
Upregulated47 Upregulated26
MMP activities Altered47, 70, 71 Altered72
Calcification by VICs can be induced in vitro by cytokines (e.g., transforming growth factor-1
(TGF-1)69 and bone morphogenetic proteins (BMPs))54, 73 or by addition of a calcifying media
supplement that consists of a combination of -glycerophosphate, ascorbic acid and/or
dexamathesone58, 73. Calcification can be achieved without additional biochemical stimuli only if
12
VICs are seeded at high (> 50,000 cells/cm2) cell-seeding density26 or cultured for a long
duration (> 21 days)54. Under appropriate culture conditions, VICs form multicellular aggregates
of various shapes, sizes, and transcript and protein expression (Figure 2.3). These aggregates are
associated with the expression of bone-related transcripts and proteins26, 54, 58, 74, the expression
of myofibroblast markers26, and/or apoptosis69, all of which are accompanied by localized
calcium deposition within the aggregates. Cellular calcification has been reported to occur
through various non-mutually exclusive processes. Cells such as VICs54, pericytes75 and
calcifying vascular smooth muscle cells76 can differentiate into osteoblast-like cells that secrete
bone matrix proteins (e.g., ALP, osteonectin and osteocalcin) and form hydroxyapatite (a bone
mineral)26, 54. Apoptosis is another calcification process that is evident in calcified tissue in
cartilage, arteries and aortic valves, and it is apparent that apoptosis is involved in calcification
by valve cells69, 77 and vascular cells77. Apoptotic bodies have been proposed to serve as a
nucleation site for calcium crystal formation77. Other processes such as active uptake of calcium
ions and phosphate by matrix vesicles, hydrolysis of pyrophosphate by alkaline phosphatase,
hydrolysis of ATP by ATPase leading to the release of pyrophosphate, and accumulation of
phospholipids as a potential apatite nucleation site may also contribute to physiologic
calcification (reviewed in78). Because of the complexity of these calcification processes, it is
unclear whether some of the in vitro calcification reported in VIC studies (Table 2.2) represents
one or many of these calcification processes, confounding the interpretation of cell culture data
and limiting our understanding of the mechanisms underlying calcification by VICs.
13
Figure 2.3. Morphology and molecular content of multicellular aggregates formed by
cultured VICs
In different studies, cell aggregates have been reported to vary in cellular and molecular content
from different studies. These cells can express (A) localized alkaline phosphatase (stained violet,
adapted from58), (B) osteocalcin (stained brown, adapted from 79), (C) -SMA (stained green,
adapted from26) and (D) annexin V indicative of apoptosis (stained green, adapted from69). (E)
Calcium deposition is often observed within the aggregates, closely apposed to intact, viable
cells. M: mineral; C: cells (adapted from58). (F) Electron diffraction patterns of mineral deposits
from calcific aggregates matched the reference pattern for hydroxyapatite (JCPDS 9-0432)
(adapted from58).
2.3.3.4. Pathological Extracellular Matrix Remodeling
The ECM provides biochemical and mechanical cues to adherent cells. ECM composition13 and
mechanical7, 16 alterations are characteristics of sclerotic diseases. Disorganization of collagen
bundles42, fragmentation and stratification of the elastic fibers13, infiltration of loose connective
tissue within the collagen matrix and an increase in proteoglycan matrix13 are commonly found
in the diseased valve leaflets. In addition, the expression of bone-related matrix proteins such as
osteocalcin, osteopontin, osteonectin, and bone morphogenetic proteins (BMPs) is often
upregulated in calcified valves48. These bone proteins are known to regulate hydroxyapatite
formation, therefore they are important mediators of cell-mediated calcification80, 81.
A B C
D E F
A B C
D E F
14
The matrix architecture can be remodeled by zinc- and calcium-dependent endopeptidases
known as matrix metalloproteinases (MMPs). Activated MMPs can degrade ECM components
such as elastin and collagen fibers; therefore a fine balance between the activities of MMPs and
their inhibitors (i.e., tissue inhibitors of metalloproteinases, TIMPs) dictates the rate of ECM
turnover. The results of MMP studies with respect to valve pathology have been inconsistent,
with some but not all studies reporting an upregulation of the expression and/or activity of
MMP-1, -2, -3, and -9 and TIMP-1 and TIMP-2 in calcified valves42, 82. Presumably, changes in
the relative activity of MMPs and TIMPs in diseased leaflets contribute to pathological matrix
remodeling, which alters cell-matrix interactions and matrix mechanics. Interestingly, calcium
deposition is spatially associated with damaged basal membrane83 and it has been postulated that
MMPs may facilitate calcification process(es) by degrading components of damaged basal
membrane84.
The function of MMPs goes beyond matrix remodeling. For example, MMP-2 has been
identified as an intracellular signaling molecule capable of modulating fibroblast proliferation
and fibrotic process in non-valve tissues85-87. The expression of MMP-2 is often found in -SMA
positive VICs70, however whether MMP-2 has similar proliferative and fibrotic effects on VICs
as observed in other cell types is unknown.
Although the involvement of MMPs and TIMPs in the pathogenesis of CAVD is evident, the
mechanisms leading to changes in the expression and/or activity of these endopeptidases is not
known. VICs have been reported to produce some of the MMPs and TIMPs. Studies have
demonstrated stimulation of the synthesis and activation of MMP-1 and MMP-2 in VICs by
proinflammatory cytokines such as interleukin-171 and tumour necrosis factor-72. Other ECM
proteins such as tenascin C have been shown to stimulate MMP-2 expression and gelatinolytic
activity in cultured VIC culture88. Tenascin-C is a multifunctional ECM glycoprotein known to
regulate cell proliferation, migration, differentiation and apoptosis89. The expression of
tenascin-C increases proportionally with the severity of valve calcification90 and is co-localized
with -SMA positive valve cells88. Further, the expression and activation of MMPs can be self-
regulated. For example, the activation of MMP-3 can trigger the activation of MMP-1 and
MMP-9. In addition to VICs, inflammatory cells that often infiltrate diseased leaflets can also
produce MMPs82, which may potentiate the development of CAVD.
15
2.3.3.5. Extracellular Signals: Cytokines and Growth Factors
Cytokines and growth factors are known to modulate AV pathogenesis (Table 2.3). The TGF-β
superfamily consists of a wide range of regulatory proteins, some of which are upregulated in
calcified AVs. The most frequently studied is TFG-1, a multifunctional cytokine that regulates
proliferation, phenotype, differentiation and fibrosis, with diverse functions in the vascular
system. Its ability to induce -SMA expression in myofibroblast precursors is indicative of its
role in myofibroblast differentiation65. Of note, TGF-1 accelerated the differentiation of
cultured VICs into -SMA positive myofibroblasts via Smad signaling and its myofibrogenic
effect was repressed by fibroblast growth factor (FGF-2)64. Jian et al identified abundant TFG-1
expression and a moderate decrease in TFG-1 receptors (RI and RII) in calcified human AV in
comparison to normal AV69. The effect of TGF-1 in culture is multifaceted, including
stimulation of MMP-9 transcript expression, MMP-2 activity74, ALP activity74, and apoptosis-
dependent calcification by VICs69. Other members of the TGF- superfamily, the bone
morphogenetic proteins (BMPs), are also upregulated in calcified AVs91. Cell culture with
BMP-2, BMP-4 or BMP-7 was found to promote calcification by VICs92. These data suggest the
involvement of proteins from the TGF- superfamily in CAVD pathogenesis.
Receptor activator of nuclear factor B (RANK), its ligand (RANKL), and the soluble receptor
osteoprotegerin (OPG) are cytokines of the tumour necrosis factor superfamily known to regulate
bone turnover, and vascular and valvular calcification. The activation of the RANK-RANKL
pathway promotes osteogenic differentiation of vascular smooth muscle cells (reviewed in98).
OPG, a soluble decoy receptor, binds to RANKL to inhibit its interaction with RANK. RANKL
and OPG are differentially expressed in calcified AVs, with RANKL expression co-localized
with areas of calcification and OPG downregulated93. RANKL treatment on cultured VICs
elevated MMP-1and MMP-2 activities72, DNA binding activity of the transcription factor
Cbfa-1/Runx2, bone-related matrix protein expression (e.g., ALP and osteocalcin) and
calcification84. These data suggest that RANKL promotes valvular calcification whereas OPG
elicits anti-calcific effects.
16
Table 2.3. Biochemical factors in valve sclerosis and calcification
Factor General functions Expression in sclerotic/calcified AV*
Effect on AV
Cytokines and growth factors TFG-1 Proliferation, differentiation of
myofibroblast 69 Pathologic
BMP Promote bone and cartilage formation
91 Pathologic
FGF Wound healing response Data not available Pathologic RANKL Bone development,
Connective tissue remodeling 93 Pathologic
OPG Bone resorption 84 Protective Transcription factors
Sox 9 Chondrocyte differentiation 94 Pathologic Cbfa-1/Runx2
Osteoblast differentiation 49 Pathologic
Smad-3 Mediate multiple signaling pathways
(Unpublished data) Pathologic
Egr-1 Proliferation, differentiation and engagement in cell death pathways
95 Pathologic
Other physiological factors ACE Lipoprotein oxidization,
Lipoprotein retention 96 Pathologic
BNP Vasodilation, natriuretic activity (In circulation) 97 Pathologic CNP Vasodilation 19 Protective
* Upregulated expression; Downregulated expression
2.3.3.6. Intracellular Signal: Transcription Factors
An increase in the expression of various transcription factors in aortic valves has been linked to
CAVD (Table 2.3). These factors are often associated with VIC differentiation into pathologic
osteoblasts and myofibroblasts. The transcript expression level of Sox9 and Cbfa1/Runx2, which
are transcription factors for chondrocyte and osteoblast differentiation respectively, were
significantly increased in calcified AVs49, 94. Mechanistically, it has been identified that Notch
homolog 1 (Notch1) regulates osteogenic differentiation by repressing Cbfa1/Runx2
transcriptional activation99 and BMP2 signaling100. Genetic research discovered a Notch1
mutation in a family of individuals who had bicuspid aortic valves and calcific aortic valve
disease. Individuals in the family with calcified tricuspid aortic valves also had a Notch1
mutation. Additionally, a Notch1 frameshift mutation was identified in an unrelated family with
17
similar aortic valve diseases. Subsequent in vitro and in vivo studies confirmed that Notch1
signalling regulates the development of aortic valves and calcification by VICs100. Inhibition of
Notch signaling in cultured VICs led to an increase in valve calcification and upregulated
expression of bone-related transcripts. Additionally, heterozygous Notch1-null
(Notch1+/-) mice had greater than five-fold more aortic valve calcification than age- and sex-
matched wildtype littermates100. These data suggest a signaling pathway that regulates activity of
transcription factors and calcification in CAVD. Egr-1 is another transcription factor that may
play a role in valve calcification. It is a nuclear phosphoprotein that regulates the transcription of
a diverse group of genes such as TGF-1, TNF-, basic fibroblast growth factor, MMPs, and
tenascin-C. Its expression was found upregulated in calcified AVs95. In vitro, the expression of
Egr-1 was upregulated in VICs cultured on non-calcifying substrates, but downregulated in
parallel with an upregulation of osteopontin and tenascin-C in VICs cultured on pro-calcific
substrates95. These confounding in vitro and in vivo results suggest further investigations are
required to determine the precise regulatory function of Egr-1 in cell-mediated calcification.
Transcription factors that regulate the differentiation of fibroblastic VICs to pathological
myofibroblasts may also play a role in CAVD. The Smad3 transcription factor was reported to
mediate myofibroblast activation of cultured porcine VICs, leading to an increase in -SMA
expression64. Similarly, our laboratory observed co-localized expression of Smad3 and -SMA
in sclerotic porcine AVs (unpublished data).
2.3.3.7. Natriuretic Peptides and Cardiovascular Disorders
Recently, increasing attention has been drawn to the role of natriuretic peptides in CAVD
pathogenesis. The family of natriuretic peptides consists of A-type natriuretic peptide (ANP), B-
type natriuretic peptide (BNP), C-type natriuretic peptide (CNP) and Dendroaspis-type
natriuretic peptide (DNP). ANP, BNP, CNP and DNP differ in their structures and functions.
Traditionally, these peptides are known to maintain blood pressure and volume, but other
physiological functions including their role in pathoregulation of cardiovascular diseases have
been recognized in recent years. ANP, BNP and CNP mediate their physiological effects by
binding with membrane receptors: natriuretic peptide receptor type A (NPR-A), natriuretic
peptide receptor type B (NPR-B) and natriuretic peptide receptor type C (NPR-C). NPR-A and
NPR-B are guanyly cyclase-coupled receptors that potentiate the catalytic conversion of
18
guanosine tri-phopshate (GTP) to cyclic guanosine monophosphate (cGMP). NPR-A has high
affinity to ANP and BNP101, whereas NPR-B is activated by CNP102. NPR-C binds to all three
natriuretic peptides. It is known as the “clearance receptor” because it lacks enzymatic activity
and it can remove natriuretic peptides from the extracellular environment through receptor-
mediated internalization and degradation103.
The study of natriuretic peptides in maintaining valve homeostasis is an emerging research field.
There have been an increasing number of studies that demonstrate the relation between BNP,
CNP and valve pathogenesis. The expression of circulating BNP, a 32 amino acid polypeptide
secreted by cardiac atria and ventricles, and its N-terminal fragment (NT-pro BNP) were
elevated in patients with aortic stenosis and the levels correlated proportionally with disease
severity97. BNP and NT-pro BNP have therefore been considered as potential diagnostic
biomarkers of valve stenosis104.
CNP is expressed and stored as a prepropeptide that consists of 103 amino acids. The prepro-
CNP becomes biologically active upon cleavage by furin into a 53 amino acid peptide or by an
unknown enzyme into a 22 amino acid peptide105 CNP binds with NPR-B receptors and induces
cGMP synthesis, which subsequently activates downstream signaling molecules to mediate its
diverse biological effects. For example, cGMP-dependent protein kinase I (PKG I) is activated
by CNP/NPR-B/cGMP signaling, which regulates cardiac contractility106. In the skeletal system,
CNP/NPR-B signaling regulates endochondral ossification via mitogen-activated protein kinase
(MAPK) pathways107, 108.
In calcified human AVs, the expression of CNP and furin were downregulated19. As mentioned
previously in this chapter, microarray studies of healthy porcine aortic valve endothelial cells
found higher expression of CNP on the disease-protected ventricular side6 in comparison to the
ECs on the disease-prone aortic side. In cultured VICs, CNP was able to suppress the formation
of TGF-1 induced calcific aggregates109. These data suggest a plausible protective role of CNP
against valve sclerosis and calcification and is one of the motivations of the current thesis work.
CNP is widely recognized to regulate fibrosis. For example, administration of CNP in animal
models reduced fibrosis associated with vascular intimal thickening110, pulmonary fibrosis111,
and myocardial infarction112. Its efficacy in preventing cardiac fibrosis after myocardial
19
infarction in rats has led to the postulation that CNP might have a potent inhibitory effect on
proliferation of myofibroblast-like cells112. However, it is unclear whether VICs respond to CNP
in a similar manner as observed in other cell types, and more importantly if CNP modulates any
of the cell-mediated pathological processes in CAVD.
2.3.3.8. Progress in Therapeutic Development
Although surgical replacement of the stenotic valve is an established procedure with relatively
high success rate (i.e., operative mortality of less than 10%)113, the operative mortality risk
increases markedly with the presence of other medical complications114 and age115, 116. Further,
many cardiovascular complications may occur in association with the usage of general
anesthesia, thoracotomy and a heart-lung machine. Non-invasive medical treatment, which can
interfere with pathological processes to either halt disease initiation in high-risk patients or slow
disease progression into stenosis, will minimize the need for surgery. The development of
pharmacological therapies for CAVD is ongoing and a number of these compounds have been
tested in animal models or clinical trials. However, the outcome of these clinical studies are
controversial, inconclusive and in some cases, unsuccessful.
LDL accumulation is present at the early stage of CAVD and continues as lesions progress. The
co-localization of angiotensin converting enzyme (ACE) with oxidized LDL in diseased leaflets
suggests a possible role of the renin-angiotensin system in retention and oxidization modification
of LDL96. Retrospective study of patients with mild to moderate aortic stenosis demonstrated no
improvement in these patients upon treatment with an ACE inhibitor117. Consistent with this,
O’Brien et al also found that ACE inhibitors failed to abolish the occurrence of aortic stenosis,
but treated patients experienced a slower rate of disease progression118.
Lipoprotein deposition may be controlled by interfering with the rate-limiting step of cholesterol
biosynthesis with 3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) reductase inhibitors
(statins), which inhibit the conversion of HMG-CoA into mevalonate. In cultured VICs, statin
treatment reduced the expression of inflammatory cytokines92, ALP activity73, osteocalcin
expression92 and calcific aggregate formation73, 119, 120, however its mechanism of action remains
unclear. Wu et al. showed the inhibitory effect of statins on aggregate formation by VICs
occured via inhibition of the mevalonate-dependent cholesterol biosynthesis pathway
20
independent of protein prenylation119, whereas Monzack et al found that the decrease in
aggregate number was achieved via modulation of ROCK signaling pathway, and did not rely on
the mevalonate-dependent cholesterol biosynthesis120. Retrospective clinical trials with statins
identified a reduction in calcium accumulation and progression of aortic stenosis117. However,
data from prospective clinical trials are contradictory, with the Scottish Aortic Stenosis and Lipid
Lowering Therapy (SALTIRE) trial indicating statins fail to halt or reverse the progression of
calcific aortic stenosis121 in patients with advanced aortic stenosis, whereas the Rosuvastatin
Affecting Aortic Valve Endothelium (RAAVE) study demonstrated that in patients with
moderate to severe aortic stenosis and hyperlipidemia, statin therapy slowed the progression of
aortic stenosis122. The patient conditions and the assessement criteria of the effectiveness of
statins on CAVD were significantly different in those two clinical trials, which might have led to
the discrepancies in the clinical outcomes. Further, the most recent clinical trial, Simvastatin and
Ezetimibe in Aortic Stenosis (SEAS), demonstrated no effect in mediating CAVD123.
Nonetheless, ongoing prospective clinical trials such as Aortic Stenosis Progression Observation:
Measuring the Effects of Rosuvastatin (ASTRONOMER) and Stop Aortic Stenosis (STOP-AS)
will help delineate the patient populations with aortic stenosis that might benefit from statin
therapy. Other agents that have been considered as potential therapeutics are neutral
endopeptidase124, angiotensin type 1 anatogonists125 and MMP inhibitors (reviewed in126).
However, further investigations are necessary to verify the protective effect of these agents
against CAVD. The molecular mechanisms targeted by these potential agents, including those
that have been tested clinically, remained poorly understood. In vitro VIC studies may facilitate
the identification of cellular mechanisms of these therapeutic interventions prior to animal and
clinical tests.
2.4. Mechanobiology Although it is generally recognized that biochemical factors influence functions and phenotypes
of valve cells, recent studies have shown that these cells, similar to others, are also responsive to
mechanical cues from their microenvironment. Valve cells experience an array of mechanical
forces including shear stress, compression, tension and flexure (reviewed in127), some of which
have been shown to regulate VIC behaviour. For instance, cyclic strain reduces the expression of
pro-inflammatory genes by VICs128, clearly demonstrating the mechanosensing ability of this
21
cell type. Presumably, VICs are similar to other adherent cells in the body, which require
interactions with the ECM to maintain proper physiologic function. The regulation of cell
functions by the ECM has traditionally been recognized purely as a series of biochemical
processes involving interactions between matrix proteins (e.g., collagen, elastin, and
proteoglycans) and cell surface receptors. It is increasingly evident that adherent cells are
responsive to the inherent mechanical properties of the ECM in vivo as well as the adhesion
substrate in vitro. As reviewed in this section, the stiffness or rigidity of the adhesion surface
(i.e., matrix stiffness) is a potent regulator of cell morphology129, differentiation130, 131 and
mineralization132 in various non-valve cell types. Matrix stiffness has important clinical
implications in disease (reviewed in133) such as osteoporosis, atherosclerosis16 and liver fibrosis7,
in which progression of these diseases often involve alterations of the physical properties of the
ECM. However, the role of matrix stiffness in valve pathogenesis has yet to be identified, partly
due to the lack of study of mechanobiology of VICs as well as suitable culture systems that can
decouple biochemical cues from mechanical cues. In this section, the mechanisms by which cells
sense the stiffness of their microenvironment are described. A summary of experimental
approaches and findings related to matrix mechanics-mediated cell responses are presented. The
association of matrix stiffness with various pathologies is discussed.
2.4.1. Definition of stiffness
Stiffness is the resistance of an elastic material to deformation by an applied stress and is
typically measured in Newtons per metre (N/m). The inherent stiffness of an isotropic elastic
material (independent of specimen geometry) can be described by the elastic modulus (E), which
is the ratio of stress over strain within the linear range (Hooke’s Law); its unit is N/m2 or Pascal
(Pa). Elastic modulus can be calculated from the slope of the linear region of a stress-strain curve
that is experimentally determined from tensile tests or compression tests. Alternatively, the
inherent stiffness of a material can be represented by the shear modulus (G). The shear modulus
can be determined by measuring the deformation of an object when a force is applied parallel to
one face of the object while the opposite face is held fixed by another equal force. The unit of
shear modulus is Pascal (Pa). Most cells and tissue have elastic moduli on the order of 101 to 106
Pa (Table 2.4), which is much more compliant than glass or tissue-cultured treated polystyrene
(TCPS) commonly used in cell culture. Therefore, studies of the effects of substrate stiffness on
22
cell function may not only improve our understanding of cell mechanobiology in general, but
also may clarify the interpretation of in vitro data and better relate these data to in vivo settings.
Table 2.4. Compliance of culture materials and tissues
Culture materials/ tissues Compliance (Pa) TCPS ~ 1012 Pa134 Glass ~ 1012 Pa135 Early atherosclerotic lesion ~ 3 x 104 – 5 x 104 Pa16 Mature collagenous bone > 105 Pa130 Brain ~ 102 – 103 Pa130 Striated muscle ~ 8 x 103 – 17 x 103 Pa136 Tendon and cartilage ~ 106 Pa137 Liver ~ 3 x 102 – 6 x 102 Pa137 Fibrotic liver ~ 2 x 104 Pa137 Mammary glands ~ 1.5 x 102 Pa138 Breast tumours ~ 4 x 103 Pa138
2.4.2. Stiffness Sensing
While it is clear that cells response to matrix mechanics, the molecular mechanisms by which
load-sensitive cells process mechanical cues into intracellular signals are still open to
investigation. Traditionally mechanotransduction was recognized as the balance of external-
internal force leading to the sequential processes of “force-signaling-response”; however, it is
increasingly apparent that mechanotransduction requires the interplay of physical and
biochemical signals in a dynamic feedback system involving the interactions of the ECM,
surface receptors and the cytoskeleton (Figure 2.4). The formation of contacts between cells and
the ECM through surface receptors is a crucial component of mechanosensing. Integrins, a
family of transmembrane heterodimeric glycoproteins with - and - subunits, are one of the
most studied mechanosensing surface receptors. Integrin activation begins with conformational
changes of the integrin - and - subunits, which is essential for the initiation of focal
complexes. The binding of integrins to ECM proteins induces the recruitment of scaffolding
proteins inside the cell to physically link the ECM with the actin cytoskeleton at the site of focal
adhesions139. Some of the proteins known to facilitate integrin-cytoskeleton linkages include
talin140, integrin-linked kinases141 and tensin142. The maturation of focal complexes into focal
adhesions depends on the force applied to the ECM-integrin-cytoskeleton connections either
externally (e.g., ECM motion) or internally (e.g., actin polymerization). Mature focal adhesions
23
are localized at the termini of stress fibers, consisting of bundles of actin filaments. The
participation of focal adhesions in sensing matrix stiffness is evident with the suppression of
focal adhesion maturation and reduced phosphorylation of focal adhesion kinase in cells cultured
on compliant substrates143. Further, myofibroblasts lacking the cytoskeleton protein, -SMA, fail
to form mature focal adhesion144, emphasizing the importance of internal actin-mediated force
generation in this process. Of note, -SMA is an abundant cytoskeleton protein found in smooth
muscle cells and myofibroblasts. Polymerization of monomeric -SMA into filamentous actin is
associated with increased cellular contractility. Interestingly, the expression of filamentous
-SMA is dependent on matrix stiffness, suggesting a role of cell-generated tension in regulating
filament formation (reviewed in145) as well as a bi-directional communication between integrin-
ECM adhesion and the actin cytoskeleton.
Matrix stiffness influences integrin-ECM contacts as well as the formation and maturation of
focal adhesions. Formation of focal adhesions and reorganization of the cytoskeleton in
mechanically loaded cells are associated with biochemical signaling pathways known to
modulate cell differentiation, shape, proliferation and motility (summarized in Table 2.5; also see
detailed reviews 146-148). Many of these biochemical pathways are differentially activated on
substrates of different stiffnesses. For instance, RhoA has been widely implicated in integrin-
mediated signaling and mechanotransduction, and was found to modulate substrate stiffness-
dependent osteogenic differentiation in pre-osteoblasts131, 132. Notably, the signaling pathways
involved in stiffness-mediated responses depend on the chemical nature149, 150, the spatial
distribution151, 152, and the topography153 of the adhesive surface, which affect ECM-integrin
interactions and the subsequent activation of specific biochemical pathways. Therefore, substrate
stiffness and surface chemistry responses are often coupled, which can confound interpretation
of experimental data obtained from some of the culture systems.
24
Figure 2.4. The interplay of physical and biochemical signals in a dynamic feedback system
involving the interactions of ECM, surface receptors and cytoskeleton (adapted from154)
Mechanosensing is not a sequential process of “force-signaling-response”; rather it requires the
cell to continually probe and respond to the physical properties of their substrate.
2.4.3. Test Systems: Engineering the Stiffness of Culture Substrata
Various culture systems have been developed to study the effect of substrate mechanics on cell
function (Table 2.6), with hydrogels being the most commonly used. Hydrogels are networks of
natural and/or synthetic polymer chains that are water-soluble. Natural polymers made of ECM
proteins such as collagen, polysaccharide and MatrigelTM are often used because of their
physiologic relevance and their ability to undergo polymerization without the addition of toxic
cross-linking agents. Changing the stiffness of natural polymer-based systems is accomplished
by either altering the concentration of the proteins, the physical constraints, the geometry of the
system or by thermal/chemical treatment of the polymers. However, each of these approaches
has drawbacks. For example, alteration of protein concentration simultaneously alters the
stiffness, the density and the distribution of ECM adhesion ligands, which complicates
interpretation of cellular responses as cell processes are regulated by both stiffness and ligand
density155. The use of thermal or chemical treatment of polymers to modify the extent of cross-
linking often denatures ECM proteins, again affecting surface chemistry. Alteration of the
physical constraints or the geometry of the system lacks the ability to fine-tune substrate
stiffness. Nonetheless, natural polymers remain an excellent culture platform because of their
25
physiologic relevance, potential use as implantable biomaterials and their high adhesiveness to
cells making it an easy platform to use with minimal experimental optimization (reviewed in10).
Alternatively, synthetic polymeric gels offer several advantages over natural polymer-based
systems as tools to study matrix regulation of cell function. Synthetic polymeric gels are inert
and stiffness can be varied over a wide range (e.g., shear moduli of polyacrylamide gels range
from 10 Pa to 5 x 103 Pa) by changing the cross-linker concentration129. The surface can then be
functionalized by coating with physiologically- relevant ECM proteins for cell adhesion. This
allows one to control both the density and the spatial distribution of the ligands while
independently varying the stiffness, therefore decoupling surface chemistry from matrix
mechanics. However, our laboratory has observed that the standard surface functionalization
procedure for polyacrylamide gels often leads to poor adhesion of primary VICs. Additional
efforts to improve surface functionalization are necessary to provide better substrate-cell
interactions.
2.4.4. Effect of Matrix Stiffness on Cell Response
The effect of substrate mechanics on cell phenotype and function has been demonstrated in two-
dimensional cultures (i.e., cells grown on top of the substrate) and in three-dimensional cultures
(i.e., cells embedded within the matrix). As reviewed below, several recent studies have reported
that regulation of cell shape, spreading, migration, growth and differentiation by matrix stiffness
is cell-type specific.
2.4.4.1. Cell Shape and Spreading
The size and the spatial distribution of cell-ECM contacts are determined by the extent of cell
spreading. The cell arranges its cytoskeleton to exert force against its adhesive contacts, defining
the amount of force that can be exerted against the ECM. It is believed that the extent of cell
spreading determines the reorganization of the cytoskeleton and the magnitude of force that the
cytoskeleton can generate156. This in turn regulates a series of cellular processes including cell
migration157, ECM remodeling158 and apoptosis152. Cells cultured on stiff substrates generally
spread more. 129. When cells are cultured on substrates with discrete changes in stiffness159, cells
migrate toward stiffer regions of the substrate. Presumably, reduced cell spreading on compliant
substrate is related to the formation of fewer and smaller focal adhesions and reduced
26
cytoskeletal tension, resulting in smaller tractional forces generated by the cell160. Notably, the
effect of matrix stiffness on cell spreading and migration is cell type specific: for example, the
stiffness at which migration rate is maximal differs for smooth muscle cells161, preosteoblasts132
and neutrophils129, suggesting the necessity to study mechanoregulation of each cell type
individually.
Although it may seem that mechanically-regulated cellular responses are mediated through
changes in cytoskeletal structure, leading to deformation of the plasma membrane and changes of
cell shape, mechanotransduction can occur without large-scale changes in cell shape. Direct
application of mechanical stress to cell surface receptors with a magnetic twisting device was
able to induce focal adhesion formation and cytoskeleton stiffening without changes in global
cell shape162. In addition, studies that constrained cell shape still displayed different focal
adhesion dynamics on compliant versus stiff substrates163, suggesting the relation between
stiffness sensing and cell shape is more complex than originally anticipated.
2.4.4.2. Cell Growth and Death
Cells generally proliferate faster on stiffer substrates than on more compliant substrates166, 167,
however the optimal stiffness for proliferation is cell type specific168. It is increasingly clear that
substrate stiffness mediates proliferative effects by manipulating the sensitivity of cells to soluble
growth factors169, 170 and their ability to progress through the cell cycle (reviewed in171).
Engagement of integrins with ECM proteins not only contributes to the formation of focal
adhesions, actin cytoskeleton reorganization and alteration in cell tension, but also to clustering
of integrins that promotes the activation of signaling components such as growth factor receptors
and their downstream targets such as phosphoinositide-3 kinase/Akt survival signaling172. For
example, binding to αvβ3 integrin is associated with the activation of platelet-derived growth
factor (PDGF) receptor, the insulin and insulin-like growth factor-I (IGF-I) receptors, and the
vascular endothelial growth factor (VEGF) receptor-2, supporting the role of integrin-based
matrix adhesion in cell growth-related intracellular signaling173.
27
Table 2.5. Matrix stiffness mediated cellular responses
Response Matrix stiffness Cell type Reference Osteogenic differentiation increases with substrate stiffness involving activation of MAPK pathway downstream of RhoA and ROCK.
Soft substrate ~ 7 kPa Stiff substrate ~ 160 kPa
MC3T3-E1 Khatiwala et al. 2009164
Greater cell spreading with higher expression of actin stress fiber and focal adhesion on stiff substrate.
Soft substrate ~ 1 kPa Stiff substrate ~ 8 kPa
Smooth muscle cells
Engler et al. 2004136,
155
Cell shape and spreading unaffected by substrate stiffness.
Soft substrate ~ 2 kPa Stiff substrate ~ 1012 Pa
Neutrophils Yeung et al. 2005129
Cells differentiated to neuronal, myogenic and osteogenic lineages when cultured on soft, immediate and stiff substrate, respectively.
Soft substrate ~ 0.1 – 1 kPa Immediate stiffness ~ 8 –17 kPa Stiff substrate ~ 25 – 40 kPa
Marrow-derived mesenchymal stem cells
Engler et al. 2006130
Formation of focal adhesion and stress fibers depends on substrate stiffness.
Soft substrate ~ 1 kPa Stiff substrate ~ 300 kPa
Smooth muscle cells
Peyton et al. 2005161
Soft substrate downregulated cyclin D1 and upregulated p27Kip1, leading to reduced cell proliferation.
Free floating gels (soft) Constrained gels (stiff)
Fibroblasts Fringer et al. 2001165
Formed striations only when cultured on intermediate (~ 11 kPa) stiffness.
Substrates at 1, 8, 11 and 17 kPa
Myoblasts Engler et al. 2004136
28
Table 2.6. Advantages and disadvantages of various culture systems for studying the effect
of substrate stiffness
Substrate Advantages Disadvantages Collagen - Easy to handle
- Physiologic relevant - Readily adhesive to cells - Can support 3D culture - Can decouple substrate chemistry from mechanics if stiffness is adjusted by changing the geometry in 2D culture
- Cannot support a wide range of stiffness, unless concentration of collagen is adjusted
MatrigelTM - Can tune the stiffness by cross-linking the gels using glutaraldehyde
- Heterogeneous composition and batch-to-batch variability - Cannot decouple substrate chemistry from mechanics as stiffness is adjusted by altering the concentration of MatrigelTM
Fibrin - Can support 3D culture - Cannot decouple substrate
chemistry from mechanics
Agarose - Easy to handle - Not readily adhesive to cells, requires surface modification - Cannot decouple substrate chemistry from mechanics
Polyacrylamide - Can adjust to a wide range of stiffness
- Limited to 2D culture - Cross-linker is toxic to cells - Requires surface functionalization
Poly(ethylene glycol) - Can adjust to a wide range of stiffness - Can generate 3D culture - Has physical characteristics similar to those of soft tissues, e.g., permeable to oxygen, nutrients and water-soluble metabolites
- Requires surface functionalization - When used in 3D culture, substrate chemistry and mechanics cannot be decoupled
Polydimethylsiloxane - Can adjust to wide range of stiffness - Surface chemistry and substrate stiffness are decoupled
- Surface functionalization is difficult - Can only support short culture periods of a few days
29
Substrate stiffness modulates proliferation by interfering with cell cycle progression (i.e., the
cycle of G1 phase, S phase, G2 phase and M phase). Focal adhesion kinase (FAK) and actin
polymerization were found to regulate the expression of the cell cycle regulatory proteins and
cylcin-dependent kinases (cdk) through extracellular signal-regulated kinase (ERK), Ras and
Rho signaling pathways depending on the level of compliance. For example, cells cultured on
free-floating collagen gels exhibited reduced cell proliferation due to G1 phase arrest, which was
accompanied by reduced FAK autophosphorylation, ERK activity, and absence of cyclin
expression and upregulation of cdk inhibitor expression. Stiffer substrates favour the formation
of mature focal adhesions and FAK activation, which is associated with ERK activation and
ERK-dependent induction of cyclin expression, hence permitting the cells to enter the S phase.
Of note, ERK- and FAK-independent induction of cyclin has also been reported and further work
is required to identify the interplay among the different mechanisms by which substrate stiffness
alters cyclin and cdk expression171.
Without doubt, cell-ECM contacts are an important aspect of stiffness sensing. It is also known
that the lack of a firm adhesive substrate contributes to anoikis (a type of apoptosis which is
induced by the detachment of cells from their adherent surfaces). Presumably, the higher number
of mature focal adhesions in cells cultured on stiffer substrates provides a firm adhesive substrate
and protects the cells from apoptosis. This notion is supported by the reduction in apoptosis of
pre-osteoblasts when cultured in stiffer substrates174. It is known that apoptosis is associated
with integrin signaling and cytoskeleton content175, but the direct relation between stiffness-
mediated cytoskeleton reorganization and apoptosis remains unknown.
2.4.4.3. Cell Phenotype and Differentiation
While the potential of mesenchymal stem cells to differentiate into a diverse range of lineages is
well-known, other cell types in the body such as VICs can also undergo phenotypic changes
during pathologic differentiation47, 49. Recent studies demonstrate that cellular differentiation is
not only regulated by soluble factors and matrix composition, but also depends on substrate
stiffness. Notably, cells appear to express their differentiated phenotype in vitro on substrates
that are similar to the stiffness of their native ECM130, 136. It has therefore been postulated that
changes in tissue mechanics during pathologic development may partly contribute to cellular
pathological differentiation16, 176. Further, matrix stiffness-induced phenotypic alterations may
30
influence the interpretation of in vitro studies, which are often conducted with glass or TCPS that
are orders of magnitude stiffer than any tissue. Lastly, the fundamental understanding of matrix
mechanics in regulating differentiation has substantial influence on the development of
biomaterials for tissue engineering as material stiffness may influence cell differentiation and
functions.
The ability to differentiate stem cells into a desired lineage is important in tissue engineering and
regenerative medicine. Interestingly, Engler’s study showed that mesenchymal stem cells
differentiate into different lineages as a function of substrate stiffness130. Mesenchymal stem
cells grown on substrates with brain-like compliance (E ~ 0.1-1 kPa) underwent neuronal
differentiation. Myogenic differenation was observed in cells cultured on substrates of
intermediate stiffness (E ~ 8-17 kPa) and osteogenic differentiation was found in cells grown on
relatively stiff substrates (E ~ 25-40 kPa). These data suggest that cells are able to recognize
physiologically relevant substrate stiffnesses and differentiate accordingly. Engler et al further
demonstrated that soluble factors and matrix stiffness synergistically guide MSC commitment to
particular lineages130.
The effect of substrate stiffness on differentiation is not limited to progenitor cells, but also
impacts on various cell lines and committed mammalian cells (e.g., pre-osteoblastic cells,
hepatocytes, myofibroblasts, VICs). One of the most frequently studied cell lines is the pre-
osteoblastic MC3T3-E1 cell line, which displays substrate stiffness-dependent osteogenic
differentiation and calcium deposition. When MC3T3-E1 cells were cultured on substrates
coated with RGD rather than full-length type I collagen, osteogenic differentiation was optimal
on more compliant substrates (E = 20 kPa)177. However, the same cells cultured on type I
collagen-coated substrates deposited more bone mineral on stiff substrates (E > 20 kPa)132.
