· OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert...

38
www.osram.com/hospitality "Alice" Suite, Hôtel Le Seven, Paris, France Hospitality. Light solutions to feel good.

Transcript of · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert...

Page 1: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

www.osram.com/hospitality

"Alice" Suite, Hôtel Le Seven, Paris, France

Hospitality.Light solutions to feel good.

Page 2: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

2

Creating the future of light with OSRAM

The lighting market is going through a period of technologi-cal change, with semiconductor-based technologies such asLEDs and OLEDs presenting customers with new possibili-ties in terms of effi ciency, quality of light and fl exibility. As a premium supplier, OSRAM is playing a leading role here.

For more than 100 years, the trademark OSRAM standsfor innovative and sustainable developments in the globallighting market. Today, OSRAM is one of the world’s largest suppliers of products and solutions for a wide range of customer requirements – from lamps and LED modules toluminaires and high-effi ciency light management systems.

OSRAM focuses all its resources on the subject of light, actively supporting its customers in making the best choices to meet their individual requirements. With more than 40000 employees in around 150 countries, OSRAMdevelops tailor-made solutions to cover the specifi c needs of its customers.

ABOUT OSRAM

Page 3: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

3

Passion for light, solutions for life.

Change is written into our DNA. OSRAM develops intelligentand sustainable products to help conserve resources world-wide and to improve the quality of life through light. Artifi cial lighting is responsible for around 20 percent of worldwide power consumption. This means that highly energy-effi -cient lighting can save as much CO2 worldwide as can be absorbed by a forest twice the size of Italy. At present, more than 70 percent of our turnover comes from energy-saving lighting solutions.

LED technology is already a crucial factor here. LED-based products now account for around 25 percent of OSRAM’s total sales. OSRAM covers the entire LED value-added chain, from components to light management solutions. And with around 8000 LED patents, OSRAM has a considerable in-fl uence on the further development of LED technologies.

As a “pure light player”, OSRAM is a strong global brand, and as a leading innovator in all application and technology sectors it is shaping the digital future of the lighting industry.

Fiscal Year 2011 (ended September 30, 2011)

ABOUT OSRAM

Page 4: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

4

Providing the right atmosphere in all locations: Lighting for hospitality

Page 5: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

5

About OSRAM 2-3Introduction 4-5Facade 6-7Signage 8-9Lobby 10-11Reception 12-13Corridor and circulation area 14-15Guest room 16-17Restaurant and bar 18-19Conference room 20-21Fitness and wellness 22-23Cellar and garage 24-25Products 26-27Light management systems 28-29LED competence 30-31Siteco 32-33Traxon 34-35Brochure and catalog overview 36-37

People visit hotels for the most varied of reasons: To revive, to work, to enjoy or to experience something. For whatever reason you go into an establishment you want to feel at home - be it for weeks, days or just for a few hours.

The right lighting is an important component in the creation of an atmosphere where people feel comfortable. With a comprehensive portfolio of innovative and energy-effi cient luminaires, lamps, LED modules and light management systems, OSRAM will support you in the creation of such lighting atmospheres - for the most varied of types of hotel as well as for each individual hotel area.

All we do is light.And light is all we do.

INTRODUCTION

Page 6: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

6

“ What characterizes the perfect light solutionfor facades? Maximum attention withminimum expenditure.”

SUB-APPLICATIONSUB-APPLICATION

Enrico Tamaro · Responsible Traxon Business Development · OSRAM Italy

Yas Viceroy Hotel, Abu Dhabi, United Arab Emirates

Page 7: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

7

FACADE

Showing character, even from a distance: Facade

The facade plays a decisive role in the perception of a hotel. It is here that the hotel presents its character to the outside world, here where people become aware of the style, the atmosphere and specialties of the establishment.

As an integral constituent of the facade, OSRAM lighting solutions accentuate the special character of the architecture without compromising it. Intelligent sensor and control systems allow the systems to adapt to the outdoor brightness and ensure a lasting impression in all weather conditions. In combination with flexible color LED modules, control units for dynamic regulation can create unique effects. In rational combinations and applications, these technologies always ensure the highest levels of attention.

