Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD...
-
Upload
shawn-patterson -
Category
Documents
-
view
216 -
download
0
Transcript of Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD...
![Page 1: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/1.jpg)
Overview of telomeres & telomerase biology: Clinical implications in cancer and aging
Meir Lahav MDLaboratory for telomere research, Rabin Medical Center, Beillinson CampusFelsenstein Medical Research Center 8 March 2010
![Page 2: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/2.jpg)
![Page 3: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/3.jpg)
Historical perspective
• 1908, McClintock & Muller“Chromosome bore a special
component at their ends that provided stability”
• Telomere: telos- end, meros- part
• 1961, Hayflick & Moorehead
“Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”.
Leonard Hayflick
![Page 4: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/4.jpg)
Biological landmarks
• 1971, Olovnikov: “Marginotomy”- the end-replication problem may account for the Hayflick limit
• 1972, Watson: DNA polymerase could not replicate chromosomes to the tip
![Page 5: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/5.jpg)
The end-replication problem
5’ 3’3’ 5’
DNA Replication
5’ 3’ R R R R
3’ 5’R
RNA primer removal
Fill-in DNA replication
Ligation 5’ 3’
3’ 5’
Each division 50-100 bp loss
![Page 6: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/6.jpg)
Biological landmarks (cont.)
• 1978, Blackburndiscovered telomeres in Tetrahymena (TTGGGG)n
• 1984, Blackburn & Greidertelomerase activity was detected in Tetrahymena
![Page 7: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/7.jpg)
Telomeric end of DNA
Genomic DNA Telomere
![Page 8: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/8.jpg)
Molecular structure of the telomere
![Page 9: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/9.jpg)
Functions of telomere [(TTAGGG)n]
• Protects the chromosomal ends from: – Recombination– End-to-end fusion– Recognition as damaged DNA
• Enables a complete replication of the DNA • Contributes to the functional organization
of chromosomes in the nucleus• Participates in regulation of gene
expression • Serves as “mitotic clock”: shortens with
each cell division
![Page 10: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/10.jpg)
Telomere length in healthy population Uziel et al. 2002
y = -27.45x + 6972.5
R2 = 0.4636
0
1000
2000
3000
4000
5000
6000
7000
8000
0 20 40 60 80 100
Age (years)
Tel
om
ere
len
gth
(b
p)
![Page 11: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/11.jpg)
Consequences of telomere shortening & damage
![Page 12: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/12.jpg)
![Page 13: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/13.jpg)
Two-step hypothesis of cellular senescence and immortalization
Wright & Shay Microbiol Mol Biol Rev 2002
![Page 14: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/14.jpg)
Telomerase
telomerase
5’ TTAGGGTTAG CAAUCCCAAUC
telomerase
5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC
telomerase
5’ TTAGGGTTAGGGTTAGGGTTAG CAAUCCCAAUC
telomerase
5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC
Telomerase
hTERT
hTR-CAAUCCCAAUC
![Page 15: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/15.jpg)
Elongation of a telomere by telomerase.
Wong L S et al. Cardiovasc Res 2009;81:244-252
Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: [email protected]
![Page 16: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/16.jpg)
Keeping telomerase in its place Maser & DePinho Nature Medicine 2002
![Page 17: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/17.jpg)
The telomere model for cellular transformation
Germ cells: telomerase ON
Somatic cells:
telomerase OFF
Immortal cells:
telomerase ONOncogeneticallytransformed cells:bypass senescence,
telomerase OFFSenescence Crisis
# of cell divisions
Telo
mere
len
gth
![Page 18: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/18.jpg)
TRF measurementsShapiro, Uziel and Lahav
2000
Southern blot FISH flow
![Page 19: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/19.jpg)
FISH on paraffin embedded tissues
![Page 20: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/20.jpg)
![Page 21: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/21.jpg)
Clinical applications of telomere research
Senescence
Cancer
![Page 22: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/22.jpg)
Acquired capabilities of cancer)Hanahan and Weinberg, Cell 100: 57-70, 2000(
![Page 23: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/23.jpg)
Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006
• Malignant conversion: – SV40 large T antigen (p53
and pRb inactivation) – Ras activation
• Malignant cells are not immortal - enter crisis and die
• Telomerase expression renders cell immortal
![Page 24: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/24.jpg)
Telomerase up-regulation cause or consequence
• Human cancer cells have– shorter telomeres then normal– dysfunctional telomeres (anaphase bridges,
ends fusions etc.,)
• Correlation between anaphase bridges and telomere length
• Human colorectal cancers show a peak in anaphase bridges index in early lesions;
![Page 25: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/25.jpg)
![Page 26: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/26.jpg)
Effect of telomerase inhibition on malignant cells growth
![Page 27: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/27.jpg)
Telomerase inhibition in cancer Lahav
2010
![Page 28: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/28.jpg)
Chemosensitization by telomeres Lahav 2009
![Page 29: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/29.jpg)
Comet assay DNA damage Lahav 2010
![Page 30: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/30.jpg)
DNA damage focci telomere dysfunction Lahav 2009
![Page 31: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/31.jpg)
Association of telomerase activity with disease free survival in non-small cell lung cancerGonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:254-262
![Page 32: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/32.jpg)
actin
hTERT
IGFI-R
CD63
actin
[ThD] g/ml 0 12.5 25 50 100