These differences may result from the unique engagement of integrins to particular ECM
proteins (i.e., typically αvβ3 and α5β1 integrins interact with RGD and α2β1 interacts with type I
collagen), which together with matrix stiffness differentially regulate cellular differentiation.
This emphasizes the importance of decoupling surface chemistry from substrate mechanics.
Similar matrix stiffness effects on cell-mediated calcification were also found in VICs. An
increase in calcium deposition by VICs was identified when cultured on fibrin-modified TCPS
(i.e., a stiff substrate) in comparison to those cultured on fibrin-modified soft polyethylene
31
glycol178. These results demonstrate that matrix stiffness regulates cell-mediated calcification.
Calcification by cultured cells is associated with integrin binding and FAK activation149.
Presumably, substrate stiffness may regulate calcification by influencing integrin binding, focal
adhesion signaling, and possibly cytoskeleton reorganization, although further studies are
necessary to decipher the precise molecular mechanisms.
Matrix stiffness also regulates and maintains the differentiation of committed cell types. This has
implications in disease development, where ECM composition and tissue compliance are often
altered and phenotypic changes of cells are observed. For example, hepatocytes cultured on soft
substrates (e.g., collagen gels and MatrigelTM of G′~ 34 Pa) remain differentiated179, whereas
those cultured on stiff substrates (e.g., collagen film and cross-linked MatrigelTM of G′~118 Pa)
adopt a dedifferentiated phenotype179, 180. Another example is the differentiation of fibroblasts to
contractile myofibroblasts in wound repair, in which matrix stiffness, cell tension, and TGF-β
release are all required to promote and maintain myofibroblast differentiation that is responsible
for wound closure (reviewed in137, 181). In vitro studies of myofibroblasts cultured on stiff
constrained collagen gels (E ~ 20 kPa) responded to TGF-β and expressed a high level of
-SMA and abundant stress fibers. In contrast, cells cultured on free floating (more compliant)
collagen gels (E ~ 8 kPa) had reduced -SMA expression and stress fibers regardless of the
presence or absence of TGF-β, suggesting that matrix stiffness regulates cellular sensitivity to
soluble factors related to myofibroblast differentiation12.
2.4.5. Matrix Stiffness and Pathologies
Regulation of cellular responses by substrate stiffness is not just an in vitro phenomenon, but
also has relevant clinical implications. Studies have linked matrix stiffness to various pathologies
such as cancer, osteoporosis and atherosclerosis. Significant stiffening of tumour tissue has been
correlated with an increase in tumour cell migration and proteolysis182, which has been suggested
to partially explain the failure of protease inhibitors as cancer therapies183, 184. This result
emphasizes the value of understanding the effect of matrix stiffness on the response of cells to
biochemical factors including therapeutics.
Fibrosis and tissue stiffening are often found as liver disease progresses. The differentiation of
portal fibroblasts and hepatic stellate cells into hepatic myofibroblasts is the key pathological
32
mediator. Interestingly, studies with rat models found that liver stiffening occurs prior to
fibrosis7, 185, suggesting that matrix mechanics may induce myofibroblast differentiation in early
liver disease. Matrix stiffness also impacts vascular diseases. Vascular calcification correlates
with arterial stiffening. Dynamic tissue stiffening was found in atherosclerotic lesions, in which
the initial soft lesion was mainly composed of foam cells, and subsequent stiffening of the lesion
was accompanied by the presence of smooth muscle cells. Further stiffening of the artery occurs
when there is marked calcification within the tissue (Figure 2.5). These data suggest a close
correlation between tissue stiffness and its pathology16. Although atherosclerosis and CAVD
shared many risk factors and disease features, it has yet to be established if similar mechanical
changes occur as the disease progresses from lipid deposition to fibrosis to eventually the
formation of calcific nodules. Studies with normal and abnormal mitral valves support a tight
association between mechanical changes and valve pathogenesis186, however such data for the
AV will have to be determined in the future.
33
Figure 2.5. Change in arterial wall stiffness in rabbit fed a high cholesterol diet to induce
atherosclerosis
Foam cells accumulated at the site of lesions after eight weeks on high cholesterol diet. The
stiffness of these early lesions was significantly lower than that of the normal tissue. The
stiffness of lesions increased substantially by week 28, in which marked calcification was found
in the tissue16.
34
Chapter 3 3. Hypotheses, Objectives and Contributions
3.1. Rationale
Myofibroblasts and osteoblasts form in sclerotic, calcified valve leaflets through processes that
are not well-defined47, 49. Although the aortic valve undergoes significant matrix remodeling and
changes in stiffness during CAVD, the role of the mechanical properties of the extracellular
matrix in regulating VIC differentiation have yet to be investigated. Matrix stiffness influences
the differentiation of and mineralization by other non-valve cell types132, 185, and may have
similar effects on VICs. Biochemical factors also regulate the pathological differentiation of
VICs69. One particularly interesting secreted protein is CNP, as it has been identified to
putatively protect against CAVD. CNP regulates calcification and differentiation of other non-
valve cell types187, 188 and its anti-fibrotic effect has been demonstrated in animal model
studies110-112, suggesting it may suppress differentiation of VICs into pathological myofibroblasts
and osteoblasts to prevent calcific aortic sclerosis. Furthermore, as matrix stiffness modulates the
response of cells to biochemical factors12, it is expected that CNP-mediated cellular responses
are affected by matrix stiffness.
3.2. Thesis Hypotheses
It is hypothesized that the response of VICs to biochemical stimuli is regulated by matrix
stiffness, which in turn modulates the pathological differentiation of and calcification by VICs.
In particular, I hypothesized that:
I. Matrix stiffness regulates the differentiation of VICs into myofibroblasts and
osteoblasts, phenotypes associated with calcification;
II. CNP, a putative protective agent, suppresses myofibroblast and osteoblast
differentiation of VICs, thereby inhibiting calcification by VICs; and
III. Matrix stiffness, CNP and their combination differentially regulate mRNA expression
by VICs.
35
3.3. Objectives and Specific Aims
The objectives (Roman numerals) and specific aims (Arabic numerals) of this thesis are:
I. To implement and characterize a cell culture system with tunable stiffness
1. Design and fabricate collagen matrices with tunable stiffness
2. Determine the mechanical properties of the matrices
3. Evaluate the surface topography of the collagen matrices
4. Evaluate the integrity of the collagen matrices over culture duration
II. To evaluate the response of VICs to pro-calcific biochemical factors and substrate
stiffness
1. Determine proliferation and morphological responses of VICs cultured on the
collagen-based culture system
2. Utilize the culture system to evaluate the effect of matrix stiffness on calcification by
VICs induced by pro-calcific media
III. To identify the cellular basis of CNP in protecting against valve calcification
1. Investigate the ability of CNP to regulate pathological differentiation of VICs
2. Identify the effect of CNP on calcification by VICs
IV. To identify the transcriptional changes in VICs when exposed to mechanical
stimuli and biochemical stimuli
1. Investigate morphological changes of VICs cultured on compliant and stiff
substrates with and without CNP treatment
2. Investigate if matrix stiffness, CNP and their combination differentially regulate
transcript expression of VICs
3.4. Overview of Contributions
The work presented in this thesis was made possible with the collaborative efforts from various
students and staff. Included in this section is a record of their contributions in implementing and
executing the proposed research ideas.
36
Technical support for the work on matrix stiffness presented in Chapters Four and Five was
provided by: Stephanie Ting, an undergraduate summer research student under my supervision,
who performed the Swinholide A dose-dependent experiment and the cyotoxcity test; Zahra
Mirzaei who did the TGF-1 ELISA and cGMP synthesis assay; Jian Wang and Robert
Chernecky from the Faculty of Dentistry who assisted with scanning electron microscopy; and
Ruogang Zhao who did the finite element models and analyses. I would like to also acknowledge
numerous insightful discussions with Jan-Hung Chen throughout the project.
The study of the effect of CNP on the pathological differentiation of VICs is described in
Chapter Six. The in vitro study of CNP began with the help from Susie Ferrante and Melissa
Filice, who were Grade 12 students under my supervision. Xiao Zhong did the clonal assay
under my supervision with help from Jan-Hung Chen. Zahra Mirzaei did the immunostaining of
CNP, -SMA and Cbfa-1/ Runx2 in valve leaflet sections. Also, I would like to acknowledge
help from Mark Blaser with siRNA transfection experiments. Lastly, the microarray experiments
in Chapter Seven were done by Kelly Jackson and partial data analysis was performed by Zhibin
Lu at the Microarray Centre of the University Health Network.
37
Chapter 4 4. Implementation and Characterization of the Cell Culture
System
A variety of hydrogel-based matrices have been developed to study the effects of substrate
stiffness on cell function. As reviewed in Chapter Two, a common feature of these systems is the
ability to tune the substrate stiffness by either altering the structural stiffness of the matrices or
by altering the elastic modulus of the material that makes up the matrices. Substrate chemistry
and mechanics are not decoupled in some of these culture systems, because adjustment of the
substrate stiffness often requires changes in ECM protein concentration, which alters ligand
availability and density. In the case where synthetic polymers are used to form an inert surface
with defined stiffness, surface modification is needed to increase the adhesiveness of the surface
to cells. Fine-tuning of the substrate stiffness can be achieved in such systems, however surface
modification can be time consuming and costly, and sometimes does not provide the desire
adhesiveness to cells. As shown in our laboratory, primary VICs adhere poorly on
polyacrylamide substrates coated with monomeric collagen. Additional optimization is often
necessary to improve the adhesiveness of these inert polymer-based platforms to specific cell
types189-191. The relatively complex fabrication process and increased cost associated with
surface modification to some extent limits the widespread appeal of these systems for cell
biology studies. To address these issues, we used a collagen gel-based culture system described
previously11 to test the sensitivity of VIC calcification to substrate stiffness. The culture system
was chosen with the following criteria:
Tunable stiffness while maintaining identical surface chemistry
Maintenance of the substrate stiffness for at least five days, as this is the shortest
culture duration necessary for VICs to form calcific aggregates120, 192
Optical transparency for visualization of cells by bright field and fluorescent
microscopy
Composed of ECM proteins that mimic those of native heart valve
The work presented here was published in Arterioscler Thromb Vasc Biol. 2009 Jun; 9(6): 36-42.
38
Ease of handling
Readily supports VIC adhesion and proliferation without any surface modification of
the substrate
The system used in this work satisfied all of these selection criteria. Matrices were composed of
bovine type I collagen, constrained to wells of microtiter plates. Two different stiffnesses were
achieved by changing the thickness of the matrices, while maintaining the same surface area and
chemistry for cell adhesion. We further characterized the culture system by evaluating the
biochemical and mechanical changes that occur in the collagen matrices over the culture period
to better define the relative contribution of substrate stiffness to the observed cellular response.
4.1. Materials and Methods
Unless otherwise stated, all reagents were purchased from Sigma-Aldrich (Oakville, ON,
Canada). Detailed protocols can be found in Appendix A.
4.1.1. Fabrication of Collagen Matrices
Fresh collagen solutions were prepared for each experiment as described previously193. Briefly, a
mixture with the following chemicals was prepared on ice: (1) 0.3 mL 10X concentrated
Dulbecco's Modified Eagle Medium (DMEM); (2) 0.3 mL 0.25 M sodium bicarbonate
(NaHCO3) buffer; (3) 0.3 mL fetal bovine serum (FBS, Hyclone, Logan, UT, lot # KRA25425);
(4) 0.3 mL penicillin/streptomycin mixture; (5) 0.12 mL 0.1 M sodium hydroxide (NaOH)
buffer; and (6) 2.5 mL 3 mg/mL bovine collagen (PureCol, Advanced BioMatrix, San Diego,
California). For thick collagen matrices, 500 L of collagen mixture was pipetted into each well
of a 24-well microtiter plate lined with sterile coverslips. Polymerization of collagen was
achieved by incubating the collagen mixture at 37 oC in a 5% CO2 incubator overnight. To make
thin collagen matrices, the same volume of collagen mixture was applied to the surface of the
well and the coverslips for one minute at room temperature. Excess collagen mixture was then
removed by aspiration, leaving a thin uniform collagen coating in the well that was polymerized
overnight.
4.1.2. Scanning Electron Microscopy for Topographic Evaluation
Thick and thin collagen matrices with or without cells were evaluated by scanning electron
microscopy (SEM). Samples were fixed with 4% formaldehyde, followed by dehydration in a
39
series of ethanol washes at 30%, 50%, 70%, 95% and 100% ethanol for 30 minutes each.
Samples were then critical point dried with liquid carbon dioxide in a Polaron CPD7501,
mounted on SEM aluminum stubs and sputter coated with gold using a Polaron SC 515 SEM
Coating System. The samples were examined at 1,000 X to 5,000 X magnifications using a
scanning electron microscope (Model S-2500, Hitachi Instrument). For collagen matrices
without cells, images were used for estimating the collagen fibril diameters with ImageJ software
(NIH, Bethesda, MD).
4.1.3. Determination of Matrix Mechanics
The effective stiffness of the initial collagen matrices (hydrated) as well as those cultured for
three and eight days was measured in compression using a Biosyntech Mach-1 mechanical test
system (Laval, QC). Constrained thick and thin matrices (n = 4 of each) were compressed within
24-well culture plates using an eight mm diameter loading platen. Load-displacement curves
were recorded, from which the effective stiffness was determined as the initial tangential slope.
To demonstrate the relative difference in the stiffness of the thick and thin collagen matrices
under shear loading that better mimics the tractional forces applied by cells on the matrices, we
performed finite element (FE) analysis using ANSYS (Canonsburg, PA). Two-dimensional,
plane strain FE models of the matrices, representing a vertical slice through the thick and thin
matrices, were constructed. The thickness of the thick and thin collagen matrices was set to the
initial thickness of 2.5 mm and 10 μm, respectively, to mimic the experimental conditions. To
demonstrate the relative difference in shear deformation between the thick and thin matrices, an
arbitrary constant shear force of 0.48 μN/mm was applied to the top surface of both matrices
over the entire width of the model. Eight-node elements were used to discretize the models.
Collagen was modeled as a hyperelastic neo-Hookean material with shear modulus of 30 kPa.
The gels were constrained in both the horizontal and vertical directions on the left and bottom
edges. The right edge of the models was left unconstrained to allow for measurement of the shear
deformation.
4.1.4. Measurement of Collagen Content
Collagen content of the thick and thin matrices was measured by colormetric hydroxyproline
assay after zero, three and eights days in culture. Briefly, collagen matrices were papain digested,
40
followed by release of hydroxyproline with acid hydrolysis using 6 N hydrochloride acid (HCl).
The hydroxlate was then neutralized with 5.7 N NaOH. The extracted hydroxyproline was
oxidized into a pyrrole with 0.05 N chloramine T, followed by treatment with
4-dimethylaminobenaldehyde to develop a colour change. The amount of hydroxyproline was
quantified by measuring the absorbance of the solution at 560 nm.
4.1.5. Statistical Analysis
Results are presented as mean standard error. Samples sizes were at least three in all cases,
and experiments were repeated at least three times. Unpaired Student’s t-test was used for
comparisons between two groups. ANOVA and Fisher’s least significant difference test were
used to evaluate statistically significant differences in multiple group comparisons.
4.2. Results
4.2.1. Collagen Matrices with Tunable Stiffness
Fibrillar collagen matrices were made in wells lined with coverslips. The coverslip facilitates
matrix removal from the well for immunostaining and SEM. Using a similar methodology as
previously described11, collagen matrices of two different stiffnesses were achieved by altering
only the thickness of constrained collagen matrices. This allows the same culture surface area
(~ 2 cm2) and collagen concentration to be used for all culture conditions, hence keeping the
ligand density consistent when cells are seeded on the surface only. Thick collagen matrices
were made with 500 L of collagen mixture, which gave rise to matrices with thickness
approximately 2.5 mm (Figure 4.1). Thin collagen matrices were achieved by coating the
coverslips with collagen mixture of the same concentration (1.97 mg/mL). The approximated
thickness of the thin matrices was 10 m (estimated previously11 (Figure 4.1)).
41
Figure 4.1. Type I collagen matrices
(A) A schematic of the experimental set up and (B) Wells of a 24-well plate with a thick collagen
matrix (top) and a thin collagen matrix (bottom). Cells were subsequently cultured on the surface
of the matrices.
The effective stiffness in this system is dictated in part by the geometry and boundary constraints
of the matrices in the wells, and therefore tensile stiffness could not be measured in situ and
compression tests were performed on constrained collagen matrices instead. Because of the
differences in the matrix thickness, the thick matrices were significantly more compliant than the
thin matrices in compression (P < 0.05, Figure 4.2 A). We performed FE analysis to estimate the
shear loading that mimics the tractional forces applied by cells on the matrices. The model
estimated a maximum shear displacement of 10.16 μm and 0.36 μm for the thick and thin
matrices, respectively (Figure 4.2 B). These results indicate that the effective stiffness of thick
matrices under shear forces was significantly less than that of the thin matrices, as expected and
consistent with the results from the compression tests.
Coverglass
Collagen matrix
Thick (2.5 mm) Thin (10 m)
A B
Thick matrix
Thin matrix
42
Figure 4.2. Mechanical properties of thick and thin collagen matrices
(A) Thin matrices were three times stiffer than the thick matrices in compression. * P < 0.05. (B
and C) FEA model of the thick and thin collagen matrices. The shear displacement was larger on
the thick matrices in comparison to the thin matrices (colour scale bar represents the magnitude
of displacement in mm)
A. B.
0
2000
4000
6000
8000
1 2
*
Co
mp
ress
ive
Stif
fne
ss(N
/m)
Thick Thin
C.
1.88 x 10-4 1.02 x 10-2
0 0.30 x 10-3
4.11 x 10-3
1.31 x 10-4
Displacement (mm)
Displacement (mm)
A. B.
0
2000
4000
6000
8000
1 2
*
Co
mp
ress
ive
Stif
fne
ss(N
/m)
Thick Thin
C.
1.88 x 10-4 1.02 x 10-2
0 0.30 x 10-3
4.11 x 10-3
1.31 x 10-4
Displacement (mm)
Displacement (mm)
43
4.2.2. Substrate Topography
Substrate topographical features, such as fiber diameter, can significantly influence cell
adhesion, migration and proliferation194. Thick and thin matrices displayed uniform fibrillar
collagen microstructure (Figure 4.3: A, B). Collagen fiber diameters ranged from 0.10 to 0.15
m and were not significantly different between the two matrices (P = 0.27, Figure 4.3: C).
These data indicate that alteration of only the thickness of these matrices did not influence the
microstructure of the culture surface.
Figure 4.3. Microstructure of collagen matrices
(A and B) SEM images of thick and thin collagen matrices. (C) Comparison of fibril diameters.
Fibril diameters were not significantly different between the two collagen matrices, P = 0.27.
4.2.3. Collagen Content and Stiffness of Matrices Over Culture Duration
Cells can enzymatically degrade collagen matrices over the culture duration, altering the
thickness of the matrices, which in turn may change the substrate stiffness. To ensure that the
mechanical properties were maintained over the culture duration, we estimated by FE analysis
that a substrate thickness of less than 100 m is required for the cells to “feel” the underlying
A. Thick matrix
B. Thin matrix
0.00
0.05
0.10
0.15
0.20
1 2
Fib
er
dia
me
ter
(m
)Thick Thin
CA. Thick matrix
B. Thin matrix
0.00
0.05
0.10
0.15
0.20
1 2
Fib
er
dia
me
ter
(m
)Thick Thin
0.00
0.05
0.10
0.15
0.20
1 2
Fib
er
dia
me
ter
(m
)Thick Thin
C
44
glass substrate, thereby increasing the perceived matrix stiffness. Experimentally, 30% collagen
degradation was detected over eight days of culturing VICs on the thick substrates (Figure 4.4:
A), which reduced the overall thickness of the thick matrices to approximately 1.75 mm.
Collagen content did not change significantly on the thin substrates (Figure 4.4: B). Consistent
with our FE analysis, this amount of collagen degradation did not affect the effective stiffness of
both the thick and thin matrices (Figure 4.4: C and D).
4.3. Discussion
A variety of hydrogel-based matrices have been developed to study the effect of substrate
stiffness on cell function, many of which lack the ability to decouple surface chemistry with
substrate mechanics. This complicates interpretation of in vitro cellular responses as cell
processes are regulated by multiple factors in the microenvironment including ligand density,
ligand type, substrate stiffness and the microstructure of culture surface (e.g., fiber diameter). In
this study, matrix composition and polymerization conditions were kept constant, while the
volume of neutralized collagen placed in each well was altered. This resulted in matrices of
different thicknesses, but similar microtopographical characteristics.
Matrix stiffness regulation of cell function is often studied using synthetic hydrogels coated with
monomeric collagen or other ECM proteins (reviewed in Yip et al.10). We chose to use fibrillar
type I collagen instead of monomeric collagen to better mimic the native ECM composition in
heart valves, as fibrillar type I collagen is the most abundant ECM protein in aortic valves24.
This may be important as different intracellular signaling pathways are activated when cells bind
fibrillar versus monomeric collagen195, 196. For example, transcript expression197 and
proliferation195 of smooth muscle cells are different when cultured on fibrillar collagen versus
monomeric collagen. It is plausible that a similar effect may apply to VICs, and therefore it was
crucial to keep the polymerization condition consistent to ensure the formation of collagen fibrils
on both thick and thin matrices. In addition, consistent polyermization should also minimize
difference in fiber density between the two matrices. However, further tests are necessary to
confirm if the fiber density is identical in the compliant and stiff matrices.
45
Figure 4.4. Collagen content and effective stiffness of the two matrices over the
course of cell culture
Data were expressed as percentage of collagen remaining relative to day 0. (A) Significant
collagen degradation was observed in thick matrices after eight days of culture (N = 3). * P <
0.05 indicates statistically significant difference in collagen content between matrices from day
zero and day eight. (B) Content of collagen remained relatively constant for the thin matrices.
Stiffness of thick matrices (C) and thin matrices (D) did not change significantly over the culture
duration.
It has been reported in various cell types that integrin binding to polymerized collagen fibrils can
induce the expression of collagenases such as MMP-1198, 199 and MMP-13200. This effect is
particularly important to our culture system because changes in collagen content within the
matrices would alter the overall matrix thickness: if an excessive amount of collagen was
degraded, the matrix could become thin enough that the cells would be able to “feel” the
underlying stiff glass substrate. By selecting the initial thickness (2.5 mm) of the thick matrices
to be substantially larger than that needed to maintain its compliance (estimated to be 100 m in
thickness by FE analysis), we prevented the effects of degradation from impacting matrix
mechanics over the culture duration.
Culture duration
020406080
100120
Day 0 Day 3 Day 8
Pe
rce
nt o
f co
llag
enA B
020406080
100120
Day 0 Day 3 Day 8
0.00.20.40.60.81.01.21.4
Day 0 Day 3 Day 8
Re
lativ
e s
tiffn
ess
n
orm
aliz
ed
to D
ay
0
C D
0.00.20.40.60.81.01.21.4
Day 0 Day 3 Day 8
*
Culture duration
020406080
100120
Day 0 Day 3 Day 8
Pe
rce
nt o
f co
llag
enA B
020406080
100120
Day 0 Day 3 Day 8
0.00.20.40.60.81.01.21.4
Day 0 Day 3 Day 8
Re
lativ
e s
tiffn
ess
n
orm
aliz
ed
to D
ay
0
C D
0.00.20.40.60.81.01.21.4
Day 0 Day 3 Day 8
*
46
The collagen used in this study was commercially available and extracted from bovine hides with
purity between 97 % to 99.9 % (determined using SDS-PAGE by the manufacturer). As it was
not possible to obtain 100 % pure type I collagen extract, because type I collagen naturally
associates with type III collagen in tissues201-203, there might be a small percentage (< 3 %) of
type III collagen present in the mixture. Both type I and type III collagens are fibrillar. Type III
collagen is a potent regulator of type I collagen fibrollogenesis, which modulates the fibril
diameter of type I collagen203. As previously mentioned, fibril diameter influences cell adhesion,
migration and proliferation194. We examined the fibril diameter in the collagen matrices made
from different batches of type I collagen extract, and found that fibril diameter was similar
among these matrices despite the potential of minor type III collagen contamination203. These
data suggest that the small percentage of type III collagen had little impact on cell function
regulated by fibril diameter. In addition, interaction with collagen affects cell adhesion,
migration, proliferation and differentiation mediated through integrin, adhesion molecules from
the immunoglobulin superfamily and discoidin domain receptors (DDR 1 and 2) (reviewed in 204,
205). Of the integrins, 11, 21, 101, 111 are known to bind to various types of collagen206-
208. Type I collagen is thought to primarily interact with 21 integrin, and type III collagen
interacts with integrin 11. However, the I domains from the 1 and 2 subunits demonstrate
similar binding affinities to type I and III collagen209. Further, some members of the
immunoglobulin superfamily have been shown to facilitate cell-integrin interaction; for example
syndecan-1 has been shown to mediate the binding of integrin 21 to collagen210. DDRs can
bind to type I and type III collagen to control cellular responses to the extracellular matrix211,212.
Aortic VICs express predominately 1, 2, 3, 4, 5 and 1 integrin subunits, but little or no
expression of adhesion molecules of the immunoglobulin superfamily (e.g. syndecan-4,
syndecan-1, E-selectin)67. DDRs have been studied widely in non-valve cell types, but the
expression and the function of DDRs in VICs has yet to be identified. As type I and III collagen
both bind to 11 and 21 integrins as well as DDRs, various batches of type I collagen matrices
with small differences in type III collagen contamination would likely elicit cellular responses
via similar receptor binding.
While the initial composition of the collagen matrices was well controlled (i.e., same
concentration and polymerization condition), compositional changes over the culture duration
were probable because of cellular remodeling. Previous studies have demonstrated that
47
calcification by valvular and vascular cells is similar on collagen and fibronectin-coated
substrates26, 213, suggesting that changes in certain ECM components during remodeling would
not impact calcification by VICs. However, characterization of the compositional changes that
occurred in the matrices would better define the relative contributions of matrix stiffness versus
composition.
To manipulate only matrix stiffness, we were limited to a two-dimensional (2D) system, as
decoupling of matrix mechanics and chemistry is not possible with three-dimensional (3D)
fibrillar collagen matrices10. Based on previous studies120, 213, some VIC responses, including
calcification92, are similar in 3D matrices as on 2D surfaces. Data from these previous studies
support the feasibility of using a 2D culture system as a “proof-of-principle” test platform, to
evaluate the effect of matrix stiffness on the calcification by VICs.
In summary, a collagen-based cell culture system with tunable stiffness was achieved by
changing the thickness of the matrices without altering the surface chemistry. Despite the
degradation of the compliant matrices over the culture period, which reduced the overall
thickness of these matrices by 20%, the effective stiffness of both the thick and thin matrices
remained constant. Although fine-tuning of stiffness was not possible in this culture system,
using an ECM protein that is commonly found in native aortic valves provided a culture
environment that was physiologically relevant and avoided the needs of costly surface
modification, which is often required in systems with finely adjustable stiffness. The selection of
a suitable culture system largely depends on the application and the research objectives. Our
current approach provides a simple means to achieve two culture surfaces with significantly
different stiffnesses. This system is sufficient to investigate whether VICs, if at all, sense the
mechanical cues from their microenvironment and how such mechanical cues may influence
their phenotype and calcification.
48
Chapter 5 5. Effect of Substrate Stiffness on Calcification by VICs
Dysregulation of normal cellular processes214, 215 leads to CAVD that often involves chronic
inflammation, fibrosis, and calcification48, 216. The progression of sclerosis and calcification is
mediated primarily by VICs that populate the interstitial matrix54, 214. As in the vasculature217,
calcification of the aortic valve occurs through multiple mechanisms218, including apoptosis-
related calcification typically associated with myofibrogenic activation of VICs4, 5, calcium
deposition associated with necrotic cells219, and bone formation by resident VICs49 or bone
marrow-derived cells5. However, details of the cellular mechanisms by which VICs contribute to
calcification are not well understood, largely due to the limited number of studies in vitro and
difficulties with their interpretation. For example, when VICs are induced to form calcified
multicellular aggregates in vitro, the aggregates are associated with the expression of bone-
related transcripts and proteins54, 74, 92, 220, the expression of myofibroblast markers26, and/or
apoptosis187, 220. It is unclear if these features represent a single or multiple calcification
process(es).
The factors that contribute to the dysregulation of VICs leading to calcification are also not fully
defined. While a variety of biochemical cues, such as TGF-β, BMP-2 and BMP-4, have been
implicated in valve calcification216, mechanical cues from the extracellular matrix may also
regulate cell function, both in vivo and in vitro. Notably, cells are able to “sense” the local
mechanical properties of their extracellular matrix, and matrix stiffness is known to regulate
motility, proliferation, and differentiation in various cell types221. The differentiation of VICs to
myofibroblasts was recently shown to be influenced by matrix stiffness55, but the role of matrix
mechanics in regulating calcification by VICs has yet to be determined. Presumably, the
combined effects of matrix stiffness and biochemical cues ultimately define VIC phenotype. An
improved understanding of VIC-matrix interactions is required to aid in interpretation of VIC
calcification studies in vitro; to guide the selection of biomaterials with appropriate mechanical
The work presented here was published in Arterioscler Thromb Vasc Biol. 2009 Jun; 9(6): 36-42.
49
properties for valve tissue engineering; and to assess if alterations in extracellular matrix
mechanics that occur with disease16, 186 modulate pathologic changes in VIC phenotypes and
calcification processes.
To gain a better understanding of calcification by VICs and its regulation by mechanical cues,
we used the fibrillar collagen-based system with tunable substrate stiffness described in Chapter
Four to study the influence of matrix stiffness on primary porcine aortic VICs in vitro. We found
that the response of VICs to pro-calcific soluble factors is sensitive to matrix stiffness. VICs
grown in pro-calcific conditions preferentially differentiate to osteoblast-like cells on compliant
substrates that mimic the stiffness of normal or early sclerotic tissue, but differentiate to
myofibroblasts on stiffer substrates that mimic the stiffness of stenotic tissue. Calcified
aggregates form in both cases, but through distinct processes that are differentially mediated by
cytoskeletal tension.
5.1. Materials and Methods
Unless otherwise stated, all reagents were purchased from Sigma-Aldrich (Oakville, ON,
Canada). Detailed protocols are described in Appendix A. Assays that followed the protocols
from the manufacturers without any modification are not listed in Appendix A; these protocols
can be found on the websites of the respective suppliers.
5.1.1. Valve Interstitial Cell Culture
Primary VICs were isolated from aortic valves of eight-month-old pigs by collagenase digestion.
Compliant and stiff collagen matrices were constructed following procedures described in
Chapter 4. VICs were seeded on collagen matrices at 10,000 cells/cm2 in either complete
medium consisting of DMEM with 10% FBS (, Hyclone, Logan, UT, lot# KRA25425), 10,000
units/mL penicillin, and 10 mg/mL streptomycin, or in calcifying medium consisting of complete
medium supplemented with 10 mM β-glycerophosphate, 10 g/mL ascorbic acid and 10 nM
dexamathesone.
5.1.2. Measurement of Cellular Proliferation
Proliferation was determined at various time points based on measurement of DNA content of
cell pellets via binding with fluorescent dye from the CyQUANT® NF cell proliferation assay
50
kit (Invitrogen, Burlington, ON). Cells cultured on compliant or stiff matrices were rinsed with
sterile phosphate buffered saline (PBS) without calcium and magnesium. VICs were released
from collagen matrices with collagenase digestion (300 units/mL) for one hour at 37 oC. Culture
media, degraded collagen and collagenase solution were centrifuged at 4 oC at 16200 × g for five
minutes, followed by aspiration of the supernatant. Cell pellets were rinsed with ice-cold PBS,
and resuspended and incubated with the CyQUANT® dye for one hour at 37 oC in a 96-well
microtiter plate. The fluorescence intensity of each sample was measured using a microplate
reader with excitation at 485 nm and emission detection at 530 nm. A standard curve consisting
of 100 to 20,000 cells was generated with primary VICs, which was used to quantify the actual
number of cells in the test samples.
5.1.3. Determination of Cell Shape and Spreading
Cell shape and spreading of VICs cultured on compliant and stiff matrices were determined after
48 hours in culture. Cells were fixed with 10% neutral buffered formalin (NBF), followed by
permeabilization with 0.1% Triton X. Cells were stained with 5 g/mL of fluoroscein
isothiocyanate (FITC)-conjugated phalloidin (excitation /emission wavelengths: 490 nm/525
nm). Samples were subsequently mounted on microscope slides with PermaFluor mounting
medium and examined by fluorescence microscopy immediately (Olympus Model IX71,
Olympus, Center Valley, PA). The cell contours were identified based on the images of
phalloidin-stained cells. Cell spreading was estimated by tracing the cell contours and measuring
the cell area with ImageJ (NIH, Bethesda, MD).
5.1.4. Staining of Viable, Dead and Apoptotic Cells
VICs cultured on compliant or stiff matrices were quickly rinsed with sterile PBS. Viable cells
were determined by fluorescent labeling with 4 M Calcein AM (excitation/emission
wavelengths: 494 nm/517 nm) and dead cells were labeled with 2 M Ethidium Homodimer-1
(excitation/emission wavelengths: 528 nm/617 nm; LIVE/DEAD® Viability/Cytotoxicity Kit for
mammalian cells, Invitrogen, Burlington, ON). Cells were incubated with fluorescent dye for one
hour at 37 oC and then the nuclei were counterstained with Hoechst 33242 dye
(excitation/emission wavelengths: 350 nm/461 nm) for five minutes. Samples were subsequently
mounted on microscope slides with PermaFluor mounting medium and examined by
fluorescence microscopy immediately. As a negative control, cells were killed by formalin
51
fixation prior to Calcein AM staining and nuclear counterstaining to confirm that the Calcein
AM staining was specific to viable cells and not simply binding to calcium.
Apoptotic cells were identified by cellular uptake of APOPercentageTM dye (Biocolor Ltd,
Carrickfergus, UK) as a result of apoptosis-induced membrane phosphatidylserine and
phosphatidylcholine translocation. In brief, samples were quickly rinsed with sterile PBS with
calcium and magnesium prior to incubation with APOPercentageTM dye diluted 1:20 in
supplemented DMEM at 37 °C for 30 minutes. Samples were then mounted on microscope slides
with PermaMount mounting medium and images were captured under the microscope. Positive
controls were achieved by chemically-induced apoptosis of cells using 5 mM hydrogen peroxide
for three hours at 37 °C prior to staining. Intense staining, typically bright pink or purple
depending on the culture substrate and cell density, was observed in the positive controls,
ensuring the validity of the apoptosis detection method in VICs. Negative controls were achieved
by incubating samples without the APOPercentageTM dye.
5.1.5. Polymerase Chain Reaction for Expression of Osteogenic Markers
VICs were released from collagen matrices via collagenase digestion. Cell pellets were obtained
by centrifugation, followed by aspiration of the supernatant. Total RNA was isolated from cell
pellets following standard protocols of the Micro RNeasy System (Qiagen, Mississauga, ON).
Subsequently, total RNA was reverse transcribed with oligo-(dT)12-18 primers (Invitrogen,
Burlington, ON) and Superscript III reverse transcriptase (Invitrogen). cDNA was quantified
with a NanoDrop Spectrophotometer (ND-1000, NanoDrop Technologies, Wilmington, DE), and
then used as the template for real-time PCR using SYBR Green, an annealing temperature of 60 oC, and 35 cycles. Two osteoblast-related transcripts, osteonectin (Accession number:
AW436132, forward primers: 5’-tccggatctttcctttgctttcta-3’ and reverse primer 5’-
ccttcacatcgtggcaagagtttg-3’) and osteocalcin (Accession number: AW346755, forward primers:
5’-tcaaccccgactgcgacgag-3’ and reverse primer 5’-ttggagcagctgggatgatgg-3’) were tested222.
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Accession number: AF017079, forward
primers: 5’-tgtaccaccaactgcttggc-3’ and reverse primer 5’-ggcatggactgtggtcatgag-3’) was used as
the housekeeping gene223. Transcriptional expression was quantified by the comparative Ct
(Cycle threshold) method (2-Ct method) with the following equations:
Ct = Ct of target gene – Ct of housekeeping gene (1)
52
Ct = Ct Compliant matrices - Ct Stiff matrices (2)
Fold increase between two matrices = 2-Ct (3)
5.1.6. Measurement of Runt-Related Transcription Factor 2 (Runx2) Protein
Runx2/Cbfa-1 protein expression was measured using a commercially available ELISA-based
immunoassay (TransAM kit, ActiveMotif, Carlsbad, CA). Nuclear extracts were prepared from
VICs following the manufacturer’s recommendations. Briefly, VICs were released from collagen
matrices with collagenase digestion (as described above) and cell pellets were obtained. Samples
were then rinsed with ice-cold PBS with phosphatase inhibitor buffer (125 mM sodium fluoride,
250 mM -glycerophosphate, 250 mM para-nitrophenyl phosphate and 25 Mm sodium vanadate)
to prevent inactivation of Runx2/Cbfa-1. Pellets were resuspended in ice-cold hypotonic buffer
(20 mM HEPES, 5 mM sodium fluoride, 10 M sodium thioglycolate and 0.1 M EDTA) and
allowed to swell on ice for 15 minutes. Cell membranes were disrupted by gentle mixing with
10% Igepal CA-630, followed by centrifugation. Nuclear pellets were resuspended in Complete
Lysis Buffer (1 M DTT, protease inhibitor cocktail, lysis buffer AM4) and rocked gently on ice
for 30 minutes. Nuclear extract was obtained by collecting the supernatant upon centrifugation.