Wall Washer Shield AC XBSpotlights for illumination from a distance,IP66

Colored T5 HEColored lamp for accentuation/identifi cation

POWERBALL HCI®-TSImproved version for more light and better color reproduction

LINEARlight Flex® ProtectFlexible linear LED module, IP67

EASY Color ControlLight control system for static and dynamic light-ing for RGB and white light

SensorsFor daylight dependent regulation or presence/ motion dependent control

Page 8: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

8

SIGNAGE

“ People acquire 80 percent of all information through their eyes. Light by OSRAM makes sure that it is the right information.”Michael Lindner · Account Manager, Retail · OSRAM Germany

Make an impression efficiently: Signage

To acquire attention using signage is not easy these days.People are swamped with information and so insertingindividual text into the consciousness of the passers-by ismore difficult than ever.

Innovative technologies by OSRAM will help you with thesolution of this problem. In addition to its low level of energyconsumption, they provide a convincing argument with theirvery long service life. The result: highest level of attention,extreme flexibility with maximum efficiency and particularlylow maintenance.

LUMILUX® XXT T8 FamilyExtremely long service life and very reliable (lowtotal lighting costs)

SubstiTUBE® Advanced in CCG operationLED lamp as replacement of T8 fl uorescent lampfor robust lighting tasks in CCG operation

BackLEDFlexible LED module for uniform illumination

DALI® MCUSimple manual dimmer solution for up to 25 DALIECGs, in parallel up to 100

EASY Color ControlLight control system for static and dynamic light-ing for RGB and white light

SensorsFor daylight dependent regulation and motiondependent control

Page 9: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

9

Hotel Atlantic Kempinski, Hamburg, Germany

Page 10: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

10

SUB-APPLICATIONSUSUSUSUSUSUSUSUSUUSUSUSUSUSUSSUSUUSUSUUSUSS B-B-B-B-B-B-B-B-B-B-B-B-B-B-B---B-B---BBBB APAPAPAPAPAPAPAPAPAPAPAPPPAPAPAPPAAPPPAPPPAPPLPLPLPLPLPLPLPLPLPLPLLPLLPLPLLLPLPLLPLLLLLLLICICICICIICICICICICICICCICCICICICIICIICCCCCICATATATATATATATATATATATAAATAATATAAAAATATAA IOIOIOIOIOIOIOIOOIOOOOOIOIOOIOOIOIOIOOOOOOOONNNNNNNNNNNNNNNNNNNN

Hotel Concorde, Berlin, Germany

For the perfect atmosphere: Lobby

In the same way as people coming together, the first impression is createdwhen entering the hotel. The lighting in the lobby therefore plays an important role in the assessment by the guests.

The key is the interaction between decorative and functional lighting: Goodlighting always ensures, along with a cozy atmosphere, easier orientationfor the guests. OSRAM technologies support you in the creation of the mostpleasant atmosphere in the entrance area.

Page 11: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

11

LOBBY

“ The best impression?Feel at home!”Lee Richards · Director, Global Key Account Management GroupTraxon United Kingdom

LUNIS® QDimmable downlight with tunable color temperature

Tecario®

Versatile light-channel in recessed, mounting orpendant installation

OSRAM DULUX® INTELLIGENT DIMDimmable in various different versions

HALOGEN ECO PRO CLASSIC BDirect replacement of conventional incandescent lamp

LUMILUX® T5 SEAMLESS (HE and HO)Continuous strip light without dark areas orshadows

PARATHOM® Classic A Advanced 320°Highly effi cient, dimmable, warm white light

COINlight® AR111Simple integration in AR111 luminaires

LINEARlight Flex®

Flexible linear LED module

EASY Color ControlLight control system for static and dynamiclighting for RGB and white light

DALIeco2 channel DALI system for daylight-dependent regulation with presence function

Page 12: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

12

RECEPTION

Preparing a pleasant reception: Reception

Reception is a place for communication. The lighting shouldmake the contact between the guest and staff as pleasant and relaxed as possible.

