Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD...

61
Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center, Beillinson Campus Felsenstein Medical Research Center

Transcript of Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD...

Page 1: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Overview of telomeres & telomerase biology: Clinical implications in cancer and aging

Meir Lahav MDLaboratory for telomere research, Rabin Medical Center, Beillinson CampusFelsenstein Medical Research Center 8 March 2010

Page 2: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 3: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Historical perspective

• 1908, McClintock & Muller“Chromosome bore a special

component at their ends that provided stability”

• Telomere: telos- end, meros- part

• 1961, Hayflick & Moorehead

“Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”.

Leonard Hayflick

Page 4: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Biological landmarks

• 1971, Olovnikov: “Marginotomy”- the end-replication problem may account for the Hayflick limit

• 1972, Watson: DNA polymerase could not replicate chromosomes to the tip

Page 5: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

The end-replication problem

5’ 3’3’ 5’

DNA Replication

5’ 3’ R R R R

3’ 5’R

RNA primer removal

Fill-in DNA replication

Ligation 5’ 3’

3’ 5’

Each division 50-100 bp loss

Page 6: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Biological landmarks (cont.)

• 1978, Blackburndiscovered telomeres in Tetrahymena (TTGGGG)n

• 1984, Blackburn & Greidertelomerase activity was detected in Tetrahymena

Page 7: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomeric end of DNA

Genomic DNA Telomere

Page 8: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Molecular structure of the telomere

Page 9: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Functions of telomere [(TTAGGG)n]

• Protects the chromosomal ends from: – Recombination– End-to-end fusion– Recognition as damaged DNA

• Enables a complete replication of the DNA • Contributes to the functional organization

of chromosomes in the nucleus• Participates in regulation of gene

expression • Serves as “mitotic clock”: shortens with

each cell division

Page 10: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomere length in healthy population Uziel et al. 2002

y = -27.45x + 6972.5

R2 = 0.4636

0

1000

2000

3000

4000

5000

6000

7000

8000

0 20 40 60 80 100

Age (years)

Tel

om

ere

len

gth

(b

p)

Page 11: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Consequences of telomere shortening & damage

Page 12: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 13: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Two-step hypothesis of cellular senescence and immortalization

Wright & Shay Microbiol Mol Biol Rev 2002

Page 14: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase

telomerase

5’ TTAGGGTTAG CAAUCCCAAUC

telomerase

5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC

telomerase

5’ TTAGGGTTAGGGTTAGGGTTAG CAAUCCCAAUC

telomerase

5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC

Telomerase

hTERT

hTR-CAAUCCCAAUC

Page 15: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Elongation of a telomere by telomerase.

Wong L S et al. Cardiovasc Res 2009;81:244-252

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: [email protected]

Page 16: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Keeping telomerase in its place Maser & DePinho Nature Medicine 2002

Page 17: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

The telomere model for cellular transformation

Germ cells: telomerase ON

Somatic cells:

telomerase OFF

Immortal cells:

telomerase ONOncogeneticallytransformed cells:bypass senescence,

telomerase OFFSenescence Crisis

# of cell divisions

Telo

mere

len

gth

Page 18: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

TRF measurementsShapiro, Uziel and Lahav

2000

Southern blot FISH flow

Page 19: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

FISH on paraffin embedded tissues

Page 20: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 21: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Clinical applications of telomere research

Senescence

Cancer

Page 22: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Acquired capabilities of cancer)Hanahan and Weinberg, Cell 100: 57-70, 2000(

Page 23: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006

• Malignant conversion: – SV40 large T antigen (p53

and pRb inactivation) – Ras activation

• Malignant cells are not immortal - enter crisis and die

• Telomerase expression renders cell immortal

Page 24: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase up-regulation cause or consequence

• Human cancer cells have– shorter telomeres then normal– dysfunctional telomeres (anaphase bridges,

ends fusions etc.,)

• Correlation between anaphase bridges and telomere length

• Human colorectal cancers show a peak in anaphase bridges index in early lesions;

Page 25: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 26: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Effect of telomerase inhibition on malignant cells growth

Page 27: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase inhibition in cancer Lahav

2010

Page 28: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Chemosensitization by telomeres Lahav 2009

Page 29: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Comet assay DNA damage Lahav 2010

Page 30: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

DNA damage focci telomere dysfunction Lahav 2009

Page 31: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Association of telomerase activity with disease free survival in non-small cell lung cancerGonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:254-262