The protein concentration in the nuclear extract was determined using a micro BCA assay
(Pierce, Rockford, IL). For each sample, 20 g of nuclear extract was used to measure the
abundance of Runx2/Cbfa-1 by an ELISA-based immunoassay following the manufacturer’s
protocol. Briefly, nuclear extracts containing unknown amount of activated transcription factor
were incubated for one hour in 96-well microtiter plates pre-coated with oligonucleotides
containing an AML-3/Runx2/Cbfa-1 consensus binding site. Primary antibody for AML-
3/Runx2/Cbfa-1 was added to the samples for another one hour of incubation, followed by one
hour incubation with horseradish peroxidase-conjugated anti-rabbit IgG. The colorimetric
reaction was initiated by a five-minute incubation with the Developing Solution, followed by the
Stop Solution. Absorbance of each sample was read immediately with a spectrophotometer at
450 nm with a reference wavelength of 655 nm. Absorbance readings were normalized by total
cell number per sample. A positive control for AML-3/Runx2/Cbfa-1 activation was performed
with 5 g/well of Saos-2 nuclear extract. Negative controls were achieved with blank compliant
and stiff collagen matrices without cells.
53
5.1.7. Alkaline Phosphatase and Alizarin Red S Staining
To detect alkaline phosphatase activity (ALP), VICs on collagen matrices were fixed in 10%
NBF and rinsed in distilled water. Samples were stained using Napthol AS MX-PO4 (Fisher
Scientific, Ottawa, ON) as the substrate, N, N-Dimethylformaide, Trizma-hydrochloride acid,
and Fast Red Violet LB salt. The stained samples were rinsed with distilled water three times and
examined under a light microscope. Positively stained cells display a reddish/purple color. To
detect the presence of calcium salts, formalin fixed samples were washed with distilled water,
followed by staining with 0.02 mg/mL Alizarin red S (ARS) solution. Cells with calcium
deposition were stained bright red. Subsequently, ARS dye was released from the stained
samples using 0.6 N HCl, followed by neutralization with 10% (vol/vol) ammonium hydroxide.
The total amount of ARS released from the culture was quantified by measuring the absorbance
of the solublized dye in solution at 405 nm.
5.1.8. Osteocalcin Immunohistochemical Staining
Immunohistochemical staining for osteocalcin was performed using Vectastain Universal Elite
ABC Kit (Vector Laboratories, Burlingame, CA). Samples were fixed in 10% NBF and washed
with 0.05% Tween 20 diluted in PBS. Following fixation, samples were treated with 3%
hydrogen peroxide in methanol at room temperature for 10 minutes, blocked with horse serum
for 20 minutes at room temperature, and then incubated for three hours at room temperature with
20 μg/mL mouse anti-bovine osteocalcin antibody (clone OCG4; Affinity BioReagents, Golden,
CO) diluted in 0.3% Triton X-100 in PBS. Secondary biotinylated antibody and 3,3'-
diaminobenzidine (DAB) substrate were then applied. The stained samples were dehydrated in
an ethanol gradient. Negative controls were achieved by omitting the primary antibody.
5.1.9. Immunofluorescent Staining of Cytoskeletal Proteins
VICs on collagen matrices were fixed in 10% NBF, followed by permeabilization with 0.1%
Triton-X and rinsing with PBS. Samples were blocked with 3% bovine serum albumin to
minimize non-specific binding. To stain for -smooth muscle actin (-SMA), monoclonal
mouse anti--SMA antibody (20 g/mL clone 1A4 mouse anti-human monoclonal primary
antibody ) and 20 g/mL Alexa Fluor® 568 goat anti-mouse antibody were used. Filamentous
(F)-actin was stained by fluoroscein isothiocyanate (FITC)-conjugated phalloidin (5 g/mL).
54
Nuclei were stained with Hoechst 33242 dye (1 g/mL). Samples were mounted on microscope
slides with PermaFluor and were examined under a fluorescence microscope.
5.1.10. Disruption of Cytoskeleton Assembly
VICs were treated with 0.4 nM of Swinholide A (SWA) after six days of culture on compliant or
stiff matrices in calcifying media. Medium with fresh SWA was exchanged every 24 hours for
two days. After two days of treatment with SWA, expression of -SMA and F-actin were
analyzed with immunostaining and the number of aggregates was recorded.
5.1.11. Response to TGF-1
VICs were cultured on compliant and stiff matrices and were immediately treated with calcifying
media (containing 10% FBS) and 5 ng/mL of TGF-1 for five days to induce -SMA
expression. The FBS used in these experiments was reported by the manufacturer to contain 10-
22 ng/mL TGF- (equivalent to 1- 2.2 ng/mL in the calcifying media). We attempted to reduce
the baseline TGF-1 concentration in the media by using 1% FBS, but this resulted in a
significant reduction in proliferation and no formation of calcified aggregates after up to 10 days
on both compliant and stiff matrices, even with the addition of exogenous TGF-1. Extended
long term culture (> 10 days) was not feasible due to collagen degradation. Responsiveness of
VICs to TGF-1 was also determined by measuring the transcript expression of TGF-1 receptor
I and II by RT-PCR using the following primers sequence: (1) TGF-1 receptor I (Accession
number: AB182260.1, forward primers: 5’-gacggcattccagtgtttct-3’ and reverse primer 5’-
tgcacatacaaatggcctgt-3’) and (2) TGF-1 receptor II (Accession number: EF396957.1, forward
primers: 5’-cagggaagaacgttcatggt-3’ and reverse primer 5’-ccaaccaaagctgagtccat-3’).
5.1.12. Expression of TGF-1
VICs were grown on compliant or stiff matrices for eight days, with media changes every two
days. Conditioned media was collected on the last day of culture. TGF-1 in the conditioned
media was measured using the TGF-1 Emax® ImmunoAssay System (Promega, Nepean, ON)
according to the manufacturer’s directions. Briefly, TGF-1 coat monoclonal antibody, which
binds to soluble TGF-1, was adhered to the surface of a 96-well microtiter plate. Samples for
generating the standard curve and the test samples were applied to each pre-coated well. Samples
55
were incubated with anti-TGF-1 polyclonal antibody, followed by incubation with a species-
specific antibody conjugated to horseradish peroxidase. Colorimetric development was achieved
by the addition of TMB One solution. The reaction was stopped by 1 N HCl. Absorbance was
read at 450 nm on a plate reader and then normalized by total cell number per sample.
5.1.13. Contraction-Dependent Apoptosis and Akt Activation
A stress-relaxation collagen gel model224 was used to evaluate the relationship between cell
contraction, apoptosis, and Akt activity. Briefly, VICs were cultured on constrained collagen gels
for six days with osteogenic media at a cell density of 10,000 cells/cm2. Cellular contraction was
induced by releasing the gels from the walls of the culture wells. Cells were stained with
APOPercetageTM dye after 0, 0.5, and 3 hours of gel release to detect the presence of apoptosis.
The level of apoptosis was quantified colorimetrically (absorbance at 550 nm) upon dye release.
In a separate experiment using the same culture methodology, proteins were extracted from cells
after 0 and 1 hour of gel release, followed by western blot for the detection of total Akt and
phosphorylated Akt. Briefly, cell cultures were washed with ice-cold PBS followed by the
addition of 1× lysis buffer. Cells were scraped and transferred to pre-chilled tubes, followed by
30-minute incubation on ice. Cell lysates were obtained by centrifugation at 16200 × g for 15
minutes at 4 oC. The protein concentrations of cell lysates were determined by micro BCA
protein assay (Pierce, Rockford, USA). 10 g of protein extract from compliant and stiff
matrices was loaded on to two identical 10% SDS-polyacrylamide gels for electrophoresis.
Samples were then transferred to two separate polyvinylidene fluoride membranes. The first
membrane was used for detection of Akt (1:1000 dilution, 60 kDa, Akt rabbit polycloncal
antibody, Cell Signaling Technology, Danvers, MA) and glyceraldehyde-3-phosphate
dehydrogenase (1:3000 dilution, 40 kDa, GAPDH mouse monoclonal antibody, Stressgen, Ann
Arbor, Michigan). The second membrane was used for detection of phospho-Akt (1:1000
dilution, 60 kDa, phospho-Akt rabbit polycloncal antibody, Cell Signaling Technology, Danvers,
MA) and GAPDH immunoblot. Expression of Akt and phospho-Akt were quantified by
densitometry using ImageJ Software (NIH, Bethesda, MD) and normalized to GAPDH
expression. Full details of western blot procedure including incubation duration, concentration of
horseradish peroxidase conjugated secondary antibody and detection of proteins with x-ray films
are described in Appendix A.
56
5.1.14. Statistical Analysis
Results are presented as mean standard error. Samples sizes were at least three in all cases,
and experiments were repeated at least three times. Unpaired Student’s t-tests were used for
comparisons between two groups. ANOVA and Fisher’s least significant difference test were
used to evaluate statistically significant differences in multiple group comparisons.
5.2. Results
5.2.1. Morphological Changes, Proliferation and Cell Spreading
VICs were cultured on the thick (relatively more compliant) matrices or the thin (stiffer)
matrices. When cultured in complete medium without pro-calcific supplements, VICs
proliferated more rapidly on compliant matrices (P < 0.05; Figure 5.1: A), but the morphology
was similar on the two matrices (Figure 5.1: B and C). In contrast, VIC proliferation rate was not
significantly different on stiff and compliant matrices when cultured in calcifying media (Figure
5.2: C), but morphological differences were substantial. In calcifying media, VICs on the more
compliant matrices formed multicellular aggregates after eight to ten days in culture (Figure 5.2:
A). In contrast, VICs on the stiffer matrices formed fewer aggregates (P < 0.05, Figure 5.2: D)
and instead tended to form ridges (Figure 5.2: B, ridges indicated by the red arrows). In medium
without pro-calcific supplements, there was no aggregation on either substrate over the culture
period.
Because VICs cultured in calcifying media displayed substantial morphological differences on
the two matrices after eight days in culture, we further investigated if initial cell-matrix contacts
altered individual cell morphology (cell shape and spreading) prior to the formation of
aggregates or ridges. Cell shape was visualized by FITC-conjugated phalloidin labeling 48 hours
after initial cell seeding. A wide variety of cell shapes were found on both matrices (Figure 5.3:
A and B), indicative of preservation of VIC heterogeneity. Although there was no striking
difference in cell shape on the two matrices, cells on the stiffer matrices spread significantly
more than those grown on compliant matrices (Figure 5.3: C).
5.2.2. More Compliant Matrices Promote Osteogenic Differentiation of VICs
VICs can form aggregates in vitro that contain calcium deposits and osteoblast-related proteins54,
so we investigated if this was the case for the cell aggregates on compliant and stiff collagen
57
matrices. There was a trend for greater calcification on the compliant matrices (P < 0.06; Figure
5.4: A). Calcium deposition was localized within the aggregates formed on both matrices (Figure
5.4: B and C).
Figure 5.1. Proliferation and morphology of VICs cultured in DMEM
supplemented with 10% FBS
(A) Cellular proliferation rate was significantly higher on compliant matrices in comparison to
those grown on stiff matrices after six and eight days in culture (* P < 0.05). (B) Bright field
images showing similar morphology of VICs on the two matrices after eight days in culture.
C. Stiff matricesB. Compliant matrices
B0
100
200
300
400
4 days 6 days 8 days
A.
4 days 6 days 8 days
*
Compliant matrices
Nu
mb
er
of
c ells
(x
10
-3)
Stiff matrices
*
Culture duration
C. Stiff matricesB. Compliant matrices
B0
100
200
300
400
4 days 6 days 8 days
A.
4 days 6 days 8 days
*
Compliant matrices
Nu
mb
er
of
c ells
(x
10
-3)
Stiff matricesCompliant matrices
Nu
mb
er
of
c ells
(x
10
-3)
Stiff matrices
*
Culture duration
58
Figure 5.2. Proliferation and morphology of VICs cultured in calcifying media
(A and C) Bright field images showing aggregates (indicated by black arrows) formation on
compliant and stiff matrices. Ridge (indicated by red arrowheads) formation can be observed
only on the stiff matrices. (B) Cellular proliferation rate was similar between the two matrices.
(C) VICs grown on compliant matrices formed more aggregates in comparison to those cultured
on stiff matrices. * P < 0.05.
B. Stiff matricesA. Compliant matrices
B0
50
100
150
200
Compliant matrices Stiff matrices
Nu
mb
er
of
ag
gre
ga
tes
*
C.
Compliantmatrices
D.
0
200
400
600
800
1000
4 days 6 days 10 days4 days 6 days 8 days
Compliant matrices
Nu
mb
er
of
cells
(x
10
-3) Stiff matrices
StiffmatricesCulture duration
B. Stiff matricesA. Compliant matrices
B0
50
100
150
200
Compliant matrices Stiff matrices
Nu
mb
er
of
ag
gre
ga
tes
*
C.
Compliantmatrices
D.
0
200
400
600
800
1000
4 days 6 days 10 days4 days 6 days 8 days
Compliant matrices
Nu
mb
er
of
cells
(x
10
-3) Stiff matrices
Stiffmatrices
B. Stiff matricesA. Compliant matrices
B0
50
100
150
200
Compliant matrices Stiff matrices
Nu
mb
er
of
ag
gre
ga
tes
*
C.
Compliantmatrices
D.
0
200
400
600
800
1000
4 days 6 days 10 days4 days 6 days 8 days
Compliant matrices
Nu
mb
er
of
cells
(x
10
-3) Stiff matrices
B. Stiff matricesA. Compliant matrices
B0
50
100
150
200
Compliant matrices Stiff matrices
Nu
mb
er
of
ag
gre
ga
tes
*
C.
Compliantmatrices
D.
0
200
400
600
800
1000
4 days 6 days 10 days4 days 6 days 8 days
Compliant matrices
Nu
mb
er
of
cells
(x
10
-3) Stiff matrices
Compliant matrices
Nu
mb
er
of
cells
(x
10
-3) Stiff matrices
StiffmatricesCulture duration
59
Figure 5.3. Cell shape and spreading 48 hours after initial seeding
Heterogeneous cell shape found on both the more compliant matrices (A) and the stiffer matrices
(B), scale bar represents 50 m. (C) Comparison of cell spreading on the two matrices.
* P < 0.05.
A. Compliant matrices B. Stiff matrices
C.
*
0
100
200
300
400
500
Compliant Stiff Type of collagen matrices
Ce
ll sp
rea
din
g a
rea
(m
2 )
Ce
ll sp
rea
din
g a
rea
(m
2)
*
A. Compliant matrices B. Stiff matrices
C.
*
0
100
200
300
400
500
Compliant Stiff Type of collagen matrices
Ce
ll sp
rea
din
g a
rea
(m
2 )
Ce
ll sp
rea
din
g a
rea
(m
2)
A. Compliant matrices B. Stiff matrices
C.
*
A. Compliant matrices B. Stiff matrices
C.
A. Compliant matrices B. Stiff matrices
C.
*
0
100
200
300
400
500
Compliant Stiff Type of collagen matrices
Ce
ll sp
rea
din
g a
rea
(m
2 )
Ce
ll sp
rea
din
g a
rea
(m
2)
0
100
200
300
400
500
Compliant Stiff Type of collagen matrices
Ce
ll sp
rea
din
g a
rea
(m
2 )
Ce
ll sp
rea
din
g a
rea
(m
2)
*
60
Figure 5.4. Calcification by VICs on the two matrices.
(A) Relative amount of calcium on the two matrices as measured by releasing the ARS dye.
# P = 0.06. (B and C) ARS staining for calcium expression showing localization of calcium
deposition within cell aggregates.
Transcriptional expression of osteonectin and osteocalcin were significantly higher in VICs
cultured on compliant matrices (Figure 5.5: A), as were the protein level of Runx2/Cbfa-1
(Figure 5.5: B), ALP activity (Figure 5.5: C), and osteocalcin protein expression assessed by
immunostaining (Figure 5.5: D). ALP activity and osteocalcin expression were localized within
the aggregates on compliant matrices. On stiff substrates, ALP activity was weak and dispersed
throughout the cell layer (Figure 5.5: C) and minimal osteocalcin expression was observed, even
in aggregates (Figure 5.5: D).
B. Compliant matrices
A.
0.0
0.5
1.0
1.5
2.0
Compliant matrices Stiff matrices
Re
lati
ve a
mo
unt
o
f ca
lciu
m (
AU
)
#
Compliant Stiff
C. Stiff matricesB. Compliant matrices
A.
0.0
0.5
1.0
1.5
2.0
Compliant matrices Stiff matrices
Re
lati
ve a
mo
unt
o
f ca
lciu
m (
AU
)
#
Compliant Stiff
C. Stiff matrices
61
Figure 5.5. Compliant matrices promote osteogenic phenotypes.
(A) Relative mRNA levels of osteocalcin and osteonectin by VICs, * P < 0.05 and # P < 0.06.
(B) Runx2/Cbfa-1 expression, * P < 0.05. (C) ALP staining. (D) Osteocalcin expression, inset
showing negative control.
Am
oun
t of
Run
x2/C
bfa
-1
(no
rma
lize
d, A
U)
02468
1012
Compliant matrices Stif f matrices
A.
*F
old
incr
ea
se re
lati
ve
to
stif
f ma
tric
es
02468
10
Osteonectin Osteocalcin
*
#
Compliant Stiff
Compliant Stiff
B.
C.
Compliant StiffD.
Am
oun
t of
Run
x2/C
bfa
-1
(no
rma
lize
d, A
U)
02468
1012
Compliant matrices Stif f matrices
A.
*F
old
incr
ea
se re
lati
ve
to
stif
f ma
tric
es
02468
10
Osteonectin Osteocalcin
*
#
Compliant Stiff
Compliant Stiff
B.
C.
Compliant StiffD.
02468
1012
Compliant matrices Stif f matrices
A.
*F
old
incr
ea
se re
lati
ve
to
stif
f ma
tric
es
02468
10
Osteonectin Osteocalcin
*
#
Compliant Stiff
Compliant Stiff
B.
C.
Compliant StiffD.
62
5.2.3. Stiffer Matrices Promote Calcification Through Apoptosis
Although VICs on stiff matrices expressed osteoblast-related markers at low levels, detectable
calcium deposition was observed within the few aggregates that formed. Morphological analysis
by SEM revealed significant differences in the spreading and shape of these cells on the surface
of and around the multicellular aggregates on the two matrices (Figure 5.6: A and B). Aggregates
on stiff matrices were rounded and symmetrical with fewer cells adjacent to the aggregates,
suggesting that these aggregates might have resulted from contraction of the confluent cell
sheets. In contrast, cells covered the entire surface of the compliant matrices. Some cells on the
aggregates were cuboidal as opposed to the elongated morphology that are often observed with
fibroblasts, suggesting a change in cell phenotype and potentially the presence of clonal growth
within these cell aggregates on the compliant matrices. Such differences in cell organization and
morphology suggested that the calcific aggregates might have occurred through different
mechanisms on the two matrices. Both in vivo and in vitro, calcification can occur through a
process involving apoptosis4, 187 (discussed in Chapter 2), so we examined whether cell death and
apoptosis was associated with localized calcium deposition in these multicellular aggregates. On
compliant matrices, the aggregates contained viable cells with little evidence of apoptosis
(Figure 5.6: C and E). Positive Calcein AM staining was not due to the presence of calcium, as
formalin-fixed calcified aggregates stained negatively (Figure 5.6: C inset). In contrast,
aggregates formed on stiff matrices contained dead and apoptotic cells (Figure 5.6: D, F).
5.2.4. Aggregate Formation on Stiffer Matrices is Mediated by Cytoskeletal Tension
The striking differences in VIC phenotypes, aggregate morphology, and calcifiation process on
compliant versus stiff matrices in otherwise identical culture conditions suggested that VICs
sense and respond to matrix stiffness. Stiff culture surfaces, such as TCPS, are known to promote
myofibroblast differentiation of VICs and increase expression of filamentous -SMA55, a
cytoskeletal protein that contributes to the contractility of activated VICs. We found that VICs
displayed F-actin fibers regardless of matrix stiffness (Figure 5.7: A and B). However, VICs on
compliant matrices expressed predominantly monomeric -SMA (Figure 5.7: E), whereas
abundant expression of filamentous -SMA was observed only in cells cultured on stiff matrices
(Figure 5.7: F) consistent with the emergence of a myofibroblast phenotype. On the stiff
matrices, ridge formation by VICs was associated with the expression of filamentous -SMA
(Figure 5.8: A, B, D, E), which eventually led to the formation of aggregates (Figure 5.8: C, F).
63
We investigated the role of actin assembly in matrix stiffness-dependent aggregate formation by
disrupting actin filaments in VICs. Actin depolymerization was observed in VICs after 48 hours
of SWA treatment on both matrices (Figure 5.7: C, D, G, H).
Figure 5.6. Stiffer matrices promote dystrophic calcification associated with VIC apoptosis.
(A and B) SEM of cell aggregates showing distinct morphological differences. (C and D)
Calcein AM staining for live cells (green) and Ethidium homodimer-1 staining for dead cells
(red) staining, inset showing the negative control with nuclear counterstaining (blue). (E and F)
APOPercentageTM staining for apoptosis, inset showing positive control (purple).
StiffCompliantS
EM
Ca
lciu
m A
MA
po
pto
sis
A B
C D
E F
StiffCompliantS
EM
Ca
lciu
m A
MA
po
pto
sis
A B
C D
E F
64
Figure 5.7. Cytoskeleton expression.
Comparison of the expression of F-actin (green, A -D) and -SMA (red, E-F) by VICs with
nuclei counterstained blue) with and without swinholide A treatment on cells cultured on the
compliant and stiff matrices.
Upon treatment with SWA, cells remained attached to the matrices, but some were rounded with
limited extension of cytoplasmic processes (Figure 5.9: A - D). On compliant matrices, actin
disruption had no effect on the formation of cell aggregates that displayed osteogenic phenotypes
(Figure 5.9: C). In contrast, on stiff matrices disruption of actin assembly significantly reduced
the formation of aggregates (Figure 5.9: B, D, E).
Without SWA With SWA
Compliant matrix Stiff matrix
A B C D
Compliant matrix Stiff matrix
-S
MA
E F G
F-a
ctin
H
Without SWA With SWA
Compliant matrix Stiff matrix
A B C D
Compliant matrix Stiff matrix
-S
MA
E F G
F-a
ctin
H
65
Figure 5.8. Aggregate formation by VICs cultured on stiff matrices
(A and D) Confluent cells on stiff matrices expressed abundant filamentous -SMA (red). (B and
E) Prior to the formation of aggregate cells expressing filamentous -SMA (red) form ridges. (C
and F) Expression of -SMA was also found in cell aggregates.
These data, along with the “contracted” appearance of the aggregates formed on the stiff
matrices (Figure 5.8: F), suggested that apoptosis leading to calcification on stiff substrates may
be due to local contraction of the cell layer resulting from increased cytoskeletal tension, which
is then released upon aggregation. To test this, we released constrained collagen gels seeded with
VICs and observed a significant increase in the number of apoptotic cells (Figure 5.10: A).
Previous studies have identified the Akt signaling pathway as a mediator of contraction-
dependent apoptosis225. We found that Akt activation was downregulated upon gel contraction
by VICs (Figure 5.10: B), prior to apoptosis, suggesting mechanically-regulated Akt activity
influences apoptosis in VICs.
Low magnification
High magnification
Overlapping cell layers Ridges Aggregates
A B C
D E F
Low magnification
High magnification
Overlapping cell layers Ridges Aggregates
Low magnification
High magnification
Overlapping cell layers Ridges Aggregates
A B C
D E F
66
Figure 5.9. Effect of cytoskeleton disruption on aggregate formation
(A – D) Swinholide A reduced the formation of ridges on stiff matrices. (E) Number of
aggregates was significantly reduced on stiff, but not compliant matrices (* P < 0.05).
5.2.5. Response to TGF-β and the Expression of its Receptors Are Matrix Stiffness
Dependent
TGF-1 is a potent inducer of -SMA expression and myofibroblast differentiation. It is also
expressed in calcified aortic valves69 and promotes VIC apoptosis and calcified aggregate
formation in vitro54, 69. We evaluated if matrix stiffness-dependent aggregation was influenced by
TGF-1. No differences were detected in endogenous total TGF-1 production by VICs on
compliant versus stiff matrices (data not shown). However, when treated with 5 ng/mL of
exogenous TGF-1, aggregate formation was accelerated on stiff matrices as early as after five
days in culture (28 ± 4 aggregates). No aggregates were found in the absence of TGF-1 after the
same culture duration (zero aggregates; P < 0.05). In contrast, no aggregates were observed after
Compliant Stiff
Without SWA With SWA
Compliant Stiff
A B C D
E
0
50
100
150
200
Compliant matrices Stiff matrices
Without SWA. 8 days in cultureWith SWA, 8 days in culture
Nu
mb
er
of
ag
gre
ga
tes
*
Compliant Stiff
Without SWA With SWA
Compliant Stiff
A B C D
E
0
50
100
150
200
Compliant matrices Stiff matrices
Without SWA. 8 days in cultureWith SWA, 8 days in culture
Nu
mb
er
of
ag
gre
ga
tes
*
67
five days on compliant matrices in the absence or presence of TGF-1. VICs grown in calcifying
media for eight days on either substrate had significantly lower expression of both TGF-1
receptor I and II compared with freshly isolated VICs. Whereas TGF- receptor II expression
was not different on compliant versus stiff matrices, TGF- receptor I expression was
significantly lower in VICs on compliant matrices (Figure 5.11). These observations suggest that
the preferential responsiveness to TGF-1 on stiff matrices is mediated in part through matrix
stiffness-dependent expression of TGF- receptor I.
Figure 5.10. Molecular factors involved in contraction-induced apoptosis on stiff substrates
(A) Apoptosis determined by APOPercentage dye upon release of constrained collagen gels,
* P < 0.05. (B), Western blot of total Akt (60 kDa) and phosphorylated Akt (p-Akt, 60 kDa) in
cells on gels before release and one hour after release. Densitometric quantification of Western
blot expressed as the ratio of phosphorylated Akt to total Akt. # P = 0.06
Pho
spho
ryla
ted
Akt
/To
tal A
kt
0.0
0.1
0.2
0.3
0.4
0.5
0 0.5 3.5Time after gel release (hours)
A B
*
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0 1
#
Total Akt
p-Akt
0 1(hr)
Re
lati
ve a
po
pto
sis
(A
U)
Time after gel release (hours)
Pho
spho
ryla
ted
Akt
/To
tal A
kt
0.0
0.1
0.2
0.3
0.4
0.5
0 0.5 3.5Time after gel release (hours)
Pho
spho
ryla
ted
Akt
/To
tal A
kt
0.0
0.1
0.2
0.3
0.4
0.5
0 0.5 3.5Time after gel release (hours)
A B
*
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0 1
#
Total Akt
p-Akt
0 1(hr)
Re
lati
ve a
po
pto
sis
(A
U)
Time after gel release (hours)
A B
*
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0 1
#
Total Akt
p-Akt
0 1(hr)
Re
lati
ve a
po
pto
sis
(A
U)
A B
*
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0 1
#
Total Akt
p-Akt
0 1(hr)
Re
lati
ve a
po
pto
sis
(A
U)
Time after gel release (hours)
68
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
TGF-beta Receptor I TGF-beta Receptor II
Freshly isolated VICs Compliant matricesStiff matrices
*
**
*
No
rma
lize
dm
RN
Ae
xpre
ssio
n (
AU
)
*
0.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
TGF-beta Receptor I TGF-beta Receptor II
Freshly isolated VICs Compliant matricesStiff matrices
*
**
*
No
rma
lize
dm
RN
Ae
xpre
ssio
n (
AU
)
*
Figure 5.11. Expression of TGF- receptors I and II
Transcript expression of TGF- receptors in freshly isolated VICs from normal porcine AV as
well as in VICs cultured on compliant and stiff matrices, * P < 0.05.
5.3. Discussion
VICs often form calcified nodules in vitro54, however the mechanisms by which VICs form
calcified aggregates and the factors that regulate these processes are not well defined. Here, we
demonstrated two distinct calcification processes that are mechanically regulated and are
associated with the differentiation of VIC into two distinct cell phenotypes. When cultured in
calcifying media, VICs grown on more compliant matrices were viable and formed calcified
bone-like nodules identified as such by the localized expression bone-related transcripts and
proteins. In contrast, VICs cultured in the same media but on the stiffer matrices had minimal
osteoblast marker expression, differentiated to contractile myofibroblasts, and formed calcified
aggregates containing apoptotic cells. Importantly, calcification on either matrix occurred within
the culture duration only when the VICs were exposed to biochemical factors that promote
calficiation. Thus, matrix stiffness alone was insufficient to cause calcification, but worked in
conjunction with soluble factors to regulate VIC differentiation and calcification. This is of
particular interest because biochemical factors are never decoupled with mechanical factors in
vivo.
69
The experimental system used here permitted specific investigation of distinct calcification
mechanisms. This has not been possible to date and has been largely ignored, confounding
interpretation of cell culture data and limiting our understanding of the mechanisms underlying
calcification by VICs. We used primary VICs rather than passaged VICs to capture the cellular
heterogeneity in intact valves 215, 226 and to avoid the phenotypic changes that occur with
subculture, including myofibroblast differentiation55 and loss of osteoprogenitors58. Cell shape
data further confirmed the preservation of cellular heterogeneity of our cultures. Although it was
difficult to determine the effect of matrix stiffness on cell shape due to heterogeneity of the cell
source, cell spreading was significantly different between the two matrices. Cell spreading is
driven by forces generated from actin polymerization227. VICs cultured on the stiffer matrices
expressed abundant actin filaments and spread more than those cultured on the more compliant
matrices. It is likely that VICs sense matrix stiffness via integrin-cytoskeleton linkages, which in
turn regulates cytoskeleton organization and cell spreading. This view is supported by studies
with epithelial keratocytes lacking adaptor proteins such as talin, which normally facilitates the
integrin-cytoskelton linkage, fail to spread228. Further investigations are necessary to identify the
molecular components necessary for stiffness sensing in VICs.
To manipulate only matrix stiffness, we were limited to a 2D system, as decoupling of matrix
mechanics and chemistry is not possible with 3D fibrillar collagen matrices10.
Although efforts were made to achieve similar surface chemistry on the compliant and sitff
matrices, some limiations remained with our 2D system. For instance, changes in matrix
composition due to cell remodeling may have occurred with time in culture. The effect of other
matrix components produced by VICs on calcification is unknown, and thus characterization of
the compositional changes that occur in the gels due to remodeling would better define the
relative contributions of matrix stiffness versus composition. Further, cells might have invaded
the collagen matrices as a result of matrix remodeling and migration, which would affect cell
shape and spreading as well as stiffness sensing by the cells. Although SEM images showed that
layers of overlapping cells occur locally at the site of aggregation, additional experiments are
necessary to evaluate the spatial distribution of cells over the given culture duration to fully
determine if cells remained on the surface of the collagen matrices.
70
Based on Hertz contact analysis of microindentation data of collagen gels identical to those used
here229, the apparent elastic moduli of the thick and thin collagen matrices are estimated to be 27
kPa and 113 kPa, respectively. Of note, VICs underwent osteogenic differentiation in the same
stiffness range (25-40 kPa) as bone marrow-derived MSCs130, consistent with recent evidence
that the aortic valve also contains a subpopulation of MSCs with robust osteogenic calcification
potential58.
The differentiation of VICs to contractile myofibroblasts that express filamentous -SMA on
stiff substrates has been reported previously55. The primary inducers of myofibroblast
differentiation are mechanical tension and TGF-β181. Cytoskeletal tension is generated
intrinsically by cells as they exert tractional forces on the surrounding extracellular matrix; stiff
matrices provide greater resistance to deformation, resulting in greater tractional forces221. The
incorporation of -SMA into stress fibers aids in force generation230. We found that -SMA
stress fibers were critical to aggregation on stiffer matrices, as this process was inhibited by
treatment with SWA, which disrupts polymerization of -SMA221, and was promoted by TGF-
1. The dependency of aggregation on cytoskeletal tension, along with the appearance of ridges
and the final symmetrical morphology of the aggregates suggested that the aggregates formed by
local contraction of the cell layer. Release of mechanical tension in VICs, as would occur with
contraction-induced aggregation, reduced Akt activity and subsequently triggered apoptosis as it
does in other myofibroblasts224, 225, 231. Apoptosis is associated with calcification of vascular and
valvular cells in vitro77 and in vivo4, 232, and is required for TGF-β1-induced calcification by
VICs69. Our observations suggest a mechanically-based mechanism with which to interpret in
vitro models of apoptosis-associated VIC calcification, particularly those performed on stiff
polystyrene tissue culture plates that induce myofibroblast differentiation55. This finding is
consistent with recent study by Anseth’s group, in which overexpression of -SMA increased
VIC calcific nodule formation, whereas knockdown of -SMA with siRNA transfection reduced
this process233. This mechanism is also likely to be important in vivo where increases in
myofibroblasts47, 55, 234, apoptotic cells4, and TGF-69 are observed in sclerotic leaflets and
alterations in matrix tension are believed to be a trigger for myofibroblast to undergo apoptosis
during wound repair224, 231.
71
In contrast to stiff matrices, addition of exogenous TGF-β1 did not accelerate calcification on
compliant substrates. The relative insensitivity of the cells on the more compliant matrices to
TGF-1 likely resulted from lower expression of the TGF- receptor I. Fibroblasts are less
sensitive to TGF- when grown in 3D spheroids than when grown as 2D monolayers on glass235.
The differential responsiveness was reported to correlate with downregulation of TGF- receptor
expression in 3D culture, which in light of our findings, may reflect differences in effective
matrix mechanical properties between 2D and 3D culture systems. We also observed significant
downregulation of both TGF- receptor I and II transcripts in VICs grown under calcifying
conditions on either substrate compared to those freshly isolated from normal valves. This is
consistent with observations from explanted human aortic valves, in which these receptors were
moderately downregulated in calcified leaflets relative to non-calcified leaflets69.
While our findings have clear implications for the interpretation of VIC calcification in vitro and
for the selection of biomaterials for valve regeneration, the relevance to valve calcification in
vivo remains to be determined. Similar to atherosclerosis, CAVD is an active pathobiological
process that involves extensive matrix remodeling13, 42, 216. The extracellular matrix provides
biochemical and mechanical cues to adherent cells, and alterations in the composition13, 236 and
mechanical properties16 of the ECM are characteristic of sclerotic diseases. The effects of matrix
composition on calcification have been reported26, 237, 238, but the influence of matrix stiffness on
vascular or valvular calcification has not been investigated. Notably, changes in the local
stiffness of atherosclerotic lesions occur early, prior to substantial histological changes in the
matrix16. Similar early dynamic changes in matrix mechanics are expected in sclerotic valves,
but the alterations in the micromechanical stiffness of the valve matrix that occur with disease
progression and the factors that contribute to these mechanical changes have yet to be
determined. While the collagen matrices used here are far less complex than valve tissue in
composition and structure, the modulus of the stiffer gels was comparable to that of sclerotic
valve tissue (based on relative changes from normal tissue186) and the modulus of the more
compliant gels was approximately two- to three-fold greater than the micromechanical tensile
modulus of normal aortic valve tissue23, but similar to that of early atherosclerotic lesions16. The
matrices that mimicked the normal or early disease stiffness promoted osteogenic differentiation
when the cells were exposed to calcific soluble signals, consistent with the appearance of
osteoblast-like VICs early in CAVD234 prior to the substantial matrix changes and calcification
72
that ultimately stiffen the matrix. While these findings are intriguing, further investigation is
required to determine the role of matrix stiffness in modulating osteogenic and non-osteogenic
calcification processes in vivo. In particular, translation of these findings to valve disease
requires additional studies of the dynamic temporal and spatial changes that occur in matrix
structure and composition during disease development and their relationships to the
micromechanical properties of the valve matrix and cell phenotypes.
In summary, by using a simple collagen-based culture platform, we were able to demonstrate the
ability of VICs to “sense” their local mechanical microenvironment. Our data demonstrate that
the differentiation of and calcification by VICs in response to biochemical factors are modulated
by the mechanical properties of the matrix. These data suggest an important regulatory role for
matrix mechanics in valve cell biology, with implications for the interpretation of in vitro models
of VIC calcification, the selection of biomaterials for tissue engineered heart valves, and possibly
disease development. While we observed that either osteoblast or myofibroblast differentiation
of VICs can result in calcification in vitro, the two processes are distinct and respectively mimic
aspects of either bone formation or apoptosis-associated calcification in vivo. The identification
of distinct calcification processes suggests the need for therapies that are specific, yet capable of
targeting multiple pathways involved in VIC pathological differentiation and valve calcification.
73
Chapter 6
6. Effect of CNP on Pathological Differentiation of VICs
The heterogeneous population of VICs has been shown to differentiate into pathologic
myofibroblasts and osteoblasts in various cell culture studies55, 58, 239. Myofibroblasts and
osteoblasts are often found in calcified AV47, 49. Myofibroblasts are responsible for pathological
matrix remodeling and fibrosis, whereas osteoblasts contribute to bone-matrix protein deposition
and calcification. In culture, myofibroblast differentiation of VICs is associated with apoptosis-
dependent calcification69. Clearly, these phenotypic changes resulting from pathological
differentiation of VICs contribute to valve dysfunction, and therefore pharmacological inhibition
of VIC pathological differentiation may prevent the occurrence of valve sclerosis and
calcification.
Clues to the molecular determinants of CAVD may come from the tendency for calcified lesions
to form more readily in the fibrosa of aortic valve leaflets than on the ventricular (disease-
protected) side14. Profiling of gene expression by endothelial cells from opposite sides of normal
porcine aortic valves revealed statistically significant side-dependent differential expression of
584 genes6. One of the most highly differentially expressed genes with higher expression on the
disease-protected side of the leaflet was CNP. It was postulated that CNP regulates valve
homeostatsis via paracrine signaling between VECs and VICs, and therefore the higher
expression of CNP by the endothelium on the ventricular side may contribute to the side-specific
disease protection. Further, CNP was found to be expressed in healthy valve leaflets, but its
expression and that of its activator, furin, were downregulated in VICs and VECs of human
sclerotic valves19, indicating that the changes in CNP expression during the progression of
CAVD are not limited to VECs. Although these data suggest that CNP may act in both autocrine
and paracrine manners to protect against sclerosis, the direct influence of CNP on VIC response
has yet to be studied. Further, it is not even clear that VICs can respond to CNP, as the
expression of components of the CNP signaling pathway, such as the NPR-B receptor and cGMP
activity, has yet to be verified. Motivated by findings from the microarray study with VECs and
the ex vivo study with human sclerotic valves, we hypothesized that VICs are equipped with
74
CNP signaling components and CNP elicits protective effects against CAVD by regulating the
pathological differentiation of VICs into myofibroblasts and osteoblasts. To test the hypothesis,
we first tested correlations between CNP expression and pathological differentiation of VICs in
normal and sclerotic valve leaflets. We then determined the expression of NPR-B, the primary
receptor for CNP, and the ability of CNP to induce the activation of cGMP signaling in vitro.
