Paraneoplastic Pemphigus Sera React Strongly with Multiple Epitopes on the Various Regions of...

Paraneoplastic Pemphigus Sera React Strongly with MultipleEpitopes on the Various Regions of Envoplakin andPeriplakin, Except for the C-Terminal Homologous Domainof Periplakin

Yoshiko Nagata,*§ Tadashi Karashima,*² Fiona M. Watt,² Wolfgang Salmhofer,*³ Tamotsu Kanzaki,§ andTakashi Hashimoto**Department of Dermatology, Kurume University School of Medicine, Kurume, Fukuoka, Japan; ²Keratinocyte Laboratory, Imperial Cancer Research

Fund, London, U.K.; ³Department of Dermatology, University of Graz, Austria; §Department of Dermatology, Kagoshima University School of

Medicine, Kagoshima, Japan

Paraneoplastic pemphigus sera react with multipleplakin family proteins, among which only envoplakinand periplakin are constantly detected by immuno-blotting using normal human epidermal extracts.Using bacterial expression vectors containing poly-merase chain reaction-ampli®ed cDNA, we haveprepared variously truncated recombinant glu-tathione-S-transferase-fusion proteins of envoplakinand periplakin, which presented N-terminal, centraland C-terminal domains of each protein, as well asthe so-called C-terminal homologous domain ofenvoplakin and the junctional regions of thesedomains. By immunoblotting using these 11 recom-binant proteins, we demonstrated that most of the 26paraneoplastic pemphigus sera reacted very stronglywith multiple recombinant proteins of envoplakinand periplakin, except for the C-terminal homolo-gous domain of periplakin. We also examined the

reactivity with these recombinant proteins of otherblistering diseases, including pemphigus vulgaris,pemphigus foliaceus, and bullous pemphigoid, andfound that a few nonparaneoplastic pemphigus serashowed a weak reactivity with some of the recombi-nant proteins. Interestingly, some sera showed rela-tively strong reactivity with the C-terminalhomologous domain of periplakin to which paraneo-plastic pemphigus sera reacted less frequently. Theseresults indicate that, although nonparaneoplasticpemphigus sera occasionally show a weak reactivitywith envoplakin and periplakin, the pathogenicityand the mechanism of antibody production in thesecases may be different from those in paraneoplasticpemphigus. Key words: autoimmune bullous disease/cor-ni®ed envelope/desmosome/plakin family/recombinantprotein. J Invest Dermatol 116:556±563, 2001

Extensive studies have shown that antigens for anti-keratinocyte cell surface autoantibodies are the 130 kDadesmoglein 3 (Dsg3) for pemphigus vulgaris (PV) andthe 160 kDa Dsg1 for pemphigus foliaceus (PF) (Stanleyet al, 1982; Stanley, 1989; Hashimoto et al, 1990;

Amagai et al, 1991, 1994). Recently, it has also been clari®ed thatthe sera of PV patients of mucocutaneous type react with bothDsg3 and Dsg1, whereas mucosal type PV sera react only with Dsg3(Amagai et al, 1999).

Paraneoplastic pemphigus (PNP) is a distinct entity of auto-immune blistering disease, characterized by severe mucosal erosivelesions and various cutaneous lesions, associated with neoplasia,particularly malignant lymphomas (Anhalt et al, 1990; Camisa et al,

1992; Camisa and Helm, 1993; Horn and Anhalt, 1992; Oursleret al, 1992; Bystryn et al, 1993; Rybojad et al, 1993; Stevens et al,1994). Unlike PV and PF, PNP sera bind not only to the cellsurface of the epidermis but also to other nonstrati®ed epithelia.Furthermore, whereas PV and PF sera primarily recognizedesmogleins, PNP sera immunoprecipitate a complex of multipleantigens migrating on the gel at 250, 230, 210, 190, and 170 kDa.In the initial studies, it was suggested that the 250 and 210 kDaproteins are desmoplakins I/II, the 230 kDa protein is the 230 kDabullous pemphigoid (BP) antigen (BP230), but the nature of the190 and 170 kDa proteins was unclear (Anhalt et al, 1990; Oursleret al, 1992).

By immunoblotting extracts of normal human epidermis, wepreviously showed that all PNP sera detect a characteristic doubletof the 210 and 190 kDa proteins (Hashimoto et al, 1995). We, aswell as other investigators, recently con®rmed that the 210 and190 kDa PNP antigens are envoplakin and periplakin, respectively(Kim et al, 1997; Kiyokawa et al, 1998; Mahoney et al, 1998;Borradori et al, 1998), which had been identi®ed as components ofthe corni®ed cell envelope (Ruhrberg et al, 1996, 1997; Ruhrbergand Watt, 1997). The molecular cloning studies revealed thatenvoplakin and periplakin belong to plakin family proteins

Manuscript received May 4, 2000; revised November 9, 2000; acceptedfor publication November 22, 2000.

Reprint requests to: Dr. Takashi Hashimoto, Department ofDermatology, Kurume University School of Medicine, 67 Asahimachi,Kurume, Fukuoka 830-0011, Japan. Email: [email protected]

Abbreviations: BP, bullous pemphigoid; GST, glutathione-S-transferase;PF, pemphigus foliaceus; PNP, paraneoplastic pemphigus; PV, pemphigusvulgaris.

0022-202X/01/$15.00 ´ Copyright # 2001 by The Society for Investigative Dermatology, Inc.

556

(Ruhrberg et al, 1996, 1997), which also include desmoplakin I/II,BP230, and plectin (Green et al, 1992; Ruhrberg and Watt, 1997).Although the molecular weight of periplakin was ®rst reported tobe 195 kDa (Ma and Sun, 1986), the 190 kDa PNP antigen hasbeen shown to be identical to periplakin. To avoid confusion, weuse the molecular weight of 190 kDa for periplakin in this study.