Page 32: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

actin

hTERT

IGFI-R

CD63

actin

[ThD] g/ml 0 12.5 25 50 100

hTERT

IGFI-R

actin

CD63

[ThD] g/ml 0 12.5 25 50 100

hTERT

IGFI-R

CD63

[ThD] g/ml 0 12.5 25 50 100 RPMI 8226 U266

ARH-77

Thalidomide downregulates telomerase promoter gene expression molecular pharmacologyDruker, Uziel, Lahav et al. 2004 molec pharmacol

Page 33: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

0M 10M 15M R8

Inhibition range: 70-90% 0

20406080

100120

1 2 3 4 5

time (days)

telo

mer

ase

acti

vity

(% o

f co

ntro

l)

Kinetics of telomerase activity during Gleevec treatment

Telomerase activity after Gleevec 5 days treatment

0

20

40

60

80

100

120

1 2 3

[Gleevec](uM)

Te

lom

era

se

ac

tiv

ity

(%

)

0 10 15

Gleevec inhibits telomerase activity in SK-N-MC cellsUziel and Lahav,2005 BJC

Page 34: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Control cells STI571 treated cells

Telomerase cellular localization in STI571 treated cells

Uziel, Beery et al 2003

Page 35: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase as a drug target

• Significant difference of telomerase expression between malignant and normal tissues

• Possible adverse effects: damage to stem and germ cells

• Telomerase inhibitors will be effective only when the telomeres shorten to critical length

• Will probably be used as an adjuvant therapy

Page 36: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Potential effects of telomerase inhibition over time on telomere length and proliferative capacityExperts reviews in molecular medicine 2002

Page 37: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Strategies for inhibition of telomerase activity• Telomerase targeting

agents:– The RNA template– Reverse transcriptase

inhibitors– Modulators of telomerase

regulating proteins

• Telomeres targeting agents– Inhibitors that interact with

G4-DNA structures– Inhibitors against

telomeres associated proteins

– “Old” DNA -interacting drugs

• compounds from random screening

Page 38: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Effect of telomerase antisense on malignant cell cultureUziel and Lahav, 2004

Page 39: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Antimetastatic effects of GRN163L on pretreated A549-Luc cellsDikmen, Z. G. et al. Cancer Res 2005;65:7866-7873

Page 40: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

0

20

40

60

80

100

120

0 5 10 15

Vincristine (ng/ml)

pro

life

rati

on

(%

)

0

20

40

60

80

100

120

0 50 100 150

Doxorubicin (ng/ml)

pro

life

rati

on

(%

)

Control

+GRN163

Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, CisplatinumUziel and Lahav, 2006

Page 41: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase inhibition – future directions

•New effective inhibitors

•Antitelomerase vaccines

•Antitelomerase adoptive immunotherapy

•Promoter driven therapy

•Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations

Page 42: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase promoter-driven gene therapy

•hTERT promoter is highly active in cancer cells (not active in somatic cells)

•Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells

•Genes used– Proapoptotic genes: caspase 8, caspase 6, TRAIL,

Bax– Prodrugs– Viral lytic genes: adenoviruses

Page 43: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Adenovirus and telomerase promoter

Page 44: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase immunotherapy

• Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells

• T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected

• Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se.

• 12 prostate cancer patients were treated as above, majority responded positively

Page 45: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Aging

Aging

Page 46: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker

Page 47: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 48: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 49: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Dolly or failure of resetting the cellular clock

Willmut et al, 1997

Page 50: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomere length & survival rate

Page 51: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Trans-differentiation of pluripotent stem cells

Page 52: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomerase effect on cells

Page 53: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomere binding defect in progeria

Page 54: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Diabetes control and telomeres Lahav

2006

Page 55: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 56: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,
Page 57: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Copyright ©2010 American Heart Association

De Angelis, A. et al. Circulation 2010;121:276-292

Telomere-telomerase and p53 function

Page 58: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Histogram showing haemoglobin levels and their association with telomere length.

Wong L S et al. Eur J Heart Fail 2010;12:348-353

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected].

Page 59: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Telomere length in the anaemic vs. non-anaemic group.

Wong L S et al. Eur J Heart Fail 2010;12:348-353

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2010. For permissions please email: [email protected].

Page 60: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Copyright restrictions may apply.

Farzaneh-Far, R. et al. JAMA 2010;303:250-257.

Absolute and Relative Mean Changes in Telomere Length Over 5 Years by Quartile of Omega-3 Fatty Acid Level, Adjusted for Age and Baseline Telomere Length

Page 61: Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center,

Translational applications ;

•Cancer; Mechanism of malignancy

• Therapeutic approaches

•Aging; Cellular ( stem cells)

• Organism ; normal

• accelerated aging