1

Parasitology Research – Supplementary material

Morphological and molecular characteristics of six Sarcocystis spp. from red deer (Cervus elaphus) in Spain, including Sarcocystis cervicanis and three new species

Bjørn Gjerde1, Mónica Luzón2, José María Alunda2, Concepción de la Fuente2 1 Norwegian University of Life Sciences, Faculty of Veterinary Medicine, Department of Food Safety and Infection Biology, P.O. Box 8146 Dep., 0033 Oslo, Norway 2 Complutense University of Madrid, Veterinary Faculty, Department of Animal Health, Avenida de Puerta de Hierro s/n, 28040 Madrid, Spain e-mail: Bjorn.Gjerde@nmbu.no; bkgjerde@hotmail.no

Table S1: Number of sarcocysts isolated from each of eight adult red deer from the Quintos de Mora park, Central Spain, grouped according to location in host and morphological type1 as seen in wet mounts under a light microscope. The numbers of sarcocysts molecularly identified at the cox1 gene from the four red deer included in this study (CeS1–CeS4) are given in parentheses

Location

Morph-

type

Red deer identification numbers (in molecular study)

C54 C100 C233 C57 (CeS1) C80 C28 (CeS2) C82 (CeS3) C85 (CeS4)

Diaphragm Type 1 0 0 0 13 (11) 0 n.e. n.e. n.e.

Type 2 0 0 0 1 (0) 0 n.e. n.e. n.e.

Type 3 2 0 2 29 (21) 0 n.e. n.e. n.e.

Oesophagus Type 1 0 3 0 6 (3) 0 n.e. n.e. n.e.

Type 2 0 6 0 5 (4) 0 n.e. n.e. n.e.

Type 3 0 0 1 11 (6) 1 n.e. n.e. n.e.

Heart Type 1 0 0 0 0 0 0 0 0

Type 2 0 0 0 0 0 0 0 0

Type 3 0 1 1 13 (3) 20 56 (21) 18 (14) 23 (20)

Total 2 10 4 78 (48) 21 56 (21) 18 (14) 23 (20)

n.e. = not examined 1 Morphological types were: Type 1: hair-like cyst wall protrusions; Type 2: sarcocysts with a fuzzy outline;

Type 3: sarcocyst surface smooth with no visible protrusions

2

Table S2 Taxa and GenBank accession numbers of the associated nucleotide sequences used in the phylogenetic analyses based on either the 18S rRNA gene or cox1. Sequences generated in the present study from Spanish red deer are in boldface

Species/taxon 18S rRNA gene cox1A

Sarcocystis alces EU282018; KF831273–KF831274 KC209578–KC209587, KF241309–KF241310, KF831244–KF831247 (16/10)

Sarcocystis alceslatrans EU282033; KF831275–KF831276 KC209588–KC209593, KF831248–KF831251 (10/8)

Sarcocystis arctica KF601301 KF601318–KF601325 (8/2)

Sarcocystis arieticanis L24382

Sarcocystis bovifelis KT901117 KC209690–KC209696; KT900961–KT900998 (45/21)

Sarcocystis bovini KT901139 KT900999–KT901022 (24/16)

Sarcocystis buffalonis KU247904 KU247868–KU247873 (6/2)

Sarcocystis cafferi KJ778011 KJ778020–KJ778022, KJ778025–KJ778028 (7/7)

Sarcocystis capracanis KU820983 KU820974, KU820977 (2/2)

Sarcocystis capreolicanis JN226117–JN226119; JN256129; KY01915–KY019029

KC209594–KC209596; KF241311; KY018938–KY018944 (11/7)

Sarcocystis cervicanis KY973333–KY973354 KY973289–KY973295 (52/7)

Sarcocystis cruzi KT901167 KC209597–KC209600; KT901078–KT901095 (22/15)

Sarcocystis entzerothi

(Sarcocystis cf. entzerothi)B

KX643334–KX643335;

(JN256125)B

KX643340–KX643343 (4/1)

Sarcocystis elongata GQ251011–GQ251013 KC209705–KC209711; KF241313–KF241329 (25/13)

Sarcocystis fusiformis KR186116 KR186081–KR186113; KU247886–KU247900 (48/17)

Sarcocystis gigantea KC209733 KC209601–KC209604 (4/1)

Sarcocystis gracilis FJ196261; KY019030–KY01931 KC209605–KC209614; KF241330–KF241341; KY018945–KY018968 (46/23)

Sarcocystis grueneri EF056010 KC209615–KC209624 (10/9)

Sarcocystis hardangeri EF056013–EF056014; EF467654; GQ250987 KC209625–KC209633 (9/5)