These previous observations led us to investigate the epitopes onenvoplakin and periplakin in more detail. By immunoblotting usingvariously truncated bacterial recombinant proteins of envoplakinand periplakin, 26 PNP sera, 49 sera of classic types of pemphigus(PV and PF), and 23 BP sera were examined. We now demonstratethat PNP sera react speci®cally with multiple epitopes on thevarious regions of envoplakin and periplakin, except for the C-terminal homologous domain of periplakin.

MATERIALS AND METHODS

Sera and antibodies Sera were obtained from 26 PNP patients. Wepreliminarily examined 60 sera each of PV and PF and 120 BP sera, andselected 17 PV sera, 12 PF sera, and 23 BP sera, which showed areactivity with protein bands comigrating with either envoplakin orperiplakin on immunoblotting using epidermal extracts. Two and 15 seraof PV patients reacted with the envoplakin and periplakin, respectively.Three and nine sera of PF patients reacted with envoplakin andperiplakin, respectively. Six and 21 sera of BP patients reacted withenvoplakin and periplakin, respectively. In total, 11 of 240 sera showedthe envoplakin band and 45 of 240 sera showed the periplakin band byimmunoblotting using epidermal extract. Sera from 20 normal volunteerswere also used as controls. All the sera were stored at ±30°C or at 4°Cin the presence of 0.1% NaN3.

All the PNP patients showed typical clinical and histopathologicfeatures, i.e., severe mucosal lesions, variable skin lesions, associationwith various hematologic malignancies, and keratinocyte necrosis withinterface dermatitis (Anhalt et al, 1990; Anhalt, 1997). These PNP seraexhibited IgG anti-keratinocyte cell surface antibodies with titers rangingfrom 40 to 640 by indirect immuno¯uorescence of either normal humanskin sections or rat bladder sections. PV and PF sera showed IgG anti-cell surface antibodies and BP sera showed anti-basement membranezone antibodies at titers ranging from 40 to 2560; however, no BP seraexhibited anti-keratinocyte cell surface antibodies by indirect immuno-

¯uorescence of normal skin sections. Normal control sera did not showany speci®c reactivity on immuno¯uorescence.

To con®rm the position of each glutathione-S-transferase (GST) fusionprotein in immunoblots, we also included rabbit polyclonal antibodyagainst GST (Sigma, St Louis, MO). Speci®city of anti-envoplakin rabbitpolyclonal antibody (CR5) (Ruhrberg et al, 1996) and anti-periplakinrabbit polyclonal antibody (CR3) (Ruhrberg et al, 1997) were previouslydescribed.

Generation of bacterial expression constructs of human envoplakinand periplakin All the plakin family proteins show similar molecularstructures, consisting of the N-terminal globular domain, middle roddomain, and C-terminal globular domain (Green et al, 1992; Ruhrbergand Watt, 1997) (Fig 1). The so-called C-terminal homologous domainis present within the region immediately before the C repeats of all theplakin family proteins. This domain is conserved in all the plakins, and isconsidered to show the highest homology among the various subdomainsof all the plakins (Mahoney et al, 1998). Therefore, we ®rst attempted togenerate bacterial GST-fusion proteins corresponding exactly to thesesubdomains of human envoplakin and periplakin.

To generate domain-speci®c GST-fusion proteins of human envopla-kin, four cDNA fragments of envoplakin were ampli®ed by polymerasechain reaction (PCR) (LA-PCR kit, Version 2, TaKaRa Biotechnology,Japan), using cDNA clones of envoplakin (p210±23 and 141 inserted inpBluescript, and p210±21 in pSPORT) (Ruhrberg et al, 1996) orkeratinocyte cDNA library as templates, as well as appropriate primers.The keratinocyte cDNA library was prepared from mRNA obtainedfrom the cultured squamous cell carcinoma cell line, KU8 (Hashimotoet al, 1990; Matsumura et al, 1996). The four cDNA fragments werenamed as ENV-N of 2721 nucleotides (99±2819) containing an entireN-terminal globular domain of envoplakin, ENV-M of 2298 nucleotides(2820±5117) containing an entire central rod domain, and ENV-C of1080 nucleotides (5118±6197) containing a C-terminal domain, accord-ing to previously reported nucleotide sequences (Ruhrberg et al, 1996).In addition, we also prepared ENV-H of 333 nucleotides (5118±5450)corresponding to the C-terminal homologous domain of envoplakin.

All the primers for PCR used in this study are summarized inTable I. Four pairs of primers, 5¢-ENV-N and 3¢-ENV-N, 5¢-ENV-Mand 3¢-ENV-M, 5¢-ENV-C and 3¢-ENV-C, and 5¢-ENV-H and 3¢-ENV-H, were used to obtain ENV-N, ENV-M, ENV-C, and ENV-H,respectively. As the templates for PCR, p210±21 cDNA clone was usedto generate ENV-M and ENV-C, and the KU8 cDNA library was usedto generate ENV-H. Because the p210±23 cDNA clone covers nucleo-

Figure 1. Schematic diagram for the structures of human envoplakin and periplakin and the positions of the 11 truncated recombinantGST-fusion proteins, including seven domain-speci®c proteins and four proteins of the junctional region. The left and right ®guressummarize the structures and the recombinant proteins of envoplakin and periplakin, respectively. In each ®gure, the upper panel depicts an entirestructure of each protein. The middle panel indicates the positions and the residue numbers of all the recombinant proteins used in this study. In thelower panel, the positions of all the cDNA constructs used as templates for PCR are shown.

VOL. 116, NO. 4 APRIL 2001 EPITOPES ON ENVOPLAKIN AND PERIPLAKIN 557

tides 1±1082 and the p210±141 covers nucleotides 575±4572, we ®rstcombined inserts of p210±23 and p210±141 and generated a new cDNAclone (p210±23 + 141) to generate ENV-N. For this purpose, we ®rstcut out the insert of the p210±23 by EcoRI digestion and reinserted itinto the EcoRI site of pBluescript in the proper direction, because theinsert was oriented in a reverse direction in the original clone. Then, thecorrectly oriented p210±23, as well as the p210±141, was digested withSacII, and the cDNA fragment (998±3228) obtained from p210±141 wasligated into SacII digested p210±23 (pBluescript with 1±998), resulting ingeneration of p210±23 + 141 (pBluescript with insert 1±3228). Weampli®ed ENV-N using the p210±23 + 141 as a template for PCR.

