Omega-3 Fatty Acids and Zinc in Neuronal Cell Homeostasis...

Omega-3 Fatty Acids and Zinc in Neuronal Cell

Homeostasis and Survival

by

Vidanelage Damitha de Mel Biological Science (Hons)

Submitted in fulfilment of the requirements for the degree of

Doctor of Philosophy

Deakin University

December, 2014

sfol

Retracted Stamp

In memory of Auguste Deter and Millions others…

Table of Contents

Abstract i

Acknowledgements v

A list of publications during the course of candidature viii

Abbreviations ix

CHAPTER 1: LITERATURE REVIEW

1.1 Omega -3 (ω-3) Fatty Acids …………………………………………………………………………... 1

1.2 Docosahexenoic acid (DHA) …………………………………………………………………………... 4

1.3 Zinc and life 6

1.3.1 Zinc 6

1.3.2 Zinc in the brain 8

1.3.3 Alterations of zinc metabolism 9

1.4 Zinc transporters …………………………………………………………………………………………………. 10

1.4.1 SLC30 (ZnT) family 12

1.4.2 SLC39 (ZIP) family 15

1.5 Alzheimer’s disease (AD) ………………………………………………………………………………….…. 17

1.5.1 History and pathology of AD 17

1.5.2 The future of Alzheimer’s disease 18

1.5.3 Predicted mechanisms for AD 19

1.5.4 Omega-3 FA and AD 20

1.5.5 Zinc and AD 20

1.5.6 Hypothesis of the study 24

1.5.7 Aims of the study 24

1.5.8 Project outline 25

1.5.9 Significance of the study 26

CHAPTER 2: DHA effect on zinc transporters and cell survival 28

2.1 Introduction ………………………………………………………………………………………………… 28

2.1.1 DHA effect on zinc transporters and cell survival 28

2.2 Materials and Methods ………………………………………………………………………………………… 31

2.2.1 Cell culture and treatments 31

2.2.1.1 Cell line and cell culture 31

2.2.1.2 Omega-3 fatty acid (DHA) and zinc treatments 34

2.2.1.3 Harvesting of cells 38

2.2.2 Quantification of zinc transporter gene levels 38

2.2.2.1 Total RNA isolation 38

2.2.2.2 cDNA synthesis 40

2.2.2.3 Quantitative PCR (QPCR) 40

2.2.3 Quantification of zinc transporter protein levels 43

2.2.3.1 Total protein isolation 43

2.2.3.2 Total protein quantification 43

2.2.4 Gel electrophoresis of proteins 44

2.2.4.1 Preparing the gels 44

2.2.4.2 Protein loading 45

2.2.4.3 Nitrocellulose membrane transfer 47

2.2.4.4 Membrane protein detection 47

2.3 Results …………………………………………………………………………………………………………….. 50

2.3.1 Zinc transporters and their expression pattern in neuronal cells 50

2.3.1.1 Basal zinc transporter levels in human neuronal cells 50

2.3.1.2 Relative zinc transporter levels in human cell lines 50

2.3.2 Effects of DHA and zinc on zinc transporter expression levels 51

2.3.2.1 hZnT1 55

2.3.2.2 hZnT2 56

2.3.2.3 hZnT3 60

2.3.2.4 hZnT4 and hZnT5 61

2.3.2.5 hZnT6 65

2.3.2.6 hZnT7 65

2.3.2.7 hZIP1 69

2.3.2.8 hZIP2 69

2.3.2.9 hZIP3 and hZIP4 72

2.3.3 DHA effect on cell survival 76

2.3.4 Effects of DHA on ZnT3 protein levels 80

2.3.4.1 ZnT3 protein expression levels in M17 cells following

DHA treatments 80

2.3.4.2 ZnT3 protein expression levels in SY5Y cells following

DHA treatments 82

2.3.4.3 ZnT3 protein expression levels in HaCaT cells following

DHA treatments 82

2.3.4.4 ZnT3 protein expression levels in NT2 cells following

DHA treatments 85

2.3.5 DHA effect with and without vitamin E on the ZnT3 transporter 87

2.3.5.1 Vitamin E working concentration 87

2.3.5.2 ZnT3 mRNA expression levels with DHA and vitamin E 87

2.3.5.3 ZnT3 protein levels with DHA and vitamin E 91

2.4 Discussion ..………..……………………………………………………………………………………………... 93

2.4.1 Effects of DHA and zinc on zinc transporter expression levels 94

2.4.1.1 hZnT1 94

2.4.1.2 hZnT2 96

2.4.1.3 hZnT3 97

2.4.1.4 hZnT4 99

2.4.1.5 hZnT6 100

2.4.1.6 hZnT5 and hZnT7 101

2.4.1.7 hZip 1-4 101

2.4.2 Effects of DHA and zinc on neuronal cell survival 103

2.4.3 Vitamin E and DHA effect on ZnT3 expression level 104

CHAPTER 3: DHA effect on zinc fluxes and labile zinc levels 106

3.1 Introduction ……………………………………………………………………………………………………….. 106

3.1.1 DHA effect on zinc fluxes 106

3.1.2 DHA and Zinc 108

3.1.3 Zinc Fluorophores 108

3.2 Materials and Methods ………………………………………………………………………………………. 111

3.2.1 Cell culture 111

3.2.2 Compatibility study of four different zinc fluorophores 111

3.2.3 DHA effect on zinc fluxes across the cell membrane 112

3.2.4 LA effect on zinc fluxes across the cell membrane 113

3.2.5 DHA treatment - timepoint study 114

3.2.6 Serum starvation study with DHA enrichment 114

3.3 Results ………………………………………………………………………………………………………………… 116






3.3.6 DHA effects on zinc fluxes across the cell membrane in NT2 cells 127

3.3.7 LA effect on zinc fluxes across the cell membrane in NT2 cells 129

3.3.8 DHA treatment - timepoint study with NT2 cells 131

3.3.9 DHA and Serum starvation study with NT2 cells 132

3.4 Discussion .…………………………………………………………………………………………………………. 137






3.4.6 Conclusion 144

CHAPTER 4: Differentiation of human cells into more primary neuronal type cells 146

4.1 Introduction ……………………………………………………………………………………………………….. 146

4.1.1 Cell culture models in neuro-research 146

4.1.2 Differentiation agents 148

4.1.3 Traditional culture system versus 3D system 149

4.1.4 Outline of the study 151

4.2 Materials and Methods ………………………………………………………………………………………. 152

4.2.1 Cell culture 152

4.2.2 M17 cell differentiation using a conventional 2D cell culture system 153

4.2.3 M17 cell differentiation using 3D culture system 153

4.2.4 Modified 3D culture system for differentiation 154

4.2.5 Protein isolation and Western blot analysis 156

4.2.6 Immunocytochemistry experiments 157

4.3 Results ………………………………………………………………………………………………………………. 159

4.3.1 M17 cells are resistant to RA in a conventional 2D cell culture system 159

4.3.2 M17 cells acquire expression of neuronal markers when cultured in the

presence of RA in a 3D cell culture system 163

4.3.2.1 Immunocytochemistry results revealed a clear difference

between 2D and 3D culture systems 163

4.3.2.2 Analysis of protein expression levels in RA treated M17

cells using a 3D culture system 166

4.3.3 Modified 3D culture method with reduced differentiation time 170

4.3.3.1 Filter Method 171

4.3.3.1.1 M17 Cells 171

4.3.3.1.2 SY5Y Cells 172

4.3.3.1.3 NT2 Cells 173

4.3.3.2 Suspension Filter Method 175

4.3.3.2.1 M17 Cells 175

4.3.3.2.2 SY5Y Cells 176

4.3.3.2.3 NT2 Cells 177

4.3.3.3 Suspension Flask Method 179

4.3.3.3.1 M17 Cells 179

4.3.3.3.2 SY5Y Cells 180

4.3.3.3.3 NT2 Cells 180

4.3.4 Analysis of protein expression levels in RA treated cells using

the modified 3D culture systems 183

4.4 Discussion ……………………………………………………………………………………………………………… 190

4.4.1 M17 cells are resistant to RA in a conventional 2D cell culture system 190

4.4.2 M17 cells acquire expression of neuronal markers when cultured

in the presence of RA in a 3D cell culture system 192

4.4.3 Modified 3D culture methods 195

4.4.4 Conclusion 197

CHAPTER 5: GENERAL DISCUSSION 199

5.1 DHA effect on neuronal cell survival and zinc homeostasis …………………………………. 201

5.1.1 DHA effect on apoptosis levels 201

5.1.2 DHA and zinc transporter levels 201

5.1.3 DHA and free zinc availability 202

5.2 Cellular differentiation …………………………………………………………………………………………. 204

5.2.1 Differentiating M17 cells 206

5.2.2 Novel differentiation method 207

5.3 Limitations of the present study ………………………………………………………………………….. 208

5.4 Future Directions …..…………………………………………………………………………………………….. 209

5.5 Significance of the current findings ….…………………………………………………………………… 211

5.6 Conclusion ……………………………………………………………………………………………………………. 213

CHAPTER 6: Bibliography 215

i

Abstract

Omega-3 fatty acids are one of the two main families of long chain polyunsaturated

