Optimizing CRISPR/Cas9 technology for precise correction ofthe Fgfr3-G374R mutation in achondroplasia in miceReceived for publication, October 30, 2018, and in revised form, November 26, 2018 Published, Papers in Press, November 28, 2018, DOI 10.1074/jbc.RA118.006496

Kai Miao‡§1, Xin Zhang‡¶1, Sek Man Su‡§, Jianming Zeng‡§, Zebin Huang‡§, Un In Chan‡¶, Xiaoling Xu‡§¶2,and X Chu-Xia Deng‡§3

From the ‡Cancer Center, Faculty of Health Sciences and the §Centre for Precision Medicine Research and Training, Faculty ofHealth Sciences, University of Macau, Macau SAR and the ¶Transgenic and Knockout Core, Faculty of Health Sciences, University ofMacau, Macau SAR, China

Edited by Xiao-Fan Wang

CRISPR/Cas9 is a powerful technology widely used forgenome editing, with the potential to be used for correcting awide variety of deleterious disease-causing mutations. However,the technique tends to generate more indels (insertions anddeletions) than precise modifications at the target sites, whichmight not resolve the mutation and could instead exacerbate theinitial genetic disruption. We sought to develop an improvedprotocol for CRISPR/Cas9 that would correct mutations with-out unintended consequences. As a case study, we focused onachondroplasia, a common genetic form of dwarfism defined bymissense mutation in the Fgfr3 gene that results in glycine toarginine substitution at position 374 in mice in fibroblastgrowth factor receptor 3 (Fgfr3-G374R), which corresponds toG380R in humans. First, we designed a GFP reporter system thatcan evaluate the cutting efficiency and specificity of single guideRNAs (sgRNAs). Using the sgRNA selected based on our GFPreporter system, we conducted targeted therapy of achondro-plasia in mice. We found that we achieved higher frequency ofprecise correction of the Fgfr3-G374R mutation using Cas9 pro-tein rather than Cas9 mRNA. We further demonstrated thattargeting oligos of 100 and 200 nucleotides precisely correctedthe mutation at equal efficiency. We showed that our strategycompletely suppressed phenotypes of achondroplasia andwhole genome sequencing detected no off-target effects.These data indicate that improved protocols can enable theprecise CRISPR/Cas9-mediated correction of individualmutations with high fidelity.

CRISPR/Cas9 is a RNA-guided genome editing tool devel-oped from a microbial adaptive immune defense system (1–3).Because of its high efficiency and easy-to-use nature, theCRISPR/Cas9 system is revolutionizing many research fields,

including gene functional study, medical research, and genomicediting. Since its introduction into mammalian cells in 2013,many important progresses have been made in various scien-tific fields (4 –6). In particular for gene therapy, several studieshave demonstrated the power of CRISPR/Cas9 technology inmouse models for the correction of human hereditary geneticdiseases, such as, cataract disorder (7), tyrosinemia (8), thalas-semia (9), Duchenne muscular dystrophy (10 –12), liver dis-eases (13, 14) and so on. These approaches are potentially trans-latable for human clinical therapy. Meanwhile studies alsorevealed some technical difficulties that CRISPR/Cas9 systemencounters, such as it preferably generates more small inser-tions and deletions (Indels) than precise modifications, and off-target effect, i.e. binding and cutting at sites with shared homo-logy (3, 15–17).

Achondroplasia is the most common genetic form of dwarf-ism inherited as an autosomal dominant disorder (18). Peoplewith achondroplasia have impaired ability in the longitudinalgrowth of long bone from endochondral ossification at theepiphyseal growth plate, leading to the short status. Homozy-gous achondroplasia predisposes its carriers to neonatal lethalcondition, whereas heterozygous achondroplastic adults can beas short as 62.8 cm (24.7 in). More than 96% of patients withachondroplasia have a Gly to Arg transition at position 1138(G1138A) of the fibroblast growth factor receptor 3 (FGFR3)gene, resulting in the Gly to Arg substitution at position 380 ofthe FGFR3 protein (19, 20), which corresponds to the Gly toArg at 374 (G1120A for DNA) in mouse Fgfr3 (21). Althoughhuman growth hormone has been used to aid growth in otherdwarfism, it does not help people with achondroplasia. Theonly way is the controversial surgery of limb-lengthening,which will lead to patients suffering huge pain. Therefore,developing a radical treatment is desired.

Using our previously generated mouse Fgfr3-G374R (corre-sponds to Fgfr3G1120A) achondroplasia model (21), here weshow that high frequency of targeted correction of the G374Rcan be achieved by co-injection into zygotes of Cas9 proteinand a single guide RNA (sgRNA)4 optimized for specificallytargeting the mutant allele. The correction occurs via homo-

This work was supported by a Chair Professor Grant (to C. D.) and multi-yearresearch Grant (MYRG) 2016-00088-FHS (to X. X.) by the University ofMacau, Macau SAR, China, Macao Science and Technology DevelopmentFund (FDCT) Grants 065/2015/A2, 094/2015/A3 (to C. D.), 027/2015/A1 (toX. X.), and 111/2017/A (to K. M.). The authors declare that they have noconflicts of interest with the contents of this article.

This article contains Figs. S1 and S2.1 Both authors contributed equally to the results of this work.2 To whom correspondence may be addressed. Tel.: 853-8822-4925; Fax: 853-

8822-2911; E-mail: xiaolingx@umac.mo.3 To whom correspondence may be addressed. Tel.: 853-8822-4997; Fax: 853-

8822-2314; E-mail: cxdeng@umac.mo.

4 The abbreviations used are: sgRNA, single guide RNA; HDR, homology-directedrepair; nt, nucleotide(s); PAM, protospacer adjacent motif; lnl, Loxp-neo-Loxp;oligo, oligonucleotide; ssDO, single strand donor DNA oligo; EGFP, enhancedgreen fluorescent protein.

croARTICLE

1142 J. Biol. Chem. (2019) 294(4) 1142–1151

© 2019 Miao et al. Published under exclusive license by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

logy-directed repair (HDR) based on an exogenously suppliedsingle strand donor DNA without inducing nonspecific off tar-geting events. The resulting mice showed normal body size,were fertile, and able to transmit the corrected allele to theirprogeny. Thus, our study provides proof for using the CRISPR/Cas9 system to correct this dominate genetic disease.