Sarcocystis heydorni KX0579996 KX057994–KX057995 (2/2)

Sarcocystis hircicanis KU820984 KU820975–KU820976 (2/2)

Sarcocystis hirsuta KT901156 KC209634; KT901023–KT901077 (56/10)

Sarcocystis hjorti EU282017; GQ250990; KF831294–KF831295; JN256124, JN256128; KY973332

KC209635–KC209643; KF241342–KF241354; KY973288 (23/11)

Sarcocystis hominis JX679470

Sarcocystis iberica KY973314–KY973323 KY973286

Sarcocystis levinei KU247914 KU247874–KU247885 (12/10)

Sarcocystis linearis KY019032–KY019055; KY973355–KY973372 KY018969–KY018987; KY973296–KY973312 (36/22)

Sarcocystis lutrae KM657769 KF601326–KF601327; KM657808–KM657809 (4/1)

Sarcocystis mehlhorni KT378042 KT378044–KT378045 (2/2)

Sarcocystis menglaensis KX610082–KX610083D KX610084–KX610085 (2/2)

Sarcocystis morae KY973373–KY973379 KY973313

Sarcocystis moulei L76473

Sarcocystis neurona U07812 (Contig from ESTs)F

Sarcocystis ovalis EU282019, EU282034, GQ250988–GQ250989; LC184602

KC209644–KC209655, KF241355–KF241382 (40/4)

3

Species/taxon 18S rRNA gene cox1A

Sarcocystis oviformis FJ196262, KC209745–KC209746; JN256130; KF880742

KC209656–KC209661 (6/2)

Sarcocystis pilosa KU753891–KU753898 KU753903–KU753910 (8/3)

Sarcocystis rangi EF056011; EF467655 KC209662–KC209670 (9/5)

Sarcocystis rangiferi GQ250977–GQ250979 KC209671–KC209676, KF241383–KF241409 (33/24)

Sarcocystis rileyi KJ396583 KJ396582

Sarcocystis scandinavica EU282020–EU282022 KC209684–KC209685 (2/2)

Sarcocystis silva EU282016; JN226125; KY019056 KC209686–KC209689; KF241410; KX643344–KX643345; KY018988–KY019014 (34/17)

Sarcocystis sinensis KT901096 KT900954–KT900960; KU196747–KU196749 (10/6)

Sarcocystis speeri KT207461

Sarcocystis taeniata (Sarcocystis cf. taeniata)C

KF831277–KF831293; KU753886–KU753890;

(JN256126–JN256127; KT626602)C

KF831252–KF831272; KU753899–KU753902 (25/17)

Sarcocystis tarandi GQ250967–GQ250969 KC209697–KC209704, KF241411–KF241438 (36/28)

Sarcocystis tarandivulpes EF056012; EF467656–EF467657 KC209712–KC209722 (11/10)

Sarcocystis tenella KC209734 KC209723–KC209732 (10/10)

Sarcocystis tragulusi KT893710–KT893711 KT893708–KT893709 (2/2)

Sarcocystis truncata GQ251021–GQ251030 KC209677–KC209683, KF241439–KF241452 (21/16)

Sarcocystis turdusi JF975681 KT588511

Sarcocystis venatoria KY973324–KY973331 KY973287

Sarcocystis sp. HM050622 (sika deer)

AB257155–AB257157

Sarcocystis sp. T18 (sika deer) AB698065

Besnoitia besnoiti AF109678

Hammondia heydorni GQ984224 JX473250

Hammondia triffittae GQ984222 JX473247

Neospora caninum U16159 JX473252

Toxoplasma gondii M97703 JX473253

Eimeria tenella U67121 HQ702484

Total number included 57 taxa; 235 sequences

28 taxa; 175 sequencesE

53 taxa; 386 sequences/haplotypes (selected from 747 sequences)

A For taxa represented by more than one cox1 sequence in GenBank, only different haplotypes were used in the final analyses. For these

taxa, the total number of available cox1 sequences and the number of haplotypes used in the analyses are given in parentheses behind

the accession numbers. B, C These sequences have not been verified to belong to S. entzerothi and S. taeniata, respectively, through sequencing of cox1. D There seems to an error in both 18S rRNA gene sequences of S. menglaensis, consisting of 43-nt-long insertion in a conserved region

at positions 995-1037, which is mainly a repetition of the preceding segment. The extra segments shown below have not been included

in the analyses.