fatty acids. Polyunsaturated fatty acids are in general considered to be one of the

most essential nutrients for humans. The human body is not capable of synthesizing

omega-3 or omega-6 fatty acids efficiently. Thus, it must be obtained through diet or

supplementation. The main omega-3 fatty acids in the mammalian body are α-

linolenic acid (ALA), docosahexenoic acid (DHA) and eicosapentaenoic acid (EPA).

Central nervous tissues of vertebrates are characterized by high concentration of

omega-3 fatty acids. Moreover, in the human brain, DHA is considered as the main

structural omega-3 fatty acid, which comprises about 40% of the PUFAs in total. DHA

deficiency is related with many disorders such as depression, inability to concentrate,

excessive mood swings, anxiety, cardiovascular disease, type 2 diabetes, dry skin and

so on. Animal model studies have shown a link between omega-3 rich diet and the

neuronal cell survival. Like DHA, zinc is the most abundant trace metal in the human

brain. There are much scientific evidence linking zinc, especially excess amounts of

free zinc, to cellular death. Neurodegenerative diseases such as Alzheimer’s disease

is characterised by the altered zinc metabolism. Studies conducted with rats have

shown increased expression of ZnT3 zinc transporter levels and increased

hippocampal levels of zinc when treated with a DHA deficient diet.

ii

Therefore, this study was designed to explore the concept of “Omega-3 fatty acids

and zinc in neuronal cell homeostasis and survival” in a holistic context. The main

focus of the research was to investigate possible link between zinc, DHA, apoptosis

and cell survival. The research also investigates many aspects of “omega-3 fatty acids

and its benefits at the cellular level”. The project attempts to gauge omega-3 effects

on neurodegenerative conditions such as Alzheimer’s disease. This study describes

various factors which are responsible for neurodegeneration and a possible link

between free zinc availability at the cellular level to neurodegeneration. To elucidate

the link between DHA, zinc and brain cell death, we cultured human neuronal M17,

SY5Y and NT2 cells in DHA-deficient or DHA-enriched culture medium. Exposure of

cells to DHA-deficient medium reduced the levels of active caspase-3 and increased

the levels of Bcl-2, relative to levels in DHA treated cells, confirming the adverse

effects of DHA deficiency in promoting neuronal cell death. To investigate the role of

zinc in DHA-induced apoptotic cell death, we grew cells in DHA-deficient and DHA-

enriched culture medium and measured zinc uptake using zinc fluorophores. In DHA

treated cells, zinc fluorescence signalling was almost invisible compared to the strong

fluorescence labelling which could be seen with the DHA deficient cells. Furthermore,

in DHA-treated cells, ZnT3 mRNA and protein levels were significantly down-

regulated compared to levels in DHA-deficient cells. Previous studies have shown

free zinc can mediate brain cell death through apoptosis. In conclusion, observations

reported by this this study suggests that DHA acts as a neuro-protective compound

trough a reduction in free cellular zinc levels that in turn protect cells from apoptosis.

iii

Despite the increasing demand, neuroscience research is limited due to the high cost

associated with the research and lack of a suitable in vitro model that can mimic the

structural and functional characteristics of human mature neurons. Many research

uses cheaper and readily available substitutes such as animal models or rodent

neurons or other different immortalized human cells such as neuroblastoma cells.

Though, these alternatives have been widely used in common practice, the

resemblance to the actual physiological conditions can vary substantially. Second

component of this study was to address this issue and was focused in developing a

better human cell culture model for neurobiology research. Human neuroblastoma

cell lines M17 and SY5Y, along with human tetra carcinoma cell line NT2, were used

in this study and differentiated using retinoic acid. Past studies have shown that M17

cells are resistant to retinoic acid and continued to proliferate under the normal

conditions when treated with retinoic acid. However, during this study, cells were

grown on a 3D structure instead of the conventional 2D method and then treated

with retinoic acid. With the combination of these improved methods, we managed

to differentiate all the three cell lines and cellular differentiation was tested with

neuronal specific markers using immunocytochemistry and Western blotting

techniques.

In conclusion, the current study provides two key significant contributions towards

the advancement of neuroscience research. Firstly by elucidating a possible link

between free zinc availability, DHA levels and apoptosis, thus suggesting a possible

neuroprotective pathway following DHA treatment at the cellular level. Secondly

iv

thist study was able to develop a better cell culture model to generate terminally

differentiated neuronal cells. The current method provides an economical, effective

and simple method of differentiating neuronally committed cells into primary

neuronal cells.

v

Acknowledgements

First and foremost, I would like to thank my supervisor Associate Professor Cenk

Suphioglu. It was a great pleasure and honour to be one of your very first Honours

students at Deakin and then go on to complete my PhD. Thank you for all the

knowledge you have passed on and your guidance over the years. Most of all thank

you for always believing in me and letting me complete my PhD journey and giving

me the strength and the support when I needed it most. Without your unconditional

care and support over the years, pursuing my career goal wouldn’t have been

possible.

To Professor Leigh Ackland,, for sharing your specialised knowledge in the field, for

guiding and helping me to design this project and many of the experiments, and for

giving me the opportunity to work with you for many years.

To Dr Agnes Michalczyk, for your outstanding knowledge and expertise in many

different techniques and fields, and for the solutions you have provided for my

project.

Thank you to Dr. Phil Taylor and Dr. Sarah Shigdar for sharing your outstanding

confocal knowledge with me and Thank you to Professor Wei Duan for allowing me

to use your Chemidoc.

vi

To the most wonderful scientists I have worked with so far, the NARL team. You guys

were a breath of fresh air to me. The warmness and support you all have shown me

from day one was immense and truly appreciated. Special thanks to Pathum, Nayyar,

Chamika, Justin and Lauren for simply being awesome.

To all my dear friends outside the lab, too many to name. Over the years you have

been there for me and made my journey more enjoyable and easy. Especially, Bope,

Prabhath, Charaka, Malinda, Nishantha and Sancha. Not forgetting my science

buddies Arash and Damon. We got to know each other at Deakin, and ten years later

we still share the same passion and interests. Thank you for all the memories at CCMB

and beyond.

To my dearest two brothers, darling sister (in-law), Junior & Hinnie. Thank you for

being such a wonderful family and the never-ceasing love and support you have all

given me.

To my second set of parents, Uncle and Aunty. Thank you for all the love and care

you have given to me. For your encouragement and strength over the past few years.

To the newest and the most precious addition to my life. My dear little princess,

Venya. I would like to dedicate this thesis to you, as an inspiration for you to achieve

your life goals despite all the hardships and difficulties you may come across. Always

remember to get up one more time than you fall.

vii

To my Darling wife, Vinali. Thank you for being part of my life. Without you this

journey wouldn’t have been possible. Thank you for all your tireless efforts in proof

reading and correcting my mistakes. Above everything for your love, care and for

being the strength behind me to complete my PhD journey.

Last but not least, to my dear parents. Without your hard work I wouldn’t be here.

Thank you very much for all the sacrifices you have made to make our lives better.

Thanks for giving us the best and for encouraging me to achieve the highest in my

life. Thanks for igniting the passion and the dream to pursue a PhD and for making

sure that I get there. I know both of you are proud of what I have achieved.

Thank You!

viii

A list of publications during the course of candidature

Suphioglu, Cenk, De Mel, Damitha, Kumar, Loveleen, Sadli, Nadia, Freestone, David,

Michalczyk, Agnes, Sinclair, Andrew and Ackland, M. Leigh (2010) The omega-3 fatty

acid, DHA, decreases neuronal cell death in association with altered zinc transport,

FEBS letters, vol. 584, no. 3, pp. 612-618.