Reception lighting by OSRAM makes it particularly simple to create a balanced mixture of working light and atmosphericlighting. Using intelligent control systems, it makes sure thatthe most varied of light sources, such as direct and indirect lighting, are combined in an optimum manner.

OSRAM DULUX® T/E PLUSVery compact and dimmable

PARATHOM® PRO MR16 AdvancedReplacement of MR16 low voltage halogenrefl ector lamps

POWERBALL HCI®-TF Very compact

LINEARlight-DRAGON® SlimSlim linear LED module in robust aluminum housing

LINEARlight Flex®

Flexible linear LED module

DALI® MCUSimple manual dimming solution for up to 25 DALI ECGs, in parallel up to 100

EASY Color ControlLight control system for static and dynamic lighting for RGB and white light

DALIeco2 channel DALI system for daylight-dependent regulation with presence function

LEDVANCE® Powerspot MFreely adjustable luminaire for track systems

Tecario®

Versatile light-channel in recessed, mounting or pendant installation

Page 13: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

13

“ A perfect reception area is simply the best start.”

Hotel Radisson Blu, Frankfurt, Germany

Isabel Zündorff · Application Manager Hospitality · OSRAM Germany

Page 14: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

14

“ The right light gives each room its structure - and gives all guests a feeling of security.”

Hotel Silken Puerta América, Madrid, Spain

Ana Isabel Sequeira · Sales Marketing Communications · OSRAM Portugal

Page 15: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

15

CORRIDOR AND CIRCULATION AREA

Feeling good and safe: Corridor and circulation area

The elongated even shape of all corridors instills a feeling of insecurity in most people. For this reason, it is decisive to choose the correct lighting.

OSRAM lighting solutions give a roomy atmosphere to corridors and circulation areas and convert them to spacious areas with a pleasant feeling. Recessed luminaires with strong lighting and particularly intensive LED light sources provide a feeling of safety. Intelligent light management systems ensure cost effective and efficient operation.

CW 91/96Recessed wall luminaire with closing ring made out of stainless steel

LEDVANCE® DOWNLIGHT LPowerful recessed luminaires

OSRAM DULUX® SQUAREExtremely fl at design and uniform light

LUMILUX® T5 SEAMLESS (HE and HO)Continuous strip light without dark areas or shadows

PARATHOM® PRO PAR16 AdvancedReplacement of PAR16 halogen lamps

DRAGONpuck®

Effi cient alternative to MR11/MR16 lighting with up to 100 lm/W

SensorsFor daylight dependent regulation or presence/motion dependent control

Page 16: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

16

GUEST ROOM

Michael Reithmeier · Senior Director OSRAM Lighting Services Global Lighting DesignOSRAM Germany

“ Enter, flick the switch, feel good:modern lighting solutions make it reallyeasy for the guest.”

Adapting to all requirements: Guest room

Why do people feel at home at home? Because they have it, themselves,adapted to their requirements and preferences. A good lighting solutionoffers the guest the facility to do exactly that in their hotel room.

OSRAM solutions make lighting adaption child's play, whether your guestswould like to revive, work or read. They can, for example, use a combinationof dimming ceiling lights and innovative control elements to simply controlthe brightness and distribution of the light in the room themselves.

Page 17: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

17

Fraunhofer FutureHotel, Duisburg, Germany

KIT Halo ProEasy to use halogen recessed luminaire

LUNIS® QDimmable downlight with tunable colortemperature

OSRAM DULUX® SUPERSTAR MINI BALLParticular compact

HALOGEN ECO PRO CLASSIC ADirect replacement of conventional incandescentlamp

LEDinestra®

Durable replacement for incandescent tube

LUMILUX® T5 SEAMLESS (HE and HO)Continuous strip light without dark areas or shadows

COINlight® ProEffi cient integration in MR16 luminaires

DALI® MCUSimple manual dimming solution for up to 25 DALIECGs, in parallel up to 100

EASY Touch Panel2 in 1: operating interface and control device withversatile functions

Page 18: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

18

Cruise liner “Celebrity Solstice”

Providing atmosphere: Restaurant and bar

Guests visit the restaurants and bars for most varied of reasons andopportunities. From a more discreet and restrained atmosphere for diningto an exciting atmosphere for parties, a wide range of moods need to beprovided.

