PAGE #1 OF PAGE #1 O PART# SUB-1739 2015 SUBARU ......the mounting tabs through the grille. Use a...
Transcript of PAGE #1 OF PAGE #1 O PART# SUB-1739 2015 SUBARU ......the mounting tabs through the grille. Use a...
2015 SUBARU IMPREZA2015 SUBARU IMPREZA UPPER GRILLE INSTUPPER GRILLE INSTALLALLPART# SUB-1739
PART# SUB-1739(3) #8 “FLAT” NUT(3) #8 X 5/8” HEX SCREWS(1) #8 “U-NUT”(1) #8 X 1” HEX SCREWS
PAGE #1 OF
For further installation details check our website installsTel:310-970-0300 Fax:310-970-0400
www.grillcraft.com
Our Project Subaru Impreza Needing aGrillCraft Grille.
Removing the 10mm bolts and Plastic Clipsholding the upper bumper retainer underneath
the hood.
In the wheel-wells, you'll need to remove theupper clip holding the bumper by pushing the
center of the clip inward, then remove it.
Underneath the bumper, remove the clipsholding the bumper cover to the lower plastics.
Once all hardware is removed, you can unclipthe bumper from the vehicle by pulling towardsyou from the wheel-well & under the bumper.
Disconnect the bumper-lights by pushing thecenter-tab inward.
Remove the upper grille shell from the bumperby unscrewing the Phillips screws along theperimeter and unclipping it from the bumper.
Place your new mesh insert into the bumperopening.
Using a sharp scribe tool, mark the locations ofthe mounting tabs through the grille.
Use a 3/16" drill bit to make the necessarymounting holes.
Recomended: Paint the area behind the grilleBLACK to give a clean, professional installation.
To do this trace the back of the grille and tapeit off in preparation for painting.
200011155555 SSSSSUBARU IMPPPPPRRRREEEEZZZZAAAA2222220000000111115 SSSSSUUUUUBBBBBBARU IMPREEEEEZZZZZAAA222222200000001111111155555555 SSSSSSUUUUUUUUBBBBBARU IMPPPPPPRRRRRRRRRREEEEEEEEZZZZZZAAAAAAAA2222200000001111115555555 SSSSSSSSSUUUUUUUBBBBBBBARU IMPRRRRRRREEEEEEEZZZZZZZAAAAAAA UPPPPPPPEEEEEERRRRR GGGRRRRILLE INSTUPPERRRRR GGGGRRRRRILLLLLLLLE INSTUPPPPPPPEEEEEEEERRRRRRRRR GGGGGGGGGRRRRRRRRIIIIIIIILLLLLLLLLLLLLLE INSTUPPEEEEEEEERRRRRRR GGGGGGGRRRRRRRIIIIIILLLLLLLLLLLLLLE INSTALLLLLLTTALLTTTTTTALLALLTTPPPPPPPPPAAAAAAAAARRRRRRRTTTTTTT######### SUBBBBBBB-----1111111117777777773333333333999999999
PPPPPPPPAAAAAAAAARRRRRRRRRRTTTTTTTT# SUBBBBBBBBB-------1111111117777777773333333399999999(3(3(3(3(3(3(3(3) ))))))) #8#8#8#8#8#8#8#8 ““““““““FFFLFFFFF AT” NUNUNUNUNUNUNUUTTTTTTTT(3(3(3(3(3(3(3) ) ) ) ))) )) #8#8#8#8#8#8#8 X X 5/8” HEXEXEXEXEXEXEXXX S S S SSSSSCRCRCRCRCRCRCRRCREEEEWEEE S(1(1(1(1(1(1((1)) ) #8 “U-NUT”(1) #8 X 1” HEX SCREWS
PAGE #1 OOOOOOOOOFFFFFFF
FFFFoFFF r further instttttttalalalalalalala laaalalalallaatitititititittit onononononononnn d d d d dd ddeeeteeeeee ails ccccccccheheheheeeheheeckckckckckckckck ooo ooooourururururururr wwwwwwwwebsite installsssssssTeTeTeTeTeTeTeTeel:l:l:l:l:l:l 313131313131333 0-0-0-0-0-00-0 9797979797997970-0-0-0-0-0-0-0-03030303030330 00 Fax:xxx:x:xxx 31313131313131310-00-0-00-0-0-0-9999799 0-0400
wwwwwww w.grillcraft.com
Oururururrurur Pr PrP Pr PrPr PrPrP ojeeojeojeojeojeoject ct ct tct cttct SubSuSububSubSubSubS aruaruaruaruaruraruaru ImImImImImImImpppprep za Needing aGriGriGriGriGririGririG llCllCllCllCllCllClCCCrafrafrafrafraffrafr t Grille.