Results

Evaluation of genome editing efficiency and specificity ofsgRNAs against Fgfr3-G374R by sgRNA testers

Three overlapping sgRNAs of 20 nt were designed to span-ning the Gly to Arg mutation in Fgfr3 gene (Fig. S1A), the top 10predicted off-target locus with NGG PAM (protospacer adja-cent motif) sequence were listed for further analysis (Fig. S1,B–D). The highest homology for these sgRNAs is WT Fgfr3 thatcontains 1 mismatched base at the “Gly to Arg” mutation site.This is followed by 1 mismatches of the Cnnm2 gene tosgRNA1; 2 mismatches of noncoding region locus Chr2:10643681 to sgRNA2, and 2 mismatches of Extl3 genes tosgRNA3, respectively. Increasing mismatches to these sgRNAsup to 4 bases in some other genes of varying homology areshown in Fig. S1, B–D.

We then tested the cutting efficiency of the sgRNAs using aGFP reporter plasmid (pCAG-EGx-xFP-BbsI), which carriestandemly duplicated defective GFPs with a mutation in their 3�and 5�, respectively. A dual BbsI cutting site was also introducedbetween two mutated GFPs for cloning of sgDNA�NGG to betested (Fig. 1A). For each sgRNA, we cloned the mutant formand the corresponding WT form, which carries one base mis-match with the mutant form, into the tester construct (Fig. 1B)to generate 3 pairs of tester reporters. Then, each of the report-ers alone or together with their corresponding CRISPR/Cas9construct were transfected into 293 cells to test their cuttingefficiency and specificity.

Our data indicated that transfection of these testers alone didnot generate obvious GFP signaling, which is consistent withthe fact that tandem duplicated GFPs are defective in thepCAG-EGx-xFP-BbsI construct. On the other hand, co-trans-fection of all three pairs of testers with their correspondingsgRNA-CRISPR/Cas9 (PX330-sgRNA) constructs generatedGFP positive cells. This is because the mutant GFPs can berepaired due to homologous recombination stimulated byCRISPR/Cas9-mediated double strand break at the target site,generating GFP� cells (Fig. 1C). The GFP expression levelshould reflect the cutting efficiency of sgRNA-guided CRISPR/Cas9 to the targeted sequence. The data indicated that sgRNA1had the highest cutting effect for the Fgfr3 mutant sequence,however, it also cut the corresponding WT sequence (one basemismatch to the MT sequence) with high efficiency. sgRNA3cut much more efficiently than sgRNA1, however, sgRNA3 alsocut the WT sequence and generated obvious GFP positive sig-naling (Fig. S2, A–C). Thus, sgRNA2 had moderate efficiencyfor cutting the Fgfr3 mutant allele among the three sgRNAstested, whereas no cutting at its corresponding WT allele (Fig.1, C and D), reflecting its high specificity to the mutant allele.Because avoiding the off-target effect is most crucial, weselected sgRNA2 for our subsequent in vivo experiments.

Targeted correction of dwarf phenotype associated withFgfr3-G374R mutation in mice

We used the mouse model of dominant achondroplasiacaused by a defined Gly to Arg mutation in exon 10 of the Fgfr3gene (21). As achondroplasia mice grow poorly throughoutdevelopment and have reduced fertility, a Loxp-neo-Loxp (lnl)cassette was inserted into intron 10 to block the expression ofthe mutant allele (Fig. 2A). Heterozygous mice for the mutation(Fgfr3G1120A�lnl/�) were normal, whereas homozygous mice(Fgfr3G1120A-lnl/G1120A-lnl) survived to adulthood and were fertile,although exhibited skeleton abnormalities similar to Fgfr3�/�

mice generated by gene targeting (22). Deletion of the lnl cassettefrom mutant mice by breeding with mice carrying the Ella-Cretransgene will allow the expression of Fgfr3G1120A allele, generat-ing mice with a dwarf phenotype (Fig. 2A). Our data indicated thatthe cross between homozygous male Fgfr3G1120A-lnl/G1120A-lnl

mice with homozygous female Ella-Cre mice could generatedwarf phenotypes in all offspring (Fgfr3G1120A/�; Ella-Cre, orFgfr3G1120A), thus the fertilized zygotes from this breedingwere collected for pronuclear injection.

Cas9 mRNA or protein, sgRNA2 RNA, and single stranddonor WT DNA were co-injected into the pronuclear ofFgfr3G1120A zygotes, which were then implanted into pseudo-pregnant female mice for further development. Of a total of 63live pups born, 42 mice were phenotypically normal (Table 1),suggesting the mutant allele was either disrupted or corrected.

We injected Cas9 mRNA at two concentrations, 200 and 5ng/�l, which generated 13 and 15 pups, respectively. Of 13 pupsgenerated by injection of 200 ng/�l mRNA, 8 (61.6%) wheremorphologically normal (Table 1). In contrast, none of the 15mice generated by injection of 5 ng/�l of mRNA were normal,despite the increased concentrations of sgRNA and singlestrand DNA oligo (ssDO) by 2.5- and 2-fold, respectively, toincrease genomic cutting and homologous recombination atthe targeting site. This observation indicates that Cas9 mRNAat 5 ng/�l was too low to achieve effective genomic editing tothe Fgfr3G1120A allele. Of note, 34 of 35 (97.1%) pups generatedby injection of the Cas9 protein exhibited normal phenotypeand 9 of them carry precision correction of the point mutation.Collectively, these data suggest that injection of Cas9 proteinhas a much higher efficiency in genome editing, although moreconclusive data may be provided in future studies.

High frequency of targeted correction of the Fgfr3G1120A pointmutation by the injection of Cas9 protein in mice

The correction of achondroplasia phenotype suggests thatthe Fgfr3G1120A allele in these mice was edited (either throughtargeted disruption or point mutation correction). Because theG to A transition at position 1120 (leading to G374R mutation)generates a SfcI restriction site (CTACAG) (Fig. 2B), thuschange at the genomic level at this mutation site can be moni-tored by SfcI digestion. Therefore, to provide a quick analysis ofthe status of the mutation site, we used a pair of PCR primersflanking the G1120A mutation site to amplify a 374-bp fragmentfollowed by restriction digestion with SfcI, which should cut thisfragment into 176 and 198 bp if the CTACAG site is intact,whereas the loss of this site should render the SfcI resistance.