Modern and flexible lighting solutions by OSRAM allow highly diverse lightconcepts to be realized in a room. In this way, you can adjust the lightingmood simply and perfectly to the individual demand at any time. The specialLED solutions are so compact that they can easily be integrated in thearchitecture. At the same time, sufficient lighting of pathways and workingareas provides for the safety of the personnel at all times.

Page 19: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

19

RESTAURANT AND BAR

“ Service is in the background, the guest is in the foregroundand enjoyment in the center– perfect.”Andreas Bär · SSL Regional Manager · OSRAM Germany

1PXL BOARDEasy to install modular board system in RGB

DECOSTAR® 51 ECOCombines economy and luminosity with highest quality

OSRAM DULUX® INTELLIGENT DIM Twist Very compact and dimmable

LUMILUX® T5 SEAMLESS (HE and HO)Continuous strip light without dark areas orshadows

PARATHOM® Classic A Advanced 320°Highly effi cient, dimmable, warm white light

COINlight® AR111Simple integration in AR111 luminaires

LINEARlight Flex®

Flexible linear LED module

DALI® PROFESSIONALLight control system for large rooms or several individual rooms

EASY Color ControlLight control system for static and dynamiclighting for RGB and white light

Page 20: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

20

CONFERENCE ROOM

Adapt to any occasion: Conference room

Conference rooms are multi-function rooms. Presentationsand discussion groups take place here, big events andquiet working in large groups also – in some cases all in a single day.

Modern light control systems by OSRAM make speciallighting for all these applications as easy as possible.Modern touchscreen controllers even make it possible for your guests to choose the desired lighting mood from pre-programmed light scenarios – from lighting for lectures via light for concentrated working to exciting lighting forbrainstorming applications.

Apollon® IICombines timeless design and highest effi ciency

Quadrature® 2 LEDAward-winning design combined with excellentlight quality.

OSRAM DULUX® T/E PLUSVery compact and dimmable

HALOSTAR® ECOIdeal for "starlight canopies" and furnitureluminaires

LUMILUX® T5 SEAMLESS (HE and HO)Continuous strip light without dark areas orshadows

PARATHOM® PRO MR16 AdvancedReplacement of MR16 low voltage halogen refl ector lamps

COINlight® AR111Simple integration in AR111 luminaires

LINEARlight Flex®

Flexible linear LED module

DALI® PROFESSIONALLight control system for large rooms or severalindividual rooms

EASY Touch Panel2 in 1: operating interface and control device with versatile functions

Page 21: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

21

Hans-Peter Birkhofer · Head of New Business Development · OSRAM Germany

Hotel InterContinental, Düsseldorf, Germany

“ Where work is being carried out you should be able to adjust the lighting to the most varied of requirements. Ideally by pressing a button.”

Page 22: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

222222

FITNESS AND WELLNESS

Hotel Bayerischer Hof, Munich, Germany

“ A spa plays a decisive role in modern hotels. And the lighting plays multiple roles.”Keith M. Pierce · National Account Manager · OSRAM SYLVANIA, USA

Page 23: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

23

Revive and be active: Fitness and wellness

Wellness and fitness areas in modern hotels are two areas where the right lighting has to meet two fundamental requirements: Activation and reviving.

Modern light solutions by OSRAM support the guests both in relaxation and with sporting activities. For example, indirect LED light sources produce colored soft light that promotes recovery and reviving. In contrast, strong light-emitting luminaires and lamps enhance performance and motivation for the sports fan.