Removing the 10mm mm mm mm mm mmmm bolbolbolbolbolbolboo ts sts tsts sst andandandandandndnd PlPlPlPlPlPlP astastastastaststasttic ic icic icicicc CCCliCCCC psholding the upppppppperererer ererr ubumbumbumbumbumbumbumbu pepeperpepepe rererererererr taitatataitataita nernernernerernerner un u u u un u derneath
theheheheheheh hohoho hohhohohood.odododododod
In nnnnnn thethehethethehehee whwwwwww eel-wells, you'll need to rro ro ro r remoemoemoemoemoememomoe ve veveeeveveee thethethetthethethetheuppuppppuppuppupp er clip holding the bumper er er er erer by by by by byby by puspuspuspuspuspuuspuspushinhhinhinhhinhinhing tg tg tg tg tg thhhehehhhhe
center of the clip inwarararararard,d,d,d,d, ddd thethethethethethhh n n n rn rn n emoemoemoemoemoemooveve ve veve veve it.itit.it.it.it.it.
UndUndUndUndUndUnddnddernernernernernernernr eateateateateatte th the bummmmmmmmperperperperperpereeer, r, r, r, r, r, r, remomomomoomoemovevevve vevvev thethethethethetheehe clclclclclclcliipshohohoholhohoh dindindindindindindidi gg tgggggg he he he hehe he he bbbumbbbb per cooooooverververververveverv to to to to to t to th thththththt e le le le le le le oweoweoweoweoweoweoow r plastics.
Once all harharharharharharrarhardwadwadwadwadwadwaare rrr is removed, yououououououu ca ca caca ca cac n un unn n un un nclnclnclnclnclncllipipipipipippthe buuuuuumpempempmpempempempemp r fr fr fr fr fr fr fr fromromromromromromrom thtththththt e vehicle bybybybybyybyby pu pu pu pu pu p p llililililililing ngng ng ng ng ngg towtowtowtowowowo ardardardardardardardrdsssssssyouyouyouyouyouyouyouyouyo frfrfr frfr frrom om om om om mom omm theththethethethetheh whwhwhwhwhwheeeeeeeeleeeeeee -well & uuuuuuundendendendendendendededer tr tr tr tr tr tr tthe eeheheehee e bumbumbumbumbumbumbumbuu perperperperperperperper.
Disconnect the bumper-lights by pushing thecentertererterterertere -ta-ta-ta-ta-ta-tab inward.
Remove thth th thh thth the ue ue ue ue e e e ppppeppeppppppp r gr ggr ggrilrilrilrilrilrri le eeee eee sheshesheshesheshehsheell lllllllll ffrom the bumperby yyyyyy unsunsunsunsunsunsunsnu creccrecrecrecrecrewinwinwinwinwinwinng tg tg tg tg tg thehehehe he hehehe PhiPhiPPhiPhiPhiPhihillillillillilliliips screws along theperperpperperperpee imeimeimemeimemeei terterterteterterterr annnn annnd ud ud ud ud ud unclncllnclnclnclnclnc ipipipippipip ing it from the bumper.
Place your new mesh iih ih ih ih iinsensensensnsnsnsns rt t rt rt rt rtt intnntntntntnto ttttto tttthehehehe hehe bumbumumumbumumumu ppperppppopeopeopeopeopepeopeninninninnininning.ggggggg
UsiUsiUsiUsiUsiUsiUs ng ng ng ng gng ng a sa sa sa sa sa ss harharharhahaharhah p scribe tool, mark the lococococococatiatatatiatiatiatiat onsonsonsonsonsonsons ooofoooothethetheththethetht mounting tabs through ttttttthe hehehe heehe hh grigrigrigriggrigrilleleleeleee.
UseUseUseUseUseUseseUse a 333/13333 6" drill bit tototototototo ma mama mama mamake ke ke ke kekekeke thethethethethethethe ne nenene ne neneecescescescescescesscese sarsasasasasasaas ymountintntntntnttt ng ngngng ngngng g hohohholhohhoh es.eses.es.eseses.es.es.
Recomendeeeed: dddddd Paint the area behinddddddd thth th thththththe ge ge ge ge gge ggrilrililrilriliilleeeeeeBLACK to to tooto to toto givgivgivgivgivgive ae ae ae ae aee clean, professioniononononnoniononal alalalal alal insnsnsnsnsinstataltatatata latatatatatttiononionononionionon.