Correction of the Fgfr3-G374R related achondroplasia

J. Biol. Chem. (2019) 294(4) 1142–1151 1143

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Of 13 samples isolated from phenotype-corrected mice gen-erated by the injection of Cas9 mRNA, 8 were SfcI resistant(pup 1 in Fig. 2, B and C), indicating the loss of cutting site; and5 were sensitive (pups 2 and 3, Fig. 2, B and C), suggesting theG1120A mutation was not corrected. To understand the reasonwhy these animals were normal while keeping the mutation, we

conducted Sanger’s sequencing and the data indicated that pup1 carried a 13-bp deletion, including the SfcI site, pup 2 had adeletion of “G,” and pup 3 had an insertion of “T,” respectively,in front of the SfcI site (Fig. 2D). In all three cases, theFgfr3G1120A allele was effectively mutated due to the frameshiftcaused by indels, leading to the loss of the mutant phenotype.

Figure 1. Cutting efficiency and off-target assay for sgRNAs. A, map for pCAG-EGx-xFP-BbsI tester, a dual BbsI cutting site was flanked by a 3�-mutated GFPand a 5�-mutated GFP. sgRNA oligos plus NGG PAM sequence are inserted into the pCAG-EGxxFP-BbsI plasmid through the dual BbsI cutting site to generatethe tester reporter for each single target sgRNA. B, sequence of sgRNA oligos used for targeting vector (PX330) and tester vector cloning. C, tester assay for theFgfr3 mutant sgRNA targeting constructs. PX330-sgRNA2 and its corresponding mutant tester or WT tester are co-transfected into 293FT cells, 24 h later, thecells were examined for GFP intensity to estimate the cutting efficiency. D, quantification of GFP positive cells and its intensity related to testers constructgenerated by sgRNA2.

Correction of the Fgfr3-G374R related achondroplasia

1144 J. Biol. Chem. (2019) 294(4) 1142–1151

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

In 34 DNA samples isolated from injection of the Cas9 pro-tein, 25 (73.5%) carried indels that disrupted the Fgfr3G374R

allele and the animal appeared normal. In the remaining 9 mice(26.5%), the “A” was replaced by G (pups 5 and 6, Fig. 2, C–E)directed by ssDO template (Correction), all of which destroyedthe SfcI site. These data indicate that injection of the Cas9 pro-tein elicits high genome editing efficiency with a significantfraction generated by precise correction. Similar high efficiencywas observed when a loxP site was introduced into the EGFPlocus through homologous recombination (Fig. 3).

Targeting single strand DNA oligos of 100 and 200 ntcorrected Fgfr3G1120A mutation at equal efficiency in theachondroplasia mice

The correction of the point mutation is primarily mediatedby targeting ssDOs, which provide a template for repairing thedouble strand break created by the cutting of CRISPR/Cas9.The length of the ssDO used in the above experiment is 200 nt.

Next, we investigated whether supplying a shorter ssDO wouldstill maintain comparable efficiency of HDR-mediated precisegenome repair. Our data indicated that the injection of a ssDOof 101 nt yielded a phenotype correction efficiency of 97.5%(40/41), which is comparable with 97.1% (34/35) obtained byusing the ssDO of 200 nt. DNA sequencing revealed that 31(77.5%) mice carried indels, whereas the remaining 9 (22.5%) micehad their G to A mutation precisely corrected (Table 2).

Taken together, our data suggest that the Cas9 protein havehigher efficiency to promote HDR-based genetic repairing, whichwas directed by exogenous oligos. 101 nt homologous ssDO keepthe same efficiency for HDR compared with 200-nt ssDO.

CRISPR/Cas9-mediated correction or disruption of Fgfr3G374R

mutation completely suppresses phenotypes ofachondroplasia mice

The most significant features of achondroplasia mice includereduced body weight, dome-shaped head, short status, reduced

Figure 2. Targeted correction of Fgfr3-G374R mutation by CRISPR/Cas9 system. A, flow chat of the breeding procedure. Male mice homozygous forFgfr3G1120A-ln/lG1120A-lnl, which phenotypically mimic Fgfr3�/� mice, were crossed with homozygous Ella-Cre transgenic female mice to cut off the ploxPneo gene toactivate the Fgfr3 point-mutated gene. All offspring were heterozygous for the activated Fgfr3 mutation (Fgfr3G1120A/�) and exhibited achondroplasia phenotypes (anexample was shown in the lower right panel). Oocytes were isolated from this cross and Cas9 protein or mRNA, sgRNA, and ssDO were injected into the pronuclear tocorrection the mutation. B, the sequence of mutant Fgfr3 gene. Fgfr3 gene harbors a G1120A point mutation in exon 10 causing G374R transition. G to A point mutationgenerated a SfcI restriction site (CTACAG) that can be identified by restriction enzyme SfcI. Primers P1 and P3 were used for SfcI cutting assay, amplicon from primersP1 and P2 were used for the Sanger sequence. C, PCR amplicon (374 bp) was cut with SfcI to identify the indel generation. Without any change, the fragment can becut into 2 fragments of 198 and 176 bp each. 1– 6, pups from injected embryos; 7, parental EIIa-Cre mouse; 8, parental Fgfr3G1120A-lnl/G1120A-lnl. D, sequence around thetarget from 6 pups revealed by Sanger sequencing. E, further Sanger sequence was conducted to verify the gene correction.

Table 1CRISPR/Cas9-mediated phenotype correction

Experimentgroup Cas9 mRNA/protein sgRNA

ssDO(200 nt)

No. of embryosinjected

No. ofpups born

No. ofnormal pups

Targetedknockin

ng/�lI mRNA (200 ng/�l) 1 2.5 184 13 8 (61.6%) 0/8II mRNA (5 ng/�l) 2.5 5 113 15 0 NAa

III Protein (30 ng/�l) 2.5 10 395 35 34 (97.1%) 9/34 (26.5%)a NA, not applicable.