CL WandDampproof wall luminaire with glass cover without screws

LEDVANCE® DOWNLIGHT M DIMMid-sized recessed powerful LED luminaire,dimmable

HALOSTAR® ECOIdeal for “starlight canopies” and furnitureluminaires

LUMILUX® T5 HO CONSTANTOptimized for hot ambient temperatures

PARATHOM® PRO MR16 AdvancedReplacement of MR16 low voltage halogen refl ector lamps

LINEARlight Flex® ProtectFlexible linear LED module IP67

DALI® PROFESSIONALLight control system for large rooms or severalindividual rooms

EASY Color ControlLight control system for static and dynamic lighting for RGB and white light

Page 24: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

24

Bavaria Parking Garages, Munich, Germany

Page 25: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

25

CELLAR AND GARAGE

“ In areas where there is no daylight, the rightlighting provides orientation and safety. And we provide the optimum solutions.”Lawrence Chan · Senior Manager, Business Development, Asia Pacifi c · OSRAM China

Providing orientation: Cellar and garage

In underground garages and cellars the lack of daylighthinders orientation. The right lighting helps to enhance thefeeling of safety in your guests. For this reason, these areasmust be perfectly lit 365 days a year 24 hours a day, whichcalls for specially energy-efficient solutions.

Lighting solutions by OSRAM help to make barriers,obstacles and other persons visible in good time and helpsin finding your way. In these applications LED luminairesimpress, not only with their especially high efficiency butalso with an extraordinarily long service life.

AQUALINE™ T5Effi cient batten damp-proof luminaire

Monsun® LEDEnergy-effi cient LED-damp-proof luminaire with asystem-lifespan of up to 40,000 hours

OSRAM DULUX® T/E PLUSVery compact and dimmable

LUMILUX® T5 HO CONSTANTOptimized for outdoor applications or hot compactluminaires

SubstiTUBE® EXT AdvancedEnergy-saving alternative to conventional T8 shape with external CCG fornew luminaires

DALI® PROFESSIONALLight control system for large rooms or several individual rooms

SensorsFor motion dependent control

Page 26: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

26

Facade Signage Lobby Reception

Lum

inai

res

> 1PXL Board

> Apollon® II

> AQUALINE™ T5

> CL Wand

> CW 91 / 96

> KIT Halo Pro

> LEDVANCE® DOWNLIGHT L

> LEDVANCE® DOWNLIGHWT M DIM

> LEDVANCE® Powerspot M ●

> LUNIS® Q ●

> Monsun® LED

> Quadrature® 2 LED

> Tecario® ● ●

> Wall Washer Shield AC XB ●

Lam

ps

> Colored T5 HE ●

> DECOSTAR® 51 ECO

> HALOGEN ECO PRO CLASSIC A

> HALOGEN ECO PRO CLASSIC B ●

> HALOSTAR® ECO

> LEDinestra®

> LUMILUX® T5 HO CONSTANT

> LUMILUX® T5 SEAMLESS (HE and HO) ●

> LUMILUX® XXT T8 Family ●

> OSRAM DULUX® INTELLIGENT DIM ●

> OSRAM DULUX® INTELLIGENT DIM Twist

> OSRAM DULUX® SQUARE

> OSRAM DULUX® SUPERSTAR MINI BALL

> OSRAM DULUX® T/E PLUS ●

> PARATHOM® Classic A Advanced 320° ●

> PARATHOM® PRO MR16 Advanced ●

> PARATHOM® PRO PAR16 Advanced

> POWERBALL HCI®-TF ●

> POWERBALL HCI®-TS ●

> SubstiTUBE® Advanced in CCG operation ●

> SubstiTUBE® EXT Advanced

LED

mod

ules

> BackLED ●

> COINlight® AR111 ●

> COINlight® Pro

> DRAGONpuck®

> LINEARlight-DRAGON® Slim ●

> LINEARlight Flex® ● ●

> LINEARlight Flex® Protect ●

Ligh

t man

agem

ent s

yste

ms > DALI® MCU ● ●

> DALI® PROFESSIONAL

> DALIeco ● ●

> EASY Color Control ● ● ● ●

> EASY Touch Panel

> Sensors ● ●

PRODUCTS

Products

Page 27: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

27

Corridor and circulation area

Guest room Restaurant and bar Conference room Fitness and wellness Cellar and garage

● ●

● ●

● ● ● ●

● ●

● ●

● ●

● ● ● ●

● ●

● ●

● ●

PRODUCTS

Page 28: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

LIGHT MANAGEMENT SYSTEMS

The right light,in the right amount, at the right time,in the right location.Thanks to modernlight management.