De Mel, Damitha, and Suphioglu, Cenk. “Fishy Business: Effect of Omega-3 Fatty Acids

on Zinc Transporters and Free Zinc Availability in Human Neuronal Cells.” Nutrients

6.8 (2014): 3245–3258. PMC. Web. 18 Dec. 2014.

ix

Abbreviations

2D 2 Dimensional

3D 3 Dimensional

ABC ATP-binding cassette

Aβ Amyloid beta

AD Alzheimer’s disease

ALS Amyotrophic lateral sclerosis

APP Amyloid precursor protein

APS ammonium persulphate

ARA Arachidonic acid

BDNF Brain-derived neurotrophic factor

βME beta- mercaptoethanol

CaEDTA Edetate calcium disodium

CDF Cation diffusion facilitator

cDNA Complementary deoxyribonucleic acid

CNS Central nervous system

DCT1 Divalent cation transporter1

DHA Docosahexenoic acid

dATP deoxyadenosine Triphosphate

dH20 distilled H20

DMEM Dulbecco’s Modified Eagle’s Medium

DNA Deoxyribonucleic acid

dNTP deoxythymidine triphosphate

ECM Extracellular matrix

EDTA Ethylenediaminetetraacetic Acid

EPA Eicosapentaenoic acid

FA Fatty acid

FBS Fetal bovine serum

G Gauge

x

g Gravity

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

HCl Hydrochloric Acid

HRP Horseradish-peroxidase

IR Infrared

IGF Insulin like growth factors

IRT1 Iron-regulated transporter 1

LA Linoleic acid

LTB4 Leukotriene B4

mRNA Messenger ribonucleic acid

milliQ ultrapure water

NGF Nerve growth factor

Opti-MEM Modified Eagle's Minimal Essential Medium

PAGE Polyacrylamide gel electrophoresis

PBS Phosphate-Buffered saline

PCR Polymerase chain reaction

PUFA Polyunsaturated fatty acid

QPCR Quantitative PCR

RA Retinoic acid

RNA Ribonucleic acid

RNase Ribonuclease

ROS Reactive oxygen species

RPMI Roswell Park Memorial Institute Medium

SDS Sodium Dodecyl Sulphate

SLC Solute Linked Carrier

ST Staurosporine

TBS Tris Buffered Saline

TBST Tris Buffered Saline with 0.1% (v/v) Tween 20

TEMED - N,N,N’ Tetramethylethylenediamine

TNF Tumour necrosis factor

TPA 12-O-tetradecanolyphorbol-13-acetate

xi

TXA2 Thromboxane A2

UV Ultraviolet

V Volts

ZIP Zinc-regulated transporters, Iron-regulated transporter-like

proteins

ZnT Zinc transporter

Chapter 1: Literature Review

1 | P a g e

CHAPTER 1: Literature Review

1.1 Omega -3 (ω-3) Fatty Acids

Fatty acids (FAs) in general are naturally occurring molecules consisting of a

hydrocarbon chain of varying length, with a carboxyl group (COOH) and a methyl

(CH3) group at either end. Fatty acids are classified according to the number of

carbon atoms and the number and the type of bond between the carbons. Saturated

FAs only have single bonds between carbon-carbon atoms, which are fully saturated

with hydrogen atoms. In contrast, unsaturated FAs have at least one or more

unsaturated carbons. Monounsaturated FAs contain a single carbon-carbon double

bond, while polyunsaturated FAs contain at least two or more double bonds. The

most common confirmation for these double bonds are in cis, however the trans

confirmation is also present as intermediates in the bio-hydrogenation of FAs in some

plant lipids (Christy et al., 2003).

Polyunsaturated fatty acids (PUFAs) in general are considered to be one of the most

essential nutrients for humans and are well known to be important as a structural

and functional component of the mammalian body. Omega-3 and omega-6 are the

two main families of PUFAs. High concentration of PUFAs can be found in the human

central nervous system (Salem et al., 1976) and eyes (Benolken et al., 1973). A huge

20% of the dry matter of the brain (Logan, 2004) and 6% of the dry matter of the


2 | P a g e

cerebral cortex is made up of PUFAs (Svennerholm, 1968). Many biochemical

processes especially in early postnatal development, such as cellular differentiation,

active synaptogenesis, and photoreceptor membrane biogenesis are extensively

dependent on PUFAs (Longo et al., 2003). However, despite of all these essentialities,

mammals cannot synthesize PUFAs de novo, and must attain it through their dietary

sources.

Both Omega-3 and omega-6 are very important in many biochemical functions, but

still metabolically and functionally distinct and have opposing physiological effects

(Simopoulos, 2002). As an example, at high concentrations, omega-6 FAs can increase

the formation of prostaglandins and thereby increase inflammatory processes. In

contrast, the reverse process can be seen with increased omega-3 in the body. Many

other factors such as thromboxane A2 (TXA2), leukotriene B4 (LTB4), IL-1, IL-6,

tumour necrosis factor (TNF), and C-reactive protein, which are related to varies

health conditions have been shown to increase with high omega-6 FAs, but decrease

with omega-3 FAs (Simopoulos, 2002).

In recent years, evidence supporting the essential nature of PUFA’s for better health

has increased. As a result, the recommended level of dietary PUFA intake has gone

through extreme scientific scrutiny over the last few years. As an example, over the

last few years the recommended levels for two main omega-3 FAs (eicosapentaenoic

acid and docosahexaenoic acid) have increased four-fold from 0.15 to 0.6 g/day (Kris-

Etherton et al., 2000). The essential nature of FAs are well documented in a study

performed with rats, where rats on a fat-free diet showed no growth or reproduction


3 | P a g e

(Holman, 1971). Both linoleic acid (omega-6 fatty acid) and α-linolenic acid (omega-3

fatty acid) have been classified as essential for humans (Burr and Burr, 1930). More

recently, arachidonic acid and docosahexaenoic acid have also been recognised for

their importance in human development (Connor et al., 1992). Docosahexaenoic acid

(DHA) is one of the major omega-3 FAs in the mammalian body along with α-linolenic

acid and eicosapentaenoic acid (EPA). Two of the major omega-6 PUFAs in the human

body are linolenic acid and arachidonic acid (ARA) (Simopoulos, 2002; Solfrizzi et al.,

2005). Linolenic (18:2n6) and α-linolenic (18:2n3) acids can be metabolized into

longer chain polyunsaturated versions such as ARA (20:4n6) and DHA (22:6n3),

respectively. However, it has been reported that this biosynthesis or inter-conversion

does not provide an adequate amount for optimal neural development (Salem et al.,

1996), indicating the importance for sufficient dietary intake. In fact, no more than

0.2% of C-18 PUFA is effectively biosynthesised into C-22 PUFA (Pawlosky et al.,

2001). Furthermore, this very low inter-conversion rate of omega-3 has been linked

to three other major factors: high omega-6 to omega-3 ratio, excess amounts of trans

FAs in the diet, and enzyme cofactor deficiencies such as zinc deficiency (Hobbeln,

2001).


4 | P a g e

1.2 Docosahexenoic acid (DHA)

Docosahexaenoic acid (DHA) is a carboxylic acid with a 22-carbon chain with six cis

carbon-carbon double bonds (Figure 1.1). DHA is the longest and most unsaturated

fatty acid. Its third carbon from the omega end contains the first double bond, hence

the fatty acid nomenclature 22:6 (n-3). The trivial name of DHA is cervonic acid and

its systematic name is all-cis-docosa-4,7,10,13,16,19-hexaenoic acid. DHA is one of

the main omega-3 FAs and its well conserved throughout the mammalian species

despite dietary differences (Neuringer et al., 1988). DHA is commonly found in the

phospholipids of biological membranes and it is a primary structural component of

membrane phospholipids at synapses, in retinal photoreceptors (Lukiw et al., 2005),

and also in testis and sperm (Neuringer et al., 1988). In adult rats’ brain, DHA

comprises approximately 17% of the total FA weight and in the retina it’s as high as

33% (Hamano et al., 1996). DHA is believed to have played a major role in the

evolution of the modern human, and in particular the well-developed brain (Crawford

et al., 1999).