Correction of the Fgfr3-G374R related achondroplasia

J. Biol. Chem. (2019) 294(4) 1142–1151 1145

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

lengths of long bone, most promptly in femurs and humerus(21) (Fig. 4A). We carefully examined all 18 mice that carriedthe corrected point mutation allele using these features ofachondroplasia, as measured by bone length and body weight,and the data indicated that all these were absent in the pheno-type-corrected mice and they were indistinguishable with WTmice (Fig. 4, A–D). One major concern of the achondroplasiatherapy is whether the dwarf phenotype can be inherited to thepups. We therefore mated them with WT mice and then ana-lyzed the pups. Progeny obtained from corrected Fgfr3 pointmutation mice were all normal. DNA sequencing using primeragainst the mutant allele showed that the pups carried therepaired Fgfr3 allele originating from their parents, indicatingthat the corrected allele could be successfully transmitted to thenext generation through the germline.

The remaining 56 (25 from using of 200 nt ssDO and 31 fromusing 101-nt ssDO) mice that carry non-homologous end join-ing-mediated insertions or deletions were also phenotypicallynormal. Analysis of the nucleotide sequences of the Fgfr3 locusrevealed that the mutant Fgfr3G374R allele was disrupted byindels at or near the G1120A mutation site in all these mice,whereas the remaining WT Fgfr3 allele is intact. This is consis-tent with our previous observation that mice heterozygous forthe Fgfr3 knockout mutation is phenotypically normal (22).

Correction of G1120A mutation without off-targeting events

The CRISPR/Cas9 system sometimes suffers an off-targeteffect by cutting at sites with shared homology (15–17). Toinvestigate this, we conducted whole-genome DNA sequencingfor 7 mice delivered by one surrogate mother, including 3 mice

Figure 3. Knock-in a loxP site into GFP transgene through pronuclear injection of CRISPR/Cas9 system. A, WT FVB mice were mated with homozygousGFP male mice to get pronuclear stage GFP-positive embryos for microinjection. B, Cas9 protein, sgRNA (CAACTACAAGACCCGCGCCG) targeting GFP gene, anda single strand donor DNA, which contains a loxp sequence and HindIII sequence flanked by two 100-nt homology arms for both sides were co-injected. C, afterinjection, we have checked 110 blastocysts for the fluoresce and knock-in event by using HindIII restriction enzyme to cut the insertion site after PCRamplification. There are 95 (86.4%) embryos that lost the GFP signal, whereas the remaining 15 (13.6%) still expressed the GFP gene. Among 95 GFP negativeblastocysts, there are only 21 blastocyst containing a HindIII cutting site that indicates the ssDNA donor gets knocked-in successfully. D, represent picture ofGFP negative blastocysts and fetus at embryonic day 14.

Table 2Comparison of ssDO length for CRISPR/Cas9-mediated genomic editing

ssDONo. of embryos

injectedNo. of

pups bornNo. of

normal pupsNo. of pups

(with indels)No. of pups(correction)

200 nt 395 35 34 25 9 (26.5%) p � 0.86101 nt 371 41 40 31 9 (22.5%)

Correction of the Fgfr3-G374R related achondroplasia

1146 J. Biol. Chem. (2019) 294(4) 1142–1151

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

with targeted mutation correction, 3 mice with indels (these 6mice are phenotypically normal), and 1 mouse with un-cor-rected G1120A mutation (achondroplasia phenotype) revealedby SfcI digestion. As shown in Fig. 5, A and B, #1083 still con-tains the G to A mutation, whereas showing the dwarf pheno-type. #1081, #1084, and #1089 only contained WT allele, sug-gesting the G1120A mutation was corrected. The remaining 3mice, #1082, #1085, and #1086, exhibited mixed ratios of WTallele and indels. In the #1082 and #1086 mice, the WT allelewas presented at 60 and 42%, respectively, which is consideredthe normal range of heterozygosity. Meanwhile, the #1082mouse also contained a deletion of 17 bp and an insertion of a T,presented at 16 and 23%, respectively, suggesting this animalcarries these two types of mutations in different portions ofcells, presumably due to two distinct indels at 2- or 4-cell stagedembryos. A similar situation was observed in #1086, which alsocarried insertion of a C and a T in different cells besides the WTallele. Mouse #1085 contained WT allele at 81.4% and an alleleof 27 bp deletion at 18.6%, suggesting a precise correction ofG1120A, and a deletion of 27 bp occurred in different cells atearly 2-cell or 4-cell staged embryos. All these events (precisioncorrection and indels) are mediated by CRISPR/Cas9 and effec-tively disrupted the Fgfr3G1120A mutation, resulting in the cor-rection of achondroplasia phenotype of the mutant mice.

Next, we examined the entire Fgfr3 locus spanning 15.4 kband detected no alterations. We then studied all homologousloci (Fig. 1C) for sgRNA2 with 1– 4 mismatched nucleotidesand detected no indels generated. These analyses indicate thatthe G1120A mutation was corrected specifically without obvi-ous off-targeting events.

Discussion

CRISPR/Cas9 is a powerful tool for genome editing that hasbeen used in multiple organisms (1, 2, 4). However, CRISPR/Cas9, at its current stands, also suffers some limitations. Forexample, the CRISPR/Cas9 system frequently suffers an off-target effect by cutting at sites with shared homology (15–17).Furthermore, due to its high efficiency cutting at targeting sites,CRISPR/Cas9 preferably generates more indels than precise mod-ifications, casting difficulty to generate the desired mutations.Using Fgfr3G374R achondroplasia mice as a model system, we haveaddressed some of the potential problems. Our optimized experi-ment conditions have achieved high specificity of targeted correc-tion of achondroplasia with several navel features.