KX610082 AAAGCATTTGCCAAAGATGTATTCATTAATCAAGAACGAAAGT

KX610083 AAAGCATTTGCCAAAGATGTTTTCATTAATCAAGAACGAAAGT E Underlined 18S rRNA gene sequences were used both in the main analysis and in an analysis comprising mainly species with a known

or presumed canine definitive host, except sequence L24382 of S. arieticanis, which was used in the latter analysis only. F The cox1 sequence of Sarcocystis neurona was artificially concatenated from expressed sequence tags (ESTs) retrieved from GenBank

as described by Gjerde and Schulze (2014); Parasitol Res 113:811–821; doi: 10.1007/s00436-013-3711-x. This sequence is identical

with the cox1 sequence of S. speeri (KT207461).

4

Table S3 Overview of the number of sarcocyst isolates from each tissue and red deer (CeS1–Ces4) that were identified to species on the basis of their cox1 sequences

Species In all hosts and tissues

CeS1 CeS2 CeS3 CeS4

Heart Diaphragm Oesophagus Heart Heart Heart

S. iberica 1 0 1 0 0 0 0

S. venatoria 10 0 10 0 0 0 0

S. hjorti 1 0 0 1 0 0 0

S. cervicanis Type A: 19 3 0 0 1 0 15

Type B: 32 0 0 0 20 12 0

Type C: 1 0 0 0 0 0 1

S. linearis 38 0 21 11 0 2 4

S. morae 1 0 0 1 0 0 0

No. of isolates 103 3 32 13 21 14 20

Table S4 Overview of cox1 haplotypes of each of the six Sarcocystis spp. found in four Spanish red deer, their GenBank accession numbers and the sarcocyst isolates (and number of sequences) associated with each haplotype. The sequence subtypes (A, B, C) of S. cervicanis are also indicated

Species (n; habitat) Haplo-type

GenBank acc.no

Isolates (n)

S. iberica (n=1; diaphragm)

1 KY973286 CeS1.1 (1)

S. venatoria (n=10; diaphragm)

1 KY973287 CeS1.2–CeS1.11 (10)

S. hjorti (n=1; oesophagus)

1 KY973288 CeS1.48 (1)

S. cervicanis (n=52; heart)

1 (A) KY973289 CeS1.54–CeS1.56 (3)

2 (A) KY973290 CeS2.12; CeS4.20 (2)

3 (A) KY973291 CeS4.1, CeS4.5, CeS4.7–CeS4.10, CeS4.12, CeS4.14, CeS4.16, CeS4.17, CeS4.19 (11)

4 (A) KY973292 CeS4.3, CeS4.4, CeS4.21 (3)

5 (B) KY973293 CeS2.1-CeS2.4, CeS2.7, CeS2.8, CeS2.10, CeS2.11, CeS2.13–CeS2.24, CeS3.5, CeS3.7, CeS3.12 (24)

6 (B) KY973294 CeS3.1, CeS3.2, CeS3.4, CeS3.8–CeS3.10, CeS3.13, CeS3.14 (8)

7 (C) KY973295 CeS4.11 (1)

S. linearis (n=38; diaphragm 21, oesophagus 11, heart 6)

1 KY973296 CeS1.13, CeS1.28, CeS1.33; CeS4.2, CeS4.15 (5)

2 KY973297 CeS1.14, CeS1.16, CeS1.23, CeS1.25 (4)

3 KY973298 CeS1.15 (1)

4 KY973299 CeS1.17–CeS1.19, CeS1.21 (4)

5 KY973300 CeS1.20, CeS1.29, CeS1.30, CeS1.32 (4)

6 KY973301 CeS1.22 (1)

7 KY973302 CeS1.24 (1)

8 KY973303 CeS1.26 (1)

9 KY973304 CeS1.27 (1)

10 KY973305 CeS1.35; CeS3.6, CeS3.11; CeS4.13 (4)

11 KY973306 CeS1.36, CeS1.37, CeS1.40, CeS1.50 (4)

12 KY973307 CeS1.42 (1)

13 KY973308 CeS1.43 (1)

14 KY973309 CeS1.44, CeS1.49 (2)

15 KY973310 CeS1.46 (1)

16 KY973311 CeS1.51, CeS1.52 (2)

17 KY973312 CeS4.18 (1)

S. morae (n=1; oesophagus)

1 KY973313 CeS1.47 (1)

5

Table S5 Range of sequence identities between cox1 sequences of five morphologically similar species. The number of haplotypes of each species used in the comparisons is given behind the species names in the header. See Table S2 for GenBank accession numbers

S. grueneri (n=9) S. taeniata

(n=17)

S. linearis (n=22) S. cervicanis

(n=7)