The right light reduces energy consumption, promoteswell-being and increases productivity. In addition to thetechnical and architectural aspects of light planning, light management systems (LMS) therefore play an importantrole in the holistic approach to lighting design. Energysavings thanks to innovative control equipment and sen-sors, daylight-dependent control systems, dynamic RGB and white light applications or manual selection of individ-ual lighting scenes – all this is possible with light manage-ment systems from OSRAM, and much more. Whether in-tegrated into luminaires or as an independent system, our light management solutions are always adapted to the specifi c requirements of the particular area of application.

28282888888882888882822888888888888888888888888

Page 29: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

29

LIGHT MANAGEMENT SYSTEMS

OSRAM offers professional light management systems forlighting in industry, shops, hospitality, offi ces, streets and even for architainment lighting. ENCELIUM – the completelight management system at building level – allows you toachieve maximum energy savings, short payback timesand considerable improvements in workplace lighting.When applied with user-friendly 3D software and freely-addressable switching and dimming functions, ENCELIUMgenerates optimal light quality at any time and in anylocation, without using more energy than necessary.Thanks to the combination of daylight and presencesensors, a variable load distribution and the presettingof the lighting level and operating time, energy savings of up to 75 % can be achieved. For this purpose, ENCELIUMcan be integrated into the existing building managementsystem.

e:cue light management systems are the best choice ifyou wish to implement comprehensive LED-based archit-ainment lighting. As the leading manufacturer for therealization of high-quality and dynamic lighting solutions,they ensure that all lighting projects are presentedprofessionally.

Street Light Control (SLC) is the perfect light management system for street lighting. SLC allows the regulation of in-dividual light points and the programming of need-basedlighting scenarios. Targeted demand-oriented lighting con-trol can signifi cantly lower energy consumption by up to40 % per year. Moreover, CO2 emission and light pollution can also be reduced correspondingly. Central monitoringand analysis of the system leads to the optimization of maintenance planning and a reduction in the associatedcosts. In addition, traffi c safety is increased because thelevel of lighting is adapted to the actual requirements.

Page 30: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

30

LED COMPETENCE OF OSRAM

Lighting solutions for today with excellent effi ciency

Innovative LED technology from OSRAM provides majorbenefi ts for luminaire manufacturers, lighting designersand end users alike.

Due to their outstanding energy effi ciency, high light qualityand numerous application possibilities, LEDs are today’s most fl exible sources of light. Their rugged ness, along with their extremely long service life time, ensures low mainte-nance requirements and long replacement intervals, pro-viding low total cost of ownership over time.

LED products from OSRAM can be installed and used almostanywhere: They provide perfect illumination in domestic,industrial or offi ce environments. They create a pleasant ambience in restaurants, hotels, shops or other placesopen to the public. And outdoors, they can be used tohighlight architectural details, such as facades, towers orentire buildings, to name just a few.

As the highly competent and experienced manufacturer, OSRAM offers a broad range of LED products – from LED lamps, modules, light engines, drivers and controllers to entire luminaires. Even customized LED modules can be produced in order to meet individual requirements. Andthanks to perfectly matched components, everything canbe easily combined, creating highly effi cient, easy-to-useLED system solutions.

LED technology from OSRAM provides perfect illumination for all areas of application

Page 31: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

31

LED COMPETENCE OF OSRAM

Page 32: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

32

SITECO

Siteco – a powerful addition

Page 33: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

33

SITECO

Luminaires and lighting systems now account for morethan two-thirds of the worldwide lighting market. Withthe successful acquisition of Siteco Beleuchtungstechnik GmbH, OSRAM AG has enhanced its reputation as asupplier of lighting solutions by adding an extensive rangeof modern products to its portfolio of indoor and outdoor luminaires.

The acquisition of Siteco – and the combination of theexpertise of OSRAM and Siteco – has strengthened thecompanies’ position in the worldwide market for innovativelighting technology – for example with LED-based lighting systems, versatile control gears and advanced light manage ment systems, as well as classic energy-saving lamps and complete luminaires.