hTERT
IGFI-R
actin
CD63
[ThD] g/ml 0 12.5 25 50 100
hTERT
IGFI-R
CD63
[ThD] g/ml 0 12.5 25 50 100 RPMI 8226 U266
ARH-77
Thalidomide downregulates telomerase promoter gene expression molecular pharmacologyDruker, Uziel, Lahav et al. 2004 molec pharmacol
![Page 33: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/33.jpg)
0M 10M 15M R8
Inhibition range: 70-90% 0
20406080
100120
1 2 3 4 5
time (days)
telo
mer
ase
acti
vity
(% o
f co
ntro
l)
Kinetics of telomerase activity during Gleevec treatment
Telomerase activity after Gleevec 5 days treatment
0
20
40
60
80
100
120
1 2 3
[Gleevec](uM)
Te
lom
era
se
ac
tiv
ity
(%
)
0 10 15
Gleevec inhibits telomerase activity in SK-N-MC cellsUziel and Lahav,2005 BJC
![Page 34: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/34.jpg)
Control cells STI571 treated cells
Telomerase cellular localization in STI571 treated cells
Uziel, Beery et al 2003
![Page 35: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/35.jpg)
Telomerase as a drug target
• Significant difference of telomerase expression between malignant and normal tissues
• Possible adverse effects: damage to stem and germ cells
• Telomerase inhibitors will be effective only when the telomeres shorten to critical length
• Will probably be used as an adjuvant therapy
![Page 36: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/36.jpg)
Potential effects of telomerase inhibition over time on telomere length and proliferative capacityExperts reviews in molecular medicine 2002
![Page 37: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/37.jpg)
Strategies for inhibition of telomerase activity• Telomerase targeting
agents:– The RNA template– Reverse transcriptase
inhibitors– Modulators of telomerase
regulating proteins
• Telomeres targeting agents– Inhibitors that interact with
G4-DNA structures– Inhibitors against
telomeres associated proteins
– “Old” DNA -interacting drugs
• compounds from random screening
![Page 38: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/38.jpg)
Effect of telomerase antisense on malignant cell cultureUziel and Lahav, 2004
![Page 39: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/39.jpg)
Antimetastatic effects of GRN163L on pretreated A549-Luc cellsDikmen, Z. G. et al. Cancer Res 2005;65:7866-7873
![Page 40: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/40.jpg)
0
20
40
60
80
100
120
0 5 10 15
Vincristine (ng/ml)
pro
life
rati
on
(%
)
0
20
40
60
80
100
120
0 50 100 150
Doxorubicin (ng/ml)
pro
life
rati
on
(%
)
Control
+GRN163
Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, CisplatinumUziel and Lahav, 2006
![Page 41: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/41.jpg)
Telomerase inhibition – future directions
•New effective inhibitors
•Antitelomerase vaccines
•Antitelomerase adoptive immunotherapy
•Promoter driven therapy
•Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations
![Page 42: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/42.jpg)
Telomerase promoter-driven gene therapy
•hTERT promoter is highly active in cancer cells (not active in somatic cells)
•Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells
•Genes used– Proapoptotic genes: caspase 8, caspase 6, TRAIL,
Bax– Prodrugs– Viral lytic genes: adenoviruses
![Page 43: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/43.jpg)
Adenovirus and telomerase promoter
![Page 44: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/44.jpg)
Telomerase immunotherapy
• Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells
• T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected
• Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se.
• 12 prostate cancer patients were treated as above, majority responded positively
![Page 45: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/45.jpg)
Aging
Aging
![Page 46: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/46.jpg)
Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker
![Page 47: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/47.jpg)
![Page 48: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/48.jpg)
![Page 49: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/49.jpg)
Dolly or failure of resetting the cellular clock
Willmut et al, 1997
![Page 50: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/50.jpg)
Telomere length & survival rate
![Page 51: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/51.jpg)
Trans-differentiation of pluripotent stem cells
![Page 52: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/52.jpg)
Telomerase effect on cells
![Page 53: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/53.jpg)
Telomere binding defect in progeria
![Page 54: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/54.jpg)
Diabetes control and telomeres Lahav
2006
![Page 55: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/55.jpg)
![Page 56: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/56.jpg)
![Page 57: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/57.jpg)
Copyright ©2010 American Heart Association
De Angelis, A. et al. Circulation 2010;121:276-292
Telomere-telomerase and p53 function
![Page 58: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/58.jpg)
Histogram showing haemoglobin levels and their association with telomere length.
Wong L S et al. Eur J Heart Fail 2010;12:348-353
Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected].
![Page 59: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/59.jpg)
Telomere length in the anaemic vs. non-anaemic group.
Wong L S et al. Eur J Heart Fail 2010;12:348-353
Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected].
![Page 60: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/60.jpg)
Copyright restrictions may apply.
Farzaneh-Far, R. et al. JAMA 2010;303:250-257.
Absolute and Relative Mean Changes in Telomere Length Over 5 Years by Quartile of Omega-3 Fatty Acid Level, Adjusted for Age and Baseline Telomere Length
![Page 61: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,](https://reader030.fdocuments.us/reader030/viewer/2022033106/56649d965503460f94a7f849/html5/thumbnails/61.jpg)
Translational applications ;
•Cancer; Mechanism of malignancy
• Therapeutic approaches
•Aging; Cellular ( stem cells)
• Organism ; normal
• accelerated aging