Myofibroblast and osteoblast differentiation of VICs in the presence or absence of CNP was
determined in vitro. As demonstrated previously, matrix stiffness modulates VICs response to
exogenous biochemical factors, and therefore we kept surface stiffness constant in this current
study in hopes to first identify if CNP has any direct cellular effect on VICs.
6.1. Materials and Methods
Unless otherwise stated, all reagents were purchased from Sigma-Aldrich (Oakville, ON,
Canada). Detailed protocols are described in Appendix A. Assays that followed the protocols
from the manufacturers without any modification are not listed in Appendix A; these protocols
can be found on the websites of the respective suppliers.
6.1.1. Animal Model and Valve Interstitial Cell Isolation
For histological analysis, sclerotic and healthy leaflets were kindly provided by Dr. Peter Davies’
laboratory at the University of Pennsylvania. Briefly, sclerotic leaflets were obtained from pigs
fed an atherogenic diet240 for five months. This hypercholesterolemic diet induces focal
calcification preferentially in the fibrosa of the valves, similar to those observed in human
sclerotic valves6. Control pigs were fed normal chow. Leaflets were fixed in 10% NBF, paraffin-
embedded and serial sectioned for immunofluorescent staining.
For cell culture, normal aortic valves were obtained from eight month old pigs immediately after
death (Quality Meat Packers, Toronto, ON). VICs were isolated by collagenase digestion as
described in Chapter Five. Only primary VICs were used to preserve the heterogeneity of the cell
population as explained in Chapter Five.
6.1.2. Cell Culture
Cells were plated on uncoated TCPS at a seeding density of 10,000 cells/cm2, and medium was
changed every two days unless otherwise stated. To evaluate myofibroblast differentiation, cells
75
were cultured in complete medium (DMEM with 10% FBS (Hyclone, Logan, UT, Lot #
KRA25425), 10,000 units/mL penicillin, and 10 mg/mL streptomycin) for seven days at 37 °C
and 5% CO2. To determine the myofibroblast content of freshly isolated VICs, an aliquot of
isolated cells was cytospun onto microscope glass slides, fixed and stained for α-SMA with
monoclonal mouse anti--SMA antibody (20 g/mL clone 1A4 mouse anti-human monoclonal
primary antibody) and 20 g/mL Alexa Fluor® 568 goat anti-mouse antibody, and for nuclei
with Hoechst 33242 dye. The dose response of CNP (CNP-22, Bachem, Torrance, CA) was
determined by measuring cGMP activity with concentrations of CNP of 0 nM, 1 nM and 100nM,
and -SMA expression of VICs with concentrations of CNP of 0 nM, 0.1 nM, 1 nM, 10 nM and
100 nM. The concentration of CNP with the most detectable activation of cGMP activity and
reduction in -SMA expression was used in subsequent experiments. To evaluate osteogenic
differentiation, cells were cultured in the presence or absence of CNP with calcifying medium
consisting of complete medium supplemented with 10 mM β-glycerophosphate, 10 g/mL
ascorbic acid and 10 nM dexamathesone for up to 21 days at 37 °C and 5%CO2.
6.1.3. Histological Analysis
Paraffin-embedded leaflets from normal and sclerotic leaflets were sectioned transversely to the
valve long axis. Serial paraffin sections were immunostained for α-SMA, Runx2/Cbfa-1 (20
g/mL Runx2 polyclonal rabbit anti-mouse antibody, Santa Cruz Biotechnology, Santa Cruz,
CA and 20 g/mL Alexa Fluor ® 568 goat anti-rabbit secondary antibody) and CNP (2 g/mL ,
goat polyclonal C-19 primary antibody, Santa Cruz Biotechnology, Santa Cruz, CA and
20 g/mL Alexa Fluor ® 568 rabbit anti-goat secondary antibody). The sections were also
stained for nuclei with Hoechst 33242 dye.
6.1.4. Dose Response of CNP
VICs were cultured in complete DMEM for 48 hours and RNA was extracted. Transcript
expression of NPR-B was determined by PCR, followed by gel electrophoresis (Accession
number: DQ487044.1, forward primer: 5’-agcattaccgtaccctgggtg-3’ and reverse primer: 5’-
tagtgaggccggtcatcatgt -3’).
76
In a separate series of experiments, VICs were treated with 0 nM, 1 nM and 100 nM of CNP for
10 minutes in DMEM. The level of cGMP activity of the cultures was measured using cGMP
Direct Biotrak EIA assay kit (Amersham/GE Healthcare, Baie d’Urfe, Quebec).
To determine the dose-dependent response of -SMA expression by VICs, cells were cultured in
complete DMEM with CNP of 0 nM, 0.1 nM, 1 nM, 10 nM and 100 nM for seven days,
followed by western blotting. . Briefly, cell cultures were washed with ice-cold PBS followed by
the addition of 1× lysis buffer. Cells were scraped and transferred to pre-chilled tubes, followed
by incubation on ice for 30 minutes. Cell lysates were obtained by centrifugation at 16200 × g
for 15 minutes at 4 oC. The protein concentrations of cell lysates were determined by the micro
BCA protein assay (Pierce, Rockford, USA). 1.5 g of protein extract from each treatment group
was loaded on to 10% SDS-polyacrylamide gels for electrophoresis. Samples were then
transferred to polyvinylidene fluoride membranes, followed by immunoblotting for α-SMA (20
ng/mL clone 1A4 mouse anti-human monoclonal primary antibody) and glyceraldehyde-3-
phosphate dehydrogenase (83 ng/mL GAPDH mouse monoclonal antibody, Stressgen, Ann
Arbor, Michigan). Expression of α-SMA was quantified by densitometry using ImageJ Software
(NIH, Bethesda, MD) and normalized to GAPDH expression.
6.1.5. Cellular Proliferation
Proliferation of VICs up to 15 days in culture was determined based on measurement of cellular
DNA content (CyQuant® NF cell proliferation assay kit, Invitrogen, Burlington, ON).
6.1.6. Evaluation of Osteogenic Differentiation
VICs were cultured in calcifying media to promote osteogenic differentiation. Transcript levels
of Cbfa-1/Runx2, osteonectin and osteocalcin after three, eight and sixteen days of culture in
calcifying media with or without CNP were measured using qRT-PCR. ALP and osteocalcin
staining was performed after 21 days of culture in calcifying media. Calcium deposition was
determined by ARS staining after 14 days of culture. In addition, a colony forming unit-ALP
(CFU-ALP) assay was used to determine the frequency of VIC osteoprogenitor differentiation
under the influence of CNP58. Briefly, viable primary VICs were seeded at 0.2 cells/well into
96-well plates. The cells were cultured for three days in complete media to permit cell adhesion,
at which point the media were replaced with calcifying media with or without CNP and changed
77
every two days for three weeks. The cells were subsequently fixed with 10% NBF and stained
for ALP. For each plate, the number of wells without ALP-positive aggregates was recorded.
The ratio of wells without ALP-positive aggregates to the total number of wells was calculated.
Based on Poisson’s distribution, the negative natural logarithm of the ratio of wells without
aggregates to the total number of wells is the CFU-ALP frequency or equivalently, the expected
number of osteoprogenitors per plate under the specific culture conditions.
6.1.7. Evaluation of Myofibroblast Differentiation
After seven days of culture in complete DMEM with or without CNP, cells were fixed with 10%
NBF, permeablized and immunostained for α-SMA, followed by nuclear counterstaining.
Expression of α-SMA was quantified by densitometry of the immunoblots. In addition, CNP
expression in cultured VICs was evaluated by immunoflurescence staining after plating and after
five days of treatment with 1 ng/mL TGF-1 to induce myofibroblast differentiation.
To investigate changes in myofibroblast function, collagen deposition and cell contractility were
analyzed. Collagen content was measured with Sirius Red dye release method as described
previously241. Briefly, cultured cells were fixed with 10% NBF, followed by one hour incubation
at room temperature with 0.1% Sirius Red F3BA reconstituted in saturated picric acid. Stained
samples were washed five times with 10 mM HCl and then rinsed with distilled water. For
quantification, Sirius Red dye was released by 0.1 M NaOH for five minutes. The absorbance of
the supernatant containing the released dye was measured at 540 nm. Absorbance was
normalized by total cell number determined by DNA content, which was measured using
PicoGreen (Molecular Probes, Eugene, OR). Contractility was measured using standard stress-
relaxation collagen gel model224. In brief, VICs were cultured on constrained, compliant collagen
gels for four days in complete media with (100 nM) or without CNP at a cell density of 10,000
cell/cm2. Myofibroblast differentiation of VICs was induced by treating the cells with 1 ng/mL
of TGF-1 for 48 hours, after which the gels were released to allow for contraction. Images of
the collagen gels were taken every 30 minutes and the gel areas were determined using ImageJ.
6.1.8. Statistical Analysis
Results are presented as mean standard error. Samples sizes were at least three in all cases,
and experiments were repeated at least three times. Unpaired Student’s t-test was used for
78
comparisons between two groups. ANOVA and Fisher’s least significant difference test were
used to evaluate statistically significant differences in multiple group comparisons.
6.2. Results
6.2.1. Expression of Pathological Markers and CNP in Normal and Sclerotic Aortic Valves
Immunofluorescent staining of normal and sclerotic aortic valve leaflets revealed that the
expression of CNP is spatially mutually exclusive with that of -SMA and Runx2/Cbfa-1
(Figure 6.1). In normal valves, CNP expression was abundant throughout the interstitium, with
slightly higher expression in the ventricularis (Figure 6.1: A). There were few -SMA positive
cells in normal leaflets (Figure 6.1: D). Numerous cells in sclerotic valves stained strongly
positive for -SMA, particularly near lesions (Figures 6.1: E and F), indicative of VIC
myofibroblast differentiation. In contrast, weak or absent CNP staining was observed in these
regions in sclerotic valves (Figures 6.1: B and C). Cbfa-1/ Runx2, an osteochondral transcription
factor, was not detected in normal leaflets (Figure 6.1: G), but was abundant in sclerotic valves
(Figure 6.1: H and I) accompanied by low expression of CNP.
6.2.2. Molecular Components of CNP Signaling
Natriuretic receptors (NPR-A, NPR-B, NPR-C) are expressed in cardiac atria and ventricles, but
their expression in VICs is unknown. Of the three receptors, CNP has the highest binding affinity
with NPR-B. NPR-B is linked to a guanylyl cyclase domain, and CNP binding with NPR-B
receptor induces cGMP synthesis, which mediates downstream cellular responses (reviewed in 242). To determine if VICs are equipped with molecular components to detect and to process CNP
signaling, we identified the expression of NPR-B mRNA by VICs as well as the induction of
cGMP synthesis by CNP. Primary VICs indeed express transcripts of NPR-B (Figure 6.2: A) and
cGMP synthesis by VICs was observed within 10 minutes of treatment with 100 nM of CNP
(Figure 6.2: B).
6.2.3. Dose Response of CNP
Induction of cGMP synthesis by CNP showed a threshold effect. VICs appeared to be highly
responsive to 100 nM of CNP (Figure 6.2: B). We further investigated if there was a dose-
dependent response by measuring the expression level of -SMA with Western blotting. By
79
treating the cells with CNP concentrations of 0, 0.1, 1, 10 and 100 nM, it was found that
suppression of -SMA was most prominent with 100 nM of CNP (Figure 6.3: A and B).
Together with the cGMP synthesis data, we decided that in this in vitro culture model, 100 nM of
CNP was the most effective in mediating detectable cellular responses and all subsequent
experiments were conducted with 100 nM of CNP.
Figure 6.1. Expression of CNP, -SMA and Runx2/Cbfa-1 in normal and sclerotic porcine
aortic valves
(A-C) Immunofluorescent staining of CNP (red) and nucleus (blue). (D-F) Immunostaining of -
SMA (red) and nucleus (blue). (G-I) Immunostaining of Runx2/Cbfa-1 (red) and nucleus (blue).
“AO” denotes the aortic side and “V” denotes the ventricular side of the normal leaflets. Only
the aortic side of the sclerotic leaflets was shown.
Normal Sclerotic
CN
P
-SM
AR
un
x2
/Cb
fa1
Boxed Area
Boxed Area
G
Boxed Area
A B C
D E F
H I
100 m
AO
V
AO
V
V
AO
Normal Sclerotic
CN
P
-SM
AR
un
x2
/Cb
fa1
Boxed Area
Boxed Area
G
Boxed Area
A B C
D E F
H I
100 m
AO
V
AO
V
V
AO
CN
P
-SM
AR
un
x2
/Cb
fa1
Boxed Area
Boxed Area
G
Boxed Area
A B C
D E F
H I
100 m
AO
V
AO
V
V
AO
80
NPR-B (142 \bp)
0 1 100
CNP concentration (nM)
cGM
P c
onc
en
tra
tion
(fm
ol/w
ell)
No
t de
tec
ted
No
t de
tec
ted
0
3
6
9
12*
B.
A.
NPR-B (142 \bp)
0 1 100
CNP concentration (nM)
cGM
P c
onc
en
tra
tion
(fm
ol/w
ell)
No
t de
tec
ted
No
t de
tec
ted
0
3
6
9
12*
B.
A.
NPR-B (142 \bp)
0 1 100
CNP concentration (nM)
cGM
P c
onc
en
tra
tion
(fm
ol/w
ell)
No
t de
tec
ted
No
t de
tec
ted
0
3
6
9
12*
B.
0
3
6
9
12*
B.
A.
Figure 6.2. Expression of NPR-B and activation of cGMP by CNP
(A) Primary VICs from three different isolations expressed transcript for NPR-B (lane 1,2,3).
(B) Treatment of VICs with 100 nM of CNP significantly induced cGMP synthesis in
comparison to those treated with 1 nM of CNP and the untreated culture, * P < 0.05
6.2.4. Cellular Proliferation and Morphological Changes
CNP had little effect on proliferation whether cells were cultured in complete media
(Figure 6.4: A) or calcifying media (Figure 6.4: B). In complete media, VICs displayed typical
fibroblastic morphology with elongated processes, and no substantial morphological differences
were observed between CNP-treated and untreated cells (data not shown). However, when cells
were cultured in calcifying media for more than ten days, formation of multicellular aggregates
was prominent only in the absence of CNP (Figures 6.4: C and D). Since CNP had no effect on
cellular proliferation in all culture conditions (P ≥ 0.4 between untreated and CNP treated
samples at each time point), cell density was similar in all cases and was unlikely to contribute to
the observed differences in aggregation or the phenotypic differences described below.
81
Figure 6.3. Dose-dependent -SMA expression by VICs
Immunoblots of -SMA and GAPDH and the corresponding densitometric quantification for
culture after seven days with CNP concentrations of 0, 0.1, 1, 10 and 100 nM. ** P < 0.001 and
* P < 0.05 in comparison to no CNP treatment.
6.2.5. CNP Inhibits Calcification and Osteogenic Differentiation of VICs
Consistent with previous studies58, VICs formed multicellular aggregates when cultured in
calcifying media (Figure 6.4: D). In untreated cultures, the aggregates contained calcium as
shown with the intense positive staining of ARS (Figure 6.5: A and B). CNP-treated VICs
stained diffusely for calcium with minimal aggregate formation (Figure 6.5: C). The few
aggregates that did form in the CNP-treated culture stained weakly for ARS (Figure 6.5: D).
Quantification of the number of ARS-positive aggregates confirmed that CNP treatment
inhibited calcification (Figure 6.5: E).
SMA (42 kDa)
GAPDH (36 kDa)
0 0.1 1 10 100
Concentration of CNP (nM)
0
20
40
60
80
100
120
0 0.1 1 10 100
Concentration of CNP (nM)
Pe
rce
nta
ge
of S
MA
e
xpre
ssio
n r
ela
tive
t o n
o tr
ea
tme
nt *
** **
**
SMA (42 kDa)
GAPDH (36 kDa)
0 0.1 1 10 100
Concentration of CNP (nM)
0
20
40
60
80
100
120
0 0.1 1 10 100
Concentration of CNP (nM)
Pe
rce
nta
ge
of S
MA
e
xpre
ssio
n r
ela
tive
t o n
o tr
ea
tme
nt *
** **
**
82
Figure 6.4. Proliferation and morphology of cells with or without CNP treatment
(A) Proliferation of VICs from four hours to 15 days in complete media and (B) calcifying
media. (C) In calcifying media, few aggregates formed in CNP-treated cultures, (D) whereas
abundant aggregate formation was observed in untreated cultures.
Formation of calcified aggregates occurs in vitro through at least two possible processes, one
associated with myofibroblast apoptosis and the other associated with osteoblast
differentiation79. Both types of aggregates were observed in the untreated cultures, indicating
calcification in the untreated VICs was due in part to osteoblast differentiation. Notably,
transcript expression of Cbfa-1/Runx2, osteonectin and osteocalcin in CNP-treated cells was
lower than that of untreated samples over the culture duration, with a significant reduction in
osteonectin expression after as little as eight days of culture (Figures 6.6: A, B and C).
Consistent with the transcriptional profile, expression of bone-related proteins was also reduced
with CNP treatment. ALP activity (Figure 6.7: A and B) and osteocalcin expression were low
Ce
ll nu
mb
er(
1x1
0-3
)
0
100
200
300
400
500
600
700
4 hrs 5 days 10 days 15 daysCulture duration
Complete media + 100nM CNPComplete media
A. B.
0
100
200
300
400
500
600
700
4 hrs 5 days 10 days 15 days
Culture duration
OS media + 100nM CNPOS media
C. Calcifying media + 100 nM CNP D. Calcifying media
Culture duration
Calcifying media + 100 nM CNPCalcifying media
Complete media + 100 nM CNPComplete media
Ce
ll nu
mb
er(
1x1
0-3
)
0
100
200
300
400
500
600
700
4 hrs 5 days 10 days 15 daysCulture duration
Complete media + 100nM CNPComplete media
A. B.
0
100
200
300
400
500
600
700
4 hrs 5 days 10 days 15 days
Culture duration
OS media + 100nM CNPOS media
C. Calcifying media + 100 nM CNP D. Calcifying media
Culture duration
Calcifying media + 100 nM CNPCalcifying media
Complete media + 100 nM CNPComplete media
83
within CNP-treated cultures (Figure 6.7: C), but high within multicellular aggregates in the
untreated cultures (Figure 6.7: D).
To further understand the cellular target of the anti-osteogenic effect of CNP, we determined the
CFU-ALP frequency as a measure of the differentiation of single osteoprogenitor cells58. Under
CNP treatment, the CFU-ALP frequency was significantly reduced in comparison to the
untreated culture (Figure 6.8). These data suggest that the anti-osteogenic effect of CNP was
mediated by suppressing the osteogenic differentiation of progenitor cells in the VIC population.
6.2.6. Inhibition of Myofibroblast Differentiation by CNP
Myofibroblast differentiation can be induced by biochemical (e.g., cytokines such as TGF-165)
and mechanical stimuli (e.g., a rigid culture surface55, 79). To evaluate the myofibroblast
differentiation of VICs, we cultured freshly isolated VICs on stiff TCPS with complete medium.
As in Chapter Five, we aimed to achieve a cell population that reflected that of native valves, and
therefore the effect of CNP was only tested on primary VICs, as subculturing induces
myofibroblast differentiation55. Freshly isolated VICs did not express -SMA, indicative of an
undifferentiated cell population (Figure 6.9: A). After seven days of culture, cells treated with
CNP (Figure 6.9: B) expressed little -SMA compared to untreated cells, which had prominent
-SMA stress fibers (Figure 6.9: C). Western blotting of CNP-treated and untreated cultures
further confirmed significantly lower -SMA expression with CNP treatment (Figures 6.10: A
and B).
84
Figure 6.5. CNP modulates calcification by VICs
(A and B) Untreated cultures stained intensely with ARS, indicating high and localized
concentration of calcium deposition. (C) CNP-treated cultures displayed diffuse ARS staining
and (D) only weak ARS staining even in the few aggregates that formed. (E) CNP inhibited
formation of calcified aggregates after fourteen days in osteogenic medium, * P < 0.05.
A. B.
0
20
40
60
80
100
120
100nM CNP No CNP
Nu
mb
er
of A
RS
-po
sitiv
ea
gg
reg
ate
s
*
E.
C. D.
A. B.
0
20
40
60
80
100
120
100nM CNP No CNP
Nu
mb
er
of A
RS
-po
sitiv
ea
gg
reg
ate
s
*
E.
C. D.
85
Figure 6.6. Expression of bone-related transcripts
(A) Transcript expression of Runx2/Cbfa-1, (B) osteonectin and (C) osteocalcin in CNP-treated
cultures relative to that of untreated samples. * P < 0.05. (A relative gene expression level of less
than one indicates lower expression with CNP treatment relative to that without CNP treatment).
A.
B.
Re
lati
ve R
un
x2/C
bfa
-1
exp
ress
ion
(AU
) *
0.00.20.40.60.81.01.21.41.6
Day 3 Day 8 Day 16
*
0.00.20.40.60.81.01.2
Day 3 Day 8 Day 16
**
Re
lati
ve o
ste
one
ctin
exp
ress
ion
(AU
)
C.
Re
lati
ve o
ste
oca
lcin
exp
ress
ion
(AU
)
0.0
1.0
2.0
3.0
4.0
5.0
Day 8 Day 16
*
A.
B.
Re
lati
ve R
un
x2/C
bfa
-1
exp
ress
ion
(AU
) *
0.00.20.40.60.81.01.21.41.6
Day 3 Day 8 Day 16
*
0.00.20.40.60.81.01.2
Day 3 Day 8 Day 16
**
Re
lati
ve o
ste
one
ctin
exp
ress
ion
(AU
)
C.
Re
lati
ve o
ste
oca
lcin
exp
ress
ion
(AU
)
0.0
1.0
2.0
3.0
4.0
5.0
Day 8 Day 16
*
86
Figure 6.7. Expression of bone-related proteins
(A) At the protein level, CNP-treated cells had low levels of ALP activity and (C) weak diffuse
staining for osteocalcin. (B) Untreated cultures displayed high levels of localized ALP activity as
well as (D) osteocalcin within the aggregates (inset represents no primary antibody control; black
arrow indicates aggregate).
To investigate if CNP regulates biochemically-induced myofibroblast differentiation of VICs, we
compared the difference in CNP expression by VICs before and after five days of culture with
TGF-1. VICs expressed CNP but not -SMA after one day in culture (Figure 6.11: A). After
five days of induction with TGF-β1, the majority of VICs differentiated into -SMA positive
myofibroblasts as expected (Figure 6.11: B). Similar to the mutually exclusive expression of
-SMA and CNP observed in the histological analysis, -SMA positive myofibroblasts did not
express CNP. A few cells that did not differentiate into myofibroblasts with TGF-1 induction
stained positive for CNP (Figure 6.11: B, arrow). Co-expression of -SMA and CNP was
therefore rarely observed in vivo or in vitro.
A. B.
C. D.
A. B.
C. D.
87
Figure 6.8. Effect of CNP on osteoprogenitor subpopulation
The CFU-ALP frequency was reduced in CNP-treated cultures, suggesting that CNP inhibits
osteogenic differentiation of the valve progenitor subpopulation (* P < 0.05).
Myofibroblasts typically have increased collagen synthesis and cellular contractility55, 59, 65. CNP
treatment suppressed collagen synthesis compared with untreated cells (Figure 6.12). To
evaluate the effect of CNP on myofibroblast-induced contractility, we cultured TGF-1-treated
VICs on constrained collagen gels and then measured gel contraction by VICs upon gel release.
Gels treated with CNP contracted significantly less than untreated gels, suggesting that CNP
suppressed TGF-1-induced myofibroblast differentiation (Figure 6.13: A and B).
6.3. Discussion
CNP is expressed in disease-protected regions of normal porcine valves6 and in normal human
valves19, but its expression is down-regulated in calcified aortic valves19 and in advanced
atherosclerotic lesions243. In the current study, we identified the expression of NPR-B receptor
and cGMP activity in VICs, which are components of CNP signaling. We found mutually
exclusive spatial expression of CNP and disease-related VIC phenotypes in vivo, and confirmed
in vitro that CNP inhibits differentiation of VICs to myofibroblasts and osteoblasts, phenotypes
associated with CAVD. Our current findings provide a cellular basis responsible for the
protective of CNP against valve calcification.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
100 nM CNP No CNP
CF
U-A
LP
fre
que
ncy
*
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
100 nM CNP No CNP
CF
U-A
LP
fre
que
ncy
*
88
Figure 6.9. CNP inhibits expression of myofibroblast marker
(A) Immunostaining of freshly isolated VICs, (B) CNP-treated VICs and (C) untreated VICs
for -SMA (red) and nucleus (blue).
The influence of CNP on osteogenic differentiation and calcification appear to be tissue and
cell-type specific. Several animal models with either targeted disruption of NPPC244, the gene
for natriuretic peptide precursor C, or loss-of-function mutation in NPR-B receptor107, 245
display skeletal defects due to disturbed chondrogenesis during endochondral ossification.
CNP-dependent skeletal growth was also demonstrated in cell culture studies with pre-
osteoblastic cells188, 246, 247 and calvaria cells248. Treatment of pre-osteoblastic cells with CNP
has been reported to increase calcium deposition and the expression of ALP and osteocalcin
via NPR-B/cGMP signaling, indicative of CNP-induced osteoblast differentiation188, 246, 247.
Although CNP promotes ossification in bone cells, the reciprocal effect was found in
vascular cells, suggesting its response is cell-type specific. Vascular smooth muscle cells
treated with CNP displayed reduced calcium deposition and ALP expression187. Here, by
manipulating the culture conditions to promote osteogenic differentiation, CNP inhibited the
differentiation of VICs into osteoblasts, as demonstrated by reduced calcium deposition and
A.
B. C.
A.
B. C.
89
No
rma
lize
d
-SM
A e
xpre
ssio
n-SMA (42 kDa)
GAPDH (36 kDa)
100nM CNP no CNP
0.0
0.5
1.0
1.5
2.0
2.5
CNP + CNP -100nM CNP no CNP
*
No
rma
lize
d
-SM
A e
xpre
ssio
n-SMA (42 kDa)
GAPDH (36 kDa)
100nM CNP no CNP
0.0
0.5
1.0
1.5
2.0
2.5
CNP + CNP -100nM CNP no CNP
*
-SMA (42 kDa)
GAPDH (36 kDa)
100nM CNP no CNP
0.0
0.5
1.0
1.5
2.0
2.5
CNP + CNP -100nM CNP no CNP
*
lowered expression of bone-related transcripts and proteins in whole cell populations,
providing additional evidence to support the paradoxical effect of CNP in the vascular
system and the skeletal system.
Figure 6.10. Quantification of -SMA expression
Western blot of -SMA and GAPDH and the corresponding densitometric quantification for
culture after seven days with or without CNP treatment. * P < 0.05.
We have previously identified a large subpopulation of progenitor cells in VICs with multipotent
differentiation potential58, and therefore investigated their responsiveness to CNP using single-
cell clonal assays. By treating cells at the start of the experiments, we tested the response of
uncommitted, undifferentiated valve progenitors to CNP. We found that CNP attenuated
osteogenic differentiation of the valve progenitor subpopulation significantly. Although the
effect of CNP on valve progenitors at different stages of committment will require further
investigation, our initial findings suggest the ability of CNP to prevent osteogenic differentiation
of at least the undifferentiated valve progenitor cells. Commitment of cells to specific lineages
has been shown to influence the responsiveness of cells to CNP treatment. For example, ROB-
C26 cells induced by BMP-2 to undergo osteoblast differentiation displayed high levels of CNP-
mediated cGMP activity, whereas the same cells committed to the adipogenic lineage with
dexamathesone treatment exhibited marked reduction of CNP-mediated cGMP activity249.
90
Presumably VICs, including the subpopulation of osteoprogenitors, undergo pathological
differentiation during CAVD pathogenesis, leading to their commitment to myofibroblast or
osteoblast cell lineages, which may ultimately alter their response to CNP. Hence, the
effectiveness of CNP against CAVD in vivo may depend on the stage of the disease. Therefore,
future work on the therapeutic application of CNP for CAVD should explore the stage-related
effect of CNP treatment as a function of the disease progression.
Figure 6.11. Mutually exclusive expression of CNP and -SMA in cultured VICs.
(A) After one day in culture, VICs expressed CNP (red). (B) After five days of growth in media
containing TGF-β1, the majority of VICs differentiated into myofibroblasts that expressed -
SMA (green); however a few cells that did not express -SMA stained positive for CNP (white
arrow).
VICs can undergo myofibroblast differentiation, which is closely associated with apoptosis-
dependent calcification in vitro as described in Chapter Five. CNP is widely recognized to
regulate fibrosis in other tissues. For example, administration of CNP in animal models reduced
fibrosis associated with vascular intimal thickening110, pulmonary fibrosis111, and myocardial
infarction112. We observed that CNP attenuated myofibroblast differentiation of quiescent VICs
as reflected by the down-regulation of -SMA and loss of myofibroblast-related functions. Co-
expression of -SMA and CNP was rarely observed in vivo or in vitro. Although the influence
of CNP on apoptosis varies with cell type250-252, an anti-apoptotic effect of CNP has been
reported in some cell types such as pulmonary endothelial cells252. In our culture, notable cell
death was not observed as majority of the cells were well-spread on TCPS and plasma membrane
A. B.A. B.
91
blebbing resulting from cleavage of cytoskeleton proteins by caspases during apoptosis253, 254
was not evident. These observations clearly demonstrate that CNP is not pro-apoptotic in VICs.
Figure 6.12. CNP affects function associated with activated myofibroblasts
Collagen production of CNP-treated cells was significantly less than the
untreated culture. * P < 0.05.
It has been well documented that the actions of CNP are modulated through membrane-bound
receptors, mainly NPR-B and NPR-C, of which only NPR-B is linked to the cGMP-dependent
signaling cascade. We found that VICs express the transcript of NPR-B and synthesize cGMP in
response to CNP treatment. Additional studies are required to determine if the observed CNP-
mediated effects on VIC differentiation involve NPR-B/cGMP pathway. Because of the lack of
an NPR-B antagonist, siRNA-based knockdown of NPR-B would be one approach to test its
role.
Co
llag
en
pro
duc
tion
(A
54
0nm
no
rma
lize
d t
o t
ota
l DN
A)
0.0
1.0
2.0
3.0
4.0
5.0
6.0
7.0
DMEM + CNP DMEM 100nM CNP no CNP
*
Co
llag
en
pro
duc
tion
(A
54
0nm
no
rma
lize
d t
o t
ota
l DN
A)
0.0
1.0
2.0
3.0
4.0
5.0
6.0
7.0
DMEM + CNP DMEM 100nM CNP no CNP
*
92
Figure 6.13. Contractility of VICs with or without CNP treatment.
Cells were seeded on the surface of constrained collagen gels. Contractility was recorded every
half an hour after gel release. Untreated VICs were more contractile than those treated with CNP
(* P < 0.05, ** P < 0.06).
In summary, the results of this study demonstrate that VICs express components of CNP
signaling. CNP inhibits myofibroblast and osteoblast differentiation of VICs, which may prevent
calcification. These findings provide a cellular mechanism by which CNP maintains valve
homeostasis and protects against aortic valve calcification in vivo. This fundamental knowledge
regarding CNP enables future studies aimed at the identification of the molecular mechanisms of
its putative protective actions, both in vitro and in vivo.
0 hr 0.5 hr 1 hr 1.5 hrs 2.0 hrs
No
CN
P1
00
nMC
NP
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0.5 1 1.5 2
100nM CNP No CNP
Ge
l are
a (
cm2) * **
Time after gel release (hr)
0 hr 0.5 hr 1 hr 1.5 hrs 2.0 hrs
No
CN
P1
00
nMC
NP
0.0
0.2
0.4
0.6
0.8
1.0
1.2
0.5 1 1.5 2
100nM CNP No CNP
Ge
l are
a (
cm2) * **
Time after gel release (hr)
93
Chapter 7
7. The Combined Effects of Mechanical and Biochemical
Cues on the Transcriptional Regulation of VICs
It is well accepted that matrix stiffness regulates phenotypic drift and functions of a wide range
of cell types55, 221. Recent studies further suggest that substrate stiffness may modulate the release
of and the response to biochemical factors by cells12. The correlative link between cellular
response, mechanical cues and biochemical cues from the microenvironment has yet to be
studied thoroughly. Little is known regarding the impact of the combined effects of mechanical
and biochemical cues on VIC biology, despite increasing evidence of close relationships between
changes in tissue mechanics, soluble factors and disease progression7-9, 176.
Matrix stiffness regulates the responses of cells to biochemical factors to ultimately define cell
behaviour. The first demonstration of this was the differential effects of TGF-β on
myofibroblasts by matrix stiffness11. Myofibroblasts cultured on more compliant substrates were
insensitive to TGF-β, whereas those cultured on stiffer substrates were highly responsive to
TGF-β. Similar differential effects of TGF-β were also observed in VICs cultured on compliant
and stiff matrices as described in Chapter Five, suggesting that matrix stiffness may also
modulate the response of VICs to soluble factors. Others have also reported growth factors
mediate cellular response in a matrix stiffness-dependent manner169, 170. In addition, soluble
factors and matrix stiffness have been shown to synergistically guide stem cell commitment to
particular lineages130.
We have demonstrated the ability of matrix stiffness or CNP alone to modulate the pathological
differentiation of VICs into myofibroblasts and osteoblasts. In this chapter, we investigated the
combined effect of matrix stiffness and CNP on the transcriptional regulation of VICs. We
identified the impact of matrix stiffness on CNP-dependent transcript expression. The evaluation
of cell response to biochemical cues in the context of the cellular mechanical environment will
provide a more complete understanding of valve cell biology.
94
7.1. Materials and Methods
7.1.1. Cell Culture
Unless otherwise stated, all reagents were purchased from Sigma-Aldrich (Oakville, ON,
Canada). Detailed protocols are described in Appendix A. Assays that followed the protocols
from the manufacturers without any modification are not listed in Appendix A; these protocols
can be found on the websites of the respective suppliers.
7.1.2. Sample Preparation
Primary VICs were isolated from porcine aortic valves by collagenase digestion as described in
Chapter Five. Compliant and stiff collagen matrices were constructed following procedures
described in Chapter Four. VICs were seeded on collagen matrices at 10,000 cells/cm2 in
calcifying media with (100 nM) or without CNP. A total of four different experimental
conditions were tested:
I. VICs cultured on compliant collagen matrices with calcifying media
II. VICs cultured on stiff collagen matrices with calcifying media
III. VICs cultured on compliant collagen matrices with calcifying media and 100 nM
CNP
IV. VICs cultured on stiff collagen matrices with calcifying media and100 nM CNP
After nine days in culture, VICs were released from collagen matrices by collagenase digestion.
Cell pellets were obtained by centrifugation, followed by aspiration of the supernatant. Total
RNA was isolated from cell pellets following standard protocols of the Micro RNeasy System
(Qiagen, Mississauga, ON). A total of 16 RNA samples from the four culture conditions using
cells from four separate VIC isolations were collected (N = 4). Universal reference RNA was
obtained by extracting RNA directly from freshly isolated VICs. RNA samples were quantified
with a NanoDrop Spectrophotometer (ND-1000, NanoDrop Technologies, Wilmington, DE).
Sample integrity based on the 28S:18S ribosomal RNA ratio was determined using Agilent 2100
Bioanalyzer (Agilent Technologies Canada, Mississauga, ON). All microarray samples had RNA
integrity number (RIN) of at least nine.
95
7.1.3. Microarray Experiments
RNA samples from the four culture conditions were labeled with Cy5 and the universal reference
RNA labeled with Cy3. Labeled RNA samples were competitively hybridized onto 44k 60-mer
Porcine Gene Expression Microarrays (G2519F, Design ID: 020109, Agilent Technologies
Canada, Mississauga, ON) at 65 oC and 20 rpm for 17 hours. Arrays were scanned using the
Agilent dual-laser DNA microarray scanner (G2565CA) and images were analyzed with Agilent
Feature Extraction Software (Version 10.5.1.1.).
7.1.4. Data Analysis
Intensity files were loaded into R statistical analysis software (Version 2.91, http://www.r-
project.org/) for preprocessing. Quality assessment was performed using Bioconductor package
(arrayQualityMetrics Version 2.2.1). One of the replicates for the RNA sample extracted from
VICs cultured on thin matrices with CNP treatment was identified to be an outlier from the log2
intensity boxplots for the red and green channels. Data generated from this sample were
eliminated from subsequent gene expression analyses. Gene expression analysis was done by
GeneSpring GX 10.0.2. Briefly, a flag filter was applied and those probes being present or
marginal in at least two out of eight samples (i.e. n = 4 for each test condition with the exception
of thin matrices with CNP treatment, for which n = 3) were kept for further analysis. An
expression filter was applied and those with raw intensities greater than 100 in at least two out of
eight samples were kept for further analysis. T-tests were performed between samples from two
different experimental conditions and the Benjamini & Hochberg False Discovery Rate (FDR)
method was used for multiple testing corrections. Transcript expression with fold change of
greater than two and P < 0.05 were recorded as statistically significant changes in fold
expression.