To generate domain-speci®c GST-fusion proteins of human peripla-kin, three cDNA fragments of periplakin were ampli®ed by PCR, usingcDNA clones of periplakin (p195±5 in pSPORT, and p195±111 inpBluescript) (Ruhrberg et al, 1997) or KU8 cDNA library as a template.The three cDNA fragments were named as PPK-N of 2832 nucleotides(91±2922) containing an N-terminus of periplakin, PPK-M of 2103nucleotides (2923±5025) containing a central rod domain, and PPK-H of333 nucleotides (5026±5358) containing an entire C-terminal domain ofperiplakin, which corresponds the C-terminal homologous domain ofperiplakin, according to previously reported nucleotide sequences(Ruhrberg et al, 1997).

Three pairs of primers, 5¢-PPK-N and 3¢-PPK-N, 5¢-PPK-M and 3¢-PPK-M, and 5¢-PPK-H and 3¢-PPK-H, were used to obtain PPK-N,PPK-M, and PPK-H, respectively. As the templates for PCR, the p195±111 cDNA clone was used to generate PPK-N, the p195±5 cDNA clonewas used to generate PPK-M, and the KU8 cDNA library was used togenerate PPK-H. PCR products were puri®ed by PCR puri®cation kit(QIAGEN, Hilden, Germany), digested with either EcoRI/NotI, BamHI/NotI, or EcoRI/SaII, and ligated into the 3¢ end of the GST gene in thebacterial expression vector pGEX-4T-1 (Pharmacia Biotech, Piscataway,NJ), which had been digested by the same pairs of restriction enzymesand gel puri®ed.

In addition, we prepared four GST-fusion proteins of junctionalregions between the three domains of envoplakin and periplakin. Thetwo cDNA fragments, designated as ENV-NM of 184 nucleotides(2726±2909) between the N-terminal and central domains, and ENV-MC of 178 nucleotides (5030±5207) between the central and C-terminaldomains of envoplakin, were ampli®ed by PCR, using the cDNA cloneof p210±21 as a template. Two pairs of primers, 5¢-ENV-NM and 3¢-ENV-NM and 5¢-ENV-MC and 3¢-ENV-MC, were used to obtainENV-NM and ENV-MC, respectively.

The two cDNA fragments, designated as PPK-NM of 174 nucleotides(2838±3011) between the N-terminal and central domains, and PPK-MC of 183 nucleotides (4933±5115) between the central and C-terminaldomains of periplakin, were ampli®ed by PCR, using p195±111 (forPPK-NM) and p195±5 (for PPK-MC) as templates. Two pairs ofprimers, 5¢-PPK-NM and 3¢-PPK-NM and 5¢-PPK-MC and 3¢-PPK-

Table I. Summary of all the primers for PCR used in this study

Names Sequences Restriction enzymea Nucleotide no.b

Start End

1 5¢-ENV-N gccgaattc ATGTTCAAGGGGCTGAGCAAAGGCTCCCAG EcoRI 99 1282 3¢-ENV-N gccgcggccgc AGGGCTCTCGGAGCCCTGCTTTGCATCATGGG NotI 2788 28193 5¢-ENV-M gccgaattc GCCCAAGCAGGGAGAGAGTCAGAGGCCCTG EcoRI 2820 28494 3¢-ENV-M gccgcggccgc TGGCTGAGCTCCTCCCGGCTCACCTTGGC NotI 5088 51165 5¢-ENV-C agaattc GAGACCCAGACGCGAGAG EcoRI 5118 51356 3¢-ENV-C gccgcggccgc TCAGCGAAGGGAGCGCGGGACGGTGGGGGAGGC NotI 6168 62007 5¢-ENV-H agaattc GAGACCCAGACGCGAGAG EcoRI 5118 51358 3¢-ENV-H agtcgac GGTCTCCCCAGCTACAAGC SaII 5432 54509 5¢-PPK-N gccgaattc ATGAACTCGCTCTTCAGGAAGAGAAACAAAGGC EcoRI 91 123

10 3¢-PPK-N gccgcggccgc GGGATCCGGCACCTTCTTGAGCACCTCCTTCC NotI 2891 292211 5¢-PPK-M gccggatcc GTGCTGGAGGAGAGCTTCCAGCAGCTGCAG BamHI 2923 295212 3¢-PPK-M gccgcggccgc GACGGCCACGGAGCCCAGGCGCTTCTGCAG NotI 4996 502513 5¢-PPK-H gccgaattc AAGCGGGAGCAGCGGGAGAAC EcoRI 5026 504614 3¢-PPK-H gccgtcgac CTTCTGCCCAGATACCAAGAC SaII 5338 535815 5¢-ENV-NM gccgaattc GCAGCTGGAGTTTGCTAG EcoRI 2726 274316 3¢-ENV-NM gccgcggccgc CGCCTCCAGCTCATGCTG NotI 2892 290917 5¢-ENV-MC gccgaattc CATCCTCCGCGAGAAG EcoRI 5030 504518 3¢-ENV-MC gccgcggccgc GTAGGCCTCGTATGGGG NotI 5191 520719 5¢-PPK-NM gccgaattc CCAGGAAGAAATCTGG EcoRI 2838 285320 3¢-PPK-NM gccgcggccgc AGTGCCTCCAGCTCC NotI 2997 301121 5¢-PPK-MC gccgaattc CTGGAGAGGGAACTG EcoRI 4933 494722 3¢-PPK-MC gccgcggccgc GTGGGCTTCCTCCGGGG NotI 5099 5115

aThe position of the restriction enzyme is indicated by italic lower case letters in 5¢ region of each primer.bThe ``Start'' and ``End'' of nucleotide numbers indicate the ®rst and the last numbers of cDNA sequence (shown by capital letter) in each primer.