The effects of dietary FAs and their deficiencies have been well studied and

documented. Furthermore, a potential protective effect from coronary heart disease

(McLennan PL, 1992), and a critical role in immune response, gene expression, and

intercellular communication have also been linked to PUFA levels (Hobbeln, 2001).

Mainly, omega-3 FAs are known to be vital in prevention of fatal ventricular

arrhythmias (Nair et al., 1997).


5 | P a g e

Figure 1.1: DHA Structure

DHA's structure is a carboxylic acid with a 22-carbon chain and six cis double bonds

with the first double bond located at the third carbon from the omega end.


6 | P a g e

Omega-3 FAs are also known to reduce thrombus formation propensity by decreasing

the platelet aggregation, blood viscosity and fibrinogen levels (Simopoulos, 1991).

Many brain related disorders such as depression (Hibbeln, 1998), bipolar (Stoll, 1999)

and unipolar (Nemets et al., 2002) disorders, impairments in learning ability

(Yamamoto et al., 1987), schizoaffective disorders (Fenton et al., 2001), dementia

(Sandra Kalmijn, 1997) and Alzheimer’s disease (Conquer et al., 2000) have all been

linked to omega-3 deficiency, suggesting its importance in cognitive functions and

health. Furthermore, conditions such as vision impairment, diabetes, arthritis, cancer

proliferation (Connor, 2000), dermatitis, growth retardation, and reproductive failure

(Holman, 1971) have also been shown to correlate with omega-3 deficiency.

1.3 Zinc and life

1.3.1 Zinc

Zinc is a trace element indispensable for life and is the second most abundant trace

element in the body (Weiss et al., 2000). Zinc is known to be related to growth,

development, differentiation, immune response, receptor activity (Vallee and

Falchuk, 1993), gene expression, DNA synthesis, enzymatic catalysis, hormonal

storage and release, tissue repair, neurotransmission, memory, the visual process

(Chai et al., 1999) and many other cellular functions too numerous to list. The

indispensability of zinc to the body can be discussed in many other aspects; including

as a component of over 300 different enzymes (Wallwork, 1987), as an integral


7 | P a g e

component of a metallithioneins (Kagi et al., 1961), or a gene regulatory protein

(Hanas et al., 1983). Approximately 3% of all proteins contain zinc binding motifs

(Frederickson et al., 2005a). The broad functional capability of zinc is thought to be

due to its usually stable chemical and physical properties (Vallee and Auld, 1990).

Zinc is thought to have three different functions in enzymes: catalytic, coactive and

structural (Vallee and Auld, 1992). Indeed, it is the only metal that can be found in

all six different subclasses of enzymes (Cai and Chou, 2005; Vallee and Falchuk, 1993).

In the mammalian body zinc is mainly localised in the brain where it is at around

150μM in concentration (Wallwork, 1987). However, free zinc in the mammalian

brain is calculated to be around 10 to 20nM (Frederickson et al., 2005a), and the rest

exist as either protein, enzymes or nucleotide bound (Vallee and Falchuk, 1993). The

brain and zinc relationship is thought to be mediated through glutamate receptors

(Smart et al., 1994), and zinc is known to inhibit both inhibitory and excitatory

receptors (Frederickson et al., 2005a). Vesicular localization of zinc in presynaptic

terminals is a characteristic feature of brain zinc and its release is dependent on

neural activity (Weiss et al., 2000).

Moreover, high zinc concentration is linked with neurodegenerative disorders such

as Alzheimer’s disease (AD) and amyotrophic lateral sclerosis (ALS) (Weiss et al.,

2000). The relationship between zinc and AD has been interpreted in several ways.

One of the studies has proposed that β-amyloid has greater propensity to form

insoluble amyloid in the presence of high physiological zinc levels (Bush et al., 1994b).

Insoluble amyloid is thought to promote plaque formation, which is a main

pathological feature of AD (Hyman, 2005). Further studies have shown that chelation


8 | P a g e

of zinc ions can deform and disaggregate the plaque (Cherny et al., 2001; Stoltenberg

et al., 2005a). In AD, the most prominent injuries can be found in hippocampal

pyramidal neurons, acetylcholine containing neurons in the basal forebrain, and in

somatostatin-containing neurons in the forebrain (Weiss et al., 2000). All these

neurons are known to favour rapid and direct entry of zinc in high concentrations (Yin

HZ, 1994), allowing frequent exposure to zinc in high dosages. This is thought to

promote neuronal cell damage through oxidative stress and mitochondrial

dysfunction (Weiss et al., 2000).

1.3.2 Zinc in the brain

In the mammalian body, the highest concentration of zinc is found in the adult brain,

which is about 150μM (Wallwork, 1987). However, free zinc in the mammalian brain

is thought to be around 10 to 20nM (Frederickson et al., 2005b) and the rest exists

bound to either proteins, enzymes or nucleotides (Vallee and Falchuk, 1993). A major

role for zinc in the brain is to regulate glutamate receptors (Smart et al., 1994), where

zinc is able to increase the activity of both inhibitory and excitatory types of receptors

(Frederickson et al., 2005b). In the central nervous system, zinc has an additional role

as a neurosecretory product or cofactor. Vesicular localization of zinc in presynaptic

terminals is a characteristic feature of brain-zinc and its release is dependent on

neural activity (Weiss et al., 2000).


9 | P a g e

1.3.3 Alterations of zinc metabolism

The importance of zinc for the human body is readily identified by studying the wide

range of pathological effects of zinc deficiency. Anorexia, embryonic and postnatal

growth retardation, alopecia, skin lesions, difficulties in wound healing, increased

haemorrhage tendency and severe reproductive abnormalities, emotional instability,

irritability and depression are just some of the many diseases linked to an altered zinc

metabolism in the body (Ackland and Michalczyk, 2006; Aggett, 1983; Halsted, 1972;

Smart et al., 1994; Vallee and Falchuk, 1993; Wallwork, 1987). Proper development

and function of the central nervous system is also dependent on zinc levels. Growth

retardation and impaired development of CNS tissues have been associated with low

levels of zinc (Dreostl, 1983). Peripheral neuropathy, spina bifida, hydrocephalus,

anencephalus (Hurley, 1981), epilepsy and Pick's disease (Frederickson, 1989), have

also been linked to zinc deficiency.

In addition to zinc deficiency causing much damage to the body, excessive amounts

of zinc can also lead to significant adverse effects. Neurotoxicity and neuro-

degeneration are widely seen with exposure to excessive amounts of zinc. Using

mouse neuronal cells, it has been shown that 24 hour exposure to 40μM of zinc was

sufficient to degenerate cells (Sheline et al., 2000b). The translocation of zinc from

presynaptic to postsynaptic neurons is the main mechanism suspected to be involved

in neurotoxicity (Weiss et al., 2000). This zinc translocation is responsible for inducing

the cell injuries encountered in conditions such as brain trauma (Suh, 2000), epilepsy

and transient global ischemia (Weiss et al., 2000). Using an intraventricular injection


10 | P a g e

of metal chelator, it has been shown that edetate calcium disodium (CaEDTA) blocked

the postsynaptic accumulation of zinc, and thereby markedly reduced the neuronal

death (Koh et al., 1996; Suh, 2000). Excessive zinc is also capable of inhibiting Ca2+

and Na+ voltage gated channels (Akaike, 1989; Ravindran et al., 1991; Winegar and

Lansman, 1990). Moreover, prolonged exposure to higher concentrations of zinc has

been shown to induce cell necrosis (McGowan et al., 1994). Another mechanism

through which zinc toxicity may work is by inhibiting glyceraldehyde-3-phosphate

dehydrogenase (GAPDH), resulting in a decrease production of ATP in neuronal cells,

and ultimately cell death (Sheline et al., 2000b). Furthermore, increased levels of zinc

have been found to up-regulate cellular levels of reactive oxygen species (ROS) (Kim

et al., 1999a). Elevated ROS levels can be directly detrimental to cell survival by

damaging key macromolecules such as nucleic acids, proteins and lipids, and

subsequently cause rapid cell death. In a recent study, cultured mouse cortical and

cerebellar granule cells died via apoptosis in response to high zinc concentrations

(Kim et al., 1999c; Manev et al., 1997).