7.1.5. Partial Annotation Mapping and Identification of Biological Processes
The contents of the porcine gene expression microarray sourced from RefSeq (release 27, Jan
2008), UniGene (release 33, Feb 2008) and TIGR (The Institute for Genomic Research, release
12, Jun 2006). As porcine genome sequencing has yet to be completed, sequences unavailable in
the porcine genome database were examined for homology to Homo sapiens, Bos taurus or Mus
musculus genome by BLAST searches. The protein sequences were identified based on the gene
sequences using the search engine of the Entrez Nucleotide database
96
(http://www.ncbi.nlm.nih.gov/sites/entrez?db=nuccore). The Gene Ontology (GO) annotation for
each sequence was determined by searching the UniProtKB (Universal Protein Resource
Knowledgebase) database (http://www.uniprot.org/help/uniprotkb), and the corresponding
biological processes were identified as listed in the GO annotations. For entries without complete
GO annotations, biological functions of the genes were determined by literature searches. Due to
the large number of entries and the lack of complete porcine annotations, an exhaustive analysis
of the complete gene list is beyond the scope of this study. Differentially expressed genes with
putative significance to valve pathology were identified and discussed.
7.1.6. Venn Diagram Analysis
Venn diagram analysis was performed to determine genes that are modulated commonly or
exclusively by matrix stiffness and by CNP. Two-way and three-way Venn diagrams were
generated using the list of differentially expressed entries and VENNY online software
(http://bioinfogp.cnb.csic.es/tools/venny/index.html, BioinfoGP Bioinformatics for Genomics
and Proteomics CNB-CSIC, Madrid, Spain)255.
7.2. Results
7.2.1. Sample Characterization
The cell morphology after nine days of culturing on compliant and stiff matrices without CNP
treatment were the same as reported in Chapter Five. Cells formed aggregates more readily on
compliant matrices in comparison to those cultured on stiff matrices. When treated with CNP,
aggregate formation by VICs on both compliant and stiff matrices was reduced (Figure 7.1 and
Figure 7.2).
97
7.2.2. Differential Gene Expression by Matrix Stiffness
In the absence of CNP, 998 sequences were identified as differentially expressed (i.e., fold
difference greater than two and P < 0.05), with higher expression of 648 sequences and lower
expression of 350 sequences in VICs cultured on the compliant matrices relative to those
cultured on stiff matrices. Seventy-eight percent of the upregulated sequences and 93% of the
downregulated sequences displayed two- to five-fold changes in expression (Figure 7.3), while
only a small fraction of the gene list displayed an expression fold difference of greater than 30-
fold.
Figure 7.1. CNP inhibites aggregate formation on VICs cultured on compliant and stiff
matrices
Relief phase contrast images of VICs cultured on compliant matrices with CNP treatment (A)
and without treatment (B), and on stiff matrices with CNP treatment (C) and without treatment
(D). Formation of aggregates was predominately found in untreated cultures (B and D, white
arrows indicate cell aggregates).
A.
CNP treated Untreated
B.
C. D.
Co
mp
lian
tS
tiff
A.
CNP treated Untreated
B.
C. D.
A.
CNP treated Untreated
B.
C. D.
A.
CNP treated Untreated
B.
C. D.
Co
mp
lian
tS
tiff
98
Figure 7.2. CNP significantly reduces the total number of aggregates formed by VICs on
compliant and stiff matrices
Only a few aggregates were formed in CNP-treated cultures on compliant and stiff matrices
(number indicates the average aggregate count). * P < 0.05 compared to untreated cultured.
Figure 7.3. The distribution of sequences differentially expressed with matrix stiffness
Sequences associated with a wide range of biological processes were altered by matrix stiffness
(Tables 7.1 and 7.2). Multiple upregulated transcripts in VICs cultured on compliant matrices
were associated with immune response, apoptosis and growth (Table 7.1). Several osteoinductive
transcripts were upregulated in cells cultured on the compliant matrices, a culture condition that
favored osteogenic differentiation of VICs. These included nuclear factor of kappa light
polypeptide gene enhancer in B-cells inhibitor- (NFKBIA), bone morphogenetic protein-2
0
50
100
150
200
Compliant matrices Stiff matricesCulture substrate
Nu
mb
er
of a
gg
reg
ate
s With 100 nM CNPWithout CNP
*
*21
0
50
100
150
200
Compliant matrices Stiff matricesCulture substrate
Nu
mb
er
of a
gg
reg
ate
s With 100 nM CNPWithout CNP
*
*21
0
50
100
150
200
250
300
350
2.5 5 10 20 30 40 +Fold difference
Nu
mb
er
of e
ntr
ies
UpregulatedDownregulated
99
(BMP2) and mitogen-activated protein kinase phosphatase-1 (MKP-1). NFKBIA encodes for a
protein that negatively regulates Notch signaling pathway. Notch signaling has been shown to
regulate osteogenesis, including its inhibitory effect on the differentiation of mesenchymal
progenitor cells to osteoblast lineage 256. Notch1, part of the Notch signaling system, represses
the activation of Cbfa-1/Runx2257, which is a transcription factor associated with osteogenic
differentiation. Expression of Cbfa-1/Runx2 was found to be upregulated in mouse and rabbit
models of valvular calcification258, 259 and in cells cultured on compliant collagen matrices
(described in Chapter Five). Negative regulation of Notch signaling by NFKBIA might possibly
promote Runx2 activation. Similarly, BMP2260 and MKP-1261 signaling for osteogenesis require
Cbfa-1/Runx2 activity (see Discussion).
Coupled with the relative high expression of osteoinductive transcripts, the expression of
transforming growth factor beta 3 (TGFB3) was downregulated in cells grown on compliant
matrices. TGFB3 has been shown to inhibit osteogenic differentiation of mesenchymal stem
cells262. The upregulation of osteoinducive transcripts and downregulation of osteorepressive
transcript on cells cultured on compliant matrices presumably contributes to the pro-osteogenic
nature of these matrices. In addition, the expression of transcripts related to cell adhesion and
actin-myosin cytoskeleton system were downregulated in VICs cultured on the more compliant
matrices.
100
Table 7.1. A subset of transcripts with higher expression in VICs cultured on compliant
matrices relative to those cultured on stiff matrices
Gene name* C/S fold change‡
P-value Biological process
CSF2 59.48 5.39 x 10-4 Immune Response IL8 41.88 2.19 x 10-6 Inflammatory response CCL20 27.58 1.21 x 10-3 Immune Response BTG2 15.24 1.91 x 10-5 Negative regulation of apoptosis SELE 9.67 2.2 x 10-3 Cell adhesion SPY2 7.27 2.27 x 10-4 Negative regulation of MAP kinase
activity NFKBIA 4.32 1.14 x 10-3 Negative regulation of Notch signaling
pathway MKP-1 3.45 1.09 x 10-3 Protein amino acid dephosphorylation BMP2 3.25 3.00 x 10-3 Growth C-JUN 2.95 1.05 x 10-4 Regulation of transcription SLN 2.79 4.22 x 10-3 Regulation of calcium ion transport PIAP 2.58 3.76 x 10-3 Regulation of apoptosis
* CSF2, colony stimulating factor 2; IL8, interleukin 8; CCL20, chemokine (C-C motif) ligand
20; BTG2, B-cell translocation gene 2; SELE, selectin; SPY2, sprouty homolog 2; NFKBIA,
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor alpha; MKP-1,
mitogen-activated protein kinase phosphatase-1; BMP2, bone morphogenetic proteins; C-JUN,
C-JUN protein; SLN, sarcolipin; PIAP, inhibitor of apoptosis-like. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡ Fold changes of genes expressed by cells cultured on compliant matrices relative to those
cultured on stiff matrices
7.2.3. Differential Gene Expression by CNP
The effect of CNP on altering transcript expression in VICs cultured on compliant and stiff
collagen matrices was evaluated. For VICs cultured on compliant matrices, CNP treatment
influenced the expression of 181 sequences, with higher expression of 73 sequences and lower
expression of 108 sequences. When VICs were cultured on stiff collagen matrices, CNP
treatment altered the expression of 237 transcripts, with higher expression of 139 genes and
lower expression of 98 genes in CNP-treated samples relative to untreated cells. The majority of
the transcripts displayed expression fold differences of less than five (Figures 7.4 and 7.5).
101
CNP treatment affects a wide variety of genes that are associated with various biological
processes. When cells were cultured on compliant matrices, CNP upregulated transcripts related
to metabolic processes such as gluconeogenesis, lipid catabolic process, collagen catabolic
process and ATP biosynthetic process (Table 7.3). CNP downregulated the expression of
transcripts related to ion binding and transport (Table7.4). Similarly when cells were cultured on
stiff matrices, CNP treatment also upregulated several transcripts related to metabolic processes
including glycogen metabolic process and lipid catabolic process (Table 7.5). CNP
downregulated transcripts associated with the actin-myosin cytoskeleton system when cells were
cultured on stiff matrices (Table 7.6).
Table 7.2. A subset of transcripts with lower expression in VICs cultured on compliant
matrices relative to those cultured on stiff matrices
Gene name* C/S fold change‡ P-value Biological classification GP38K 11.75 3.31 x 10-5 Carbohydrate metabolic process TNFSF10 6.58 5.85 x 10-3 Immune response ITIH4 5.10 1.67 x 10-3 Acute phase response CDH5 4.77 2.39 x 10-3 Cell adhesion WNT2B 3.46 2.68 x 10-4 Wnt receptor signaling pathway,
calcium modulating pathway CNN1 3.27 9.89 x 10-5 Actomyosin structure organization TIMP1 2.76 3.12 x 10-3 Erythrocyte maturation TNNC2 2.59 3.06 x 10-3 Calcium ion binding COL5A1 2.52 9.43 x 10-4 Cell adhesion TGFB3 2.37 5.41 x 10-5 Growth, positive regulation of cell
division DDC 2.37 6.07 x 10-3 Metabolic process, catecholamine
biosynthetic process TPM1 2.08 8.61 x 10-4 Actin binding
* GP38K, 38 kDa heparin-binding glycoprotein; TNFSF10, tumour necrosis factor (ligand)
superfamily member 10; ITIH4, inter-alpha (globulin) inhibitor H4 (plasma kallikrein-sensitive
glycoprotein); CHD5, cadherin 5; WNT2B, wingless-type MMTV integration site family,
member 2B;CNN1, calponin 1 basic smooth muscle; TIMP1, TIMP metallopeptidase inhibitor 1;
TNNC2, troponin C type 2; COL5A1, collage type V alpha 1; TGFB3, transforming growth
factor beta 3; DDC, dopa decarboxylase; TPM1, tropomyosin 1. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡ Fold changes of genes expressed by cells cultured on compliant matrices relative to those
cultured on stiff matrices
102
0
10
20
30
40
50
60
70
2.5 5 10 20 30 40+Fold difference
Nu
mb
er
of e
ntr
ies
UpregulatedDownregulated
Figure 7.4. The distribution of sequences differentially expressed with CNP treatment in
cultures on compliant matrices
Figure 7.5. The distribution of sequences differentially expressed with CNP treatment in
cultures on stiff matrices
0102030405060708090
2.5 5 10 20 30 40+
Fold difference
Nu
mb
er
of e
ntr
ies Upregulated
Downregulated
103
Table 7.3. A subset of transcripts with higher expression in CNP-treated VICs relative to
untreated cells when cultured on compliant matrices.
Gene name T/U fold change‡ P value Biological classification PAH 11.47 2.06 x 10-3 Aromatic amino acid family metabolic
process, L-phenylalanine catabolic process, oxidation reduction
HP 6.98 3.13 x 10-4 Proteolysis MMP1 4.68 7.41 x 10-3 Proteolysis, metabolic process, collagen
catabolic process CCRL1 3.89 6.93 x 10-5 G-protein coupled receptor protein
signaling pathway AMCF-II 2.98 9.21 x 10-3 Immune response, chemotaxis,
inflammatory response HSD11B1 2.62 7.17 x 10-3 Metabolic process ANGPT1 2.62 1.82 x 10-2 Signal transduction, angiogenesis, cell
differentiation C1S 2.22 1.71 x 10-2 Proteolysis, innate immune response,
complement activation classical pathway
VDR 2.22 2.78 x 10-2 Regulation of transcription PTGFR 2.09 4.65 x 10-2 G-protein coupled receptor protein
signaling pathway LPL 2.04 4.40 x 10-2 Lipid catabolic process, lipid metabolic
process ATP9A 2.03 2.97 x 10-2 ATP biosynthetic process, metabolic
process, phospholipid transport PC 2.03 1.10 x 10-2 Gluconeogenesis, metabolic process
*PAH, phenylalanine hydroxylase; HP, haptoglobin; MMP1, matrix metalloproteinase-1;
CCRL1, chemokine receptor-like 1; AMCF-II, alveolar macrophaste-derived chemotactic factor-
II; HSD11B1, 11-beta hydroxysteroid dehydrogenase isoform 1; ANGPT1, angiopoietin 1;C1S,
complement component 1;VDR, vitamin D (1,25-dihydroxyvitamine D3) receptor; PTGFR,
prostaglandin F receptor; LDL, lipoprotein lipase; ATP9A, ATPase class II type 9A; PC,
pyruvate carboxylase. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡Fold changes of genes expressed by CNP-treated cells relative to untreated cells
7.2.4. The Combined Effect of Matrix Stiffness and CNP on Transcriptional Regulation
Venn diagrams were constructed to identify the genes commonly and exclusively modulated by
matrix stiffness and by CNP. We first compared the list of differentially expressed sequences by
104
matrix stiffness alone and by CNP on cells cultured on compliant matrices. Matrix stiffness alone
affected five times more transcripts than those regulated by CNP treatment. Of the 998
transcripts modulated by matrix stiffness, the expression of only 18 transcripts was also regulated
by CNP when cells were cultured on compliant matrices (Figure 7.6), suggesting the majority of
the transcripts were exclusively regulated by either matrix stiffnss or by CNP.
A similar trend was observed when comparing the number of sequences affected by matrix
stiffness and by CNP treatment on VICs cultured on stiff matrices. The expression of only a
small portion (i.e., 31 entries) of the sequences was influenced by matrix stiffness as well as by
CNP, further confirming that the majority of the transcripts were exclusively regulated by either
mechanical and biochemical cues (Figure 7.7).
Table 7.4. A subset of transcripts with lower expression in CNP-treated VICs relative to
untreated cells when cultured on compliant matrices.
Gene name T/U fold change‡ P value Biological classification PBD-1 7.39 9.65 x 10-4 Defense response PALMD 2.57 2.16 x 10-3 Regulation of cell shape LIM 2.41 1.35 x 10-2 Metal ion binding, zinc ion
binding SRPK3 2.17 3.78 x 10-3 Protein amino acid
phosphorylation KCNN4 2.10 7.40 x 10-5 Potassium ion transport ALDH1A3 2.05 2.56 x 10-2 Positive regulation of apoptosis,
oxidation reduction, metabolic process
GPR183 2.05 1.36 x 10-2 G-protein coupled receptor protein signaling pathway, immune response
UPP1 2.04 1.52 x 10-3 Nucleotide catabolic process *PBD-1, prepro-beta-defensin 1; PALMD, palmdelphin ; LIM, alpha-actinin-2-associated LIM
protein; SRPK3, SFRS protein kinase 3; KCNN4, potassium intermediate/small conductance
calcium-activated channel subfamily N member 4; ALDH1A, aldehyde dehydrogenase family 1
subfamily A3;GPR183, G-protein coupled receptor 183 ; UPP1, uridine phosphorylase 1. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡Fold changes of genes expressed by CNP-treated cells relative to untreated cells
105
Table 7.5. A subset of transcripts with higher expression in CNP-treated VICs relative to
untreated cells when cultured on stiff matrices
Gene name T/U fold
change‡
P value Biological classification
HP 5.05 7.72 x 10-3 Proteolysis PKHA1 3.34 2.61 x 10-2 Glycogen metabolic process CD36 2.83 9.67 x 10-3 Cell adhesion ANGPTL4 2.25 2.75 x 10-3 Cell differentiation, angiogenesis, signal
transduction CXCL12 2.22 1.55 x 10-2 Immune response ALB 2.17 3.62 x 10-2 Cellular response to starvation,
maintenance of mitochondrion location, negative regulation of apoptosis, transport
PLA2G7 2.16 2.38 x 10-2 Lipid catabolic process FABP4 2.10 9.28 x 10-2 Transport (lipid binding) IGF1 2.06 6.79 x 10-4 Positive regulation of DNA replication ANGPT1 2.04 2.24 x 10-2 Signal transduction, angiogenesis, cell
differentiation SERPINA6 2.03 3.01 x 10-2 Transport NEO 2.02 2.56 x 10-2 Cell adhesion, regulation of
transcription, myoblast fusion RAMP1 2.00 1.79 x 10-2 Regulation of G-protein coupled
receptor protein signaling pathway, intracellular protein transport, transport
*HP, haptoglobin; PHKA1, phosphorylase kinase alpha 1; CD36, thrombospondin receptor;
ANGPTL4, angiopoietin-like 4; CXCL12, chemokine lingand 12 (stromal cell-derived factor 1) ;
ALB, albumin ; PLA2G7, phospholipase A2 group VII; FABP4, fatty acid binding protein 4;
IGF1, insulin-like growth factor 1; ANGPT1, angiopoietin 1; SERPINA6, serpin peptidase
inhibitor, clade A (alpha-1 antiproteinase, antitrypsin); NEO, neogenin; RAMP1, receptor (G-
protein-coupled) activity modifying protein 1. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡Fold changes of genes expressed by CNP-treated cells relative to untreated cells
106
Table 7.6. A subset of transcripts with lower expression in CNP-treated VICs relative to
untreated VICs cells when cultured on stiff matrices
Gene name T/U fold change‡ P value Biological classification ACTA1 6.69 9.05 x 10-3 Skeletal muscle fiber development,
muscle thin filament assembly CNN1 2.83 5.89 x 10-3 Actomyosin structure organization NPY1R 2.44 3.61 x 10-2 Signal transduction, G-protein coupled
receptor protein signaling pathway GNAO1 2.30 2.00 x 10-3 Locomotory behaviour, regulation of
heart contraction, dopamine receptor signaling pathway, cellular process, G-protein coupled receptor signaling pathway, muscle contraction
APBB1IP 2.23 4.80 x 10-2 Signal transduction NTF3 2.22 3.17 x 10-2 Growth factor activity, neurotrophin
receptor binding *ACTA1, actin alpha skeletal muscle; CNN1, calponin 1 basic smooth muscle; NPY1R ,
neuropeptide Y receptor Y1; GNAO1, guanine nucleotide binding protein (G protein), alpha
activating activity polypeptide O; NTF3, neurotrophin 3; APBB1IP, Amyloid beat (A4) protein-
binding family B member 1 interacting protein. Sequence mapped to genome of other species (e.g. Homo sapiens, Bos taurus, Mus musculus) ‡Fold changes of genes expressed by CNP-treated cells relative to untreated cells
107
Figure 7.6. Transcript expression modulated by matrix stiffness and/or by CNP in cultures
on compliant matrices
Blue region represents transcript expression altered by matrix stiffness. Yellow region represents
transcripts that were changed in VICs cultured on compliant matrices with CNP treatment
relative to the untreated cultures. The union region represents genes that were non-exclusively
regulated by matrix stiffness.
When cells were cultured on compliant or stiff matrices, CNP treatment influenced
approximately 150-200 genes (Figure 7.8). The expression of only 30 CNP-regulated genes was
not affected by matrix stiffness (Figure 7.8, union region), indicating matrix mechanics
significantly modulated the response of VICs to CNP treatment. CNP-modulated, but non-
mechanically regulated genes were related to diverse biological processes including cell division,
replication of DNA, cellular amino acid biosynthetic process (Table 7.7).
980 genesregulated by matrix stiffness
163 genes regulated by CNP (cells cultured on compliant matrices)
18 genes
980 genesregulated by matrix stiffness
163 genes regulated by CNP (cells cultured on compliant matrices)
18 genes
108
Figure 7.7. Transcript expression modulated by matrix stiffness and/or by CNP in cultures
on stiff matrices
Blue region represents sequences regulated by matrix stiffness. Yellow region represents
transcripts that were changed in VICs cultured on stiff matrices with CNP treatment relative to
the untreated cultures. The union region represents genes that were non-exclusively regulated by
matrix stiffness.
967 genesregulated by matrix stiffness
208 genes regulated by CNP (cells cultured on stiff matrices)
31 genes967 genesregulated by matrix stiffness
208 genes regulated by CNP (cells cultured on stiff matrices)
31 genes
109
Table 7.7. A partial list of CNP-regulated, mechanically-insensitive genes
Gene Name Description Biological Processes
STAG2 Stromal antigen 2, transcript variant 4
Cell cycle, cell division, mitosis, meiosis, chromosome segregation
IGF1 Insulin-like growth factor 1 Positive regulation of DNA replication FST Follistatin Undefined† ABCC9 ATP-binding cassette, sub family
C, member 9, transcript variant SUR2B
Potassium ion transport
FUR1 Uracil phosphoribosyltransferase homolog
Transferase activity, transferring glycosyl groups, uracil phosphoribosyltransferase activity
HP Haptoglobin Proteolysis SAA1 Serum amyloid A1, transcript
variant 1 Positive regulation of interleukin-1 secretion, regulation of protein secretion, positive regulation of cell adhesion, acute-phase response, platelet activation, negative regulation of inflammatory response, chemotaxis, elevation of cytosolic calcium ion concentration
PAH Phenylalanine hydroxylase Oxidation reduction, L-phenylalanine catabolic process, metabolic process, aromatic amino acid family metabolic process, cellular amino acid biosynthetic process
SULT1A1 Sulfotransferase family, cytosolic, 1A, phenolpreferring, member 1
Undefined†
HRH1 Histamine receptor H1 Signal transduction, G-protein coupled receptor protein signaling pathway, positive regulation of nitro oxide biosynthetic process, synaptic transmission, inflammatory response
RAMP1 Receptor (G protein-coupled) activity modifying protein 1
Regulation of G-protein coupled recpetor protein signaling pathway, intracellular protein transport, transport
NFE2 Nuclear factor (erythroid-derived 2)
Regulation of transcription (DNA-dependent), Nucleosome disassembly, homeostasis, blood circulation, multicellular organismal development
ANGPT1 Angiopoietin 1 Signal transduction, angiogenesis, multicellular organismal development, cell differentiation
SLC25A25 Solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25, nuclear gene encoding mitochondrial protein
Transport
CCDC73 Coiled-coil domain containing 73 Undefined†
NCALD Neurocalcin delta, transcript variant 7
Vesicle-mediated transport
Sequence mapped to annotation of other species (e.g. Homo sapiens, Bos taurus, Mus musculus)
† Incomplete GO annotation lacking defined biological process(es). Molecular functions: FST, TGF-
signaling pathway; SULT1A1, transferase activity.
110
A three-way Venn diagram was constructed to further identify any genes that were regulated by
matrix stiffness and/or CNP. The regulation of only one transcript, follistatin, was altered by
matrix stiffness and CNP (Figure 7.8). Interestingly, in the absence of CNP, the expression of
follistatin transcript was 2.4-fold higher on compliant matrices relative to cells cultured on stiff
matrices, indicative of mechanically-regulated follistatin transcript expression in certain
biochemical environments. On the compliant matrices that favored osteogenic differentiation of
VICs, expression of follistatin was 2.0-fold higher in CNP-treated cells relative to the untreated
cells. On the stiff matrices that preferentially promoted myofibroblast differentiation, CNP-
treatment on VICs led to a 3.3-fold upregulation in the expression of follistatin. These data
suggest that the regulation of follistatin transcript expression by VICs in the presence of CNP
was independent of matrix stiffness, while the majority of CNP-regulated transcripts were
sensitive to modulation by matrix mechanics.
7.3. Discussion
Although matrix stiffness is recognized to play critical roles in regulating cell functions and
differentiation, its contribution in regulating cellular response to biochemical factors is poorly
understood. Further, the effect of matrix stiffness on CNP-mediated cellular response has never
been studied. By evaluating the transcriptional profile of VICs cultured on compliant and stiff
collagen matrices in the presence or absence of CNP, we identified a subset of mechanically- and
biochemically-regulated transcripts. The differential gene expression profile suggests that the
majority of CNP-regulated transcripts are sensitive to matrix stiffness. These data demonstrate
the significance of matrix stiffness in modulating the response of VICs to CNP, and the
combined effect of mechanical and biochemical cues in regulating VICs at the transcriptional
level, which ultimately may be important in understanding valve pathology and in determining
VIC response to potential therapeutics, as valve tissues mechanics changes during disease
progression.
111
Figure 7.8. A three-way Venn diagram showing the commonly and exclusively modulated
genes by matrix stiffness and by CNP
Blue region represents transcriptional regulation by matrix stiffness alone. Yellow region
represents CNP-regulated genes in VICs cultured on stiff matrices. Green region represents
CNP-regulated genes in VICs cultured on compliant matrices. The center area in which all three
regions overlap indicates a transcript (follistatin) that was regulated by matrix stiffness and CNP.
In the absence of CNP, higher expression of osteoinductive transcripts (e.g., BMP-2, NFKB1A,
MKP-1) was observed on compliant matrices, substrates that favored osteogenic differentiation
of VICs. The expression of BMP-2 has been observed in VICs differentiated to osteoblast-like
cells in vitro68 and in calcified valvular tissue48, 84. Addition of BMP-2 to VICs in culture
increased their expression of osteoblast-related markers and their rate of calcific aggregate
formation54, 73. BMP-2-induced osteoblastic differentiation has been shown to be mediated in a
MKP-1-dependent manner263. Similarly, we also found an upregulation of MKP-1 in the pro-
osteogenic, compliant matrices. Further, Notch signaling is involved in early stage of valve
formation as well as inhibition of the mediators of osteogenic-dependent valvular calcification257.
950 genesregulated by matrix stiffness
208 genes regulated by CNP (cells cultured on stiff matrices)
30
134 genes regulated by CNP (cells cultured on compliant matrices)
17
1
29
950 genesregulated by matrix stiffness
208 genes regulated by CNP (cells cultured on stiff matrices)
30
134 genes regulated by CNP (cells cultured on compliant matrices)
17
1
29
950 genesregulated by matrix stiffness
208 genes regulated by CNP (cells cultured on stiff matrices)
30
134 genes regulated by CNP (cells cultured on compliant matrices)
17
1
29
112
Presumably, the negative regulator of Notch signaling pathway, NFKB1A, may regulate
osteogenic differentiation indirectly by mitigating the osteorepressive effect of Notch signaling;
however the direct contribution of NFKB1A in CAVD will require further investigation.
When cells were cultured on the stiffer matrices that promoted myofibroblast differentiation,
higher expression of transcripts associated with actin-myosin cytoskeleton system including
calponin 1 (CNN1) and tropomyosin 1 (TPM-1) was observed. These findings are consistent
with a previous study by Chambers et al. in which expression profiling identified upregulation of
genes associated with contractile phenotype and cytoskeletal organization in myofibroblasts264
when compared to quiescent fibroblasts. The transition of fibroblasts to myofibroblasts is
closely related to maturation of focal adhesions265, which depends on the force applied to the
ECM-integrin-cytoskeleton connections either externally (e.g., ECM motion, substrate rigidity)
or internally (e.g., actin polymerization). A stiffer culture surface would presumably permit the
generation of greater traction forces, which facilitates focal adhesion maturation and enables the
transition of fibroblasts to myofibroblasts. The dependency of the transition of VICs into
myofibroblasts on matrix stiffness has previously been reported in the study by Pho et al.55 and
likely plays a role in the phenotypic drift of VICs in stiffened sclerotic valves.
Matrix stiffness alone affected the expression of ~ 1000 transcripts, whereas the expression of
only ~ 200 transcripts was affected by CNP. Notably, CNP upregulated various transcripts
associated with metabolic processes, including lipoprotein lipase (LPL) and phospholipase A2
(PLA2G7). LPL is the rate-limiting enzyme of triglyceride removal from plasma and has been
implicated in atherosclerosis. The expression of LPL transcript was downregulated in
atherosclerotic patients266, whereas statin treatment significantly increased LPL activity in
patients267. Our microarray data suggest a link between lipoprotein catabolic processes and CNP
signaling. Intriguingly, initial work found an upregulation of CNP transcript expression in statin-
treated VICs (Appendix B1); however whether there exists molecular relationships among
lipoprotein, statins and CNP awaits to be determined.
A striking observation from the two-way Venn diagram was the relatively small number of CNP-
dependent transcripts that were insensitive to matrix stiffness. The expression of 97% of all the
differentially expressed CNP-dependent transcripts was regulated by matrix stiffness. These data
emphasize the contribution of matrix mechanics in modulating cellular response to biochemical
113
factors. Also notable in the three-way Venn diagram analysis was the expression of only one
transcript, follistatin, which was non-exclusively regulated by matrix stiffness or CNP. One
possible explanation is that follistatin may regulate both osteoblast and myofibroblast
differentiation. Follistatin is a 34-kDa soluble protein that binds activin with high affinity to
inhibit the activation of TGF- signaling268, 269. In the absence of follistatin, activins bind to the
activin type IIA and type IIB receptors, leading to the recruitment and phosphorylation of type I
receptor, and subsequently the phosphorylation of Smad2/3270. Activation of Smad2/3 signaling
has been shown to increase -SMA expression and myofibroblast differentiation271. In addition
to activin signalling, follistatin has also been demonstrated to form a trimeric complex with BMP
and receptors of BMP to inhibit osteogenic effect mediated by BMP activity272. VICs
preferentially differentiated to pathological osteoblasts when cultured on compliant matrices and
CNP treatment would presumably prevent the osteogenic differentiation of these VICs. The
upregulation of follistatin in CNP-treated cells cultured on compliant matrices may facilitate the
inhibition of osteogenic differentiation by mitigating BMP activity272. CNP repressed
myofibroblast differentiation of VICs on stiff matrices. The higher expression of follistatin on
CNP-treated cells cultured on stiff matrices would likely mitigate TGF- signaling and Smad2/3
phosphorylation, which are required for the activation of fibroblasts to myofibroblasts.
Clearly, matrix stiffness has been shown to modulate various cell behaviours in vitro. Here, we
demonstrated the significance of matrix stiffness not only in modulating VIC phenotype, but also
their response to CNP at the transcriptional level. We identified a subset of mechanically- and
biochemically-regulated transcripts. The differential gene expression profile suggests that the
majority of CNP-regulated transcripts are sensitive to matrix stiffness. These data demonstrate
that matrix stiffness significantly affects the response of VICs to biochemical cues, and the
combined effect of mechanical and biochemical cues may ultimately govern the functions and
phenotypes of VICs. These findings may impact the response of cells to therapeutics in diseases
with substantial tissue matrix remodeling, where changes in tissue mechanics may define cellular
response to soluble factors. For example, significant stiffening of tumour tissue has been
correlated to an increase in proteolysis182, which has been suggested to partially explain the
failure of protease inhibitors as cancer therapies. The aortic valve undergoes significant
pathological matrix remodeling, which may alter local matrix mechanics. It is possible that local
matrix mechanics regulates valve homeostasis and functions of VICs in vivo, which may affect
114
their response to biochemical factors and the effectiveness of therapeutics against CAVD in a
stage-dependent manner. While our findings are suggestive of a correlative link between matrix
mechanics, VIC phenotypes and transcriptional regulation, further investigations are required to
demonstrate causality of this link.
115
Chapter 8 8. Conclusions and Recommendations
8.1. Conclusions
Pathological differentiation of VICs alters cell functions and is closely associated with valve
calcification. It is well accepted that biochemical factors such as TGF-1 induce the pathological
differentiation of VICs69, but little is known regarding factors that can inhibit the differentiation
of VICs into undesirable phenotypes. Further, the role of mechanical stimuli in regulating VIC
phenotype and functions has been overlooked and has yet to be investigated, despite the
observed influence of matrix stiffness on the differentiation of and mineralization by other non-
valve cell types132, 185. Alterations in tissue stiffness have been reported to occur prior to
substantial cellular and histological changes in diseases such as liver fibrosis7 and
atherosclerosis16, suggesting correlative links between tissue mechanics, disease progression and
the regulation of cell response. The aortic valve undergoes significant pathological matrix
remodeling and stiffens when calcified; it is likely that matrix stiffness may modulate VIC
behaviour and response to biochemical factors. Hence, the overall goal of this thesis was to
investigate the effect of matrix stiffness on modulating the response of VICs to pro- and anti-
calcific biochemical factors, which would provide further insights in valve pathology.
The first objective was to implement and characterize a culture system with tunable stiffness.
The morphological and molecular changes in VICs cultured on compliant and stiff matrices were
evaluated. In addition, the ability of CNP, a putative anti-sclerotic and anti-calcific agent, to
suppress pathological differentiation of VICs was tested in vitro. Lastly, the combined effect of
matrix stiffness and CNP on the transcriptional regulation of VICs was investigated.
VICs were found to be highly responsive to matrix stiffness. In conjunction with pro-calcific
biochemical factors, VICs preferentially underwent osteogenic differentiation and calcified when
cultured on the more compliant matrices. In contrast, the stiffer matrix favored myofibroblast
differentiation of VICs, contributing to contraction-mediated calcification that downregulated
Akt activity and was associated with apoptosis. Similarly, microarray study of cells cultured on
compliant and stiff matrices with pro-calcific biochemical factors identified upregulation of
116
osteoinductive transcripts and downregulation of osteorepressive transcripts on the more
compliant matrices relative to those cultured on the stiffer matrices. The ability to distinguish
two calcification processes by simply changing the matrix stiffness provides a useful research
tool to dissect the fundamental mechanisms of cell-mediated calcification.
The protective effect of CNP on VICs was also evident in the cell culture study. CNP inhibited
myofibroblast and osteoblast differentiation of VICs and suppressed in vitro calcification by
VICs. A striking finding was the small number of transcripts that were commonly regulated by
CNP and by matrix stiffness. The microarray results clearly demonstrate that the combined
effects of mechanical and biochemical cues govern transcriptional regulation of VIC, which
further emphasizes the necessity to consider both biochemical and mechanical factors in valve
studies in order to improve our fundamental understanding of VIC biology and valve pathology.
This thesis work contributes to the field of mechanobiology and valve biology. It provides an
improved understanding of VIC-matrix interactions, which is required to aid in interpretation of
VIC calcification studies in vitro; to guide the selection of biomaterials with appropriate
mechanical properties for valve tissue engineering; and to assess if alterations in extracellular
matrix mechanics that occur with disease modulate pathologic changes in VIC phenotypes and
calcification processes. In addition, the current study identifies for the first time the ability of
VICs to respond to CNP and provides a cellular explanation responsible for the protective effect
of CNP against calcification. These fundamental findings are essential for future mechanistic
studies of CNP at the molecular level and may perhaps eventually lead to the development of a
new treatment option.
8.2. Future Work
Given the current results, there are a number of suggested directions for future investigations, as
detailed in the following sections.
8.2.1. Determination of Changes in Valve Matrix Mechanics in vivo
The significance of matrix mechanics in modulating phenotype and transcriptional regulation of
VICs is evident in this thesis. To bridge the gap between our in vitro findings and the in vivo
relevancy, it will be important to identify the association between changes in valve matrix
117
mechanics and the progression of CAVD. Changes in mechanical properties of valve tissue
during CAVD can be determined using a micropipette aspiration technique similar to that
described by Matsumoto et al.16. AVs at different stages of disease development can be obtained
from porcine animal model fed with an atherogenic diet for various durations. The local elastic
moduli of normal AVs (i.e., animal fed a normal diet) and those of early-, intermediate- and late-
disease stage AVs can be measured by the micropipette aspiration method.
Immunohistochemical staining can be performed to characterize the pathological differentiation
of VICs temporally with respect to disease progression. Changes in the mechanical properties of
normal and diseased valve tissues can then be correlated with the extent of pathological
differentiation of VICs.
8.2.2. Improvement of the Cell Culture System
Although the collagen-based cell culture system was functional for all tests conducted, there
exist a number of limitations. Some of the limitations are: 1) the duration of cell culture was
limited to prevent substantial collagen degradation; 2) there exists a difference in the total
amount of collagen available on the two matrices, which may affect the ability of cells to spread
at later time points; and 3) fine tuning of stiffness is not possible with the existing system.
Presumably, changes in valve matrix mechanics involve a wide range of stiffness. To study the
effect of a range of physiologically relevant stiffness identified from Section 8.2.1, a culture
system that can be fine-tuned to provide a wide range of stiffness while maintaining surface
chemistry and to provide substrates with the same total collagen available over the given culture
conditions is needed. Polyacrylamide (PA) substrates are promising candidate materials as they
can provide a wide range of stiffnesses, while maintaining similar surface chemistry (reviewed in 10). However, initial efforts in our lab with standard surface modification methods failed to
provide appropriate surface adhesiveness to VICs. Recently, we successfully modified the
surface modification procedure and improved the adhesiveness to primary VICs. Our
preliminary study with primary VICs cultured on collagen-coated PA substrates with stiffnesses
of 11 kPa, 22 kPa, 50 kPa and 144 kPa showed that calcification by VICs was more prominent
on substrates with stiffnesses of 22 kPa and 50 kPa in comparison to those cultured on substrate
with stiffnesses of 11 kPa and 144 kPa (Figure B.3. in Appendix B). This preliminary result
suggests the possibility of culturing VICs on PA substrates, which can be tuned to the stiffness of
valve tissues measured at various disease stages. Such an in vitro study will provide a means to
118
identify the molecular determinants for mechanically regulated phenotypic drift of and
calcification by VICs on materials that closely resemble the mechanical properties of native
normal and diseased valves.