TToTTo TToT do this trace the back of the grille and tapeit off in preparation for painting.
Place the mesh insert back into the bumperopening.
The top tab utilizes the 1" Hex Screw andmounts through the upper plactic reinforcement
on the bumper.
The side tabs attach as shown with the flat-nuts opposite to the hex-screw.
The lower screw will attach as shown throughthe bumper into the previously attached U-Nut.
Reinstall the bumper back onto vehicle andinstallation is complete. Shown here in Black.
Another view of our MX-Series Signature MeshGrilles.
PAGE #2 OF
For further installation details check our website installsTel:310-970-0300 Fax:310-970-0400
www.grillcraft.com
Another view of the painted section. Locate the included hardware. On the bottom tab of the grille, attach the pro-vided U-Clip. Smooth side faces downward.
Another view of the taped section. Once painted the bumper should look likeshown.
Another view of the painted section.
PlaPlaPlaPlaPlaPlalalace cece cececece the mesh insert back into the bumperopening.
TheTheThehTheeTheTheThe tttottottotott p tp tp tp tp tp tp tp tab abab ab ab ab ab utiutiutiutiutitit lizlizlizlizlizlizlizizeees eeee the 1" Hex Screw andmoumoumoumoumoumomoum ntsntsntsntsntsntsnts th th th th th throurourourouoorough ghgh gh ghgh ggh ttthetttt upper plactic reinforcement
on the bumper.
The side tabs as as as aaas aattattattattattattattat ch ch chhchch h as asassasas shoshoshoshoshoshsh wn wn wn wnwn wn w witwitwitwitwitwittitw hhhh thhh he flat-nutttttutts os os os os os os oppopopoppoppopopositsittsitsitsite te te te te te tee to too to to to to to he he he he he he h hexhexhexhexhexhexhehex-screw.
The lower screw will attach assss shshsh shshshhshshowowownowowowoww thh thth ththththrororouoro ghghghghgghghtheeeeeee bubu bubu bu buuub mpempmpmpmpmpmpmmp r into the previouououououuuouo slyslyslyslyslyslysly a at at at at at attactactactactactact chedededededede U- U- U- U- U-U-UU-NutNutNutNutNutNutN .
Reinstall the bumper back onto vehicle anddddddinstallation is complete. Shown here in BlBlBlBlBlBlBlackackackackacackackc .....
AnoAnoAnoAnAnoAnoA othethethethetheheeer vr vr vr vr vvviiiiewieie of our MX-SX-SX-SX-SX-S-SX-Sererererierer es eses es eses SigSigSigigSigSigSigSignature MeshGrilleleleleeees.s.s.s.s.ss
PAGE #2 OOOOOOOOOFFFFFFFFF
FFFFoFFFF r further insttttalalalalalalala lalalalalalaaalatitititititiiononononononononon dd d dd ddetetetetetetetetee ails cccccccheehehehehheheheckckckckckckckck o o o oo ooourururururururr w ww w www website installsTeTeTeTeTeTeeeel:l:l:l:l:l:l:3131313131313133 0-0-0-0-0-000-979797979797970-0-0-0-0-0-0-0 030303030303030 00 Fax:x:x:x:xx:x:3131313313131310-0-0-00-0-0-0-0-99997999 0-0400
wwwwwwww w.grillcraft.com
Anothethethethehetheer vr vr vr vr vr vr vvviewiewiewiewiewiewiew ofofofofofofofo th th th th ththhhhe pe pe pe pe pe ppainainainainainainia tetetetetedtett section. Locate the includeudeudeudeudeudeeudeud d hd d hd hhd hd hardardardardarddwarwarwarwarwarware.e.e.e.e On the bottom tab of the grille, attachhhhhh thth th th th ththt e pe pe pe pe pe ppe pro-ro-o-o---vided U-CU Clip. Smooth side faceees ds ds ds ds ds ds dowowownownowowowww warwawawawawawaa ddd. ddd
AnoAnoAnoAnoAnoAnoAnoAn thethehethethethehther vr vr vr vr vr vr vr iewiewiewiewiewiewiewwew ofofof of of offf thth th th th ththhthe e e e e teeee aped sectectecectectectectc iononononononon. Once painted the be be be be be be bbumpumpumpumpumpumpumpuum er rer erer erer e shohohohohhohoould look likeeeeeeeshoshoshoshoshoshoshownwn.wn.wnwnwnw
AnoAnoAnoAnoAnoAnoAnAn ther view of the painted sesection.