1.4 Zinc transporters

As described above, deficient or excessive amounts of zinc in the body can be

extremely catastrophic to the integrity of biochemical and biological systems. Thus,

this indicates the necessity of an appropriate and sophisticated homeostatic

mechanism. Primarily, this is done by the gastrointestinal system by controlling the

absorption, execration and the distribution of zinc (Krebs, 2000), though the


11 | P a g e

hydrophilic and high charge molecular characteristics of zinc are not favourable for

passive diffusion across cell membranes (McMahon and Cousins, 1998). Thus, most

if not in all zinc movement across cell membranes are known to occur via inter-

membrane zinc transporter proteins (Kambe et al., 2004b). These transporters are

mainly categorized under two metal–transporter families; Zip (ZRT, IRT – like

proteins) and CDF/ ZincT (Cation diffusion facilitator) (Kambe et al., 2004b). Both

families are also known as SLC (Solute Linked Carrier) gene families: ZincT (SLC30) and

Zip (SLC39) (Liuzzi and Cousins, 2004b).

The SLC 30 family facilitates zinc efflux from the cytosol to the extracellular matrix or

into the lumen of intracellular compartments, thus decreasing intracellular zinc

availability. Conversely, the SLC39 family facilitates the opposite mechanism: Zinc

influx to the cytosol, either from the extracellular matrix or from intracellular

compartments. ZincT1 was the first mammalian zinc transporter to be identified, in

an experiment with rat kidney cDNA (Findley, 1995). Since then, more than 100

different members of at least 9 known zinc transporters, and around 86 members of

15 known Zip transporters have been identified in human cells (Liuzzi and Cousins,

2004b). In addition, a “Nramp” family of metal-ion transporter, divalent cation

transporter1 (DCT1), is also suspected to be involved in zinc transportation (Gunshin

H, 1997). Apart from the recent rapid enhancement in the knowledge of these

transporters, the exact molecular mechanism of zinc metabolism is yet to be

understood.


12 | P a g e

1.4.1 SLC30 (ZnT) family

Members of the SLC30 family are putative facilitators of zinc efflux from the cytosol

to the extracellular environment or into luminal compartments such as secretory

granules, endosomes and synaptic vesicles, thus decreasing the intracellular zinc

availability (Figure 1.2). The predicted protein structure of this family consists of six

membrane-spanning domains, a large intracellular loop, and the amino and carboxyl

termini are both localized to the cytoplasmic side (Figure 1.3). Between the IV and V

transmembrane domains, there is a histidine rich intracellular loop, which is common

for this family. The predicted protein sizes are around 40 to 60 kDa (Palmiter, 1995b)

for this family. The ZnT1 gene cloned from a rat kidney cDNA library was the first

mammalian zinc transporter to be identified (Palmiter, 1995b). More than 100

different members have now been identified in the ZnT family (Gaither, 2001), and

out of these at least 9 are known to be present in human cells.


13 | P a g e

Figure 1.2: Putative cellular localization of the different human zinc transporters.

Arrows indicate the direction of zinc (Zn2+) transport by the appropriate putative zinc

transporters (i.e. Zip1- Zip4 and ZnT1- ZnT7).


14 | P a g e

Figure 1.3: Predicted structure of the SLC30 family members.

Key amino acid residues highlighted include leucine (L) on the amino or N-terminal

(NH2) half and the histidine (H) rich loop on the carboxyl or C-terminal half of the

molecule. Arrow indicates the direction of zinc movement from the membrane by

the putative zinc transporters.


15 | P a g e

1.4.2 SLC39 (ZIP) family

Members of the SLC39 family facilitate zinc influx into the cytosol, either from the

extracellular environment or from intracellular compartments (Figure 1.2). The

identification of this transporter family was a result of gene alignment of known ZRT1,

IRT1-like protein transporters in plants, yeast and human GenBank sequences

(Gaither and Eide, 2000). Most members of this family contain eight trans-membrane

domains and a long cytoplasmic histidine rich loop between domains III and IV. This

loop is thought to facilitate zinc transportation by binding to zinc molecules. In the

ZIP family, both the amino and carboxyl termini are on the extracellular or luminal

side (Eide, 2004). Predicted protein sizes for this family are around 30 to 40 kDa (Eide,

2004). Currently, about 86 ZIP family members have been identified and 15 of these

are known be present in human cells (Liuzzi and Cousins, 2004a).

In addition to these two families, the “Nramp” family metal-ion transporters,

divalent cation transporter1 (DCT1) (Gunshin H, 1997), metallithioneins, ATP-binding

cassette (ABC) transporters (Dean, 2001), P-type ATPases (Thelwell et al., 1998) and

iron regulated-like proteins (IRT1) (Smith et al., 2006) are also suspected to be

involved in zinc transportation across organisms. Despite the recent rapid increase

in knowledge of these transporters, many aspects of the molecular mechanisms of

zinc metabolism are yet to be understood.


16 | P a g e

Figure 1.4: Predicted structure of the SLC39 family members.

The amino acid residue highlighted on the diagram is histidine (H), which is rich in the

loop between domains III and IV of the molecule. Arrow indicates the direction of

zinc movement from the membrane by the putative zinc transporters.


17 | P a g e

1.5 Alzheimer’s disease (AD)

1.5.1 History and pathology of AD

AD is a neurodegenerative disorder that was first described by the German physician,

Alois Alzheimer and his colleagues in 1906 (Rainulf, 1995). Studies done on Augusta

Deter, a patient who showed distinct behavioural changes, lead to this remarkable

discovery. As described by Dr. Alzheimer, AD is characterised by a progressive pre-

senile dementia with general cortical atrophy (Rainulf, 1995). Gradually increasing

memory loss is the first symptom in many cases, and from then onwards the brain

deterioration becomes more rapid until the patient loses their ability to perform

almost all of the cognitive functions. Finally, the brain stops functioning due to

significant neuronal loss, resulting in death (Shapiro et al., 1985). The pathological

changes of AD includes β-amyloid plaque formation, dystrophic neurites associated

with plaques and neuro-fibrillary tangles within nerve cell bodies (Vickers et al.,

2000). AD is known to be the most prevalent cause of progressive dementia,

accountable for 50 - 70% of cases (Katzman, 1986). Within 100 years of its discovery,

much research was conducted to find a cure or a specific cause for the disease,

however most of these studies failed to make the target, though a few made

significant contributions (Gracious et al., 2010; Kuratko and Salem, 2009; Lien, 2009;

Sadli et al., 2012; Shahdat et al., 2009; Suphioglu et al., 2010b).


18 | P a g e

1.5.2 The future of Alzheimer’s disease

AD has been classified as a chronic brain disorder known to have a staggering impact

on both the health and economic prospect of the world. More than 1 in 10 people

over the age of 65 and almost half the population over 85 years is believed to suffer

from AD (Wall, 2007). Another study has estimated more than 26 million people

worldwide suffer from AD at present. Forecasts predict this number will more than

quadruple by 2050 from 26 million to 106 million and an estimated huge increase in

cost of 400% from 12.6 million to 62.8 million in Asia by 2050. In USA alone, the

incidence of AD is projected to rise from 5 million to 16 million. The forecast for other

regions are: Africa, 1.3 million cases today and 6.3 million by 2050; Europe, from 7.2

million to 16.5 million; Latin America and the Caribbean, 2 million to 10.8 million;

Oceania, from 200,000 to 800,000 (Wall, 2007). In USA, it’s considered to be the

fourth leading cause of death and third most expensive disease (Evans et al., 1989).

In addition to the huge monetary cost, the emotional and psychological impact

associated with AD for both patients and their families are even more devastating.

Therefore, AD is considered a significant health threat to the world, and since no

effective cure exists, mental health research has become a national priority for many

countries around the globe.


19 | P a g e

1.5.3 Predicted mechanisms for Alzheimer’s disease

In the process of identifying the cause for AD, several mechanisms have been

suggested. These include the amyloid cascade hypothesis (Zlokovic et al., 2005),

neurovascular hypothesis (Zlokovic, 2005), and dysregulated protein hypothesis

(Xiao, 2005). Also, processes such as phosphorylation of microtubule-associated

protein τ (tau protein), oxidative stress, metal ion deregulation, inflammation and

dysregulation of the cell cycle (Webber et al., 2005) have been identified as

mechanisms by which the disease develops. In addition to the above mechanisms,

genetic links have been proposed to some cases of AD (de la Torre, 2005; Erçelen,

2005). However, none of these hypotheses have been proven conclusively. Despite

its different mechanisms, the pathological features of AD have been well

documented and the most prominent is the formation of senile plaques. Amyloid

beta (Aβ) is primarily responsible for the formation of these senile plaques. This

plaque is then thought to trigger a cascade of reactions resulting in neurotoxicity

(Patel, 2003). Fragmentation of the transmembrane protein APP (amyloid precursor

protein) by the enzymes α, β and γ secretase produces Aβ. The enzymatic cleavage

of APP by α- secretase followed by γ is non-amyloidogenic. In contrast, β and γ

cleavage produces β-amyloid by the amyloidogenic pathway (Wolozin, 2001). The

neurofibrillary tangles present in AD plaques also consist of tau protein (Robert

Adalberta, 2007). Hyper-phosphorylation of this tau protein has been listed as a

causative factor in AD, along with many other candidates.