Unintended binding, modification, and cleavage of nucleicacids, so called the off-target effect, is a major challenge to theCRISPR/Cas9 system (3). To overcome this problem, manysgRNA designing tools have been developed to increase speci-ficity of sgRNAs at the silicon level (23, 24). A number of meth-ods have also been employed to avoid off-target cutting or iden-tify undesired mutations, such as using single-based editorscorrect base-pairing to avoid inducing a dsDNA break, orreplace Cas9 with Cas13a to target RNA editing (3). In ourstudy, the off-target effect still occurred even if CRISPR designsoftware was used to design our sgRNAs. Because of the newlydesigned GFP tester, we found two of three sgRNAs could cutthe WT Fgfr3 sequence with a single mismatched base, whereasthe other sgRNA cuts only at the MT Fgfr3 sequence. We usedthis sgRNA for further genome editing in mice and it indeed didnot cut the corresponding WT Fgfr3 sequence with single mis-matched base.

Figure 4. Observation of gene corrected and mutant mice. A, whole mount skeleton staining of Fgfr3G1120A/� dwarf (left) and corrected mice (right) at 1month of age. B, X-ray images and its statistical analysis (C) showing the length of femur of dwarf and corrected mice. D, comparison of body weight betweendwarf mice, corrected mice, and knockout mice.

Correction of the Fgfr3-G374R related achondroplasia

J. Biol. Chem. (2019) 294(4) 1142–1151 1147

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

More recently, there are some discussions about whetheror not the CRISPR/Cas9 system could generate unexpectedmutations in vivo (25–29). To investigate this, we conductedwhole genome sequencing, and detected no off-target eventsin the region near the targeting site, the entire Fgfr3 locus,and in all predicted potential off-target sites, which sharevarying degrees of homology with the target sequence. Alto-gether, we demonstrated that by using our optimizedsgRNA, the CRISPR/Cas9-mediated targeted correction ofthe Fgfr3-G374R point mutation completely suppresses phe-notypes of achondroplasia mice with high fidelity. Thisresult demonstrates in principle the importance of usingsuch a tester system to avoid potential off-target effects priorto the experiment. For example, if sgRNA 1 or 3 was used inour experiment, it might have generated off-target events.The GFP tester is user friendly, and reliable for providingfunctional evaluation of sgRNAs for their specificity and effi-ciency. From the long run, highly suspected sequences foroff-target predicted by software could also be tested first toavoid any potential problems.

Both Cas9 mRNA and proteins have been widely used forachieving genome editing with variable frequencies (30, 31). Ourdata revealed significant higher frequency of CRRSPR/Cas9-me-diated genome cutting at the target site and the precise correctionof the G1120A point mutation by the Cas9 protein than Cas9mRNA. For the underlying mechanism, we believe that there willbe a gap between the time of injection of mRNA and producing theeffective amount of protein by translation. However, this gap nolonger exists by direct admission of Cas9 protein, as the protein

can be immediately used for genome editing. We have also testedthe knock-in efficiency by Cas9 protein to EGFP genes, and a com-parable efficiency was achieved by introducing a 47-base loxP siteinto the EGFP gene. In conclusion, Cas9 protein achieves muchhigher efficiency than Cas9 mRNA of genome editing and intro-duction of knock-in mutation.

Conventional gene targeting by homologous recombina-tion has high demand on the length of targeting homology toachieve ideal targeting efficiency (32). Because the CRISPR/Cas9 system generates double strand breaks at the targetsites that greatly stimulates efficiency of homologous recom-bination, the long homologous arm of targeting constructs isless critical (32). Donor oligo or targeting constructs withless than 1000-bp homology arms are frequently used forgenome editing in mouse zygotes (33). In our study, we firsttested targeting ssDO with 200 nt (with around 100 nt oneach side of the G to A mutation) and obtained genomeediting frequency in 34/35 (97%) mice. In the 34 mice, 9 carryprecise G1120A mutation correction (26.5%). To further testthe effect of the length of homology, we injected a 101-ntssDO and obtained comparable editing frequency and muta-tion correction rate. These data demonstrate that the target-ing oligos of 101 and 200 nt precisely corrected the mutationat similar efficiency. As oligos of 101 nt can be generatedmuch more economically, our finding is of great significancewhen designing targeting ssODs.

In summary, we have demonstrated that the CRISPR/Cas9 sys-tem can be used to cure achondroplasia in mouse by directly cor-recting the genetic defect through homology-mediated gene edit-

Figure 5. Off-target analysis of sgRNA2 based on whole genome sequence. A, summary of genomic editing at the Fgfr3-G1120A site of 7 mice. #1083 stillcontains the Fgfr3-G1120A allele at about 40% suggesting no editing in the target region. #1081, #1084, and #1089 mice only contain WT allele, suggesting theirFgfr3-G1120A mutation was corrected. #1082 and #1086 mice contain WT allele with 60 and 42%, respectively, and also contain two different types of indels atlower percentages, suggesting these indels occurred at 2- or 4-cell staged embryos. #1085 mouse contain a WT allele at 81.4% and an allele of 27 bp deletionat 18.6%, suggesting the G1120A mutation may be corrected in some cells. B, types of mutations occurred in the Fgfr3-G1120A region of these 7 mice, includingdeletions of 17 or 27 bp, and two insertions of single nucleotides near the Fgfr3-G1120A mutation site, which effectively disrupted expression of the mutantallele.

Correction of the Fgfr3-G374R related achondroplasia

1148 J. Biol. Chem. (2019) 294(4) 1142–1151

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

ing. Our GFP reporter can be used to select sgRNAs with highspecificity and reasonable cutting efficiency to avoid off-targeteffects. Microinjection of Cas9 protein greatly improves genomeediting frequency. Targeting oligo of 101 nt, which is more easilyaffordable than longer oligos, can be reliably used for the editing.The combination of these factors greatly facilitates the introduc-tion of the desired genome modification with high fidelity.