Figure 2. By immunoblotting of normal human epidermalextracts, all the PNP sera reacted strongly with envoplakin andperiplakin, whereas a few non-PNP sera reacted weakly withproteins showing the same migration. By immunoblotting ofepidermal extracts, six representative PNP sera reacted with the doubletof the 210 kDa envoplakin and the 190 kDa periplakin (lanes 1±6),whereas either of these protein bands was also recognized by someparticular sera from cases of BP (lanes 7±9), PV (lanes 10±11), and PF(lane 12), in addition to their speci®c antigens. The positions of the250 kDa desmoplakin I (DPKI), the 210 kDa envoplakin (ENV), andthe 190 kDa periplakin (PPK) are shown on the left. The positions ofthe 230 kDa BP230, the 180 kDa BP180, the 160 kDa Dsg1, and130 kDa Dsg3 are shown on the right.

558 NAGATA ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

MC, were used to obtain PPK-NM and PPK-MC, respectively. PCRproducts were puri®ed by PCR puri®cation kit (QIAGEN), digestedwith EcoRI/NotI and ligated into the 3¢ end of the GST gene in thebacterial expression vector pGEX-5X-3 (Pharmacia LKB Biotechnology,NJ), which had been digested by the same pairs of restriction enzymesand gel puri®ed. For ENV-N, ENV-M, PPK-N, and PPK-M, PCR wasperformed in the following conditions: 94°C 1 min, one cycle; 98°C20 s, 68°C, 15 min, 30 cycles; and 72°C 10 min, one cycle.

For ENV-C, ENV-H, PPK-H, and four constructs of the junctionalregions, PCR was performed in the following conditions: 94°C 5 min,50°C 2 min, 72°C 3 min, one cycle; 94°C 1 min, 50°C 2 min, 72°C3 min, 30 cycles; and 94°C 1 min, 50°C 2 min, 72°C 10 min, onecycle. All the constructs were subjected to nucleotide sequence analysisby ABI PRISM 310 Genetic Analyzer using 5¢-pGEX and 3¢-pGEXsequencing primers, to con®rm the identity and ®delity of subcloningsteps.

Preparation of GST-fusion proteins of envoplakin andperiplakin Recombinant GST-fusion proteins were prepared asdescribed previously (Matsumura et al, 1996; Nie and Hashimoto, 1999)Because the fusion proteins of ENV-C, ENV-H, and PPK-H weresoluble in 1% Triton-X-100 phosphate-buffered saline, these proteinswere in puri®ed using a glutathione-sepharose 4B column (PharmaciaBiotech, Uppsala, Sweden), according to the manufacturer's protocol.(To simplify the terminology, we call a cDNA clone and the resultedfusion protein by the same name in this study, such as ENV-N.) Becausethe fusion proteins of ENV-N, ENV-M, PPK-N, and PPK-M were notsoluble in this buffer, the pellets were further extracted with 3 ml 2 Murea as described previously (Tanaka et al, 1991). The supernatant wasused for immunoblot analysis. The reactivity with the four fusionproteins of junctional regions (ENV-NM, ENV-MC, PPK-NM, andPPK-MC) were also examined using the same method as that for ENV-N, ENV-M, PPK-N, and PPK-M. We quantitated the recombinantproteins using Bio-Rad Protein Assay (Bio-Rad, Hercules, CA),according to the manufacturer's recommendation.

Immunoblot analysis Immunoblotting of extracts of normal humanepidermis was performed as described previously (Sugi et al, 1989;Hashimoto et al, 1990, 1995; Tanaka et al, 1991). The fractionatedproteins were transferred on to nitrocellulose membrane. Blots wereincubated with blocking solution (Tris-buffered saline with 3% skimmilk) for 1 h at room temperature. Because the fusion proteins of ENV-N, ENV-M, PPK-N, and PPK-M could not be puri®ed by glutathione-sepharose 4B column, the patients' sera were preabsorbed with Escherichiacoli lysate to reduce background reactivity with nonspeci®c anti-E. coliantibodies.

Escherichia coli lysate was prepared as described below. Two hundredmilliliters of Luria-Bertani medium was added with 20 ml of overnightculture of XL I-Blue transfected with pGEX without insert, cultured for3 h, and induced by 1 mM isopropyl thiogalactose. After the bacteriareached con¯uence, a bacterial pellet was resuspended in 5 ml of

phosphate-buffered saline, subjected to three cycles of freezing/thawing,sonicated mildly, and kept at ±80°C until use. For preabsorption, theserum diluted in 3% milk in Tris-buffered saline was mixed with E. colilysate (the same volume as the serum), agitated at room temperature for1 h, and centrifuged for 10 min at 11,000 3 g. The supernatant wasused as the ®rst antibody.

Combination method of immunoprecipitation and immuno-blotting To determine if the PV, PF, and BP sera react with eitherenvoplakin or periplakin, we performed the combined method ofimmunoprecipitation and immunoblotting (Kiyokawa et al, 1998). Weused normal human epidermal extracts in 1.5% sodium dodecyl sulfate±Tris buffer, as an antigen source, according to a previously describedmethod (Tanaka et al, 1991). Brie¯y, the epidermal extracts were diluted20-fold with 1% Triton X-100 in Tris-buffered saline containing 1 mMphenylmethylsulfonyl ¯uoride and 1 mM ethylenediamine tetraaceticacid to reduce the sodium dodecyl sulfate concentration to 0.075%; theywere then ®rst incubated with patient sera and precipitated with proteinA sepharose 4B (Pharmacia, Biotech). After extensive washing, proteinswere eluted by boiling in Laemmli's sample buffer containing 5% b-mercaptoethanol and were separated on a 4±20% gradient gel. Proteinbands were detected using the anti-envoplakin antibody (CR5) or anti-periplakin rabbit polyclonal antibody (CR3).

RESULTS

The schematic illustration of the 11 fusion proteins Theentire structures of envoplakin and periplakin, as well as the regionscorresponding to the seven domain-speci®c fusion proteins and thefour fusion proteins of junctional region, are depicted schematicallyin Fig 1.