8.2.3. Effect of CNP treatment at Different Stages of Disease Progression
This thesis identified a cellular basis responsible for the protective effects of CNP against
CAVD. The next logical step is to identify the molecular mechanism responsible for the
inhibitory effects of CNP in the pathological differentiation of VICs. We hypothesized that CNP
mediated its cellular response via the NPR-B/cGMP signaling pathway. To address this
hypothesis, we have begun siRNA transfection experiments to manipulate the expression of
NPR-B receptor in VICs. Once those are completed, it will be important to evaluate the effect of
CNP: 1) in vitro by culturing cells on matrices with stiffnesses that represent various disease
stages; and 2) in vivo to evaluate the effectiveness of CNP treatment given at different stages of
CAVD. Because of the heterogeneity of VICs and the ability of these cells to differentiate into
various phenotypes over the disease progression, their response to CNP may vary depending on
the time at which treatment is administered. Studies have reported that the responsiveness of
cells to CNP depends on their commitment to certain lineages249. Presumably, the ability of VICs
to differentiate into various phenotypes is regulated in part by matrix stiffness and is altered as
the disease progresses. To test this, CNP can be applied to VICs cultured on matrices with
stiffnesses that represent early-, immediate- and late-stages of the disease. Such a culture system
can provide information regarding the ability of CNP to suppress pathological changes of VICs
when subjected to matrix stiffnesses that are physiologically relevant. Subsequently, these data
may help determine the preferred CNP treatment time point over the course of disease
development. Such data can serve as an initial guideline for the selection of treatment regimen
for in vivo tests. Mice models may be suitable for in vivo CNP studies, because genetic mutation
with mice can be done with ease. Initial work has verified the feasibility of dissecting mouse
aortic valves and isolating VICs from the valve leaflets (Figure B.4 and B.5 in Appendix B).
8.2.4. Identification of Transcriptional Pathways that Regulate Pathological
Differentiation of VICs
The current microarray study identified differential regulation of transcripts by matrix stiffness
and CNP. The study further confirmed the pro-osteogenic nature of our compliant matrices.
119
However, to fully benefit from the hypothesis generating power of microarray experiments and
to understand the transcriptional regulatory pathways that are involved in mechanical and
biochemical modulations, gene expression network analysis can be done to reveal important
phenomenological link between the expression of different genes. To do so, re-annotation of all
entries of the porcine microarray chips based on BLAST and cross-referencing of porcine
sequences to the human genome is necessary. Based on the re-annotation, canonical pathway
analysis can be performed to identify transcript networks with putative significance in CAVD.
120
References
1. WHO World Health Report 2003: World Health Organization. Geneva, Switzerland; 2003.
2. Stewart BF, Siscovick D, Lind BK, Gardin JM, Gottdiener JS, Smith VE, Kitzman DW, Otto CM. Clinical factors associated with calcific aortic valve disease. Cardiovascular Health Study. J Am Coll Cardiol. 1997;29:630-634.
3. Otto CM, Lind BK, Kitzman DW, Gersh BJ, Siscovick DS. Association of aortic-valve sclerosis with cardiovascular mortality and morbidity in the elderly. N Engl J Med. 1999;341:142-147.
4. Rajamannan NM, Sangiorgi G, Springett M, Arnold K, Mohacsi T, Spagnoli LG, Edwards WD, Tajik AJ, Schwartz RS. Experimental hypercholesterolemia induces apoptosis in the aortic valve. J Heart Valve Dis. 2001;10:371-374.
5. Tanaka K, Sata M, Fukuda D, Suematsu Y, Motomura N, Takamoto S, Hirata Y, Nagai R. Age-associated aortic stenosis in apolipoprotein E-deficient mice. J Am Coll Cardiol. 2005;46:134-141.
6. Simmons CA, Grant GR, Manduchi E, Davies PF. Spatial heterogeneity of endothelial phenotypes correlates with side-specific vulnerability to calcification in normal porcine aortic valves. Circ Res. 2005;96:792-799.
7. Georges PC, Hui JJ, Gombos Z, McCormick ME, Wang AY, Uemura M, Mick R, Janmey PA, Furth EE, Wells RG. Increased stiffness of the rat liver precedes matrix deposition: implications for fibrosis. Am J Physiol Gastrointest Liver Physiol. 2007;293:G1147-1154.
8. Shroff RC, Shah V, Hiorns MP, Schoppet M, Hofbauer LC, Hawa G, Schurgers LJ, Singhal A, Merryweather I, Brogan P, Shanahan C, Deanfield J, Rees L. The circulating calcification inhibitors, fetuin-A and osteoprotegerin, but not matrix Gla protein, are associated with vascular stiffness and calcification in children on dialysis. Nephrol Dial Transplant. 2008;23:3263-3271.
9. Suki B, Bates JH. Extracellular matrix mechanics in lung parenchymal diseases. Respir Physiol Neurobiol. 2008;163:33-43.
10. Yip CYY, Chen J-H, Simmons CA. Engineering substrate mechanics to regulate cell response. In: Khademhosseini A, Borenstein J, Toner M, Takayama S, eds. . Norwood, Mass: Artech Hourse; 2008.
11. Arora PD, Narani N, McCulloch CA. The compliance of collagen gels regulates transforming growth factor-beta induction of alpha-smooth muscle actin in fibroblasts. Am J Pathol. 1999;154:871-882.
121
12. Wells RG, Discher DE. Matrix elasticity, cytoskeletal tension, and TGF-beta: the insoluble and soluble meet. Sci Signal. 2008;1:pe13.
13. Hinton RB, Jr., Lincoln J, Deutsch GH, Osinska H, Manning PB, Benson DW, Yutzey KE. Extracellular matrix remodeling and organization in developing and diseased aortic valves. Circ Res. 2006;98:1431-1438.
14. Otto CM, Kuusisto J, Reichenbach DD, Gown AM, O'Brien KD. Characterization of the early lesion of 'degenerative' valvular aortic stenosis. Histological and immunohistochemical studies. Circulation. 1994;90:844-853.
15. Lee TC, Midura RJ, Hascall VC, Vesely I. The effect of elastin damage on the mechanics of the aortic valve. J Biomech. 2001;34:203-210.
16. Matsumoto T, Abe H, Ohashi T, Kato Y, Sato M. Local elastic modulus of atherosclerotic lesions of rabbit thoracic aortas measured by pipette aspiration method. Physiol Meas. 2002;23:635-648.
17. Loomba RS, Arora R. Statin Therapy and Aortic Stenosis: A Systematic Review of the Effects of Statin Therapy on Aortic Stenosis. Am J Ther. 2009.
18. Olsson AG. Lipid lowering and aortic valve disease. Curr Atheroscler Rep. 2009;11:377-383.
19. Peltonen TO, Taskinen P, Soini Y, Rysa J, Ronkainen J, Ohtonen P, Satta J, Juvonen T, Ruskoaho H, Leskinen H. Distinct downregulation of C-type natriuretic peptide system in human aortic valve stenosis. Circulation. 2007;116:1283-1289.
20. Thubrikar MJ. The aortic valve. Boca Raton, Florida: CRC Press, Inc.; 1990.
21. Stella JA, Sacks MS. On the biaxial mechanical properties of the layers of the aortic valve leaflet. J Biomech Eng. 2007;129:757-766.
22. Sacks MS, Smith DB, Hiester ED. The aortic valve microstructure: effects of transvalvular pressure. J Biomed Mater Res. 1998;41:131-141.
23. Vesely I, Noseworthy R. Micromechanics of the fibrosa and the ventricularis in aortic valve leaflets. J Biomech. 1992;25:101-113.
24. Schoen FJ. Aortic valve structure-function correlations: role of elastic fibers no longer a stretch of the imagination. J Heart Valve Dis. 1997;6:1-6.
25. Vesely I. The role of elastin in aortic valve mechanics. J Biomech. 1998;31:115-123.
26. Rodriguez KJ, Masters KS. Regulation of valvular interstitial cell calcification by components of the extracellular matrix. J Biomed Mater Res A. 2009;90:1043-1053.
27. Statistics Canada. Causes of Death 2003. http://www.statcan.ca/bsolc/english/bsolc?catno=84-208-X.
122
28. Economic burden of illness in Canada,1998.: Health Canada; 2002.
29. International Cardiovascular Disease Statistics.: American Heart Association; 2004.
30. Heart and Stroke Foundation of Canada Web site. www.heartandstroke.ca.
31. Freeman RV, Otto CM. Spectrum of calcific aortic valve disease: pathogenesis, disease progression, and treatment strategies. Circulation. 2005;111:3316-3326.
32. Aronow WS, Ahn C, Shirani J, Kronzon I. Comparison of frequency of new coronary events in older subjects with and without valvular aortic sclerosis. Am J Cardiol. 1999;83:599-600, A598.
33. World Population Ageing 1950-2050. : Population Division, DESA, United Nations.; 2007.
34. Barasch E, Gottdiener JS, Marino Larsen EK, Chaves PH, Newman AB. Cardiovascular morbidity and mortality in community-dwelling elderly individuals with calcification of the fibrous skeleton of the base of the heart and aortosclerosis (The Cardiovascular Health Study). Am J Cardiol. 2006;97:1281-1286.
35. Rossi A, Bertagnolli G, Cicoira M, Golia G, Zanolla L, Santini F, Cemin C, Ferrario G, Zardini P. Association of aortic valve sclerosis and coronary artery disease in patients with severe nonischemic mitral regurgitation. Clin Cardiol. 2003;26:579-582.
36. Otto CM, O'Brien KD. Why is there discordance between calcific aortic stenosis and coronary artery disease? Heart. 2001;85:601-602.
37. Demer LL. Cholesterol in vascular and valvular calcification. Circulation. 2001;104:1881-1883.
38. Cury RC, Ferencik M, Hoffmann U, Ferullo A, Moselewski F, Abbara S, Booth SL, O'Donnell CJ, Brady TJ, Achenbach S. Epidemiology and association of vascular and valvular calcium quantified by multidetector computed tomography in elderly asymptomatic subjects. Am J Cardiol. 2004;94:348-351.
39. Massy ZA, Maziere C, Kamel S, Brazier M, Choukroun G, Tribouilloy C, Slama M, Andrejak M, Maziere JC. Impact of inflammation and oxidative stress on vascular calcifications in chronic kidney disease. Pediatr Nephrol. 2005;20:380-382.
40. Pohle K, Maffert R, Ropers D, Moshage W, Stilianakis N, Daniel WG, Achenbach S. Progression of aortic valve calcification: association with coronary atherosclerosis and cardiovascular risk factors. Circulation. 2001;104:1927-1932.
41. Ladislas R. Matrix remodeling and atherosclerosis effect of age Fibrogenesis: Cellular and Molecular Basis: Springer US; 2005.
42. Fondard O, Detaint D, Iung B, Choqueux C, Adle-Biassette H, Jarraya M, Hvass U, Couetil JP, Henin D, Michel JB, Vahanian A, Jacob MP. Extracellular matrix
123
remodelling in human aortic valve disease: the role of matrix metalloproteinases and their tissue inhibitors. Eur Heart J. 2005;26:1333-1341.
43. O'Brien KD, Reichenbach DD, Marcovina SM, Kuusisto J, Alpers CE, Otto CM. Apolipoproteins B, (a), and E accumulate in the morphologically early lesion of 'degenerative' valvular aortic stenosis. Arterioscler Thromb Vasc Biol. 1996;16:523-532.
44. Mehrabian M, Demer LL, Lusis AJ. Differential accumulation of intimal monocyte-macrophages relative to lipoproteins and lipofuscin corresponds to hemodynamic forces on cardiac valves in mice. Arterioscler Thromb. 1991;11:947-957.
45. Thubrikar MJ, Aouad J, Nolan SP. Patterns of calcific deposits in operatively excised stenotic or purely regurgitant aortic valves and their relation to mechanical stress. Am J Cardiol. 1986;58:304-308.
46. Thubrikar MJ, Nolan SP, Aouad J, Deck JD. Stress sharing between the sinus and leaflets of canine aortic valve. Ann Thorac Surg. 1986;42:434-440.
47. Rabkin-Aikawa E, Farber M, Aikawa M, Schoen FJ. Dynamic and reversible changes of interstitial cell phenotype during remodeling of cardiac valves. J Heart Valve Dis. 2004;13:841-847.
48. Mohler ER, 3rd, Gannon F, Reynolds C, Zimmerman R, Keane MG, Kaplan FS. Bone formation and inflammation in cardiac valves. Circulation. 2001;103:1522-1528.
49. Rajamannan NM, Subramaniam M, Rickard D, Stock SR, Donovan J, Springett M, Orszulak T, Fullerton DA, Tajik AJ, Bonow RO, Spelsberg T. Human aortic valve calcification is associated with an osteoblast phenotype. Circulation. 2003;107:2181-2184.
50. Poggianti E, Venneri L, Chubuchny V, Jambrik Z, Baroncini LA, Picano E. Aortic valve sclerosis is associated with systemic endothelial dysfunction. J Am Coll Cardiol. 2003;41:136-141.
51. Young EW, Wheeler AR, Simmons CA. Matrix-dependent adhesion of vascular and valvular endothelial cells in microfluidic channels. Lab Chip. 2007;7:1759-1766.
52. Bairati A, DeBiasi S. Presence of a smooth muscle system in aortic valve leaflets. Anat Embryol (Berl). 1981;161:329-340.
53. Merryman WD, Huang HY, Schoen FJ, Sacks MS. The effects of cellular contraction on aortic valve leaflet flexural stiffness. J Biomech. 2006;39:88-96.
54. Mohler ER, 3rd, Chawla MK, Chang AW, Vyavahare N, Levy RJ, Graham L, Gannon FH. Identification and characterization of calcifying valve cells from human and canine aortic valves. J Heart Valve Dis. 1999;8:254-260.
124
55. Pho M, Lee W, Watt DR, Laschinger C, Simmons CA, McCulloch CA. Cofilin is a marker of myofibroblast differentiation in cells from porcine aortic cardiac valves. Am J Physiol Heart Circ Physiol. 2008;294:H1767-1778.
56. Cimini M, Rogers KA, Boughner DR. Aortic valve interstitial cells: an evaluation of cell viability and cell phenotype over time. J Heart Valve Dis. 2002;11:881-887.
57. Messier RH, Jr., Bass BL, Aly HM, Jones JL, Domkowski PW, Wallace RB, Hopkins RA. Dual structural and functional phenotypes of the porcine aortic valve interstitial population: characteristics of the leaflet myofibroblast. J Surg Res. 1994;57:1-21.
58. Chen JH, Yip CY, Sone ED, Simmons CA. Identification and characterization of aortic valve mesenchymal progenitor cells with robust osteogenic calcification potential. Am J Pathol. 2009;174:1109-1119.
59. Cushing MC, Liao JT, Anseth KS. Activation of valvular interstitial cells is mediated by transforming growth factor-beta1 interactions with matrix molecules. Matrix Biol. 2005;24:428-437.
60. Komuro T. Re-evaluation of fibroblasts and fibroblast-like cells. Anat Embryol (Berl). 1990;182:103-112.
61. Taylor PM, Allen SP, Yacoub MH. Phenotypic and functional characterization of interstitial cells from human heart valves, pericardium and skin. J Heart Valve Dis. 2000;9:150-158.
62. Lester W, Rosenthal A, Granton B, Gotlieb AI. Porcine mitral valve interstitial cells in culture. Lab Invest. 1988;59:710-719.
63. Mulholland DL, Gotlieb AI. Cell biology of valvular interstitial cells. Can J Cardiol. 1996;12:231-236.
64. Cushing MC, Mariner PD, Liao JT, Sims EA, Anseth KS. Fibroblast growth factor represses Smad-mediated myofibroblast activation in aortic valvular interstitial cells. Faseb J. 2008;22:1769-1777.
65. Walker GA, Masters KS, Shah DN, Anseth KS, Leinwand LA. Valvular myofibroblast activation by transforming growth factor-beta: implications for pathological extracellular matrix remodeling in heart valve disease. Circ Res. 2004;95:253-260.
66. Visconti RP, Ebihara Y, LaRue AC, Fleming PA, McQuinn TC, Masuya M, Minamiguchi H, Markwald RR, Ogawa M, Drake CJ. An in vivo analysis of hematopoietic stem cell potential: hematopoietic origin of cardiac valve interstitial cells. Circ Res. 2006;98:690-696.
67. Latif N, Sarathchandra P, Taylor PM, Antoniw J, Yacoub MH. Molecules mediating cell-ECM and cell-cell communication in human heart valves. Cell Biochem Biophys. 2005;43:275-287.
125
68. Yang X, Fullerton DA, Su X, Ao L, Cleveland JC, Jr., Meng X. Pro-osteogenic phenotype of human aortic valve interstitial cells is associated with higher levels of Toll-like receptors 2 and 4 and enhanced expression of bone morphogenetic protein 2. J Am Coll Cardiol. 2009;53:491-500.
69. Jian B, Narula N, Li QY, Mohler ER, 3rd, Levy RJ. Progression of aortic valve stenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aortic valve interstitial cell calcification via apoptosis. Ann Thorac Surg. 2003;75:457-465; discussion 465-456.
70. Soini Y, Satta J, Maatta M, Autio-Harmainen H. Expression of MMP2, MMP9, MT1-MMP, TIMP1, and TIMP2 mRNA in valvular lesions of the heart. J Pathol. 2001;194:225-231.
71. Kaden JJ, Dempfle CE, Grobholz R, Tran HT, Kilic R, Sarikoc A, Brueckmann M, Vahl C, Hagl S, Haase KK, Borggrefe M. Interleukin-1 beta promotes matrix metalloproteinase expression and cell proliferation in calcific aortic valve stenosis. Atherosclerosis. 2003;170:205-211.
72. Kaden JJ, Dempfle CE, Grobholz R, Fischer CS, Vocke DC, Kilic R, Sarikoc A, Pinol R, Hagl S, Lang S, Brueckmann M, Borggrefe M. Inflammatory regulation of extracellular matrix remodeling in calcific aortic valve stenosis. Cardiovasc Pathol. 2005;14:80-87.
73. Osman L, Chester AH, Amrani M, Yacoub MH, Smolenski RT. A novel role of extracellular nucleotides in valve calcification: a potential target for atorvastatin. Circulation. 2006;114:I566-572.
74. Clark-Greuel JN, Connolly JM, Sorichillo E, Narula NR, Rapoport HS, Mohler ER, 3rd, Gorman JH, 3rd, Gorman RC, Levy RJ. Transforming growth factor-beta1 mechanisms in aortic valve calcification: increased alkaline phosphatase and related events. Ann Thorac Surg. 2007;83:946-953.
75. Canfield AE, Doherty MJ, Wood AC, Farrington C, Ashton B, Begum N, Harvey B, Poole A, Grant ME, Boot-Handford RP. Role of pericytes in vascular calcification: a review. Z Kardiol. 2000;89 Suppl 2:20-27.
76. Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF-beta 1 and 25-hydroxycholesterol stimulate osteoblast-like vascular cells to calcify. J Clin Invest. 1994;93:2106-2113.
77. Proudfoot D, Skepper JN, Hegyi L, Bennett MR, Shanahan CM, Weissberg PL. Apoptosis regulates human vascular calcification in vitro: evidence for initiation of vascular calcification by apoptotic bodies. Circ Res. 2000;87:1055-1062.
78. Kim KM. Apoptosis and calcification. Scanning Microsc. 1995;9:1137-1175; discussion 1175-1138.
79. Yip CY, Chen JH, Zhao R, Simmons CA. Calcification by valve interstitial cells is regulated by the stiffness of the extracellular matrix. Arterioscler Thromb Vasc Biol. 2009;29:936-942.
126
80. Hunter GK, Hauschka PV, Poole AR, Rosenberg LC, Goldberg HA. Nucleation and inhibition of hydroxyapatite formation by mineralized tissue proteins. Biochem J. 1996;317 ( Pt 1):59-64.
81. Hauschka PV, Wians FH, Jr. Osteocalcin-hydroxyapatite interaction in the extracellular organic matrix of bone. Anat Rec. 1989;224:180-188.
82. Edep ME, Shirani J, Wolf P, Brown DL. Matrix metalloproteinase expression in nonrheumatic aortic stenosis. Cardiovasc Pathol. 2000;9:281-286.
83. Lee YS, Chou YY. Endothelial alterations and senile calcific aortic stenosis: an electron microscopic observation. Proc Natl Sci Counc Repub China B. 1997;21:137-143.
84. Kaden JJ, Bickelhaupt S, Grobholz R, Haase KK, Sarikoc A, Kilic R, Brueckmann M, Lang S, Zahn I, Vahl C, Hagl S, Dempfle CE, Borggrefe M. Receptor activator of nuclear factor kappaB ligand and osteoprotegerin regulate aortic valve calcification. J Mol Cell Cardiol. 2004;36:57-66.
85. Taipale J, Saharinen J, Hedman K, Keski-Oja J. Latent transforming growth factor-beta 1 and its binding protein are components of extracellular matrix microfibrils. J Histochem Cytochem. 1996;44:875-889.
86. Corcoran ML, Stetler-Stevenson WG. Tissue inhibitor of metalloproteinase-2 stimulates fibroblast proliferation via a cAMP-dependent mechanism. J Biol Chem. 1995;270:13453-13459.
87. Hayakawa T, Yamashita K, Ohuchi E, Shinagawa A. Cell growth-promoting activity of tissue inhibitor of metalloproteinases-2 (TIMP-2). J Cell Sci. 1994;107 ( Pt 9):2373-2379.
88. Jian B, Jones PL, Li Q, Mohler ER, 3rd, Schoen FJ, Levy RJ. Matrix metalloproteinase-2 is associated with tenascin-C in calcific aortic stenosis. Am J Pathol. 2001;159:321-327.
89. Jones PL, Jones FS. Tenascin-C in development and disease: gene regulation and cell function. Matrix Biol. 2000;19:581-596.
90. Satta J, Melkko J, Pollanen R, Tuukkanen J, Paakko P, Ohtonen P, Mennander A, Soini Y. Progression of human aortic valve stenosis is associated with tenascin-C expression. J Am Coll Cardiol. 2002;39:96-101.
91. Kaden JJ, Bickelhaupt S, Grobholz R, Vahl CF, Hagl S, Brueckmann M, Haase KK, Dempfle CE, Borggrefe M. Expression of bone sialoprotein and bone morphogenetic protein-2 in calcific aortic stenosis. J Heart Valve Dis. 2004;13:560-566.
92. Osman L, Yacoub MH, Latif N, Amrani M, Chester AH. Role of human valve interstitial cells in valve calcification and their response to atorvastatin. Circulation. 2006;114:I547-552.
93. Mallat Z, Tedgui A. Unbalanced RANKL/RANK pathway in aortic valve sclerosis. J Mol Cell Cardiol. 2004;36:17-19.
127
94. Alexopoulos A, Bravou V, Peroukides S, Kaklamanis L, Varakis J, Alexopoulos D, Papadaki H. Bone regulatory factors NFATc1 and Osterix in human calcific aortic valves. Int J Cardiol. 2008.
95. Ghazvini-Boroujerdi M, Clark J, Narula N, Palmatory E, Connolly JM, DeFelice S, Xu J, Jian B, Hazelwood S, Levy RJ. Transcription factor Egr-1 in calcific aortic valve disease. J Heart Valve Dis. 2004;13:894-903.
96. O'Brien KD, Shavelle DM, Caulfield MT, McDonald TO, Olin-Lewis K, Otto CM, Probstfield JL. Association of angiotensin-converting enzyme with low-density lipoprotein in aortic valvular lesions and in human plasma. Circulation. 2002;106:2224-2230.
97. Gerber IL, Legget ME, West TM, Richards AM, Stewart RA. Usefulness of serial measurement of N-terminal pro-brain natriuretic peptide plasma levels in asymptomatic patients with aortic stenosis to predict symptomatic deterioration. Am J Cardiol. 2005;95:898-901.
98. Hofbauer LC, Schoppet M. Clinical implications of the osteoprotegerin/RANKL/RANK system for bone and vascular diseases. Jama. 2004;292:490-495.
99. Tang Y, Urs S, Liaw L. Hairy-related transcription factors inhibit Notch-induced smooth muscle alpha-actin expression by interfering with Notch intracellular domain/CBF-1 complex interaction with the CBF-1-binding site. Circ Res. 2008;102:661-668.
100. Nigam V, Srivastava D. Notch1 Represses Osteogenic Pathways in Aortic Valve Cells. J Mol Cell Cardiol. 2009.
101. Nakao K, Ogawa Y, Suga S, Imura H. Molecular biology and biochemistry of the natriuretic peptide system. II: Natriuretic peptide receptors. J Hypertens. 1992;10:1111-1114.
102. Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, Goeddel DV. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science. 1991;252:120-123.
103. Potter LR, Abbey-Hosch S, Dickey DM. Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocr Rev. 2006;27:47-72.
104. Moura LM, Rocha-Goncalves F, Zamorano JL, Barros I, Bettencourt P, Rajamannan N. New cardiovascular biomarkers: clinical implications in patients with valvular heart disease. Expert Rev Cardiovasc Ther. 2008;6:945-954.
105. Wu C, Wu F, Pan J, Morser J, Wu Q. Furin-mediated processing of Pro-C-type natriuretic peptide. J Biol Chem. 2003;278:25847-25852.
106. Wollert KC, Yurukova S, Kilic A, Begrow F, Fiedler B, Gambaryan S, Walter U, Lohmann SM, Kuhn M. Increased effects of C-type natriuretic peptide on contractility
128
and calcium regulation in murine hearts overexpressing cyclic GMP-dependent protein kinase I. Br J Pharmacol. 2003;140:1227-1236.
107. Tsuji T, Kunieda T. A loss-of-function mutation in natriuretic peptide receptor 2 (Npr2) gene is responsible for disproportionate dwarfism in cn/cn mouse. J Biol Chem. 2005;280:14288-14292.
108. Yasoda A, Komatsu Y, Chusho H, Miyazawa T, Ozasa A, Miura M, Kurihara T, Rogi T, Tanaka S, Suda M, Tamura N, Ogawa Y, Nakao K. Overexpression of CNP in chondrocytes rescues achondroplasia through a MAPK-dependent pathway. Nat Med. 2004;10:80-86.
109. Kennedy JA, Hua X, Mishra K, Murphy GA, Rosenkranz AC, Horowitz JD. Inhibition of calcifying nodule formation in cultured porcine aortic valve cells by nitric oxide donors. Eur J Pharmacol. 2009;602:28-35.
110. Matsuo H, Furuya M. C-type natriuretic protein inhibits intimal thickening after vascular injury. Ann N Y Acad Sci. 1997;811:45-47.
111. Murakami S, Nagaya N, Itoh T, Fujii T, Iwase T, Hamada K, Kimura H, Kangawa K. C-type natriuretic peptide attenuates bleomycin-induced pulmonary fibrosis in mice. Am J Physiol Lung Cell Mol Physiol. 2004;287:L1172-1177.
112. Soeki T, Kishimoto I, Okumura H, Tokudome T, Horio T, Mori K, Kangawa K. C-type natriuretic peptide, a novel antifibrotic and antihypertrophic agent, prevents cardiac remodeling after myocardial infarction. J Am Coll Cardiol. 2005;45:608-616.
113. Astor BC, Kaczmarek RG, Hefflin B, Daley WR. Mortality after aortic valve replacement: results from a nationally representative database. Ann Thorac Surg. 2000;70:1939-1945.
114. Sharony R, Grossi EA, Saunders PC, Schwartz CF, Ciuffo GB, Baumann FG, Delianides J, Applebaum RM, Ribakove GH, Culliford AT, Galloway AC, Colvin SB. Aortic valve replacement in patients with impaired ventricular function. Ann Thorac Surg. 2003;75:1808-1814.
115. Grube E, Schuler G, Buellesfeld L, Gerckens U, Linke A, Wenaweser P, Sauren B, Mohr FW, Walther T, Zickmann B, Iversen S, Felderhoff T, Cartier R, Bonan R. Percutaneous aortic valve replacement for severe aortic stenosis in high-risk patients using the second- and current third-generation self-expanding CoreValve prosthesis: device success and 30-day clinical outcome. J Am Coll Cardiol. 2007;50:69-76.
116. Kvidal P, Bergstrom R, Malm T, Stahle E. Long-term follow-up of morbidity and mortality after aortic valve replacement with a mechanical valve prosthesis. Eur Heart J. 2000;21:1099-1111.
117. Rosenhek R, Rader F, Loho N, Gabriel H, Heger M, Klaar U, Schemper M, Binder T, Maurer G, Baumgartner H. Statins but not angiotensin-converting enzyme inhibitors delay progression of aortic stenosis. Circulation. 2004;110:1291-1295.
129
118. O'Brien KD, Probstfield JL, Caulfield MT, Nasir K, Takasu J, Shavelle DM, Wu AH, Zhao XQ, Budoff MJ. Angiotensin-converting enzyme inhibitors and change in aortic valve calcium. Arch Intern Med. 2005;165:858-862.
119. Wu B, Elmariah S, Kaplan FS, Cheng G, Mohler ER, 3rd. Paradoxical effects of statins on aortic valve myofibroblasts and osteoblasts: implications for end-stage valvular heart disease. Arterioscler Thromb Vasc Biol. 2005;25:592-597.
120. Monzack EL, Gu X, Masters KS. Efficacy of simvastatin treatment of valvular interstitial cells varies with the extracellular environment. Arterioscler Thromb Vasc Biol. 2009;29:246-253.
121. Cowell SJ, Newby DE, Prescott RJ, Bloomfield P, Reid J, Northridge DB, Boon NA. A randomized trial of intensive lipid-lowering therapy in calcific aortic stenosis. N Engl J Med. 2005;352:2389-2397.
122. Tammen H, Zucht HD, Budde P. Oncopeptidomics--a commentary on opportunities and limitations. Cancer Lett. 2007;249:80-86.
123. Farmer JA. Intensive lipid lowering with simvastatin and ezetimibe in aortic stenosis (the SEAS trial). Curr Atheroscler Rep. 2009;11:82-83.
124. Helske S, Laine M, Kupari M, Lommi J, Turto H, Nurmi L, Tikkanen I, Werkkala K, Lindstedt KA, Kovanen PT. Increased expression of profibrotic neutral endopeptidase and bradykinin type 1 receptors in stenotic aortic valves. Eur Heart J. 2007;28:1894-1903.
125. Arishiro K, Hoshiga M, Negoro N, Jin D, Takai S, Miyazaki M, Ishihara T, Hanafusa T. Angiotensin receptor-1 blocker inhibits atherosclerotic changes and endothelial disruption of the aortic valve in hypercholesterolemic rabbits. J Am Coll Cardiol. 2007;49:1482-1489.
126. Peterson JT. The importance of estimating the therapeutic index in the development of matrix metalloproteinase inhibitors. Cardiovasc Res. 2006;69:677-687.
127. Butcher JT, Simmons CA, Warnock JN. Mechanobiology of the aortic heart valve. J Heart Valve Dis. 2008;17:62-73.
128. Smith KE, Metzler SA, Warnock JN. Cyclic strain inhibits acute pro-inflammatory gene expression in aortic valve interstitial cells. Biomech Model Mechanobiol. 2009.
129. Yeung T, Georges PC, Flanagan LA, Marg B, Ortiz M, Funaki M, Zahir N, Ming W, Weaver V, Janmey PA. Effects of substrate stiffness on cell morphology, cytoskeletal structure, and adhesion. Cell Motil Cytoskeleton. 2005;60:24-34.
130. Engler AJ, Sen S, Sweeney HL, Discher DE. Matrix elasticity directs stem cell lineage specification. Cell. 2006;126:677-689.
130
131. Khatiwala CB, Peyton SR, Metzke M, Putnam AJ. The regulation of osteogenesis by ECM rigidity in MC3T3-E1 cells requires MAPK activation. J Cell Physiol. 2007;211:661-672.
132. Khatiwala CB, Peyton SR, Putnam AJ. Intrinsic mechanical properties of the extracellular matrix affect the behavior of pre-osteoblastic MC3T3-E1 cells. Am J Physiol Cell Physiol. 2006;290:C1640-1650.
133. Ingber DE. Mechanobiology and diseases of mechanotransduction. Ann Med. 2003;35:564-577.
134. Rai US, Singh RK. Synthesis and mechanical characterization of polymer-matrix composites containing calcium carbonate/white cement filler. Materials Letters. 2004;58:235-240.
135. Bauccio M. ASM Engineered Materials Reference Book. ASM International; 1994.
136. Engler AJ, Griffin MA, Sen S, Bonnemann CG, Sweeney HL, Discher DE. Myotubes differentiate optimally on substrates with tissue-like stiffness: pathological implications for soft or stiff microenvironments. J Cell Biol. 2004;166:877-887.
137. Wells RG. The role of matrix stiffness in regulating cell behavior. Hepatology. 2008;47:1394-1400.
138. Paszek MJ, Zahir N, Johnson KR, Lakins JN, Rozenberg GI, Gefen A, Reinhart-King CA, Margulies SS, Dembo M, Boettiger D, Hammer DA, Weaver VM. Tensional homeostasis and the malignant phenotype. Cancer Cell. 2005;8:241-254.
139. Choquet D, Felsenfeld DP, Sheetz MP. Extracellular matrix rigidity causes strengthening of integrin-cytoskeleton linkages. Cell. 1997;88:39-48.
140. Nayal A, Webb DJ, Horwitz AF. Talin: an emerging focal point of adhesion dynamics. Curr Opin Cell Biol. 2004;16:94-98.
141. Legate KR, Montanez E, Kudlacek O, Fassler R. ILK, PINCH and parvin: the tIPP of integrin signalling. Nat Rev Mol Cell Biol. 2006;7:20-31.
142. Pankov R, Cukierman E, Katz BZ, Matsumoto K, Lin DC, Lin S, Hahn C, Yamada KM. Integrin dynamics and matrix assembly: tensin-dependent translocation of alpha(5)beta(1) integrins promotes early fibronectin fibrillogenesis. J Cell Biol. 2000;148:1075-1090.
143. Schlunck G, Han H, Wecker T, Kampik D, Meyer-ter-Vehn T, Grehn F. Substrate rigidity modulates cell matrix interactions and protein expression in human trabecular meshwork cells. Invest Ophthalmol Vis Sci. 2008;49:262-269.
144. Hinz B, Dugina V, Ballestrem C, Wehrle-Haller B, Chaponnier C. Alpha-smooth muscle actin is crucial for focal adhesion maturation in myofibroblasts. Mol Biol Cell. 2003;14:2508-2519.
131
145. Hinz B. Masters and servants of the force: the role of matrix adhesions in myofibroblast force perception and transmission. Eur J Cell Biol. 2006;85:175-181.
146. Chiquet M, Gelman L, Lutz R, Maier S. From mechanotransduction to extracellular matrix gene expression in fibroblasts. Biochim Biophys Acta. 2009;1793:911-920.
147. Chen CS. Mechanotransduction - a field pulling together? J Cell Sci. 2008;121:3285-3292.
148. Geiger B, Spatz JP, Bershadsky AD. Environmental sensing through focal adhesions. Nat Rev Mol Cell Biol. 2009;10:21-33.
149. Keselowsky BG, Collard DM, Garcia AJ. Surface chemistry modulates focal adhesion composition and signaling through changes in integrin binding. Biomaterials. 2004;25:5947-5954.
150. Mercier I, Lechaire JP, Desmouliere A, Gaill F, Aumailley M. Interactions of human skin fibroblasts with monomeric or fibrillar collagens induce different organization of the cytoskeleton. Exp Cell Res. 1996;225:245-256.
151. Arnold M, Cavalcanti-Adam EA, Glass R, Blummel J, Eck W, Kantlehner M, Kessler H, Spatz JP. Activation of integrin function by nanopatterned adhesive interfaces. Chemphyschem. 2004;5:383-388.
152. Chen CS, Mrksich M, Huang S, Whitesides GM, Ingber DE. Geometric control of cell life and death. Science. 1997;276:1425-1428.
153. Dalby MJ, Riehle MO, Johnstone H, Affrossman S, Curtis AS. In vitro reaction of endothelial cells to polymer demixed nanotopography. Biomaterials. 2002;23:2945-2954.
154. Vogel V, Sheetz M. Local force and geometry sensing regulate cell functions. Nat Rev Mol Cell Biol. 2006;7:265-275.
155. Engler A, Bacakova L, Newman C, Hategan A, Griffin M, Discher D. Substrate compliance versus ligand density in cell on gel responses. Biophys J. 2004;86:617-628.
156. Galbraith CG, Sheetz MP. Forces on adhesive contacts affect cell function. Curr Opin Cell Biol. 1998;10:566-571.
157. Pelham RJ, Jr., Wang Y. Cell locomotion and focal adhesions are regulated by substrate flexibility. Proc Natl Acad Sci U S A. 1997;94:13661-13665.
158. Zhong C, Chrzanowska-Wodnicka M, Brown J, Shaub A, Belkin AM, Burridge K. Rho-mediated contractility exposes a cryptic site in fibronectin and induces fibronectin matrix assembly. J Cell Biol. 1998;141:539-551.
159. Wong AH, Amabile PG, Yuksel E, Waugh JM, Dake MD. Perivascular release of insulin-like growth factor-1 limits neointima formation in the balloon-injured artery by redirecting smooth muscle cell migration. J Vasc Interv Radiol. 2001;12:347-350.
132
160. Galbraith CG, Yamada KM, Sheetz MP. The relationship between force and focal complex development. J Cell Biol. 2002;159:695-705.
161. Peyton SR, Putnam AJ. Extracellular matrix rigidity governs smooth muscle cell motility in a biphasic fashion. J Cell Physiol. 2005;204:198-209.
162. Wang N, Ingber DE. Control of cytoskeletal mechanics by extracellular matrix, cell shape, and mechanical tension. Biophys J. 1994;66:2181-2189.
163. Guo WH, Wang YL. Retrograde fluxes of focal adhesion proteins in response to cell migration and mechanical signals. Mol Biol Cell. 2007;18:4519-4527.
164. Khatiwala CB, Kim PD, Peyton SR, Putnam AJ. ECM compliance regulates osteogenesis by influencing MAPK signaling downstream of RhoA and ROCK. J Bone Miner Res. 2009;24:886-898.
165. Fringer J, Grinnell F. Fibroblast quiescence in floating or released collagen matrices: contribution of the ERK signaling pathway and actin cytoskeletal organization. J Biol Chem. 2001;276:31047-31052.
166. Paszek MJ, Weaver VM. The tension mounts: mechanics meets morphogenesis and malignancy. J Mammary Gland Biol Neoplasia. 2004;9:325-342.
167. Georges PC, Janmey PA. Cell type-specific response to growth on soft materials. J Appl Physiol. 2005;98:1547-1553.
168. Georges PC, Miller WJ, Meaney DF, Sawyer ES, Janmey PA. Matrices with compliance comparable to that of brain tissue select neuronal over glial growth in mixed cortical cultures. Biophys J. 2006;90:3012-3018.