Experimental procedures

Animal model

As previously described to bypass the lethal effect ofFgfr3G1120A mutation, a lnl cassette is inserted between exons10 and 11 to knockout the mutant Fgfr3 gene (21). Mice har-boring homozygous Fgfr3G1120A-lnl/G1120A-lnl exhibit pheno-types similar to Fgfr3�/� mice (22) and are maintained to serveas stud mice. Homozygote of EIIa-Cre (JAX, ME) female micewere superovulated by injection with pregnant mare’s serumgonadotropin followed by human chorionic gonadotropin, andthen crossed with Fgfr3G1120A-lnl/G1120A-lnl stud mice to deletethe lnl cassette and obtain Fgfr3 point mutant embryos for pro-nuclear injection. All animal procedures were performed underthe ethical guidelines of the University of Macau (animal pro-tocol number: UMAEC-037-2015).

sgRNA reporter plasmid construction

sgRNA reporter plasmid (pCAG-EGx-xFP-BbsI) was con-structed by modifying pCAG-EGxxFP (Addgene). Briefly, ashort dual BbsI cassette was amplified from plasmid PX330 (1)and inserted into the pCAG-EGxxFP digested with EcoRI toobtain pCAG-EGxxFP-BbsI (Fig. 1A). sgRNA tester sequencewas designed based on the sgRNA sequence including the NGGPAM sequence, then the adapter was added for further cloning.To clone the target sequence into the reporter plasmid, pairedoligos with adaptor were synthesized (Fig. 1A). Each pair ofoligos was phosphorylated and annealed followed by ligationwith a BbsI pre-digested reporter plasmid.

Microinjection

sgRNA(s) were designed by using Optimized CRISPR Designonline tools (34), then ligation with PX330 plasmid. sgRNAswith a T7 promoter were amplified by PCR and in vitro tran-scribed using a MEGAshortscript T7 kit (Thermo Fisher Scien-tific, MA). After transcription, the sgRNAs were purified with aMEGAclear kit (Thermo Fisher Scientific, MA) according tothe manufacturer’s instructions. The sequences used for prep-aration of template for in vitro transcription of sgRNA2 wasamplified from PX330-sgRNA2 using primers (TTAATAC-GACTCACTATAGGCGCAGGCGTCCTCAGCTAC andAAAAGCACCGACTCGGTGCC).

Two single strand donor DNA oligo (ssDO) of the totallength of 200 and 101 nt were designed based on WT Fgfr3genomic DNA. The ssDO-200 nt contains 99 and 100 nt at 5�and 3� to the G to A point mutation, respectively; and thessODN-101 nt contains 50 nt on each side flanking the G to Apoint mutation as shown; Wt-200nt, AAGGCTGGATGA-GGCCCCAAAATTTGTATCTTTGCAGCTGAGGAGGAG-CTGATGGAAACTGATGAGGCTGGCAGCGTGTACGC-

AGGCGTCCTCAGCTACGGGGTGGTCTTCTTCCTCTT-CATCCTGGTGGTGGCAGCTGTGATACTCTGCCGCCT-GCGCAGTCCCCCAAAGAAGGGCTTGGGCTCGCCCAC-CGTGCACAA; and Wt-101nt: TGATGGAAACTGATGA-GGCTGGCAGCGTGTACGCAGGCGTCCTCAGCTACGG-GGTGGTCTTCTTCCTCTTCATCCTGGTGGTGGCAGC-TGTGATACTCTGC.

EIIa-Cre female mice were superovulated and mated withFgfr3G1120A-lnl/G1120A-lnl males. Pronuclear stage embryos werecollected followed by microinjection punched by FemtoJetdevice (Eppendorf). Cas9 mRNA or proteins were co-injectedwith sgRNA and ssDO. For Cas9 mRNA injection, differentconcentrations of Cas9 mRNAs (5 or 200 ng/�l) and sgRNA(2.5 or 1 ng/�l) were mixed with ssDO (5 or 2.5 ng/�l) injectedinto the embryos. The injected embryos were transferred intopseudopregnant female mice.

Genotyping, DNA sequencing analysis, and Sangersequencing

The target site (sequence around Fgfr3G1120A mutation site)was amplified from genomic DNA of the genetic modified miceby PCR with primers (Fgfr3-s and Fgfr3-a) for SfcI digestiondiagnosis, and flanking primers (Fgfr3-s and Loxp-a) for Sangersequence; Fgfr3-s (P1), CTCTTCTCCAAGTATCCCAGG-TCC; Fgfr3-a (P2), CCTGCTGGGACTCTAGGAGACAC;and Loxp-a (P3), CGAAGTTATCTAGAGTCGACCATCG.

Whole genome sequencing

Total DNA was extracted from mouse tail using DNeasyBlood & Tissue Kits (Qiagen, Hilden, Germany). Wholegenome sequencing libraries were prepared using the DNALibrary Prep kit (New England Biolabs) in accordance with themanufacturer’s instructions. Briefly, 1 �g of DNA was shearedusing a Covarias sonicator, then followed by end-repair, liga-tion, and amplification. Whole genome sequencing librarieswere evaluated using BioAnalyzer (Agilent, CA) and quantita-tive PCR. Libraries were sequenced on an Illumina Hiseq �10sequencer using 2 � 150 bp cycles to meet coverage of 30 timesfor further analysis.

Bioinformatics analyses

Sequenced reads were mapped to the mouse (Mus muscu-lus) genome (mm10) using Burrows-Wheeler Aligner (ver-sion 0.7.15). Unique mapped reads were used for the furtheranalysis. GATK best practices (version 4.0.3) workflows wereused to identify SNV(s) and Indel(s). Variants were furtherfiltered to exclude variants in dbSNPv150. Variant annota-tions were done via SnpEff (version 4.3T) The top potentialoff-target sites were predicted by Optimized CRISPR Designonline tools (34).

X-ray and whole mount skeletal preparation

For X-ray imaging, animals were euthanatized with CO2.After removing the skin, photographs were taken by using anX-ray machine (Bruker, MA). For skeletal preparation, the car-casses were eviscerated, fixed in 95% ethanol, stained with Aliz-arin red S and Alcian blue, cleared by KOH treatment, and thenstored in glycerol as previously described (22).

Correction of the Fgfr3-G374R related achondroplasia

J. Biol. Chem. (2019) 294(4) 1142–1151 1149

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Author contributions—K. M., X. Z., J. Z., X. X., and C.-X. D. resourc-es; K. M., X. Z., J. Z., X. X., and C.-X. D. data curation; K. M., X. Z.,and J. Z. software; K. M., X. X., and C.-X. D. funding acquisition;K. M., X. Z., and S. M. S. validation; K. M., X. Z., S. M. S., Z. H.,U. I. C., X. X., and C.-X. D. investigation; K. M., X. Z., and S. M. S.visualization; K. M., X. Z., S. M. S., J. Z., Z. H., U. I.C., X. X., andC.-X. D. methodology; K. M., X. X., and C.-X. D. writing-originaldraft; K. M. and C.-X. D. writing-review and editing; X. Z., J. Z.,X. X., and C.-X. D. formal analysis; X. X. and C.-X. D. conceptualiza-tion; X. X. and C.-X. D. supervision; X. X. and C.-X. D. projectadministration.