Authentic envoplakin and periplakin in the epidermalextracts were recognized strongly by all the PNP sera, andweakly by some sera from non-PNP autoimmune bullousdiseases (Table I) All the 26 PNP sera reacted clearly with thecharacteristic doublet proteins of 210 kDa envoplakin and 190 kDaperiplakin by immunoblotting extracts of normal human epidermis(Fig 2). Two and 15 sera from PV patients reacted with the210 kDa protein comigrating with envoplakin and the 190 kDaprotein comigrating periplakin, respectively, by immunoblottingepidermal extracts. Three and nine sera from PF patients reactedwith the 210 kDa and 190 kDa proteins, respectively. Six and 21 ofthe 23 BP sera reacted with the 210 kDa and 190 kDa proteins,respectively. No control sera showed any speci®c reactivity.

All the PNP sera reacted strongly with multiple domain-speci®c recombinant fusion proteins of envoplakin andperiplakin, except for the C-terminal homologous domain

Figure 3. Multiple recombinant proteins ofenvoplakin were strongly recognized by themajority of the PNP sera. Panels 1±4 show theresults of all the 26 PNP sera (``PNP'') andnormal sera (``Cont'') on immunoblotting ofENV-N, ENV-M, ENV-C, and ENV-H,respectively. An arrowhead on the left of eachpanel indicates the position of intact recombinantprotein.


of periplakin To immunoblot various domain-speci®crecombinant proteins, each well of the gels was applied with anapproximately 20 mg sample of recombinant proteins for ENV-N,ENV-M, ENV-C, PPK-N, and PPK-M, and with anapproximately 5 mg sample of recombinant proteins for ENV-Hand PPK-H. The results of immunoblotting recombinant proteinsfor the 26 PNP sera, as well as normal sera, are shown in Figs 3 and4, and are summarized in Table II.

Nineteen (73%) PNP sera showed IgG antibodies reactive withthe GST-fusion protein ENV-N containing the N-terminaldomain of envoplakin (Fig 3). Sixteen (62%) and 15 (58%) PNPsera reacted with ENV-M, the central domain, and with ENV-C,the C-terminus domain of envoplakin, respectively. Eighteen(69%) PNP sera reacted with ENV-H, the C-terminal homologousdomain of envoplakin. Eleven (42%) PNP sera reacted with all thefour truncated forms of envoplakin. Five (19%) PNP sera did notrecognize any fusion proteins. In total, 21 (81%) PNP sera showedIgG antibodies reactive against at least one of the fusion proteins ofenvoplakin.

Sixteen (62%) PNP sera reacted with PPK-N, the recombinantfusion protein of the N-terminal domain of periplakin (Fig 4).Fifteen (58%) and three (12%) PNP sera reacted with PPK-M, thecentral domain and with PPK-H, the C-terminal homologousdomain of periplakin. Three (12%) PNP sera reacted with all threetruncated forms of periplakin. Six (23%) PNP sera did notrecognize any fusion proteins. In total, 20 (77%) PNP sera reactedwith at least one of the fusion proteins of periplakin. There was acon¯icting result, however: i.e., 15 PNP sera reacted with theENV-C and 18 PNP sera reacted with ENV-H. The shorterconstruct (ENV-H) was recognized by more PNP sera.

PNP sera also reacted with the recombinant fusion proteinsof the junctional regions of envoplakin and periplakin Tofurther characterize the epitopes, which may be present betweeneach domain and cannot be presented by domain-speci®crecombinant proteins, we also examined the reactivity of PNPsera with the four recombinant proteins of junctional regions. Forthis experiment, 21 PNP sera were available (Fig 5). Four (19%) ofthe 21 PNP sera reacted with the GST-fusion protein ENV-NM,and four (19%) PNP sera also reacted with ENV-MC. Three (14%)

Figure 4. Multiple recombinant proteins of periplakin werestrongly recognized by the majority of the PNP sera, whereas theC-terminal homologous domain of periplakin reacted with onlythree PNP sera. Panels 1±3 show the results of all the 26 PNP sera(``PNP'') and normal sera (``Cont'') on immunoblotting of PPK-N,PPK-M, and PPK-H, respectively. An arrowhead on the left of each panelindicates the position of intact recombinant protein.

Figure 5. A few PNP sera reacted with the small recombinantproteins of junctional regions between each domain ofenvoplakin and periplakin. Panels 1±4 show the results ofimmunoblotting of the recombinant proteins of junctional regions,ENV-NM, ENV-MC, PPK-NM, and PPK-MC, respectively. In eachpanel, lanes 1±6 show the results for PNP sera, lane 7 for anti-GSTpolyclonal antibody, and lanes 8±10 show the results for normal controlsera. In all the panels, the lanes with the same number show thereactivity of the same serum.


PNP sera reacted with PPK-NM, but no PNP sera reacted withPPK-MC. None of the 10 normal control sera showed any speci®creactivity with these four recombinant proteins.

A few non-PNP sera reacted weakly with some recombinantfusion proteins, particularly with the C-terminal homo-logous domain of periplakin The results of immunoblottingof recombinant proteins for the sera from non-PNP bullousdiseases, as well as normal sera, are shown in Fig 6 and summarizedin Table II.

The two PV sera reactive with the authentic envoplakin inepidermal extracts reacted with ENV-M, the central rod domain ofenvoplakin, but not with ENV-N, ENV-C, or ENV-H. Amongthe three PF sera reactive with authentic envoplakin, one (33%),two (67%), one (33%), and two (67%) sera reacted with ENV-Nand ENV-M, ENV-C and ENV-H, respectively. Five (83%) andone (17%) of six BP sera reactive with authentic envoplakin reactedwith ENV-M and ENV-H, respectively.

Among the 15 PV sera, which reacted with authentic periplakinin the epidermal extracts, ®ve (33%), two (13%), and nine (60%)sera reacted with PPK-N, PPK-M, and PPK-H, respectively. Two(22%), two (22%), and seven (78%) sera of the nine PF sera reactivewith authentic periplakin also reacted with PPK-N, PPK-M, andPPK-H, respectively. Nine (43%), six (29%), and 14 (67%) of the21 BP sera reactive with authentic periplakin reacted with PPK-N,PPK-M, and PPK-H, respectively.