169. Zamir E, Geiger B. Molecular complexity and dynamics of cell-matrix adhesions. J Cell Sci. 2001;114:3583-3590.
170. Zaidel-Bar R, Itzkovitz S, Ma'ayan A, Iyengar R, Geiger B. Functional atlas of the integrin adhesome. Nat Cell Biol. 2007;9:858-867.
171. Assoian RK, Klein EA. Growth control by intracellular tension and extracellular stiffness. Trends Cell Biol. 2008;18:347-352.
172. Frisch SM, Screaton RA. Anoikis mechanisms. Curr Opin Cell Biol. 2001;13:555-562.
173. Comoglio PM, Boccaccio C, Trusolino L. Interactions between growth factor receptors and adhesion molecules: breaking the rules. Curr Opin Cell Biol. 2003;15:565-571.
174. Buxton PG, Bitar M, Gellynck K, Parkar M, Brown RA, Young AM, Knowles JC, Nazhat SN. Dense collagen matrix accelerates osteogenic differentiation and rescues the apoptotic response to MMP inhibition. Bone. 2008;43:377-385.
175. Rodolfo C, Piacentini M. Does cytoskeleton 'Akt' in apoptosis? Cell Death Differ. 2002;9:477-478.
133
176. Wells RG. The role of matrix stiffness in hepatic stellate cell activation and liver fibrosis. J Clin Gastroenterol. 2005;39:S158-161.
177. Kong HJ, Polte TR, Alsberg E, Mooney DJ. FRET measurements of cell-traction forces and nano-scale clustering of adhesion ligands varied by substrate stiffness. Proc Natl Acad Sci U S A. 2005;102:4300-4305.
178. Benton JA, Kern HB, Anseth KS. Substrate properties influence calcification in valvular interstitial cell culture. J Heart Valve Dis. 2008;17:689-699.
179. Hansen LK, Wilhelm J, Fassett JT. Regulation of hepatocyte cell cycle progression and differentiation by type I collagen structure. Curr Top Dev Biol. 2006;72:205-236.
180. Semler EJ, Ranucci CS, Moghe PV. Mechanochemical manipulation of hepatocyte aggregation can selectively induce or repress liver-specific function. Biotechnol Bioeng. 2000;69:359-369.
181. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3:349-363.
182. Zaman MH, Trapani LM, Sieminski AL, Mackellar D, Gong H, Kamm RD, Wells A, Lauffenburger DA, Matsudaira P. Migration of tumor cells in 3D matrices is governed by matrix stiffness along with cell-matrix adhesion and proteolysis. Proc Natl Acad Sci U S A. 2006;103:10889-10894.
183. Wolf K, Mazo I, Leung H, Engelke K, von Andrian UH, Deryugina EI, Strongin AY, Brocker EB, Friedl P. Compensation mechanism in tumor cell migration: mesenchymal-amoeboid transition after blocking of pericellular proteolysis. J Cell Biol. 2003;160:267-277.
184. Peyton SR, Kim PD, Ghajar CM, Seliktar D, Putnam AJ. The effects of matrix stiffness and RhoA on the phenotypic plasticity of smooth muscle cells in a 3-D biosynthetic hydrogel system. Biomaterials. 2008;29:2597-2607.
185. Li Z, Dranoff JA, Chan EP, Uemura M, Sevigny J, Wells RG. Transforming growth factor-beta and substrate stiffness regulate portal fibroblast activation in culture. Hepatology. 2007;46:1246-1256.
186. Imanaka K, Takamoto S, Ohtsuka T, Oka T, Furuse A, Omata S. The stiffness of normal and abnormal mitral valves. Ann Thorac Cardiovasc Surg. 2007;13:178-184.
187. Huang Z, Li J, Jiang Z, Qi Y, Tang C, Du J. Effects of adrenomedullin, C-type natriuretic peptide, and parathyroid hormone-related peptide on calcification in cultured rat vascular smooth muscle cells. J Cardiovasc Pharmacol. 2003;42:89-97.
188. Inoue A, Hiruma Y, Hirose S, Yamaguchi A, Furuya M, Tanaka S, Hagiwara H. Stimulation by C-type natriuretic peptide of the differentiation of clonal osteoblastic MC3T3-E1 cells. Biochem Biophys Res Commun. 1996;221:703-707.
134
189. Quirk RA, Kellam B, Bhandari RN, Davies MC, Tendler SJ, Shakesheff KM. Cell-type-specific adhesion onto polymer surfaces from mixed cell populations. Biotechnol Bioeng. 2003;81:625-628.
190. Hubbell JA, Massia SP, Desai NP, Drumheller PD. Endothelial cell-selective materials for tissue engineering in the vascular graft via a new receptor. Biotechnology (N Y). 1991;9:568-572.
191. Iwasaki Y, Tabata E, Kurita K, Akiyoshi K. Selective cell attachment to a biomimetic polymer surface through the recognition of cell-surface tags. Bioconjug Chem. 2005;16:567-575.
192. Gu X, Masters KS. Role of the MAPK/ERK pathway in valvular interstitial cell calcification. Am J Physiol Heart Circ Physiol. 2009;296:H1748-1757.
193. Bellows CG, Melcher AH, Aubin JE. Contraction and organization of collagen gels by cells cultured from periodontal ligament, gingiva and bone suggest functional differences between cell types. J Cell Sci. 1981;50:299-314.
194. Christopherson GT, Song H, Mao HQ. The influence of fiber diameter of electrospun substrates on neural stem cell differentiation and proliferation. Biomaterials. 2009;30:556-564.
195. Koyama H, Raines EW, Bornfeldt KE, Roberts JM, Ross R. Fibrillar collagen inhibits arterial smooth muscle proliferation through regulation of Cdk2 inhibitors. Cell. 1996;87:1069-1078.
196. Nishiyama T, Horii I, Nakayama Y, Ozawa T, Hayashi T. A distinct characteristic of the quiescent state of human dermal fibroblasts in contracted collagen gel as revealed by no response to epidermal growth factor alone, but a positive growth response to a combination of the growth factor and saikosaponin b1. Matrix. 1990;10:412-419.
197. Ichii T, Koyama H, Tanaka S, Kim S, Shioi A, Okuno Y, Raines EW, Iwao H, Otani S, Nishizawa Y. Fibrillar collagen specifically regulates human vascular smooth muscle cell genes involved in cellular responses and the pericellular matrix environment. Circ Res. 2001;88:460-467.
198. Mauch C, Adelmann-Grill B, Hatamochi A, Krieg T. Collagenase gene expression in fibroblasts is regulated by a three-dimensional contact with collagen. FEBS Lett. 1989;250:301-305.
199. Mauch C, Hatamochi A, Scharffetter K, Krieg T. Regulation of collagen synthesis in fibroblasts within a three-dimensional collagen gel. Exp Cell Res. 1988;178:493-503.
200. Ravanti L, Heino J, Lopez-Otin C, Kahari VM. Induction of collagenase-3 (MMP-13) expression in human skin fibroblasts by three-dimensional collagen is mediated by p38 mitogen-activated protein kinase. J Biol Chem. 1999;274:2446-2455.
135
201. Romanic AM, Adachi E, Kadler KE, Hojima Y, Prockop DJ. Copolymerization of pNcollagen III and collagen I. pNcollagen III decreases the rate of incorporation of collagen I into fibrils, the amount of collagen I incorporated, and the diameter of the fibrils formed. J Biol Chem. 1991;266:12703-12709.
202. Prockop DJ, Kivirikko KI. Collagens: molecular biology, diseases, and potentials for therapy. Annu Rev Biochem. 1995;64:403-434.
203. Liu X, Wu H, Byrne M, Krane S, Jaenisch R. Type III collagen is crucial for collagen I fibrillogenesis and for normal cardiovascular development. Proc Natl Acad Sci U S A. 1997;94:1852-1856.
204. Gullberg DE, Lundgren-Akerlund E. Collagen-binding I domain integrins--what do they do? Prog Histochem Cytochem. 2002;37:3-54.
205. Heino J, Huhtala M, Kapyla J, Johnson MS. Evolution of collagen-based adhesion systems. Int J Biochem Cell Biol. 2009;41:341-348.
206. Kramer RH, Marks N. Identification of integrin collagen receptors on human melanoma cells. J Biol Chem. 1989;264:4684-4688.
207. Camper L, Hellman U, Lundgren-Akerlund E. Isolation, cloning, and sequence analysis of the integrin subunit alpha10, a beta1-associated collagen binding integrin expressed on chondrocytes. J Biol Chem. 1998;273:20383-20389.
208. Velling T, Kusche-Gullberg M, Sejersen T, Gullberg D. cDNA cloning and chromosomal localization of human alpha(11) integrin. A collagen-binding, I domain-containing, beta(1)-associated integrin alpha-chain present in muscle tissues. J Biol Chem. 1999;274:25735-25742.
209. Kim JK, Xu Y, Xu X, Keene DR, Gurusiddappa S, Liang X, Wary KK, Hook M. A novel binding site in collagen type III for integrins alpha1beta1 and alpha2beta1. J Biol Chem. 2005;280:32512-32520.
210. Vuoriluoto K, Jokinen J, Kallio K, Salmivirta M, Heino J, Ivaska J. Syndecan-1 supports integrin alpha2beta1-mediated adhesion to collagen. Exp Cell Res. 2008;314:3369-3381.
211. Shrivastava A, Radziejewski C, Campbell E, Kovac L, McGlynn M, Ryan TE, Davis S, Goldfarb MP, Glass DJ, Lemke G, Yancopoulos GD. An orphan receptor tyrosine kinase family whose members serve as nonintegrin collagen receptors. Mol Cell. 1997;1:25-34.
212. Vogel W, Gish GD, Alves F, Pawson T. The discoidin domain receptor tyrosine kinases are activated by collagen. Mol Cell. 1997;1:13-23.
213. Shah DN, Recktenwall-Work SM, Anseth KS. The effect of bioactive hydrogels on the secretion of extracellular matrix molecules by valvular interstitial cells. Biomaterials. 2008;29:2060-2072.
136
214. Chester AH, Taylor PM. Molecular and functional characteristics of heart-valve interstitial cells. Philos Trans R Soc Lond B Biol Sci. 2007;362:1437-1443.
215. Liu AC, Joag VR, Gotlieb AI. The emerging role of valve interstitial cell phenotypes in regulating heart valve pathobiology. Am J Pathol. 2007;171:1407-1418.
216. O'Brien KD. Pathogenesis of calcific aortic valve disease: a disease process comes of age (and a good deal more). Arterioscler Thromb Vasc Biol. 2006;26:1721-1728.
217. Speer MY, Giachelli CM. Regulation of cardiovascular calcification. Cardiovasc Pathol. 2004;13:63-70.
218. Mohler ER, 3rd. Mechanisms of aortic valve calcification. Am J Cardiol. 2004;94:1396-1402, A1396.
219. Filip DA, Nistor A, Bulla A, Radu A, Lupu F, Simionescu M. Cellular events in the development of valvular atherosclerotic lesions induced by experimental hypercholesterolemia. Atherosclerosis. 1987;67:199-214.
220. Mathieu P, Voisine P, Pepin A, Shetty R, Savard N, Dagenais F. Calcification of human valve interstitial cells is dependent on alkaline phosphatase activity. J Heart Valve Dis. 2005;14:353-357.
221. Discher DE, Janmey P, Wang YL. Tissue cells feel and respond to the stiffness of their substrate. Science. 2005;310:1139-1143.
222. Ringe J, Kaps C, Schmitt B, Buscher K, Bartel J, Smolian H, Schultz O, Burmester GR, Haupl T, Sittinger M. Porcine mesenchymal stem cells. Induction of distinct mesenchymal cell lineages. Cell Tissue Res. 2002;307:321-327.
223. Chai H, Zhou W, Lin P, Lumsden A, Yao Q, Chen C. Ginsenosides block HIV protease inhibitor ritonavir-induced vascular dysfunction of porcine coronary arteries. Am J Physiol Heart Circ Physiol. 2005;288:H2965-2971.
224. Grinnell F, Zhu M, Carlson MA, Abrams JM. Release of mechanical tension triggers apoptosis of human fibroblasts in a model of regressing granulation tissue. Exp Cell Res. 1999;248:608-619.
225. Xia H, Nho RS, Kahm J, Kleidon J, Henke CA. Focal adhesion kinase is upstream of phosphatidylinositol 3-kinase/Akt in regulating fibroblast survival in response to contraction of type I collagen matrices via a beta 1 integrin viability signaling pathway. J Biol Chem. 2004;279:33024-33034.
226. Schoen FJ. Evolving concepts of cardiac valve dynamics: the continuum of development, functional structure, pathobiology, and tissue engineering. Circulation. 2008;118:1864-1880.
227. Theriot JA, Mitchison TJ. Actin microfilament dynamics in locomoting cells. Nature. 1991;352:126-131.
137
228. Frame M, Norman J. A tal(in) of cell spreading. Nat Cell Biol. 2008;10:1017-1019.
229. Arora PD, McCulloch CA. Dependence of collagen remodelling on alpha-smooth muscle actin expression by fibroblasts. J Cell Physiol. 1994;159:161-175.
230. Hinz B, Celetta G, Tomasek JJ, Gabbiani G, Chaponnier C. Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol Biol Cell. 2001;12:2730-2741.
231. Tian B, Lessan K, Kahm J, Kleidon J, Henke C. beta 1 integrin regulates fibroblast viability during collagen matrix contraction through a phosphatidylinositol 3-kinase/Akt/protein kinase B signaling pathway. J Biol Chem. 2002;277:24667-24675.
232. Clarke MC, Littlewood TD, Figg N, Maguire JJ, Davenport AP, Goddard M, Bennett MR. Chronic apoptosis of vascular smooth muscle cells accelerates atherosclerosis and promotes calcification and medial degeneration. Circ Res. 2008;102:1529-1538.
233. Benton JA, Kern HB, Leinwand LA, Mariner PD, Anseth KS. Statins Block Calcific Nodule Formation of Valvular Interstitial Cells by Inhibiting {alpha}-Smooth Muscle Actin Expression. Arterioscler Thromb Vasc Biol. 2009.
234. Aikawa E, Nahrendorf M, Sosnovik D, Lok VM, Jaffer FA, Aikawa M, Weissleder R. Multimodality molecular imaging identifies proteolytic and osteogenic activities in early aortic valve disease. Circulation. 2007;115:377-386.
235. Kunz-Schughart LA, Wenninger S, Neumeier T, Seidl P, Knuechel R. Three-dimensional tissue structure affects sensitivity of fibroblasts to TGF-beta 1. Am J Physiol Cell Physiol. 2003;284:C209-219.
236. McDonald TO, Gerrity RG, Jen C, Chen HJ, Wark K, Wight TN, Chait A, O'Brien KD. Diabetes and arterial extracellular matrix changes in a porcine model of atherosclerosis. J Histochem Cytochem. 2007;55:1149-1157.
237. Simionescu A, Simionescu DT, Vyavahare NR. Osteogenic responses in fibroblasts activated by elastin degradation products and transforming growth factor-beta1: role of myofibroblasts in vascular calcification. Am J Pathol. 2007;171:116-123.
238. Watson KE, Parhami F, Shin V, Demer LL. Fibronectin and collagen I matrixes promote calcification of vascular cells in vitro, whereas collagen IV matrix is inhibitory. Arterioscler Thromb Vasc Biol. 1998;18:1964-1971.
239. Mohler ER, 3rd, Adam LP, McClelland P, Graham L, Hathaway DR. Detection of osteopontin in calcified human aortic valves. Arterioscler Thromb Vasc Biol. 1997;17:547-552.
240. Fang Y, Mohler ER, 3rd, Hsieh E, Osman H, Hashemi SM, Davies PF, Rothblat GH, Wilensky RL, Levitan I. Hypercholesterolemia suppresses inwardly rectifying K+ channels in aortic endothelium in vitro and in vivo. Circ Res. 2006;98:1064-1071.
138
241. Walsh BJ, Thornton SC, Penny R, Breit SN. Microplate reader-based quantitation of collagens. Anal Biochem. 1992;203:187-190.
242. Pandey KN. Biology of natriuretic peptides and their receptors. Peptides. 2005;26:901-932.
243. Naruko T, Ueda M, van der Wal AC, van der Loos CM, Itoh H, Nakao K, Becker AE. C-type natriuretic peptide in human coronary atherosclerotic lesions. Circulation. 1996;94:3103-3108.
244. Chusho H, Tamura N, Ogawa Y, Yasoda A, Suda M, Miyazawa T, Nakamura K, Nakao K, Kurihara T, Komatsu Y, Itoh H, Tanaka K, Saito Y, Katsuki M, Nakao K. Dwarfism and early death in mice lacking C-type natriuretic peptide. Proc Natl Acad Sci U S A. 2001;98:4016-4021.
245. Tamura N, Doolittle LK, Hammer RE, Shelton JM, Richardson JA, Garbers DL. Critical roles of the guanylyl cyclase B receptor in endochondral ossification and development of female reproductive organs. Proc Natl Acad Sci U S A. 2004;101:17300-17305.
246. Inoue A, Hiruma Y, Hirose S, Yamaguchi A, Hagiwara H. Reciprocal regulation by cyclic nucleotides of the differentiation of rat osteoblast-like cells and mineralization of nodules. Biochem Biophys Res Commun. 1995;215:1104-1110.
247. Suda M, Tanaka K, Fukushima M, Natsui K, Yasoda A, Komatsu Y, Ogawa Y, Itoh H, Nakao K. C-type natriuretic peptide as an autocrine/paracrine regulator of osteoblast. Evidence for possible presence of bone natriuretic peptide system. Biochem Biophys Res Commun. 1996;223:1-6.
248. Yeh LC, Zavala MC, Lee JC. C-type natriuretic peptide enhances osteogenic protein-1-induced osteoblastic cell differentiation via Smad5 phosphorylation. J Cell Biochem. 2006;97:494-500.
249. Suda M, Komatsu Y, Tanaka K, Yasoda A, Sakuma Y, Tamura N, Ogawa Y, Nakao K. C-Type natriuretic peptide/guanylate cyclase B system in rat osteogenic ROB-C26 cells and its down-regulation by dexamethazone. Calcif Tissue Int. 1999;65:472-478.
250. Han B, Fixler R, Beeri R, Wang Y, Bachrach U, Hasin Y. The opposing effects of endothelin-1 and C-type natriuretic peptide on apoptosis of neonatal rat cardiac myocytes. Eur J Pharmacol. 2003;474:15-20.
251. Suenobu N, Shichiri M, Iwashina M, Marumo F, Hirata Y. Natriuretic peptides and nitric oxide induce endothelial apoptosis via a cGMP-dependent mechanism. Arterioscler Thromb Vasc Biol. 1999;19:140-146.
252. Itoh T, Nagaya N, Murakami S, Fujii T, Iwase T, Ishibashi-Ueda H, Yutani C, Yamagishi M, Kimura H, Kangawa K. C-type natriuretic peptide ameliorates monocrotaline-induced pulmonary hypertension in rats. Am J Respir Crit Care Med. 2004;170:1204-1211.
139
253. Miyoshi H, Umeshita K, Sakon M, Imajoh-Ohmi S, Fujitani K, Gotoh M, Oiki E, Kambayashi J, Monden M. Calpain activation in plasma membrane bleb formation during tert-butyl hydroperoxide-induced rat hepatocyte injury. Gastroenterology. 1996;110:1897-1904.
254. Martin SJ, O'Brien GA, Nishioka WK, McGahon AJ, Mahboubi A, Saido TC, Green DR. Proteolysis of fodrin (non-erythroid spectrin) during apoptosis. J Biol Chem. 1995;270:6425-6428.
255. Oliveros JC. VENNY. An interactive tool for comparing lists with Venn Diagrams.; 2007.
256. Shindo K, Kawashima N, Sakamoto K, Yamaguchi A, Umezawa A, Takagi M, Katsube K, Suda H. Osteogenic differentiation of the mesenchymal progenitor cells, Kusa is suppressed by Notch signaling. Exp Cell Res. 2003;290:370-380.
257. Garg V, Muth AN, Ransom JF, Schluterman MK, Barnes R, King IN, Grossfeld PD, Srivastava D. Mutations in NOTCH1 cause aortic valve disease. Nature. 2005;437:270-274.
258. Steitz SA, Speer MY, Curinga G, Yang HY, Haynes P, Aebersold R, Schinke T, Karsenty G, Giachelli CM. Smooth muscle cell phenotypic transition associated with calcification: upregulation of Cbfa1 and downregulation of smooth muscle lineage markers. Circ Res. 2001;89:1147-1154.
259. Rajamannan NM, Subramaniam M, Springett M, Sebo TC, Niekrasz M, McConnell JP, Singh RJ, Stone NJ, Bonow RO, Spelsberg TC. Atorvastatin inhibits hypercholesterolemia-induced cellular proliferation and bone matrix production in the rabbit aortic valve. Circulation. 2002;105:2660-2665.
260. Javed A, Bae JS, Afzal F, Gutierrez S, Pratap J, Zaidi SK, Lou Y, van Wijnen AJ, Stein JL, Stein GS, Lian JB. Structural coupling of Smad and Runx2 for execution of the BMP2 osteogenic signal. J Biol Chem. 2008;283:8412-8422.
261. Phillips JE, Gersbach CA, Wojtowicz AM, Garcia AJ. Glucocorticoid-induced osteogenesis is negatively regulated by Runx2/Cbfa1 serine phosphorylation. J Cell Sci. 2006;119:581-591.
262. Moioli EK, Hong L, Mao JJ. Inhibition of osteogenic differentiation of human mesenchymal stem cells. Wound Repair Regen. 2007;15:413-421.
263. Ghayor C, Ehrbar M, San Miguel B, Gratz KW, Weber FE. cAMP enhances BMP2-signaling through PKA and MKP1-dependent mechanisms. Biochem Biophys Res Commun. 2009;381:247-252.
264. Chambers RC, Leoni P, Kaminski N, Laurent GJ, Heller RA. Global expression profiling of fibroblast responses to transforming growth factor-beta1 reveals the induction of inhibitor of differentiation-1 and provides evidence of smooth muscle cell phenotypic switching. Am J Pathol. 2003;162:533-546.
140
265. Serini G, Gabbiani G. Mechanisms of myofibroblast activity and phenotypic modulation. Exp Cell Res. 1999;250:273-283.
266. Cagnin S, Biscuola M, Patuzzo C, Trabetti E, Pasquali A, Laveder P, Faggian G, Iafrancesco M, Mazzucco A, Pignatti PF, Lanfranchi G. Reconstruction and functional analysis of altered molecular pathways in human atherosclerotic arteries. BMC Genomics. 2009;10:13.
267. Schneider JG, von Eynatten M, Parhofer KG, Volkmer JE, Schiekofer S, Hamann A, Nawroth PP, Dugi KA. Atorvastatin improves diabetic dyslipidemia and increases lipoprotein lipase activity in vivo. Atherosclerosis. 2004;175:325-331.
268. Ueno N, Ling N, Ying SY, Esch F, Shimasaki S, Guillemin R. Isolation and partial characterization of follistatin: a single-chain Mr 35,000 monomeric protein that inhibits the release of follicle-stimulating hormone. Proc Natl Acad Sci U S A. 1987;84:8282-8286.
269. de Winter JP, ten Dijke P, de Vries CJ, van Achterberg TA, Sugino H, de Waele P, Huylebroeck D, Verschueren K, van den Eijnden-van Raaij AJ. Follistatins neutralize activin bioactivity by inhibition of activin binding to its type II receptors. Mol Cell Endocrinol. 1996;116:105-114.
270. Itoh S, Itoh F, Goumans MJ, Ten Dijke P. Signaling of transforming growth factor-beta family members through Smad proteins. Eur J Biochem. 2000;267:6954-6967.
271. You L, Kruse FE. Differential effect of activin A and BMP-7 on myofibroblast differentiation and the role of the Smad signaling pathway. Invest Ophthalmol Vis Sci. 2002;43:72-81.
272. Iemura S, Yamamoto TS, Takagi C, Uchiyama H, Natsume T, Shimasaki S, Sugino H, Ueno N. Direct binding of follistatin to a complex of bone-morphogenetic protein and its receptor inhibits ventral and epidermal cell fates in early Xenopus embryo. Proc Natl Acad Sci U S A. 1998;95:9337-9342.
273. Sadeghi MM, Collinge M, Pardi R, Bender JR. Simvastatin modulates cytokine-mediated endothelial cell adhesion molecule induction: involvement of an inhibitory G protein. J Immunol. 2000;165:2712-2718.
274. Sugiyama S, Kugiyama K, Matsumura T, Suga S, Itoh H, Nakao K, Yasue H. Lipoproteins regulate C-type natriuretic peptide secretion from cultured vascular endothelial cells. Arterioscler Thromb Vasc Biol. 1995;15:1968-1974.
275. Kohno M, Yokokawa K, Yasunari K, Kano H, Minami M, Ueda M, Yoshikawa J. Effect of natriuretic peptide family on the oxidized LDL-induced migration of human coronary artery smooth muscle cells. Circ Res. 1997;81:585-590.
276. Kohno M, Yasunari K, Maeda K, Kano H, Minami M, Hanehira T, Yoshikawa J. Effects of cardiac natriuretic peptides on oxidized low-density lipoprotein- and
141
lysophosphatidylcholine-induced human mesangial cell migration. Hypertension. 2000;35:971-977.
277. Chrisman TD, Perkins DT, Garbers DL. Identification of a potent serum factor that causes desensitization of the receptor for C-Type natriuretic peptide. Cell Commun Signal. 2003;1:4.
278. Yoder AR, Kruse AC, Earhart CA, Ohlendorf DH, Potter LR. Reduced ability of C-type natriuretic peptide (CNP) to activate natriuretic peptide receptor B (NPR-B) causes dwarfism in lbab -/- mice. Peptides. 2008;29:1575-1581.
142
Appendix A A. Protocols
A.1. Fabrication of Type I Collagen Matrices
(Modified from Bellows CG, Melcher AH, Aubin JE. Contraction and organization of collagen
gels by cells cultured from periodontal ligament, gingiva and bone suggest functional differences
between cell types. J Cell Sci. 1981;50:299-314.)
Purpose: To synthesize collagen matrices with different mechanical properties, but similar
biochemical properties.
Reagents:
10x concentrated sterile DMEM (Sigma D7777) made with distilled water
0.25 M sterile NaHCO3 (Sigma 223530) buffer made with distilled water
0.01 M sterile NaOH (Sigma S2770) made with distilled water
FBS (HyClone FSSP9749370, lot # KRA25425)
1% Penicillin/Streptomycin (P/S) mixture (Sigma P4333)
Bovine dermal Type I collagen (Advanced Biomatrix, Part No. 5005)
Equipment:
24 well plate
12mm coverslips
Small tweezers
Procedure:
1. Sterilize coverslips with ethanol burner and place in 24 well plate
2. For 24-well plate, combine and vortex to mix:
a. 0.6mL of 10x concentrated DMEM
b. 0.6mL of 0.25 M NaHCO3
c. 0.6mL of FBS
d. 0.6mL of P/S mixture
e. 0.24mL of 0.01 M NaOH
3. Add 5mL of Type I collagen; pipette up and down gently to mix.
4. Pipette gel mixture onto plate:
a. Thick/compliant gel – 500 L in each well of a 24-well plate
143
b. Thin/stiff gel – 500 L in each well of a 24-well plate, let sit for 1 minute and
then remove excess gel mixture by aspiration
5. Incubate at 37oC, 5% CO2 overnight for polymerization
A.2. Scanning Electron Microscopy
Purpose: To study the microstructure of specimens
Reagents:
Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
10% Neutral Buffered Formalin (NBF)
- 100 mL formaldehyde (Sigma F1635)
- 900 mL distilled water
- 4g sodium phosphate monobasic (Sigma S8282)
- 6.5g sodium phosphate dibasic anhydrous (Sigma S0876)
Ethanol (30%, 50%, 70%, 90%, 95% and 100%)
Liquid carbon dioxide
Conductive paint
Equipment:
Polaron CPD7501 critical point drying system
Polaron SC515 SEM coating system
Scanning Electron Microscope (Hitachi Instrument Model S-2500)
Aluminum stubs
Procedures:
1. Wash samples (2-3 times) with sterile PBS
2. Fix samples with sterile 10% NBF for 30 minutes (note: sterilize NBF with 0.2m filter)
3. Dehydrate sample at room temperature in a series of ethanol washes at 30%, 50%, 70%*,
95%* and 100% ethanol for 30 minutes each
4. Critical point dry the sample with liquid carbon dioxide in a Polaron CPD7501
5. Mount the samples on aluminum stubs and place conductive paint on the end of the
samples
6. Sputter coat with gold using a Polaron SC515 SEM coating system
7. Examine the sample at 1,000X to 5,000X magnification using a scanning electron
microscope
144
* Note: samples may be store in 70% or 95% ethanol at 4oC degree for a few weeks before the
last step of dehydration.
A.3. Hydroxyproline Assay
Purpose: To determine the approximate collagen content within a sample by quantifying the
amount of hydroxyproline (OH-Pro).
Overview:
This colourimetric assay is used to quantitate the amount of hydroxyproline (OH-Pro) in papain
digested samples subjected to acid hydrolysis. Since collagen contains approximately 8-10%
hydroxyproline, this assay can be used to determine the approximate amount of collagen within a
sample. Free hydroxyproline is released from protein and peptides by acid hydrolysis. The
hydroxlate is then neutralized. The hydroxyproline is oxidized into a pyrrole with chloramine T.
This intermediate turns pink in colour with the addition of Ehrlich’s Reagent (4-
dimethylaminobenaldehyde).
Reagents:
Papain digestion buffer
- 0.272 g ammonium acetate
- 0.038 g Na2 EDTA 2H2O
- 0.031 g DL-dithiothreitol (DTT)
- Add 100 mL distilled water
- Adjust pH to 6.2 with acetic acid or sodium hydroxide
- Store at 4oC
Papain (25 mg/mL Sigma P3125)
0.001 N and 6 N hydrochloride acid (HCl)
5.7 N NaOH
L-hydroxyproline standard (either cis or trans variants)
Hydroxyproline assay buffer
- 5 g citric acid
- 1.2 mL glacial acetic acid
- 7.23 g sodium acetate
- 3.4 g sodium hydroxide
145
- Bring up to 100 mL with deionized H2O and adjust pH to 6 with acetic acid or sodium
hydroxide
- Store at 4oC for up to 2-3 weeks
0.05 N chloramine-T
- Dissolve 0.282 g chloramine-T in 4 mL deionized H2O
- Add 6 mL methyl-cellosolve (2-methoxyethanol) and 10 mL of assay buffer
- Chloramine-T solution must be prepared fresh each time
3.15 N perchloric acid
- In a fume hood, dilute 4.6 mL of 70% perchloric acid in 14.6 mL deionized H2O
- Store in a glass container at room temperature
Ehrlich’s Reagent
- Dissolve 4 g of Ehrlich’s reagent ((p-Dimethylaminobenzaldehyde) in 20 mL of methyl-
cellosolve
- Dilution is facilitated by heating the mixture to no greater than 60C
- Ehrlich’s reagent must be prepared fresh each time
Equipment:
96 well microplate
Plate reader (for absorbance measurement)
Procedures:
I. Papain digestion
1. Pre-heat the waterbath to 65C
2. Dilute papain stock solution to desire concentration with papain digestion buffer. For in
vitro cell cultures, a concentration of 40 g/mL is recommended. For in vivo samples, a
concentration of 80 g/mL is recommended.
3. Add 600 L papain digestion solution to each sample and transfer to eppendorf tubes
4. Wrap each tube with paraffin and a plastic microtube cover
5. Digest the samples at 65oC for 48 hours
6. Store the samples at –20oC until ready for hydroxyproline assay
146
II. Acid hydrolysis of samples
7. Pre-heat the test tube heater to 100oC
8. Transfer 100 L of papain digested sample into a Pyrex glass tube with a Teflon lined
screw cap
9. Add an equal amount of 6N HCl (e.g. add 100 L of sample with 100 L 6N HCl)
10. Incubate the samples in the test tube holder at 110oC for 18 hours
11. Neutralize the hydroxylate by adding the same amount of NaOH (e.g. 100 L 5.7N
NaOH required for 100 L sample)
12. Make a 1/60 dilution of the hydroxylate by bringing up the volume to 6 mL with
deionized H2O. (e.g. add 5700 L for 100 L of sample)
13. Aliquot 600 L of hydroxylate into three separate eppendorf tubes
III. Preparation of L-hydroxyproline standards
14. Prepare hydroxyproline stock solution by dissolving L-hydroxyproline standard to a final
concentration of 100 g/mL in 0.001N HCl. Store in aliquot of 200 L each at –70oC.
15. Prepare a fresh set of OH-Pro standards by diluting the 100 g/mL hydroxyproline stock
solution in distilled water. Keep the standards on ice.
Serial Dilution for Hydroxyproline Standard Initial Volume 2400
Concentrations Volume Aliquot Less Aliquot Mass Add Volume
[g/mL] [L] [L] [L] [g] [L]
5 2400 600 1800 9 450 4 2250 600 1650 6.6 550 3 2200 600 1600 4.8 800 2 2400 600 1800 3.6 1800 1 3600 600 3000 3 3000 0.5 6000 600 5400 2.7 Concentration of Standard 100 [g/mL] Volume of Standard 120 [L] Volume of Distilled Water 2280 [L]
147
IV. Colour development for microplate protocol
16. For each tube (samples and standards), in the same order, add the following:
- 300 L 0.05 N chloramine-T (mix and let stand for 20 minutes)
- 300 L 3.15 N perchloric acid (mix and let stand for 5 minutes)
- 300 L Ehrlich’s Reagent (mix and heat at 60C for 20 minutes)
17. Cool tubes in cold tap water for 5 minutes
18. Load 200 L of standards ad samples into a 96 well microplate
19. Measure the absorbance at 560 nm using a plate reader
V. Determination of hydroxyproline content
20. Determine concentration of sample from standard curve and multiply by the dilution
factor (i.e. 6000 L/ volume of aliquot in L)
A.4. Valvular Interstitial Cell Isolation
Purpose: To isolation pure population of valve interstitial cells from pig aortic valves.
Reagents:
1% Penicillin/Streptomycin (P/S) mixture (Sigma P4333) 0.1mg/ml Amphotericin B (Sigma A9528) Sterile and non-sterile phosphate buffered saline (PBS) with calcium chloride and
magnesium chloride (Sigma P5655) 0.125% trypsin with EDTA (Sigma T4049) TESCA buffer (50mM TES (Sigma T5691), 0.36mM Calcium chloride (Sigma C5670), pH
7.4 at 37oC) 150 units/ml of collagenase (Sigma TC0130) Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma D7777) Fetal Bovine Serum (FBS, HyClone FSSP9749370, lot # KRA25425) Trypan blue solution (Sigma T8154) Equipment:
Large and small dissection scissors Large and small tweezers Scalpel Biohazard waste bags
148
Dissection tray
40 m and 70 m cell strainers
Cell scrapers Sterile petri dishes 15mL centrifuge tubes 50mL centrifuge tubes Hemocytometer or ViCell cell viability analyzer Procedure:
Step 1-3 can be done outside the hood
1. Store pig hearts in non-sterile PBS with Ca2+/Mg2+ until ready for dissection
2. Cut heart in half
3. Use large dissection scissors to cut open aorta until all three leaflets are visible
4. Use small scissors and tweezers to remove individual leaflets and then rinse the leaflets
with PBS with Ca2+/Mg2+ and 1% P/S and 0.1mg/ml Amphotericin B
Step 4 and up must be done in the cell culture hood
5. Rinse leaflets (2-3 times) with sterile PBS with Ca2+/Mg2+ and 1% P/S and 0.1mg/ml
Amphotericin B, hold leaflets in last wash
6. To remove endothelial cells (ECs):
a. Place 3 leaflets per 5mL of 150 units/mL collagenase solution reconstituted in
TESCA buffer
b. Incubate for 20 minutes at 37oC, 5% CO2
c. Transfer leaflets to a new tube containing 0.125% trypsin and incubate for 7
minutes at 37oC, 5% CO2
7. Vortex at maximum speed for 1 minute
8. Place leaflets in a petri dish and scrape leaflet surfaces using a cell scraper
9. In another clean petri dish, rinse (2-3 times) away loose ECs with sterile PBS with
Ca2+/Mg2+ and 1% P/S and 0.1mg/ml Amphotericin B
10. In another clean petri dish, soak leaflets in 0.125% trypsin for 1-2 minutes
11. Transfer three leaflets at a time into a new petri dish and mince into small pieces with
scissors
12. Transfer leaflets pieces to 5ml of 150 units/mL collagenase solution reconstituted in PBS
with Ca2+/Mg2+
149
13. Incubate for 2 hours at 37oC, 5% CO2
14. Vortex at maximum speed for 1 minute
15. Strain tissue using 70 m cell strainers (1 strainer/3 leaflets)
16. Rinse filter once with equal volume (i.e. 5mL) of DMEM
17. Centrifuge cell to pellet (Speed: 1150 rpm, 7 minutes)
18. Resuspend in supplemented DMEM (DMEM + 10% FBS + 1% P/S)
19. Count viable and dead cells with hemocytometer or with Vi-Cell cell viability analyzer
20. Seed cells with the desire cell density
21. Two hours after plating, check cells to see if adherent
22. Remove medium and dead cells by replacing the media with fresh supplemented DMEM
the following day
A.5. Cryopresevation of VICs Purpose: To store viable animal cells long-term.
Regents:
Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma D7777)
Sterile PBS without calcium chloride and magnesium chloride (Sigma P5655)
0.125% trypsin with EDTA (Sigma T4049)
Cryoprotective medium (90% supplemented DMEM and 10% of dimethyl sulfoxide
(DMSO, Sigma D2650))
Trypan blue solution (Sigma T8154)
Equipment:
15mL centrifuge tubes
2mL cryogenic vials
Hemocytometer or ViCell cell viability analyzer
Procedure:
Prior to freezing, the cells should be maintained in an actively growing state to ensure maximum
health and a good recovery. Using a microscope, quickly check the general appearance of the
culture. Also check culture with unaided eye to look for contaminants (bacteria, small fungal
colonies that may be floating at the medium-air interface).