Acknowledgments—We thank members of the C. Deng and X. Xulaboratories for helpful advice and discussion.

References1. Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu,

X., Jiang, W., Marraffini, L. A., and Zhang, F. (2013) Multiplex genomeengineering using CRISPR/Cas systems. Science 339, 819 – 823 CrossRefMedline

2. Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville,J. E., and Church, G. M. (2013) RNA-guided human genome engineeringvia Cas9. Science 339, 823– 826 CrossRef Medline

3. Knott, G. J., and Doudna, J. A. (2018) CRISPR-Cas guides the future ofgenetic engineering. Science 361, 866 – 869 CrossRef Medline

4. Chen, S., Sun, H., Miao, K., and Deng, C. X. (2016) CRISPR-Cas9: fromgenome editing to cancer res. Int. J. Biol. Sci. 12, 1427–1436 CrossRefMedline

5. Luther, D. C., Lee, Y. W., Nagaraj, H., Scaletti, F., and Rotello, V. M. (2018)Delivery approaches for CRISPR/Cas9 therapeutics in vivo: advances andchallenges. Expert Opin. Drug Deliv. 15, 905–913 CrossRef

6. Chen, S., Sanjana, N. E., Zheng, K., Shalem, O., Lee, K., Shi, X., Scott, D. A.,Song, J., Pan, J. Q., Weissleder, R., Lee, H., Zhang, F., and Sharp, P. A.(2015) Genome-wide CRISPR screen in a mouse model of tumor growthand metastasis. Cell 160, 1246 –1260 CrossRef Medline

7. Wu, Y., Liang, D., Wang, Y., Bai, M., Tang, W., Bao, S., Yan, Z., Li, D., andLi, J. (2013) Correction of a genetic disease in mouse via use of CRISPR-Cas9. Cell Stem Cell 13, 659 – 662 CrossRef Medline

8. Yin, H., Xue, W., Chen, S., Bogorad, R. L., Benedetti, E., Grompe, M.,Koteliansky, V., Sharp, P. A., Jacks, T., and Anderson, D. G. (2014) Ge-nome editing with Cas9 in adult mice corrects a disease mutation andphenotype. Nat. Biotechnol. 32, 551–553 CrossRef Medline

9. Ou, Z., Niu, X., He, W., Chen, Y., Song, B., Xian, Y., Fan, D., Tang, D., andSun, X. (2016) The combination of CRISPR/Cas9 and iPSC technologiesin the gene therapy of human �-thalassemia in mice. Sci. Rep. 6, 32463CrossRef Medline

10. Tabebordbar, M., Zhu, K., Cheng, J. K. W., Chew, W. L., Widrick, J. J., Yan,W. X., Maesner, C., Wu, E. Y., Xiao, R., Ran, F. A., Cong, L., Zhang, F.,Vandenberghe, L. H., Church, G. M., and Wagers, A. J. (2016) In vivo geneediting in dystrophic mouse muscle and muscle stem cells. Science 351,407– 411 CrossRef Medline

11. Nelson, C. E., Hakim, C. H., Ousterout, D. G., Thakore, P. I., Moreb, E. A.,Castellanos Rivera, R. M., Madhavan, S., Pan, X., Ran, F. A., Yan, W. X.,Asokan, A., Zhang, F., Duan, D., and Gersbach, C. A. (2016) In vivo ge-nome editing improves muscle function in a mouse model of Duchennemuscular dystrophy. Science 351, 403– 407 CrossRef Medline

12. Long, C., Amoasii, L., Mireault, A. A., McAnally, J. R., Li, H., Sanchez-Ortiz, E., Bhattacharyya, S., Shelton, J. M., Bassel-Duby, R., and Olson,E. N. (2016) Postnatal genome editing partially restores dystrophin ex-pression in a mouse model of muscular dystrophy. Science 351, 400 – 403CrossRef Medline

13. Yang, Y., Wang, L., Bell, P., McMenamin, D., He, Z., White, J., Yu, H., Xu,C., Morizono, H., Musunuru, K., Batshaw, M. L., and Wilson, J. M. (2016)A dual AAV system enables the Cas9-mediated correction of a metabolic

liver disease in newborn mice. Nat. Biotechnol. 34, 334 –338 CrossRefMedline

14. Yin, H., Song, C. Q., Dorkin, J. R., Zhu, L. J., Li, Y., Wu, Q., Park, A., Yang,J., Suresh, S., Bizhanova, A., Gupta, A., Bolukbasi, M. F., Walsh, S., Bogo-rad, R. L., Gao, G., Weng, Z., Dong, Y., Koteliansky, V., Wolfe, S. A.,Langer, R., Xue, W., and Anderson, D. G. (2016) Therapeutic genomeediting by combined viral and non-viral delivery of CRISPR system com-ponents in vivo. Nat. Biotechnol. 34, 328 –333 CrossRef Medline

15. Martin, F., Sánchez-Hernandez, S., Gutiérrez-Guerrero, A., Pinedo-Go-mez, J., and Benabdellah, K. (2016) Biased and unbiased methods for thedetection of off-target cleavage by CRISPR/Cas9: an overview. Int. J. Mol.Sci. 17, e1507 Medline

16. Rastogi, A., Murik, O., Bowler, C., and Tirichine, L. (2016) PhytoCRISP-Ex: aweb-based and stand-alone application to find specific target sequences forCRISPR/CAS editing. BMC Bioinformatics 17, 261 CrossRef Medline

17. Haeussler, M., Schönig, K., Eckert, H., Eschstruth, A., Mianné, J., Renaud,J. B., Schneider-Maunoury, S., Shkumatava, A., Teboul, L., Kent, J., Joly,J. S., and Concordet, J. P. (2016) Evaluation of off-target and on-targetscoring algorithms and integration into the guide RNA selection toolCRISPOR. Genome Biol. 17, 148 CrossRef Medline