In general, the non-PNP sera reactive with the authenticenvoplakin and periplakin in the epidermal extracts reactedfrequently with some of the recombinant proteins of envoplakinand periplakin, respectively. In addition, non-PNP sera reactedpreferentially with ENV-M and PPK-H. Interestingly, as many as14 (67%) of the 21 BP sera reacted relatively strongly with PPK-H(Fig 6, panel 7), which was recognized least frequently by PNPsera. The reactivity of IgG antibodies of the non-PNP patients withall the recombinant fusion proteins, however, was in general muchweaker than that of positive control PNP sera, as clearly seen inFig 6.

There were some con¯icting results: i.e., 10 non-PNP sera,which reactivated with the 210 kDa protein comigrating periplakinin epidermal extracts, did not react with any of the fusion proteins.In contrast, four non-PNP sera, which did not react with authenticperiplakin in epidermal extracts, reacted relatively clearly with someof the periplakin fusion proteins.

The results of the combined method of immuno-precipitation and immunoblotting con®rmed that the

210 kDa and 190 kDa proteins that reacted with the non-PNP sera are envoplakin and periplakin To con®rm that the210 kDa and 190 kDa proteins, which reacted with some of thePV, PF, and BP sera, are identical to envoplakin and periplakin, thecombined method of immunoprecipitation and immunoblottingwas performed for the representative sera (Fig 7). Three sera (onePV, two BP), which reacted relatively strongly with the 210 kDaprotein in the epidermal extracts, could immunoprecipitateenvoplakin, which was detected by immunostaining byenvoplakin-speci®c antibody (CR5) (Fig 7, lanes 1±4). Eight sera(®ve PV, two PF, and one BP), which reacted relatively stronglywith the 190 kDa protein in the epidermal extracts, couldimmunoprecipitate periplakin, which was detected byimmunostaining by periplakin-speci®c antibody (CR3) (Fig 7,

Figure 6. A few non-PNP sera reactedweakly with some recombinant fusionproteins, particularly with the C-terminalhomologous domain of periplakin. Panels 1±7show the results of representative sera from BP(lanes 1 and 2), PV (lanes 3 and 4), and PF (lanes 5and 6), as well as normal sera (lanes 7 and 8), acontrol PNP serum (lane 9), and anti-GSTpolyclonal antibody (lane 10) on immunoblottingof ENV-N, ENV-M, ENV-C, ENV-H, PPK-N,PPK-M, and PPK-H, respectively. In all thepanels, the lanes with the same number showedthe reactivity of the same serum.

Figure 7. Combination method of immunoprecipitation andimmunoblotting con®rmed that some non-PNP sera react withenvoplakin and periplakin. The diluted epidermal extracts were ®rstimmunoprecipitated with various sera, and immunoprecipitated materialswere fractionated by sodium dodecyl sulfate±polyacrylamide gelelectrophoresis and blotted. The anti-envoplakin antibody (CR5)detected envoplakin in the blots for various sera, which showed theprotein comigrating with envoplakin by immunoblotting (lanes 1±4).Anti-periplakin antibody (CR3) detected periplakin in the blots forvarious sera, which showed the protein comigrating with periplakin byimmunoblotting (lanes 5±10).


lanes 5±10). Two control PNP sera also immunoprecipitatedenvoplakin and periplakin, whereas two control normal sera did notshow any positive reactivity.

DISCUSSION

In this study, we prepared seven truncated recombinant fusionproteins, which correspond to three distinct domains of envoplakinand periplakin and in total cover the entire molecule of eachprotein. By immunoblotting using these recombinant proteins, weexamined the reactivity of 26 PNP sera, as well as a number of serafrom other autoimmune bullous diseases. We found that themajority of the PNP sera (58%±73%) showed a strong reactivitywith multiple recombinant fusion proteins of either envoplakin orperiplakin, except for the C-terminal homologous domain ofperiplakin, to which only three (12%) PNP sera bound. Theseresults further con®rmed that envoplakin and periplakin are themajor autoantigens in PNP (Kim et al, 1997; Borradori et al, 1998;Kiyokawa et al, 1998; Mahoney et al, 1998).

Although the C-terminal homologous domains in all the plakinfamily proteins were suggested to harbor major epitopes for PNPsera (Mahoney et al, 1998), our study revealed that the epitopes forPNP autoantibodies distribute widely over the entire molecules, atleast in envoplakin and periplakin. The reason why very few PNPsera reacted with the C-terminal domain of periplakin, whichcorresponds to the entire C-terminal homologous domain, is notclear. It is speculated, however, that some difference in eithersequential or conformational epitopes in this region betweenenvoplakin and periplakin might contribute to the differentrecognition by either T cells or B cells in PNP patients.

In addition, to characterize further the epitope pro®les onenvoplakin and periplakin, we also produced small recombinantfusion proteins of junctional regions, each of envoplakin andperiplakin, with about 60 amino acids. By immunoblotting usingthese recombinant proteins, we found that a few PNP sera (0%±

19%) showed some reactivity with these recombinant proteins.These results indicated that, although some epitopes are present inthese junctional regions, these junctional regions in envoplakin andperiplakin are not the most immunogenic sites for PNP sera.

The presence of multiple epitopes for the PNP sera inenvoplakin and periplakin is consistent with the results in theprevious studies that BP sera reacted with multiple epitopes onBP230, another plakin family protein (Rico et al, 1990; Skaria et al,2000). This extension of epitopes is considered to occur probablyvia the so-called ``epitope-spreading phenomenon'' (Vanderlugtand Miller, 1996; Chan et al, 1998).