For more information about Siteco’s innovative lightingsolutions, please visit www.siteco.com, where you canalso download or order catalogs and brochures.

Page 34: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

34

TRAXON

Double the power for new ideas in lighting:OSRAM and Traxon Technologies

Traxon Technologies, together with its control brand e:cue,is a global leader in solid state lighting and control systemsproviding complete, sustainable and intelligent lighting so-lutions. Working with an extensive partner network, TraxonTechnologies transforms creative visions into unforgettablelighting experiences, elevating architectural, entertainment, hospitality and retail environments around the world.

Flexibility, simplicity and innovation are the guiding princi-ples of the company. These values drive and shape everyworking process – from product development to planningand on-site project management to the fi nal customizedsolution.

Among the customers and partners of Traxon Technologiesare the leading companies in international lighting design,architecture and engineering. Together with them, Traxonand e:cue have completed over 4000 installations world-wide, including renowned architectural landmarks such as

the Yas Hotel in Abu Dhabi, the Esprit fl agship store in Frankfurt and the Christ statue in Rio de Janeiro. The company’s product portfolio has won many prestigious awards, such as the iF Design Award, the Red Dot Design Award and the LFI Innovation Award, and therefore standsfor innovation, aesthetic design and creativity.

Traxon Technologies, a joint venture with OSRAM partici-pation since 2009, was completely acquired by OSRAM in2011, thus strengthening the position of the company in the market by combining knowledge and experience intechnology and marketing, and building on synergies withOSRAM’s global presence.

For more information about Traxon’s innovative lighting solutions, please visit www.traxontechnologies.com, where you can also download or order catalogs and brochures.

Page 35: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

35

TRAXON

Page 36: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

36

Retail. Light solutions that incite wishful thinking.

www.osram.com/retail

Industry/Logistics.Light solutions that really work.

www.osram.com/industry

Cities, roads, pathways and city squares.Light solutions to ensure safety and create a good atmosphere.

www.osram.com/street

www.osram.com/office

Office buildings. Light solutions that you can work with.

Sports facilities. Light solutions that inspire.

www.osram.com/sport

Industry/Logistics.Light solutions that really work.

Offi ce buildings. Light solutionsthat you can work with.

Retail. Light solutions that incitewishful thinking.

Sports facilities.Light solutions that inspire.

Cities, roads, pathways and openareas. Light solutions for safetyand atmosphere.

Page 37: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

37

BROCHURE AND CATALOG OVERVIEW

www.osram.com

Luminaire Program2012

www.osram.com

Lighting Program2012/2013

LED light designLED modulesLED light sourcesLED ballast and dimmersLight management systemsLED lampsLED lamps

Indoor lampsOutdoor lamps

LED lampsLED systemsHalogen lampsCompact fl uorescent lampsFluorescent lampsDischarge lampsDisplay and signal lampsGeneral illuminationElectronic control gearsLight management systems

Lighting Atmosphere and emphasisMedial solutionsFacade solutionsControl softwareControl EnginesUser terminalsInterfaces & accessories

Standard lampsLinear fl uorescent luminary DownlightsWall and ceiling lightsSales furniture lightingTrunking systems Wet room lightingHall lightingSecondary refl ector systemsFacade and pathway lightingLight management

Facade and pathway lightingCity and park lightingStreet lightingLamps for special applicationsHeadlamps and fl oodlightsSecondary refl ector systemsTunnel lightingLight management

LED Programincl. Light management systems

2012

www.osram.com

Page 38: · OSRAM lighting solutions give a roomy atmosphere to corridors an d circulation areas an d convert t hem to spac ious areas with a pleasant feeling. Recessed luminaires with strong

OSRAM AG

Head Offi ceHellabrunner Strasse 181543 MunichGermanyPhone +49 (0) 89-6213-0Fax +49 (0) 89-6213-20 20www.osram.com

www.osram.com/hospitality

RM M

K AB

Sub

ject

to c

hang

e w

ithou

t not

ice.

Err

ors

and

omis

sion

exc

epte

d.7Z

ZK00

2GB

07/1

2 OS

RAM

CR