20 | P a g e

1.5.4 Omega-3 FA and Alzheimer’s disease

The absence of omega-3 FA in the diet has been linked with the onset of AD.

Epidemiology evidence suggests increased dietary omega-3 consumption can reduce

or delay the risk of AD. A recent experiment in rats has shown an increase in zinc

transporter 3 (ZnT3) expression levels with reduced consumption of omega-3 FA.

From this observation, the authors suggest this alteration can explain the link

between consumption of FA with the reduced risk of dementia and AD (Jayasooriya

et al., 2005a). Another study suggests that omega-3 FA can decrease β-amyloid

production, its accumulation and potential downstream toxicity, and therefore

reduce the onset of AD (Lim et al., 2005). In the same study, a DHA-enriched diet has

been shown to reduce the β-amyloid production in transgenic mice by approximately

70% and decrease the accumulation of plaques by approximately 40 to 50%.

Moreover, this study also demonstrated that both α and β APP C-terminal fragment

products and full length APP production was decreased due to DHA. Short term

administration of DHA into rats was shown to increase the transcription of a gene

responsible for scavenging the β – amyloid proteins (Puskas et al., 2003).

1.5.5 Zinc and Alzheimer’s disease

The relationship between zinc and AD has been interpreted in several ways. The

presence of zinc in neurofibrillary tangles has been well documented and studied.


21 | P a g e

One study has proposed that β-amyloid has a greater propensity to form insoluble

amyloid in the presence of high physiological zinc levels. Insoluble amyloid is thought

to promote the plaque formation, the main pathological feature of AD (Hyman,

2005). In addition, in vitro studies conducted with zinc and β-amyloid (Aβ) has shown

that zinc can precipitate soluble Aβ into protease resistant amyloid aggregates (Bush

et al., 1994b; Bush, 1994b). Zinc chelation from post-mortem AD brains was shown

to increase the solubility of Aβ proteins (Cherny R. A., 1997). Another study

performed using Tg2576 transgenic mice have shown the release of zinc during

synaptic transmission to stimulate cerebral Aβ deposition (Bush, 2003). Further

studies have revealed that chelation of zinc ions can cause the plaque to deform and

disaggregate (Cherny et al., 2001; Stoltenberg et al., 2005b). These studies

conducted using human AD brains and transgenic Tg2576 mice brains have exhibited

high level of zinc and a link between excess amounts of zinc and the formation of

amyloid plaques (Huang et al., 2000). Moreover, ZnT-3 knockout transgenic Tg2576

mice have demonstrated substantially reduced levels of insoluble Aβ and reduced

amyloid plaque formation (Lee, 2002). These findings confirm the link between high

levels of cytoplasmic zinc and AD.

In AD, the most noticeable damage can be found in hippocampal pyramidal neurons,

acetylcholine containing neurons in the basal forebrain and in somatostatin-

containing neurons in the forebrain (Weiss et al., 2000). These neurons are highly

permeable to zinc (Yin HZ, 1994), leaving neurons exposed to frequent and high

fluctuations in zinc. This is thought to promote neuronal cell damage through

oxidative stress and mitochondrial dysfunction (Weiss et al., 2000). Zinc has also


22 | P a g e

been shown to specifically inhibit the α-secretase cleavage of APP, which is the non-

amyloidogenic pathway, thereby increasing the propensity for AD (Roberts et al.,

1994). In addition, a specific and saturable binding site for zinc (KA = 750 nmol/L) has

been identified within the cysteine-rich region on the ectodomain of amyloid

precursor proteins (Bush, 1994a). Zinc is well conserved throughout all members of

the APP super-family (Bush et al., 1993), and considered as being one of the most

conspicuous metals available at physiological pH levels to precipitate Aβ (Bush et al.,

1994b). On the other hand, metals such as copper tend to be more active in acidosis

conditions (Atwood, 1998). A series of studies conducted with early and late AD

brains have shown significantly elevated levels of ZnT-1, ZnT-4 and ZnT-6 proteins

(Lovell et al., 2006; Lovell et al., 2005; Smith et al., 2006). These findings further

strengthen the link between altered zinc levels in the brain and development of AD.

Recently, a link between DHA dietary levels and zinc homeostasis has been revealed

for the first time. A study using rats has shown that dietary deprivation of DHA levels

caused abnormal zinc metabolism via overexpression of ZnT-3 (Jayasooriya et al.,

2005a), suggesting a possible relationship between zinc levels and omega-3

consumption in AD cases. In summary, the studies mentioned above highlight links

between zinc metabolism and AD; dietary omega-3 FA levels with the onset of AD;

and also an association between DHA levels and zinc metabolism (Figure 1.5). Thus,

these findings suggest a possible synergistic effect, which may be present in AD.


23 | P a g e

Figure 1.5: Summary of key findings from literature to establish a possible link

between DHA, zinc and AD.

The figure indicates all the major findings from literature to establish a possible link

between DHA, zinc and AD. The project was based on these major findings and the

fourth point forms the basis of the hypothesis, the increase in DHA affects zinc

transporter expression levels in human neuronal cell cultures.


24 | P a g e

1.5.6 Hypothesis of the study

The study is based on the hypothesis that the manipulation of DHA levels available to

human neuronal cells will influence the zinc homeostasis through altering the zinc

transporter expression levels. The link between DHA levels and zinc will be examined

using cultured human neuronal cells (SY5Y and M17), the human tetracarcinoma cell

line (NT2) and the human skin cell line (HaCaT) as the control.

1.5.7 Aims of the study

The aims of this project are outlined as follows:

To investigate the changes in gene expression levels of zinc transporters in

neuronal cells in response to different concentrations of omega-3 FAs and zinc

availability using quantitative PCR (QPCR);

To determine the changes in levels of zinc transporter proteins with different

doses of omega-3 and zinc levels using SDS-PAGE and immunoblotting, and

thereby confirm the PCR results;

To assess the free zinc availability following DHA treatment in human cells using

M17 and NT2. Thus, to determine the effect of DHA on cell survival and

homeostasis;

Assess the importance of these zinc transporters on cell survival and apoptosis by

using different levels of DHA and zinc;Develop a better cell culture model for


25 | P a g e

neuronal research by differentiating human cell lines to display more neuronal

properties.

1.5.8 Project outline

Four different cell lines: HaCaT, SY5Y, M17 and NT2 will be used in this study. HaCaT

is a skin cell line, which will be used as the control cell line. SY5Y and M17 cell lines

are both derived from human bone marrow neuroblastoma and both exhibit

epithelial and neuroblast morphologies (Biedler et al., 1978; Ciccarone et al., 1989).

NT2 cells are neuronally committed human teratocarcinoma cell line (Andrews,

1984). The experimental plan will be to culture these four cell lines to a fully

confluent stage and treat with 12 different treatment regimens for 4 days. Cell-

specific media supplemented with different concentrations of DHA (0, 5, 10, 20 & 40

μg/ml) with or without zinc will be used. All the different cell samples will be

collected and then total RNA and total protein will be isolated. cDNA will be

synthesised through reverse transcription of RNA, which will be used in QPCR to

measure any up-regulation or down-regulation of zinc transporter genes using gene

specific primers (hZnT1 - hZnT7 & hZIP1 - hZIP4). After this initial step, all results will

be analysed to choose 1 zinc transporter for further studies in this project.

In the second half of the project, DHA effects on human cells will be investigated.

Excessive amount of free zinc is considered as a biomarker for neurodegeneration.

Thus, DHA effect on labile zinc will be assessed following DHA treatments (20 μg/ml).


26 | P a g e

Linoleic acid will be used to compare the specificity of the results obtained using DHA.