In our routine immunoblot study of human epidermal extracts,we have noticed that some sera of non-PNP patients showreactivity with protein bands comigrating with either envoplakin orperiplakin. We ®rst examined in total, 240 sera of PV, PF, and BPpatients by immunoblotting of epidermal extracts, and found thatonly 11 (4.6%) non-PNP sera reacted with the protein comigratingwith envoplakin and a relatively large number of non-PNP sera (45sera: 19%) reacted with the protein comigrating with periplakin.The reactivity of these non-PNP sera, however, were in generalmuch weaker than that by PNP sera.

To characterize these protein bands further, we selected sera ofPV, PF, and BP patients, which reacted relatively strongly withproteins comigrating with either envoplakin or periplakin, andexamined the reactivity of these sera with various domain-speci®crecombinant proteins of envoplakin and periplakin. All sera reactivewith the protein comigrating envoplakin reacted with some of therecombinant proteins of envoplakin, mainly ENV-M. Most serareactive with the protein comigrating with periplakin reacted withsome of the recombinant proteins of periplakin, mainly PPK-H(identical to the C-terminal domain of periplakin). The reactivitywith these recombinant fusion proteins by non-PNP sera, how-ever, was in general much weaker than that of PNP sera. Theseresults suggested that, although the number is not very high and the

Table II. The results of immunoblotting of epidermal extracts and domain speci®c recombinant proteins of envoplakinand periplakin

Epidermal extract Recombinant proteins

Diseases No Envoplakin Periplakin ENV-N ENV-M ENV-C ENV-H PPK-N PPK-M PPK-H

Envoplakin experimentsPNP 26 26 19 16 15 18

73% 62% 58% 69%PV 2 2 0 2 0 0

100%PF 3 3 1 2 1 2

33% 67% 33% 67%BP 6 6 0 5 0 1

83% 17%Normal 20 0 0 0 0 0Pemphigusa 20 0 0 1 0 1

5% 5%

Periplakin experimentsPNP 26 26 16 15 3

62% 58% 12%PV 15 15 5 2 9

33% 13% 60%PF 9 9 2 2 7

22% 22% 78%BP 21 21 9 6 14

43% 29% 67%Normal 20 0 0 0 0Pemphigusa 20 0 1 1 2

5% 5% 10%

aPV and PF sera which showed no reactivity to either envoplakin or periplakin by immunoblotting of epidermal extracts.


reactivity is relatively weak, some non-PNP sera do show somereactivity with either envoplakin and periplakin, particularly withperiplakin.

To con®rm further that envoplakin and periplakin show somereactivity with non-PNP sera, we performed the combined methodof immunoprecipitation and immunoblotting. This study clearlyindicated that at least some of the representative sera from non-PNP patients contain antibodies to either envoplakin andperiplakin.

There were some con¯icting results in this study. Fifteen PNPsera reacted with ENV-C, whereas 18 PNP sera reacted withENV-H, which is shorter than ENV-C. The reason for thisdiscrepancy is unclear, but one possible explanation is that PNP seracan enter shorter proteins more easily.

In addition, 10 non-PNP sera, which recognized a proteincomigrating with periplakin in epidermal extracts, did not reactwith any of the three periplakin recombinant proteins. It is dif®cultto explain this controversial result. We may speculate, however,that some non-PNP sera react with epitopes that are presentbetween two recombinant proteins or with epitopes that cannot beexpressed in the truncated fusion proteins. It may also be possiblethat these sera react with a 190 kDa protein different fromperiplakin. Conversely, four non-PNP sera, which did not reactwith authentic periplakin, reacted with some periplakin recombi-nant proteins. The explanation for this result may be that someshort fusion proteins may present a epitope to which some non-PNP sera can enter more easily, or simply a greater amount ofeffusion proteins can be applied on the blots.

Although there were some con¯icting results, this study clearlyshows that envoplakin and periplakin react not only with PNP sera,but also with some non-PNP sera. Almost all the non-PNP serareacted with only one of the two antigens. In addition, asmentioned above, the reactivity of non-PNP sera with the twoantigens and various recombinant proteins was in general veryweak. These reactivities are quite different from those of PNP sera,which constantly showed a very strong reactivity with both theantigens.

Another interesting result in this study was the differentreactivity with the C-terminal homologous domain of periplakinbetween PNP sera and non-PNP sera. Only three (12%) PNP serareacted with this domain of periplakin, although other domains ofenvoplakin and periplakin were recognized by the majority of thePNP sera. This is quite different from the observation that non-PNP sera most frequently reacted with this very short domain. Thereason for this phenomenon is unclear. There should, however, bea different autoimmune response to periplakin between PNP andnon-PNP patients.

In conclusion, immunoblotting using the recombinant proteinsof each domain of envoplakin and periplakin should be a useful toolto study the pathophysiology of PNP.

We thank Dr. Christiana Ruhrberg for sending the cDNA clones of envoplakin and

periplakin, which she originally prepared, and allowing us to use them. This work

was supported by a Grant-in-Aid for Scienti®c Research from the Ministry of

Education, Science and Culture of Japan, a grant from the Ministry of Health and

Welfare of Japan, and a Collaborative Research Project of the British Council,

Tokyo, Japan.

REFERENCES

Amagai M, Klaus-Kovtun V, Stanley JR: Autoantibodies against a novel epithelialcadherin in PV, a disease of cell adhesion. Cell 67:869±877, 1991

Amagai M, Hashimoto T, Shimizu N, Nishikawa T: Absorption of pathogenicautoantibodies by the extracellular domain of PV antigen (Dsg3) produced bybaculovirus. J Clin Invest 94:59±67, 1994

Amagai M, Tsunoda K, Zillikens D, Nagai T, Nishikawa T: The clinical phenotype

of pemphigus is de®ned by the anti-desmoglein autoantibody pro®le. J AmAcad Dermatol 40:167±170, 1999

Anhalt GJ: Paraneoplastic pemphigus. Adv Dermatol 12:77±96, 1997Anhalt GJ, Kim S-C, Stanley JR, et al: An autoimmune mucocutaneous disease

associated with neoplasia. N Engl J Med 323:1729±1735, 1990Borradori L, Trueb RM, Jaunin F, Limat A, Favre B, Saurat J-H: Autoantibodies

from a patient with paraneoplastic pemphigus bind periplakin, a novel memberof the plakin family. J Invest Dermatol 111:338±339, 1998