S. morae (n=1)

S. grueneri

S. taeniata 83.5–84.4%

S. linearis 83.8–85.0% 95.8–97.1%

S. cervicanis 83.6–84.8% 86.7–87.4% 85.5–86.3%

S. morae 86.0–86.4% 86.4–86.8% 86.3–86.9% 88.4–88.9%

Fig. S1 Sequence variation between nucleotides 91 and 118 from the 3’ end of the 18S rRNA gene of S. linearis and S. taeniata in isolates from red deer (Ce), roe deer (Cc), moose (Aa) and sika deer (Cn) in Spain (Sp), Italy (It), Canada (Ca) and Lithuania (Lit). GenBank accession numbers of published sequences are given in parentheses behind the species names

S. linearis Cc It (KY919052) TCCCGTTTTTTACGCGCGTGTTTTACGC

S. linearis Cc It (KY919053) TCCCGTTTTT-ACGCGCGTGTTTTACGC

S. linearis Cc It (KY919054) TCCCGTTTTTTACGCGCGTGTTCCACGC

S. linearis Ce Sp (KY973355) TCCCGTTT---ACGCGCGTGTTCCACGC

S. linearis Ce Sp (KY973363) TCCCGTTT---ACGCGCGTGTTTTACGC

S. linearis Ce Sp (consensus) TCCCGTTT---ACGCGCGTGTTYYACGC

S. ‘taeniata’ Ce Lit (JN256126) TCCCGTTT---ACGCGCGTGTTTTACGC

S. ‘taeniata’ Ce Arg (KT626602) TCCCGTTT---ACGCGCGTGTTTTACGC

S. taeniata Aa Can (KF831277) TCCCGTTTTTTACGCGCGTGTTTCACGC

S. taeniata Aa Can (unpublished) TCCCGTTTTTTACGCGCGTGTTYYACGC

S. taeniata Aa Can (unpublished) TCCCGTTTTT-ACGCGCGTGTTYYACGC

S. taeniata Cn Lit (KU753886) TCCCGTTTTTTACGCGCGTGTTTCACGC

S. taeniata Cn Lit (KU753887) TCCCGTTTTTTACGCGCGTGTTTTACGC

Y = C or T

Fig. S2 Sequence variation between nucleotides 74 and 120 from the 3’ end of the 18S rRNA gene of eight isolates of S. cervicanis, which had cox1 sequences of either type A, B or C. Three isolates of type A had four variable positions in this region, whereas one type A isolate and all type B and C isolates had no variation or a deletion at these sites

Isolate Type Sequence

CeS1.54 A ACCGTYCCGTTTTtACGYGCGTTTCTACGTGCGTGCGGRATGGAAAG

CeS1.55 A ACCGTYCCGTTTTtACGYGCGTTTCTACGTGCGTGCGGRATGGAAAG

CeS4.12 A ACCGTYCCGTTTTtACGYGCGTTTCTACGTGCGTGCGGRATGGAAAG

CeS4.4 A ACCGTTCCGTTTT-ACGCGCGTTTCTACGTGCGTGCGGAATGGAAAG

CeS2.4 B ACCGTTCCGTTTT-ACGCGCGTTTCTACGTGCGTGCGGAATGGAAAG

CeS2.15 B ACCGTTCCGTTTT-ACGCGCGTTTCTACGTGCGTGCGGAATGGAAAG

CeS3.8 B ACCGTTCCGTTTT-ACGCGCGTTTCTACGTGCGTGCGGAATGGAAAG

CeS4.11 C ACCGTTCCGTTTT-ACGCGCGTTTCTACGTGCGTGCGGAATGGAAAG

Y = C or T; R = A or G; t indicates an insertion/deletion of T

6

Fig S3 Phylogenetic tree for selected members of the Sarcocystidae based on near full-length sequences of the 18S rRNA gene and inferred using the maximum parsimony method with the Subtree-Pruning-Regrafting algorithm. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. Subtrees formed by two or more sequences of the same or closely related species have been collapsed, but the number of sequences included are given behind the taxon names, which are in boldface when comprising sequences from the present study. The GenBank accession numbers for all sequences are given in Table S2 above. In the collapsed subtree formed by sequences of S. linearis and S. taeniata, sequences of the two species were interleaved. The same was true for sequences of S. iberica and S. venatoria. Note that the single sequence of Sarcocystis sp. T18 from sika deer (AB698065) clusters in between sequences of S. cervicanis. A phylogenetic tree reconstructed from a smaller dataset, comprising mainly Sarcocystis spp. known or believed to be transmitted by canids is shown in Fig. 4 in the main paper.