1. Pre-label the estimated number of cryogenic vials required (assuming 1-2 x 106 cells/vial)
with the following information:
150
a. Name of the cell type
b. Passage number
c. Date
d. Cell density
e. Your name
2. Harvest cells by trypsinization and count total cell number using a hemocytometer or Vi-
Cell cell viability analyzer
3. Remove the supernatant from the centrifuged cells and resuspend the cell pellet with
sufficient cryoprotective medium to give a final cell concentration of 1-2 x 106 cells/vial.
4. Place the vials in a controlled rate of freezing container overnight in the –80oC freezer.
5. The next day, transfer the vials to a liquid nitrogen freezer for permanent storage.
A.6. Releasing Cells from Collagen Matrices
Purpose: To release the cells cultured on the surface of collagen matrices for nucleic acid
extraction, proliferation assay or protein extraction
Reagents:
Collagenase (Sigma C0130)
TESCA buffer (TESCA buffer (50mM TES (Sigma T5691), 0.36mM Calcium chloride
(Sigma C5670), pH 7.4 at 37oC)
Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
Equipment:
4 oC Centrifuge
Procedures:
1. Prepare 500 units/mL of collagenase with TESCA buffer, protect away from light
a. For 24 well plate, each well will require 1 mL of collagenase mixture
2. Remove cell culture media
3. Rinse samples (2-3 times) with sterile PBS with Ca2+/Mg2+
4. Incubate samples with 500 units/mL of collagenase at 37oC:
a. Thick/compliant matrices – incubate for 1.5 hours, pipette the matrices up and
down every 15-20 minutes to facilitate the digestion
b. Thin/stiff matrices – incubate for 20 minutes
151
5. Once incubation is completed (i.e. collagen matrices should be digested and become a
liquid), transfer the digested mixtures (i.e. degraded collagen, collagenase solution and
cell suspension) to eppendorf tubes
6. Pellet cells by centrifugation at 4oC, 900 x g for 15 minutes
7. Remove supernatant
8. Resuspend cell pellets with sterile PBS with Ca2+ /Mg2+ or RNase/ DNase PBS if
samples are used for RNA extraction
9. Centrifuge at 4 oC, 900 x g for 10 minutes
10. Remove supernatant
11. Store cell pellets at –80oC or proceed to assay
A.7. Cellular Proliferation Assay (Modified from manufacturer protocol “CyQuant® NF Cell Proliferation Assay kit”, Invitrogen.)
Purpose: To determine the extent of proliferation based on measurement of cellular DNA
content via fluorescent dye binding.
Reagents:
CyQuant® NF cell proliferation assay kit (Invitrogen C35006)
Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
RNAse/DNase free deionized water
Equipment:
4 oC Centrifuge
FLUOstar OPTIMA fluorescence plate reader
Procedures:
1. After releasing cells from collagen matrices using collagenase (See protocol A.6).
Sediment cells by centrifugation (300 x g for 10 minutes) and wash cell pellets with
sterile PBS
2. Primary VICs of known cell numbers (100-20000 cells/tube) can be used to generate
standard curve
3. Prepare 11 mL of 1x HBSS buffer by diluting 2.2 mL of 5x HBSS buffer (Component C)
with 8.8 mL of RNAse/DNase free deionized water
4. Prepare 2x dye binding solution by adding 22 L of CyQuant® NF dye reagent
(Component A)
152
5. Resuspend cell pellets in 1x HBSS buffer and dispense 50 L aliquots of suspension
containing 100-10000 cells into microplate wells
6. Dispense 50 L of 2X dye binding solution into each microplate well
7. Cover the microplate with tin foil and incubate at 37 oC for 60 minutes
8. Measure the fluorescence intensity of each sample using a fluorescence microplate reader
with excitation at ~485 nm and emission detection at ~530 nm with in 2 hours after
incubation
A.8. Cell Viability Assay (Modified from manufacturer protocol “LIVE/ DEAD ® Viability/Cytotoxicity Kit for
mammalian cells”, Invitrogen.)
Purpose: To determine live and dead cells with two fluorescence probes that recognize
intracellular esterase activity and plasma membrane integrity.
Reagents:
LIVE/ DEAD ® Viability/Cytotoxicity Kit for mammalian cells (Invitrogen MP03224)
Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
Supplemented DMEM
Equipment:
Fluorescence microscope with excitation/emission wavelengths at 494/517nm and
528/617nm
Procedures:
1. Warm the dye reagent to room temperature
2. Wash adherent cells with sterile PBS to remove esterase accumulated in the serum
3. For controls, kill the cells using 4% formalin for 5-10 minutes
4. Dilute calcein AM and Ethidium Homodimer (EthD-1) to 4 M and 2 M,
respectively, with freshly made supplemented DMEM
5. Add 500 L of the diluted calcein AM and EthD-1 mixture to each well
6. Cover the culture plate with tin foil and incubate at 37 oC for 30 minutes
7. Immediate examine the staining under a fluorescence microscope. Live and dead cells
can be visualized with excitation/emission wavelengths at 494/517nm (i.e. Green) and
528/617nm (i.e. Red), respectively.
153
8. Samples can be mounted on clean microscope slides and sealed under a coverglass to
prevent evaporation for storage.
A.9. Alkaline Phosphatase Staining
Purpose: To determine alkaline phosphatase activity in culture, which is a marker for osteoblast
differentiation.
Reagents:
ALP harvest buffer:
- 10 mM Tris-HCl, pH 7.4 (Sigma T-3253 Trizma HCl, MW = 157.6)
- 0.2% NP40 or IgePal
- Mix the two chemicals in one tube/glass bottle. Store at 4 degree fridge.
ALP assay buffer:
- 2 mM PMSF (Sigma P7626 Phenylmethylsulfonyl fluoride)
Make a stock of 200mM PMSF with 100% EtOH. Store at 4 degree fridge. Add
PMSF to mixture (a+b) right before use to give a final concentration of 2mM PMSF.
(i.e. 1:100 dilution).
ALP assay buffer:
- 100 mM glycine (MW = 75.07). For 500 mL, add 3.754 g
- 1 mM MgCl2 (hexahydrate form, FW = 203.3). For 500 mL, add 0.1017g
- deionized water to 500 mL
Adjust pH to 10.5, store at 4°C
pNPP substrate:
- 50 mM pNPP (Sigma 4744 p-Nitrophenylphosphate disodium hexaH2O, FW=371.1)can be
found in -20 degree freezer with the ALP staining reagents. Add 0.4639g to 24.5mL
deionized water.
pNP standard (reaction product)
- stock solution is 10 mM pNP (Sigma 7660 p-Nitrophenol solution), can be found in 4
degree fridge
0.1N NaOH (reaction stop solution)
- If the stock solution is more concentrated than 0.1N, dilute with deionized water
154
Procedure:
1. Wash cells with cold PBS
2. Add:
- 250uL lysis buffer to cells for 6-well plate
- 120uL lysis buffer to cells for 12-well plate
- 50uL lysis buffer to cells for 24-well plate
3. Rocking wells to cover all cells
4. Incubate 15 minutes, then scrape and collect lysate in 1.5mL centrifuge tube
5. Vortex lysate for 30 seconds and keep ON ICE or store at -20 oC
6. Centrifuge for 10 minutes at 13,000 RPM
7. Transfer sample volume of supernatant to 2 new 1.5mL centrifuge tubes.
For VICs cultured in OS media,
- 45ul for the ALP activity assay
- 5uL for micro BCA assay
8. Prepare a control (blank) sample with the same volume of lysis buffer only
9. To samples and the blank, add ALP assay buffer to make a total volume of:
a. 400uL for 6 well plate samples
b. 200uL for 12 well plate samples
c. 100uL for 24 well plate samples
10. The next steps are TIMED, so leave 20 seconds between tubes to allow enough
time for the procedure
a. Add 50mM pNPP to a tube, vortex well to mix, and incubate in 37 oC
water bath for 10-60 minutes (this is a guideline only; monitor colour for
change to yellow)
- 100uL of pNPP for 6 well plate samples
- 50uL of pNPP for 12 well plate samples
- 25uL of pNPP for 24 well plate samples
b. Repeat step (a) for each tube, leaving 20 seconds between tubes
11.While waiting for reaction to complete, prepare pNP standard solutions
diluted in assay buffer
a. Standards of 0-500uM pNP
b Make 1 mL of 500uM pNP by mixing 50uL of 10 mM pNP, 450uL water, and
155
500 uL assay buffer
c. Make 1 mL of 250 mM pNP by 1:2 dilution of 500 uM pNP solution with assay buffer
(i.e., 500 uL of 500 uM pNP + 500 uL assay buffer)
d. Continue to make serial dilutions of 125, 62.5, 31.25, 15.625, and 0 uM pNP.
12. To stop the reaction, add 0.1N NaOH (500ul for 6 well plate samples, 250ul
for 12 well plate samples, 125ul for 24 well plate) to the first tube
incubated and vortex. Repeat for each tube, leaving 20 seconds between tubes
so that all incubation times are equal. Also add 500uL 0.1N NaOH to each of
the standards.
14. Read the absorbance at 405nm with a spectrophotometer or microplate reader.
15. Activity is expressed in units of mol pNP per minute. Remember to take into
account the dilution factor.
A.10. Indirect Immunostaining Protocol
Purpose: To visualize the expression of protein being investigated
Reagents:
Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
10% Neutral Buffered Formalin (NBF)
- 100 mL formaldehyde (Sigma F1635)
- 900 mL distilled water
- 4g sodium phosphate monobasic (Sigma S8282)
- 6.5g sodium phosphate dibasic anhydrous (Sigma S0876)
0.1% Triton X-100 (Sigma T8532, diluted with deionized H2O)
3% Bovine serum albumin (BSA, Sigma A9647, reconstituted in PBS)
Antibody for the protein of interest (Primary antibody)
Fluorescent conjugated secondary antibody (e.g. if host of primary antibody is mouse, use
anti-mouse secondary antibody)
10% Serum from host of secondary antibody (diluted with PBS)
Permafluor anti-fade mounting medium
10 ug/mL Hoechst nuclear stain (Invitrogen H3570, diluted with 10% serum)
156
Equipment:
Coverglass
Humidification chamber (i.e. Gladware container lined with wet paper towels)
Fluorescence microscope
Procedures:
I. Fixation and permeabilization
1. Remove media
2. Rinse samples (2-3 times) with PBS
3. Fix samples with 10% NBF for 15-30 minutes (depending on the porosity of the samples)
at room temperature
4. Remove fixative and rinse twice with PBS for 5 minutes each
5. Permeabilize with 0.1% Triton X-100 for 5 minutes
6. Rinse twce with PBS for 5 minutes
7. Fixed and permeabilized cells can be stored in PBS at 4oC if necessary
II. Primary antibody staining
8. Block with 3% BSA for 20 minutes at 37oC
9. Dilute primary antibody with 3% BSA to working concentration
10. Remove blocking solution and apply primary antibody. Do the following if:
a. Cytospin samples - Use wax pen to mark circle around cell splatter and then apply
sufficient reagent to cover the cells
b. Culture on coverglass – Pipet a droplet of antibody on a clean paraffin surface (50
L for a 12mm coverglass). Place the coverglass with cells facing down, onto the
antibody droplet.
c. Collagen matrice samples – Stain directly in the wells. Do not remove the
constrained matrices from the wells.
11. Incubate 60 minutes at 37 oC or overnight at 4 oC.
III. Secondary antibody staining
12. Wash slides twice with PBS for 10 minutes
13. Make 10% serum/PBS using serum from host of secondary antibody
14. Dilute secondary antibody in 10% serum to working concentration
157
15. Block slides with 10% serum for 30 minutes at room temperature
16. Apply secondary antibody to slides for one hour at room temperature in humidification
chamber
17. Rinse with PBS for 5 minutes
18. Incubate with Hoechst diluted 1:1000 in PBS for 5 minutes to stain nuclei
19. Rinse with PBS for 5 minutes
20. Briefly rinse with distilled water to remove salts from PBS
21. Apply Permaflour mounting medium and mount coverslips with nail polish*
* Note: for collagen matrices, carefully remove the matrices from the wells. Pipet a droplet
of Permaflour mounting medium onto a microscope slide and then place the surface with
cells onto the mounting medium. Do not mount with coverslips.
Primary antibody Secondary antibody Antibody Dilution
factor Incubation
time Antibody Dilution
factor Incubation time
-SMA 1:100 1 hour @ 37oC or overnight @ 4oC
Anti-mouse
1:100 1 hour @ RT
Fluorescent-conjugated Phalloidin
1:100 1 hour @ 37oC or overnight @ 4oC
na na na
CNP 1:10 3 hour @ room temperature
Anti-goat 1:100 1 hour @ room temperature
Cbfa1/Runx2 1:100 3 hour @ room temperature
Anti-rabbit
1:100 1 hour @ room temperature
A.11. Western Blot Purpose: To quantify the expression of a protein of interest
Reagents:
Cold Sterile PBS with calcium chloride and magnesium chloride (Sigma P5655)
10x lysis buffer
100 mM Phenylmethanesulfonyl fluoride (Sigma P7626, reconstituted in 100% ethanol)
Micro BCA Protein Assay Reagent (Pierce 23235)
30% acrylamide and bis-crylamide(acry/bis)
Resolving gel buffer (1.5 M Tris-base)
158
- 18.15 g Tris-base (Sigma 77-86-1)
- 60 mL Deionized H2O
- Adjust pH with 6 N HCl to pH 8.8
- Bring volume to 100mL and store at 4oC
Stacking gel buffer
- 6 g Tris-base (Sigma 77-86-1)
- 60 mL Deionized H2O
- Adjust pH with 6 N HCl to pH 6.8
- Bring volume to 100mL and store at 4oC
0.5% (wt/vol) and 10% (wt/vol) sodium dodecyl sulfate (SDS, Sigma L3771, reconstituted in
deionized H2O)
10% APS
TEMED (Sigma
10x running buffer
- 30.3 g Tris-base (Sigma 77-86-1)
- 144 g Glycine (Sigma G8898)
- Bring to 1 litre with deionized H2O, store at 4oC
1M Tris-base
- 12 g Tris-base (Sigma 77-86-1)
- Adjust pH with 6 N HCl to pH 6.8
- Bring volume to 100 mL with deionized H2O, store at 4oC
5x Laemmli loading dye
- 1 M Tris-base
- 10 g SDS (Sigma L3771)
- 50 mL Glycerol
- 250 mg Bromophenol blue
- 20 mL -mercaptoethanol (Sigma M3148)
- Store in glass bottle at room temperature
Protein ladder (Fermentas SM0671)
Methanol (Sigma 179957)
Protein transfer buffer (** must be made one day in advance)
- 11.64 g Tris-base
159
- 5.86 g Glycine
- 20% Methanol
- 7.5 mL 10% SDS
- Bring the volume to 1 litre with deionized H2O and store at 4 oC
10x TBS
- Tris-base
- NaCl
- Bring the volume to 1 litre with deionized H2O and store at 4 oC
1% Bovine serum albumin (BSA Sigma A9647, reconstituted in 1x TBST buffer)
Amersham ECL Plus™ chemilumiscece western blotting detection reagent
Equipment:
Pre-chilled cell scrapers
Pre-chilled eppendorf tubes
96 well plate
Filter papers
Polyvinylidene fluoride (PVDF) transfer membranes (BioRad 1620177)
SNAP i.d.TM protein detection system
Western blotting film
Procedures:
I. Protein extraction
1. Prepare fresh 1x lysis buffer for each protein extraction. For 1 mL of 1x lysis buffer,
combine:
a. 100 L 10x lysis buffer
b. 10 L 100 mM PMSF
c. 890 L deionized H2O
2. Place culture on ice
3. Remove media
4. Rinse (2-3 times) with cold PBS
5. Add 1x lysis buffer
a. For 24 well plate, add 30 L per well
b. For 12 well plate, add 100 L per well
c. For 6 well plate, add 200 L per well
160
6. Remove cells from culture by using a pre-chilled cell scrape. Rinse cell scrape with cold
PBS between samples.
7. Transfer lysate to a pre-chilled eppendorf tubes
8. Incubate on ice and place on a shaker set at maximum speed for 30 minutes
9. Vortex the samples every 5 minutes
II. Quantification of protein concentration
10. Prepare diluted BSA albumin standards
Vial Volume of diluent Volume and source of BSA Final BSA concentration
A 450 L 50 L of stock (2 mg/mL) 200 g/mL
B 400 L 100 L of vial A dilution 40 g/mL
C 250 L 250 L of vial B dilution 20 g/mL
D 250 L 250 L of vial C dilution 10 g/mL
E 250 L 250 L of vial D dilution 5 g/mL
F 250 L 250 L of vial E dilution 2.5 g/mL
G 300 L 200 L of vial F dilution 1 g/mL
H 250 L 250 L of vial G dilution 0.5 g/mL
I 500 L -- 0 g/mL
11. Prepare BCA working reagent by mixing 25 parts of micro BCA reagent MA, 24 parts
Reagent MB with 1 part of Reagent MC (25:24:1, Reagent MA:MB:MC)
12. Pipette 50 L of each standard or unknown sample into a microplate well
13. Add 50 L of working reagent to each well and mix plate thoroughly on a plate shaker
for 30 seconds
14. Incubate at 37oC for 2 hours
15. Cool plate to room temperature
16. Measure the absorbance at or near 562 nm on a plate reader
17. Subtract the average 562 nm absorbance reading of the Blank standard replicates from
the 562 nm reading of all other individual standard and unknown sample replicates
18. Prepare a standard curve by plotting the average Blank-corrected 562 nm reading for
each BSA standard versus its concentration in g/mL. Use the standard curve to
161
determine the protein concentration of each unknown sample. The linear working range
is 2-40 g/mL.
III. Protein electrophoresis
19. Cast 10% resolving gel by combining the reagents in the following order:
a. 7.9 mL deionized H2O
b. 6.7 mL 30% acryl/bis
c. 5 mL resolving gel buffer
d. 200 L 10% SDS
e. 200 L of 10% APS
f. 8 L TEMED
g. Mix gently on ice and immediately pour into the gel cassette. Fill the gel cassette
up to 1 cm under the comb.
h. Overlay the gel with 0.5% SDS
i. Allow the gel to polymerize for 45-60 minutes
j. Rinse the gel completely with deionized H2O to remove SDS
k. Remove excess water with filter paper
20. Cast 5% stacking gel by combining:
a. 76.8 mL deionized H2O
b. 1.7 mL 30% acryl/bis
c. 1.25 mL stacking gel buffer
d. 100 L 10% SDS
e. 100 L of 10% APS
f. 10 L TEMED
g. Mix gently on ice and immediately pour on top of the polymerized resolving gel
h. Place gel comb into the cassette
i. Overlay the gel with 0.5% SDS
l. Allow the gel to polymerize for 45-60 minutes
m. Rinse the gel completely with deionized H2O to remove SDS
n. Wrap the gel with plastic wrap and then store in humidifying chamber at 4oC or
proceed to protein electrophoresis
21. Prepare 1x running buffer by combining:
162
a. 100 mL 10x running buffer
b. 10 mL 10% SDS
c. 890 mL Deionized H2O
d. Warm buffer to room temperature
22. Boil a beaker of water to 95%
23. Dilute samples to the desire concentration with 1x lysis buffer and 5x loading dye. Keep
samples on ice at all time. (e.g. For 60 g/ 40 L in a lane, combine X L of sample, 8
L of 5x loading dye and 40 L - 8 L - X L of 1x lysis buffer)
24. Pipette up and down to mix
25. Boil diluted samples at 95 oC for 5 minutes
26. Cool to room temperature and spin down the samples with a bench top centrifuge
27. Load the samples to the gel (i.e. 40 l per lane for a 1.5 mm gel)
28. Load 10 l of ladder to the gel
29. Run gel with running buffer for 1.5 hour at 170 V and 0.04 A
IV. Protein transfer to membrane
30. Prepare filter pads, filter papers and membrane for protein transfer
a. Filter pads:
i. Rinse with warm tap H2O
ii. Soak in distilled H2O for 5 minutes
iii. Soak in deionized H2O for 5 minutes
iv. Soak in cold transfer buffer for at least 30 minutes
b. Filter papers
i. Soak in distilled H2O for 5 minutes
ii. Soak in deionized H2O for 5 minutes
iii. Soak in cold transfer buffer for at least 30 minutes
c. PDVF membranes (*do not touch the membrane with gloves, use tweezers)
i. Soak in distilled H2O for 5 minutes
ii. Soak in deionized H2O for 5 minutes
iii. Soak in cold transfer buffer for at least 30 minutes
31. Assemble the transfer tank on ice with stir bar according the following diagram
32. Run transfer tank at 100 V, 0.35 A for 1hour and 5 minutes
163
33. In the mean while, prepare 1x TBST by combing:
a. 1 mL Tween 20
b. 100 mL 10x TBS buffer
c. Bring the volume to 1 litre with deionized H2O, store at 4oC
34. Upon completion of protein transfer, rinse membrane twice with 1x TBST
35. Membranes can be wrapped with plastic wrap and store at –20oC or proceed to
immunoblot
Figure A.1. Assembly of the protein transfer tank
V. Immunoblot
36. Rinse membrane twice with 1x TBST
37. Prepare the SNAP i.d.TM protein detection system accordingly to user’s manual
38. Prepare 1% (wt/vol) BSA with 1x TBST (i.e. the blocking agent, ~ 50 mL per membrane)
39. Dilute primary antibody with 1% BSA and store on ice (see dilution chart for details, ~3
mL per membrane)
40. Dilute secondary antibody with 1% BSA and store on ice (see dilution chart for details,
~3mL per membrane)
41. Place membranes onto SNAP i.d.TM protein detection system
42. Block membranes with 1% BSA for 20-30s
43. Add 3 mL of diluted primary antibody to each membrane and incubate for 10 minutes at
room temperature. At this point, prepare the developing machine (i.e. ensure there is
sufficient developer, fixer, water and turn on the machine) and warm the
chemiluminescence reagents to room temperature.
164
44. Wash membranes (3-5 times) with approximately 30 mL of 1x TBST. Turn on the
vacuum pump for 20-30 seconds in-between each wash to remove the reagents.
45. Add 3 mL of diluted secondary antibody to each membrane and incubate for 10 minutes
at room temperature
46. Wash membranes (3-5 times) with approximately 30 mL of 1x TBST. Turn on the
vacuum pump for 20-30 seconds in-between each wash to remove the reagents.
47. Remove the membranes to plastic tray and keep membranes in 1x TBST
VI. Chemiluminescence detection (* must be done in the dark)
48. For each membrane, mix 4 mL of Amersham ECL Plus™ Reagent A with 100 L of
Reagent B in the dark. Store the detection mixture in a tube wrapped with tin foil.
49. In the dark room, prepare three pieces of clean plastic wrap
50. Place membrane onto a clean plastic wrap
51. Pour 4 mL of detection mixture onto each membrane
52. Incubate for 1-5 minutes
53. Remove membrane with tweezers and remove excess detection reagents by tapping the
edge of the membrane on a paper towel
54. Place the membranes onto another clean plastic wrap
55. Wrap the membrane with the plastic wrap and fold the edges to prevent the membrane
from drying up
56. Place the wrapped membrane onto a cassette
57. Carefully place a piece of film on top. Expose the film what an appropriate length of
time.
58. Develop the film immediate
59. Repeat the procedure for optimal exposure time
60. Rinse (2-3 times) membranes with 1x TBST, wrap with plastic wrap and store at –80oC
(* membranes can be used again in the future with proper handling and storage)
VII. Image analysis
61. Scan the developed film
62. Load the image into Image J
63. Select “analyze” function
165
64. Select “gel” function
65. Set the location of each lane
66. Select “plot lanes”
67. Measure area of each lane by using the “wand” tool
68. Do the same with the housekeeping protein
69. Normalize protein expression with the housekeeping protein expression level
VIII. Antibody dilution chart
Primary antibody Secondary antibody
Name and supplier Dilution factor
Expected product size
(kDa)
Name and supplier
Dilution factor
GAPDH (Stressgen CSA-335E)
1:3000
36 HRP anti-mouse 1:3000
Akt (Cell signal #9272)
1:1000 60 HRP anti-rabbit 1:3000
Phosphorylated Akt (Cell signal #9271)
1:1000 60 HRP anti-rabbit 1:3000
P38 (Cell signal #9212)
1:1000 43 HRP anti-rabbit 1:3000
Phosphorylated P38 (Cell signal #9211)
1:1000 43 HRP anti-rabbit 1:3000
-SMA (Sigma A2547)
1:10000 42 HRP anti-mouse 1:3000
166
A.12. Primer Sequences for PCR and qRT-PCR
Gene name and accession
number
Primer sequence Annealing temperature
( oC)
Product size (bp)
NPR-B DQ487044.1
Left primer: 5’-agcattaccgtaccctggtg-3’ Right primer: 5’-tagtgaggccggtcatcatgt-3’
60 142
CNP, M64758.1
Left primer: 5’-accgactccagca-3’ Right primer: 5’-ataaagtggccag-3’
60 103
Osteonectin, AW436132
Left primer: 5’-tccggatctttcctttgctttcta-3’ Right primer: 5’-ccttcacatcgtggcaagagtttg-3’
60 187
Osteocalcin, AW346755
Left primer: 5’-tcaaccccgactgcgacgag-3’ Right primer 5’-ttggagcagctgggatgatgg-3’
60 106
GAPDH, AF017079
Left primer: 5’-tgtaccaccaactgcttggc-3’ Right primer 5’-ggcatggactgtggtcatgag-3’
60 86
TGF-1 receptor I, AB182260.1
Left primer: 5’-gacggcattccagtgtttct-3’ Right primer: 5’-tgcacatacaaatggcctgt-3’
60 169
TGF-1 receptor II, EF396957.1
Left primer: 5’-cagggaagaacgttcatggt-3’ Right primer 5’-ccaaccaaagctgagtccat-3’
60 128
167
Appendix B B. Preliminary Data
B.1. The Effect of Statins on the Expression of CNP by VICs Objective: Statins are lipoprotein-lowering agents and are potential therapeutics for CAVD.
Intriguingly, statins display similar effects as CNP on the differentiation of VICs, inhibiting
myofibroblast120, 233 and osteoblast differentiation of VICs in vitro92. This prompts the question
of whether there exists a possible molecular association between CNP and statins, leading to
similar biological effects on VICs. We therefore evaluated the expression of CNP in VICs
treated with or without simvastatin as a means to provide a mechanistic explanation of statin-
mediated protective effects on VICs.
Methods: The effect of statin treatment on CNP expression by VICs was evaluated. Simvastatin
was activated prior to use by alkaline hydrolysis with NaOH and ethanol273. Cells were cultured
in complete media or calcifying media with (1 M) or without activated simvastatin for up to 14
days. Morphological changes were evaluated with bright field microscopy. RNA was extracted
after three days of treatment and qRT-PCR was performed with primers for CNP (Accession
number: M64768, forward primer: 5’-accgactccagca-3’ and reverse primer: 5’-ataaagtggccag-3’).
Transcriptional expression was quantified by the comparative Ct method as previously described.
Results: A three-day treatment with simvastatin significantly upregulated CNP transcript
expression in cells cultured in complete media (Figure B.1). Statin treatment had no detectable
effect on CNP transcript expression in cells cultured on calcifying media (Figure B.1), despite its
ability to inhibit aggregate formation after 14 days in culture (Figure B.2: A, B and D).
168
Figure B.1. Expression of CNP transcript after three days of simvastatin treatment
A relative gene expression level of less than one indicates lower exprssion with simvastatin
treatment relative to that without treatment. * P < 0.05.
Discussion: Similar to CNP, statins have recently been shown to suppress aggregate formation
that is associated with myofibroblast or osteoblast differentiation of VICs in vitro. We found that
expression of CNP by VICs cultured in calcifying media was not augmented by simvastatin,
despite the observed inhibition of calcific aggregate formation with simvastatin treatment. These
data suggest that statins might regulate osteogenic differentiation of VICs via a signaling
pathway independent of CNP. Statins could interfere with other signaling pathways that regulate
osteogenic differentiation of VICs. For instance, statins promote the breakdown of extracellular
ATP to adenosine and trigger signaling via the P1 purinergic receptor, which leads to the
inhibition of osteogenic differentiation of VICs in vitro73. In contrast, we identified an
upregulation of CNP expression by simvastatin, when VICs were cultured in conditions that
favoured myofibroblast differentiation. Although this result is intriguing, additional investigation
is necessary to further identify if CNP signaling mediates, in part, the anti-myofibrogenic effect
of statins. Whether CNP signaling pathway interacts with the HMG-CoA reductase pathway has
yet to be investigated, but statins have been shown to decrease aggregate formation associated
with myofibroblasts independent of the HMG-CoA reductase pathway120. While little is known
regarding the regulation of CNP production by VICs, CNP expression by endothelial cells has
been studied extensively274. It has been shown that oxidized LDL and its extracted lipids reduce
secretion of CNP by cultured vascular endothelial cells. Various in vitro studies suggest that
CNP could act to suppress the atherogenic activity of both oxidized LDL and the bioactive
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Complete media Osteogenic media
Re
lativ
e fo
ld e
xpre
ssio
n(T
rea
ted
/un
tre
ate
d)
Re
lati
ve C
NP
exp
ress
ion
(A
U)
*
Complete media Calcifying media
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Complete media Osteogenic media
Re
lativ
e fo
ld e
xpre
ssio
n(T
rea
ted
/un
tre
ate
d)
Re
lati
ve C
NP
exp
ress
ion
(A
U)
*
Complete media Calcifying media
Re
lati
ve C
NP
exp
ress
ion
(A
U)
*
Complete media Calcifying media
169
lysophospholipids275, 276. Lipophilic signaling molecules known to be associated with high-
density lipoprotein (HDL) such as sphingosine-1-phosphate have also been showed to suppress
CNP/NPR-B signaling277. Data from these studies suggest a close relation between lipoproteins
and CNP signaling, which should be investigated in the future in order to improve our
fundamental understanding of CNP and its involvement in valve cell biology.
B.2. Culturing Primary VICs on Polyacrylamide Substrates
Objective: An alternative cell culture system that can be fine-tuned to a wider range of stiffness
was implemented for culturing of VICs. Previously, we found poor adhesion of primary VICs to
polyacrylamide (PA) substrates coated with monomeric collagen. It is evident that VICs adhere
well on fibrillar type I collagen matrices, and therefore we tested if coating PA substrates with
thin fibrillar type I collagen matrices could improve the adhesivness of primary VICs to the PA
substrates.
Method: The process to fabricate the PA gels was described in the study by
Khatiwala et al132. Briefly, stock solutions of 40% acrylamide and 2% bis-acrylamide (Bio-Rad
Laboratories) were used. Different volumes of acrylamide and bis-acrylamide were mixed with
sterile de-ionized water and 10 M HEPES (pH 7.5). The ratio of acrylamide and bis-acrylamide
determines the stiffness of PA gels. Next, photoinitiator (10% ammonium persulfate; Bio-Rad
Laboratories) and radical stabilizer TEMED (Bio-Rad Laboratories) were added at 1/200 volume
and 1/2000 volume respectively. Immediately, the solution was syringe filtered using a 0.22 μm
filter. The mixture was pipetted onto an adhesive film and then covered with a surfasil-treated
top coverslip. The gels were polymerized in sterile biosafety cabinet for 10-15 minuties. Once
polymerized, the top cover slips were removed and the gels were surface functionalized with N-
sulfosucciniidyl-6-(4’-azido-2’-nitrophenylamino) hexanoate (sulfo-SANPAH; Pierce
Biotechnology), a UV-light sensitive heterobifunctional crosslinker. The photoinitiator was
activated through exposure to UV light (Blak-Ray; UVP) at 365 nm for 12 min. Once activated,
the gels were rinsed with PBS and then thin fibrillar type I collagen was placed on the surface of
the gels.
170
Figure B.2. Inhibition of aggregate formation by simavastatin treatment
(A and C) Few aggregates were formed in culture with statin treatment by day 9 and 14. (B and
D) In the absence of simvastatin, aggregates formed readily by day 9 and seemed to increase in
size by day 14. (E) Statin treatment significantly reduced aggregate formation by VICs cultured
in calcifying media in comparison to those of untreated samples. * P < 0.05.
020406080
100120140
Day 9 Day 14Treatment duration
Nu
mb
er
of a
gg
reg
ate
s Without simavastatin With simvastatin
A. B.
C. D.
Da
y 9
Da
y 1
4
E.
**
020406080
100120140
Day 9 Day 14Treatment duration
Nu
mb
er
of a
gg
reg
ate
s Without simavastatin With simvastatin
A. B.
C. D.
Da
y 9
Da
y 1
4
E.
020406080
100120140
Day 9 Day 14Treatment duration
Nu
mb
er
of a
gg
reg
ate
s Without simavastatin With simvastatin
A. B.
C. D.
Da
y 9
Da
y 1
4
E.
**
171
Results: The adhesion of VICs to PA substrates coated with fibrillar type I collage was
significantly improved compared to those of coated with monomeric collagen. We found that the
morphology varied when cells were cultured on PA substrates with different stiffnesses. When
primary VICs were cultured in calcifying media on fibrillar type I collagen-coated PA substrates
of various stiffnesses (11 kPa, 22 kPa, 50 kPa and 144 kPa), calcification by VICs was most
prominent on substrates with stiffness of 22 kPa and 50 kPa (Figure B.3). Cells also formed
aggregates on PA substrate with stiffnesses of 11 kPa and 144 kPa, but those aggregates stained
weakly for ARS (Figure B.3).
Discussion: By lining PA gels of different stiffnesses with thin type I collagen matrices, primary
VICs were able to adhere to and proliferate on these culture surfaces. Importantly, cells were
able to response to the stiffness of the substrate underlying the thin collagen matrices. With this
approach, the surface chemistry is decoupled from substrate mechanics. The total amount of
collagen is the same on all PA gels. We further observed, quantitatively, calcification by VICs
was most prominent on substrates with stiffness of 22 kPa and 50 kPa. Cell aggregates found on
the more compliant gels (11 kPa) stained weakly for ARS. Engler et al has shown that bone
marrow-derived MSCs underwent osteogenic differentiation perferentially on substrates with
stiffness range of 25 – 40 kPa130. Further experiments should be performed to determine if VICs
respond to substrate stiffness in a similar manner as MSCs, in which calcification occurs via
osteogenic differentiation on substrates with stiffness of 22 kPa and 50 kPa. As described in
Chapter Five, compliant collagen matrices (E ~ 30 kPa) promote osteogenic-dependent
calcification by VICs, it is expected that VICs cultured on substrates with stiffness of 22 kPa and
50 kPa would also likely calcify via osteogenic differentiation. The preliminary data support the
use of PA gels to test the matrix stiffness effects on mediating the response of primary VICs.
This experimental technique will be directly applicable to the suggested future work desapcribed
in Chapter Eight.
172
Figure B.3. Calcification by primary VICs on PA substrates with different stiffnesses
ARS staining for calcium was more intense in aggregates found on substrates with stiffness of 22
kPa and 50 kPa.
B.3. Isolation of VICs from Mouse Aortic Valve
Objective: In vitro data showed that CNP protected against pathological differentiation of VICs
into myofibroblasts and osteoblasts. In vivo testing is necessary to determine the effectiveness of
CNP in protecting against CAVD and also to identify possible molecular mechanisms. One
possible in vivo model is to use genetically modified mice to evaluate the role of CNP signaling
components in regulating the progression of valve calcification. For example, long bone
abnormality (lbab-/-) mice can be used to study if the anti-calcific effect of CNP depends on the
activation of NPR-B. These mice have a single point mutation that converts an arginine to a
glycine in a conserved coding region of the CNP gene, reducing the ability of CNP to bind to
NPR-B278. In order to use mice as models of CAVD, it is important to first establish methods to
dissect aortic valves from mice. Further, it may be useful to isolate VICs from genetically
modified mice for furture molecular studies.
Methods: Aortic valves from 8-11 weeks old mice were dissected under a stereomicroscope.
Briefly, the heart was removed from the mouse and placed in sterile PBS (Figure B.4). The aorta
was cut open carefully and the aortic valve leaflets were removed and placed in sterile PBS. The
valve leaflets were paraffin embedded, sectioned and stained with Masson trichrome for the
evaluation of valve matrix organization and composition. Individual valve leaflets were placed
on collagen-coated TCPS, which preferentially leads to the explant of VICs, and cultured in
complete media.
173
Results: Mouse aortic valve leaflets were successfully dissected. Histological analysis showed
VICs permeate the valve matrix. Masson trichrome staining showed abundant collagen in the
ventricular side of the mouse AV (Green, Figure B.5: A). The explant method using collagen-
coated TCPS successfully isolated VICs from the mouse leaflets (Figure B.5: B). The explanted
cells stained positive for - SMA (Green, Figure B.5: C), consistent with the phenotype of VICs
from pigs and humans when cultured on a stiff substrate.
Figure B.4. Isolation of mouse aortic valve
The size of a mouse heart is approximately 10 mm in length. In order to dissect the aortic valve,
the aortic arch was first identified (labeled AA) and the aorta was cut open. The aortic valve
(labeled AV) can be found between the aorta and the left ventricle.
Discussion: It is possible to dissect individual aortic valve leaflets from mice and to isolate VICs
by using an explant method. It is, therefore, feasible to use mouse cells in vitro to study the
molecular mechanisms responsible for CNP signaling in CAVD.
174
Figure B.5. Mouse aortic valve and VICs
(A) Masson trichrome histochemical staining of a paraffin-embedded mouse aortic valve,
showing the transverse section of the leaflet. (B) Mouse aortic VICs were isolated by an explant
method on collagen-coated TCPS to enrich for VICs over VECs, which were previously shown
not to adhere well to type I collagen51. (C) On stiff TCPS, the mouse VICs express -SMA stress
fibres (green), consistent with the phenotype of VICs from pigs and humans.
A.
B. C.
A.
B. C.
A.
B. C.
Aortic side
Ventricular side