The purpose of this part of the study is to analyse any neuroprotective properties

DHA may have thus to identify a possible pathway for neuroprotection through

omega-3 FAs.

Third part of the project is to develop a methodology to differentiate human neuronal

cells to give more neuronal properties so that it can be used in neuronal research. RA

will be used as the differentiation agent. Traditional monolayer method of cell

differentiation will be tested against the novel 3D differentiation to evaluate the pros

and cons of each method.

1.5.9 Significance of the study

The experiments are planned to established the effects of DHA and zinc on zinc

transporter expression levels and ultimately on neuronal cell survival. In conclusion,

this study is intended to elucidate the link between dietary omega-3 FA levels and AD

onset. In the future, it may be possible that these results will assist in finding a

prevention or therapeutic treatment for this debilitating disease.

In addition, by establishing a method to differentiate human cells to give more

neuronal properties will greatly benefit neurobiology research in general. A cost and


27 | P a g e

time efficient method for cell differentiation translates to improved productivity and

affordability in the research area in general.

Chapter 2. 1: Introduction

28 | P a g e

CHAPTER 2.1: Introduction

2.1 DHA effect on zinc transporters and cell survival

The hydrophilic and high charge atomic nature of zinc is not very compatible with

passive diffusion across the cell membrane (McMahon, 1998). Thus, in most if not in

all these cases, zinc movement is known to be mediated by intra-membrane proteins

termed zinc transporters (Kambe et al., 2004a). These transporters can be

categorized into two main metal transporter families, ZnT (Zinc transporters) family

and ZIP (ZRT, IRT – like proteins) family. Members of the ZnT family are putative

facilitators of zinc efflux from the cytosol to the extracellular environment or into

luminal compartments such as secretory granules, endosomes and synaptic vesicles,

thus decreasing intracellular zinc availability (Kambe et al., 2004a). ZIP transporters

facilitate zinc influx into the cytosol, either from the extracellular environment or

from intracellular compartments (Liuzzi and Cousins, 2004a). In addition to these two

main families, the “Nramp” family metal-ion transporters, divalent cation

transporter1 (DCT1) (Gunshin H, 1997), metallithioneins, ATP-binding cassette (ABC)

transporters (Dean, 2001), P-type ATPases (Thelwell et al., 1998), and iron regulated-

like proteins (IRT1) (Smith et al., 2006) are also supposed to be involved in zinc

transportation across organisms.


29 | P a g e

DHA is an omega-3 PUFA found predominantly in marine and plant oils. Mammals

cannot produce adequate amounts of omega-3 FAs through biosynthesis or inter-

conversion (Salem et al., 1996). Thus, sufficient dietary intake is vital for many

biological processes such as brain development, brain function and vision (Connor et

al., 1990; Gamoh et al., 2001; Ikemoto et al., 2001; Kyle et al., 1999; Mitchell et al.,

1998; Suzuki et al., 1998). Effects of DHA deficiency are well studied and

documented. Hearing and vision impairments (Bourre, 2004), depression (Logan,

2004), deficits in learning ability, cystic fibrosis, unipolar depression and

cardiovascular diseases (Horrocks and Yeo, 1999) are just some disorders known to

be associated with DHA deficiency. Neurodegenerative disorders such as AD and

Parkinson are also linked with DHA deficiency (Bousquet et al., 2011; Bousquet et al.,

2008; Calon and Cole, 2007). Studies done with rats have shown a link between zinc

homeostasis and DHA intake. DHA deficient rats have shown a decrease in plasma

zinc levels and modified brain zinc distribution (Jayasooriya et al., 2005b). More

importantly, DHA deficient rats also exhibit increased ZnT3 zinc transporter

expression levels (Jayasooriya et al., 2005b).

Both labile Zn2+ levels in a cellular system and DHA availability are linked with

neuronal cell death. Increased free zinc levels are associated with

neurodegeneration (Mocchegiani et al., 2005). When cortical neurons were exposed

to zinc, cells displayed widespread degeneration within 15 minutes (Koh and Choi,

1994). DHA on the other hand had a protective effect on serum-starved rodent

neural cells (Kim et al., 2000).


30 | P a g e

Though, a possible link between DHA and zinc is widely discussed the molecular basic

of this link remains unknown. Hence, this study intends to establish the effects of

DHA and zinc on zinc transporter expression levels and zinc metabolism, specifically

in relation to cell death through apoptosis.

Chapter 2.2: Materials & Methods

31 | P a g e

CHAPTER 2.2: Materials & Methods

2.2.1 Cell culture and treatments

2.2.1.1 Cell line and cell culture

The human neuroblastoma cell lines BE(2)-M17, SH-SY5Y, human teratocarcinoma

cell line NT2 and human skin (keratinocyte) cell line HaCaT, which were used in these

experimental studies, were obtained from Professor Leigh Ackland, Centre for

Cellular and Molecular Biology, Deakin University, (VIC, Australia).

HaCaT, the skin cell line was used as a control cell line to validate the neuronal

specificity of the results obtained from this study. HaCaT cells were originally isolated

from a melanoma of a sixty two year old male patient, and display an aneuploid

karyotype with distinctive stable marker chromosomes indicating monoclonal origin

(Boukamp, 1988). HaCaT cells were grown in Dulbecco’s Modified Eagle’s Medium

(DMEM) with 10% heat inactivated foetal bovine serum (FBS). SH-SY5Y is a thrice-

cloned sub line originally derived from a bone marrow biopsy from a four year old

female in 1970 (Biedler et al., 1978). This cell lines was grown in Roswell Park

Memorial institute 1640 (RPMI) medium supplemented with 20% heat inactivated

FBS. BE(2)-M17 is a twice cloned cell line, which originated from a bone marrow of a

two year old male patient with disseminated neuroblastoma (Ciccarone et al., 1989).


32 | P a g e

These cells were cultured in OPTI-MEM (modified Eagles Minimum Essential

Medium) with 2.5% heat inactivated FBS. The Ntera 2/D1 (NT2) is a neuronally

committed human teratocarcinoma cell line and was grown in Dulbecco's modified

Eagle medium (DMEM) with 10% heat inactivated FBS.

All four cell lines were grown as monolayers in 75 cm2 Nunc® EasYFlasks™ (Invitrogen,

Melbourne, Australia) and incubated at 37ºC in a humidified atmosphere of 5% CO2.

When monolayers reached confluence, cells were rinsed once with phosphate-

buffered saline (PBS), then rinsed again with 0.05% Trypsin

/ethylenediaminetetraacetic acid (EDTA) solution (Sigma-Aldrich, Sydney, Australia),

and finally incubated with Trypsin/EDTA at 37ºC for approximately 5 minutes (min)

for cells to be detached from the flask and from each other, and viewed under light

microscopy (Olympus CK40). Suspension was pipetted up and down, to further break

up cells, and divided into fresh media containing flasks, according to divisional needs

(Table 2.1).


33 | P a g e

Table 2.1: Cell culture media and divisional needs.

RPMI (Roswell Park Memorial Institute 1640 medium), was supplemented with 20%

of heat inactivated foetal bovine serum (FBS). DMEM (Dulbecco's Modified Eagle's

Medium), was supplemented with heat inactivated FBS at 20%. OPTIMEM is a

modified MEM (Eagle’s) media, supplemented with 2.5% heat inactivated FBS.

Cell line

Media % FBS

Passages (per

week)

Feeds (per

week)

%Trypsin

Proportion of cells to split in new

flaskHaCat DMEM 10 1 1 0.05 1:20SY5Y RPMI 20 1 - 0.025 1:20M17 OPTI-MEM 2.5 1 - 0.025 1:20NT2 DMEM 10 1 - 0.025 1:20


34 | P a g e

2.2.1.2 Omega-3 fatty acid (DHA) and zinc treatments

Cells were treated with five different doses of DHA and with or without Zinc (Figure

2.1) therefore, for each cell line 10 flasks were used. First of all, 4 flasks from each

cell lines were grown to confluence, and then harvested into 50 mL Falcon tubes and

diluted with five times the volume of appropriate media. Then 50 μL of this cell

suspension was combined with equal volume of trypan blue and cells per a unit

volume were counted using a haemocytometer under light microscope using Hoskins,

Meynell and Sanders (1956) method. Following that, for each cell line 10 flasks were

seeded with one million of cells and allowed to grow to confluence (approximately 2

to 3 days). While waiting, DHA and with or without zinc containing stock solutions of

media were made according to Table 2.2. The stock solutions were incubated at 37ºC

overnight on an orbital rotator. This was to allow DHA to conjugate with proteins in

the media to ensure maximum delivery into the cells. These stock solutions were

then used to make each treatment regime (Table 2.3) and were refrigerated until

further use.