Bystryn J-C, Hodak E, Gao S-Q, Chuba JV, Amorosi EL: A paraneoplastic mixedbullous skin disease associated with anti-skin antibodies and a B-cell lymphoma.Arch Dermatol 129:870±875, 1993

Camisa C, Helm TN: Paraneoplastic pemphigus is a distinct neoplasia-inducedautoimmune disease. Arch Dermatol 129:883±886, 1993

Camisa C, Helm TN, Liu YC, et al: Paraneoplastic pemphigus: a report of three casesincluding one long-term survivor. J Am Acad Dermatol 27:547±553, 1992

Chan LS, Vanderlugt CJ, Cooper KD, et al: Epitope spreading: lessons fromautoimmune skin diseases. J Invest Dermatol 110:103±109, 1998

Green KJ, Virata ML, Elgart GW, Stanley JR, Parry DAD: Comparative structuralanalysis of desmoplakin, BP antigen and plectin: members of a new gene familyinvolved in organization of intermediate ®laments. Int J Biol Macromol14:145±153, 1992

Hashimoto T, Ogawa MM, Konohana A, Nishikawa T: Detection of PV and PFantigens by immunoblot analysis using different antigen sources. J InvestDermatol 94:327±331, 1990

Hashimoto T, Amagai M, Watanabe K, et al: Characterization of paraneoplasticpemphigus autoantigens by immunoblot analysis. J Invest Dermatol104:829±834, 1995

Horn TD, Anhalt GJ: Histologic features of paraneoplastic pemphigus. Arch Dermatol128:1091±1095, 1992

Kim S-C, Kwon YD, Lee U, et al: cDNA cloning of the 210 kDa paraneoplasticpemphigus antigen reveals that envoplakin is a component of the antigencomplex. J Invest Dermatol 109:365±369, 1997

Kiyokawa C, Ruhrberg C, Karashima T, et al: Envoplakin and periplakin arecomponents of the paraneoplastic pemphigus antigen complex. J Invest Dermatol111(12):1236±1238, 1998

Ma AS, Sun TT: Differentiation-dependent changes in the solubility of a 195-kDprotein in human epidermal keratinocytes. J Cell Biol 103:41±48, 1986

Mahoney MG, Aho S, Uitto J, Stanley JR: The members of the plakin family ofproteins recognized by paraneoplastic pemphigus antibodies include periplakin.J Invest Dermatol 111:308±313, 1998

Matsumura K, Hashimoto T, Ohata Y, Nishiikawa T: Majority of BP and herpesgestationis sera react with NC16a domain of the 180 kD BP antigen. ArchDermatol Res 288:507±509, 1996

Nie Z, Hashimoto T: IgA antibodies of cicatricial pemphigoid sera speci®cally reactwith C-terminus of BP180. J Invest Dermatol 112:254±255, 1999

Oursler JR, Labib RS, Ariss-Abdo L, Burke T, O'Keefe EJ, Anhalt GJ: Humanautoantibodies against desmoplakins in paraneoplastic pemphigus. J Clin Invest89:1775±1782, 1992

Rico MJ, Korman NJ, Stanley JR, Tanaka T, Hall RP: IgG antibodies from patientswith bullous pemphigoid bind to localized epitopes on synthetic peptidesencoded by bullous pemphigoid antigen cDNA. J Immunol 145:3728±3733,1990

Ruhrberg C, Watt FM: The plakin family: versatile organizers of cytoskeletalarchitecture. Curr Opin Genet Dev 7:392±397, 1997

Ruhrberg C, Hajibagheri N, Simon M, Dooley TP, Watt FM: Envoplakin, a novelprecursor of the corni®ed envelope that has homology to desmoplakin. J CellBiol 134:715±729, 1996

Ruhrberg C, Hajibagheri N, Parry DAD, Watt FM: Periplakin, a novel componentof corni®ed envelopes and desmosomes that belongs to the plakin family andforms complexes with envoplakin. J Cell Biol 135:1835±1849, 1997

Rybojad M, Leblanc T, Flageui B, et al: Paraneoplastic pemphigus in a child with aT-cell lymphoblastic lymphoma. Br J Dermatol 128:418±422, 1993

Skaria M, Jaunin F, Hunziker T, et al: IgG autoantibodies from bullous pemphigoidpatients recognize multiple antigenic reactive sites located predominantlywithin the B and C subdomains of the COOH-terminus of BP230. J InvestDermatol 114:998±1004, 2000

Stanley JR: Pemphigus and pemphigoid as paradigm of organ-speci®c, autoantibody-mediated diseases. J Clin Invest 83:1443±1448, 1989

Stanley JR, Yaar M, Hawley-Nelson P, Katz SI: Pemphigus antibodies identify a cellsurface glycoprotein synthesized by human and mouse keratinocytes. J ClinInvest 70:281±288, 1982

Stevens HP, Ostlere LS, Black MM, Nishikawa T, Hashimoto T, Bhogal BS, RustinMHA: Paraneoplastic pemphigus as a presenting feature of an occultlymphoma. Eur J Dermatol 4:26±29, 1994

Sugi T, Hashimoto T, Hibi T, Nishikawa T: Production of human monoclonal anti-basement membrane zone (BMZ) antibodies from a patient with BP (BP) byEpstein-Barr virus transformation. Analyses of the heterogeneity of anti-BMZantibodies in BP sera using them. J Clin Invest 84:1050±1055, 1989

Tanaka M, Hashimoto T, Amagai M, et al: Characterization of BP antibodies by useof recombinant BP antigen proteins. J Invest Dermatol 97:725±728, 1991

Vanderlugt CJ, Miller SD: Epitope spreading. Curr Opin Immunol 8:831±836, 1996


Paraneoplastic Pemphigus Sera React Strongly with Multiple Epitopes on the Various Regions of...

Documents

Transcript of Paraneoplastic Pemphigus Sera React Strongly with Multiple Epitopes on the Various Regions of...