18. Ornitz, D. M., and Legeai-Mallet, L. (2017) Achondroplasia: development,pathogenesis, and therapy. Dev. Dyn. 246, 291–309 CrossRef Medline

19. Bellus, G. A., Hefferon, T. W., Ortiz de Luna, R. I., Hecht, J. T., Horton,W. A., Machado, M., Kaitila, I., McIntosh, I., and Francomano, C. A.(1995) Achondroplasia is defined by recurrent G380R mutations ofFGFR3. Am. J. Hum. Genet. 56, 368 –373 Medline

20. Stoilov, I., Kilpatrick, M. W., and Tsipouras, P. (1995) A common FGFR3gene mutation is present in achondroplasia but not in hypochondroplasia.Am. J. Med. Genet. 55, 127–133 CrossRef Medline

21. Wang, J. M., Du., X. L., Li, C. L., Yin, L. J., Chen, B., Sun, J., Su, N., Zhao, L.,Song, R. H., Song, W. W., Chen, L., and Deng, C. X. (2004) Gly374Argmutation in Fgfr3 causes achondroplasia in mice. Chinese J. Med. Genet.21, 537 Medline

22. Deng, C., Wynshaw-Boris, A., Zhou, F., Kuo, A., and Leder, P. (1996)Fibroblast growth factor receptor 3 is a negative regulator of bone growth.Cell 84, 911–921 CrossRef Medline

23. Cui, Y., Xu, J., Cheng, M., Liao, X., and Peng, S. (2018) Review of CRISPR/Cas9 sgRNA design tools. Interdiscip. Sci. 10, 455– 465 CrossRef Medline

24. Listgarten, J., Weinstein, M., Kleinstiver, B. P., Sousa, A. A., Joung, J. K.,Crawford, J., Gao, K., Hoang, L., Elibol, M., Doench, J. G., and Fusi, N.(2018) Prediction of off-target activities for the end-to-end design ofCRISPR guide RNAs. Nat. Biomed. Eng. 2, 38 – 47 CrossRef Medline

25. Lareau, C. A., Clement, K., Hsu, J. Y., Pattanayak, V., Joung, J. K., Aryee, M. J.,and Pinello, L. (2018) Response to “unexpected mutations after CRISPR-Cas9editing in vivo.” Nat. Methods 15, 238–239 CrossRef Medline

26. Nutter, L. M. J., Heaney, J. D., Lloyd, K. C. K., Murray, S. A., Seavitt, J. R.,Skarnes, W. C., Teboul, L., Brown, S. D. M., and Moore, M. (2018) Re-sponse to “unexpected mutations after CRISPR-Cas9 editing in vivo.” Nat.Methods 15, 235–236 CrossRef Medline

27. Kim, S. T., Park, J., Kim, D., Kim, K., Bae, S., Schlesner, M., and Kim, J. S.(2018) Response to “unexpected mutations after CRISPR-Cas9 editing invivo.” Nat. Methods 15, 239 –240 CrossRef Medline

28. Wilson, C. J., Fennell, T., Bothmer, A., Maeder, M. L., Reyon, D., Cotta-Ramusino, C., Fernandez, C. A., Marco, E., Barrera, L. A., Jayaram, H.,Albright, C. F., Cox, G. F., Church, G. M., and Myer, V. E. (2018) Responseto “unexpected mutations after CRISPR-Cas9 editing in vivo.” Nat. Meth-ods 15, 236 –237 CrossRef Medline

29. Lescarbeau, R. M., Murray, B., Barnes, T. M., and Bermingham, N. (2018)Response to “unexpected mutations after CRISPR-Cas9 editing in vivo.”Nat. Methods 15, 237 CrossRef Medline

30. Chu, V. T., Weber, T., Graf, R., Sommermann, T., Petsch, K., Sack, U.,Volchkov, P., Rajewsky, K., and Kühn, R. (2016) Efficient generation ofRosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes. BMC Bio-technol. 16, 4 CrossRef Medline

31. Wang, L., Shao, Y., Guan, Y., Li, L., Wu, L., Chen, F., Liu, M., Chen, H., Ma,Y., Ma, X., Liu, M., and Li, D. (2015) Large genomic fragment deletion andfunctional gene cassette knock-in via Cas9 protein mediated genome ed-iting in one-cell rodent embryos. Sci. Rep. 5, 17517 CrossRef Medline

Correction of the Fgfr3-G374R related achondroplasia

1150 J. Biol. Chem. (2019) 294(4) 1142–1151

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

32. Deng, C., and Capecchi, M. R. (1992) Reexamination of gene targetingfrequency as a function of the extent of homology between the targetingvector and the target locus. Mol. Cell. Biol. 12, 3365–3371 CrossRefMedline

33. Yao, X., Zhang, M., Wang, X., Ying, W., Hu, X., Dai, P., Meng, F., Shi, L.,Sun, Y., Yao, N., Zhong, W., Li, Y., Wu, K. L., Li, W. P., Chen, Z., and Yang,

H. (2018) Tild-CRISPR allows for efficient and precise gene knockin inmouse and human cells. Dev. Cell 45, 526 –536 CrossRef Medline

34. Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agar-wala, V., Li, Y., Fine, E. J., Wu, X., Shalem, O., Cradick, T. J., Marraffini,L. A., Bao, G., and Zhang, F. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31, 827– 832 CrossRef Medline

Correction of the Fgfr3-G374R related achondroplasia

J. Biol. Chem. (2019) 294(4) 1142–1151 1151

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

Xu and Chu-Xia DengKai Miao, Xin Zhang, Sek Man Su, Jianming Zeng, Zebin Huang, Un In Chan, Xiaoling

mutation in achondroplasia in miceOptimizing CRISPR/Cas9 technology for precise correction of the Fgfr3-G374R

doi: 10.1074/jbc.RA118.006496 originally published online November 28, 20182019, 294:1142-1151.J. Biol. Chem. 

  10.1074/jbc.RA118.006496Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/294/4/1142.full.html#ref-list-1

This article cites 34 references, 7 of which can be accessed free at

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from