When cells were about 100% confluent, old media was replaced by 20 mL of

appropriate media and left for two days before harvesting.


35 | P a g e

Figure 2.1: Cell culture treatment regimes.

Cells from each cell line were grown to 100% confluence and then treated with

different doses of DHA (0, 2.5, 5, 10, 20 and 40μg/mL) and with or without zinc

treatments for two days. This treatment was repeated for twice and then cells were

harvested for further studies. The cell specific media which cells were grown in are

indicated in the figure as well: (HaCaT – DMEM, SY5Y – RPMI, M17 – OPTI MEM).


36 | P a g e

Table 2.2: Stock solutions for DHA treatments

Stock solutions for DHA treatments were prepared according to the table prior

dividing to each treatment regimes

Volume (mL)

DHA stock (μg/mL)

ZnCl2(μM)

DMEM 90 160 -90 160 10

RPMI 45 80 -45 80 5

OPTI-MEM 45 80 -45 80 5


37 | P a g e

Table 2.3: Different DHA regimes

The treatment regime indicated in the table is for one cell line. As it shows each cell

line had 10 different treatment regimes, therefore altogether 40 regimes for 4 cell

lines.

Treatment Number

DHA(μg/mL) Zn

1 0 -2 2.5 -3 5 -4 10 -5 20 -6 0 +7 2.5 +8 5 +9 10 +10 20 +


38 | P a g e

2.2.1.3 Harvesting of cells

Cells were harvested using the method stated in “cell line and cell culture” (2.1.1)

section described above. Then, each of the cell-trypsin solutions was poured into 15

mL Falcon tubes and diluted with five times the volume of appropriate media. Cell

count was performed using 50 μL of cell suspension and trypan blue. Rest of the

samples were then centrifuged for 5 mins at 1,000 X g. The pellet was resuspended

in 3 mL of PBS, pipetted up and down to homogenise, and separated into three 1 mL

aliquots. These aliquots were centrifuged for 5 mins at 16,000 X g, the supernatant

was discarded and the cell pellets drained and stored at -80° C.

2.2.2 Quantification of zinc transporter gene levels

2.2.2.1 Total RNA isolation

Total RNA isolation was performed from cell pellets from all the four cell lines using

Silica Membrane RNeasy Mini Kit (QIAGEN, Doncaster, VIC) following the

manufacturer’s instructions. During the whole process, extreme care was taken to

prevent any contamination (i.e. RNase contamination) with the use of gloves,

goggles, aerosol barrier tips, dedicated RNA bench and pipettes.

In brief, cells were first disrupted by adding 350 μL of reducing agent β-

mercaptoethanol (β-ME) and buffer RLT mix (10 μL of β-ME for every 1 mL of RLT).


39 | P a g e

Samples were first mixed thoroughly by pipetting up and down. Then, the samples

were homogenized using 21G (gauge) needles with an RNase free syringe. After

that, 350 μl of 70% ethanol was added to each sample and mixed by pipetting. Whole

mixture from each sample was then transferred to RNeasy silica gel membrane mini

columns, which were placed in 2 mL collection tubes. Tubes were centrifuged at

10,000 X g for 15 seconds (s) and the flow through was discarded. Then 350 μl of

buffer RW1 was added to the columns and again spun for 15 s at 10,000 X g. The flow

through was again discarded and then this was followed by another centrifugation

for 15 s at 10,000 X g. The flow through was discarded. An additional step of on-

column DNase-I digestion was carried out according to the instructions listed in the

same protocol to ensure the removal of all contaminating DNA. First, DNase stock

solution was prepared by adding 550 μL of RNase free water to DNase-I powder.

Then, 10 μL of this DNase stock solution and 70 μL RDD buffer was delivered directly

onto each RNeasy silica membrane and incubated at room temperature for 15 mins.

After the incubation, 350 μL of buffer RW1 was added to each tube and centrifuged

for 15 s at 10,000 X g, and the flow through was discarded. 500 μL of RPE solution

was added to the columns and then centrifuged for 2 mins at 10,000 X g, the flow

through was discarded. The columns were centrifuged for a further 1 min at 10,000

X g to dry. The RNeasy columns were then transferred to a new 1.5 mL collection

tube and 50 μL of RNase free water was delivered to the membrane. The tubes were

centrifuged for 1 min at 10,000 X g to elute RNA. RNA concentrations and quality

were estimated using a DU 530 Life Science UV spectrophotometer (Beckman,

Melbourne, Australia) at 260/280 wavelengths. Total RNA was standardised to 5,000

ng/μL for cDNA synthesis.


40 | P a g e

2.2.2.2 cDNA synthesis

Total RNA was reverse transcribed to cDNA using StrataScript Reverse Transcriptase

kit (Stratagene, La Jolla, California) following the manufacturer’s instructions. In

brief, into nuclease-free microcentrifuge tubes, 10 μg of total RNA from each sample,

3 μL of 100 ng/μL random primers and diethylpyrocarbonate (DEPC) treated water to

a final volume of 50 μL were added. Then the tubes were placed into heat block set

at 65ºC for 5 min, and then allowed to cool to room temperature. Subsequently into

each tube, 5 μL of 10× StrataScript buffer, 1 μL of 40 U/μL RNase Block (ribonuclease

inhibitor), 2 μL of 100 mM dNTP mix and 1-2 μL of 50 U/μL StratScript reverse

transcriptase were added. The tubes were mixed gently by inversion and then

incubated for 1 h at 42ºC, followed by 5 min at 90ºC. The transcribed cDNA was then

frozen away at -20ºC until needed.

2.2.2.3 Quantitative PCR (Q-PCR)

Reverse transcribed cDNA from each cell line and treatment were used in real time

PCR. Amplification reactions were performed with 1 × SYBR Green PCR Master Mix

(Applied Biosystem, Warrington, UK), 3 μM of forward and reverse primers for Znt 1-

7, Zip 1-4 and GAPDH (Table 2.4) and 20ng cDNA from each sample. Samples were

analysed in triplicate in 20μl total volume per well using GeneAmp 5700 Sequence

Detection System (PE Biosystems, Foster City, CA). GAPDH was the internal control


41 | P a g e

used to normalize RNA quantities and efficiency of reverse transcription.

Amplification was performed as follows: One cycle at 50°C for 2 minutes and 95°C for

10 minutes, 45 cycles at 95°C for 15 minutes and 60°C for 60 s. Incorporation of SYBR

green dye into double stranded DNA produce fluorescence which would be then

automatically detected and recorded after the elongation phase of each repetitive

cycle. The specificity of each reaction was determined by analysis of the melting

point dissociation curve produced at the end of each PCR. The abundance of each

mRNA was measured as the cycle threshold (Ct) value, which is the cycle number

when fluorescence level exceeds the threshold value. The Ct values were

automatically recorded after each reaction. The Ct value of GAPDH was subtracted

from the Ct value of the target gene to produce ∆Ct for each sample. The relative

RNA expression level of each sample was calculated using the equation 2-∆∆Ct,

where ∆∆Ct is a difference between the treated ∆Ct and control ∆Ct. Two types of

PCR controls were performed to assure correct and acuate results. First one was a

“no-amplification control”, in which water replaced the volume of the primers. The

other one was a “no-template control”, which was with no cDNA. Also all the reaction

mixtures were prepared in bulk (master mixtures) in order to minimize pipetting

steps therefore reducing the risk of DNA contamination and also for better accuracy.


42 | P a g e

Table 2.4: List of QPCR primers

All the forward and reverse primers used in QPCR analysis of human zinc transporters.

Transporter Forward primer Reverse primer

hZnT1 hZnT1-1 (20-mer) CTGGTGAACGCCATCTTCCT hZnT1-2 (19-mer) CAATCTCGTGCGGCTCGAT

hZnT2 hZnT2-1 (19-mer) GCGCTGTGGCTGTGAACAT hZnT2-2 (20-mer) GGGTTCTCCTCCTGCTGGTT

hZnT3 hZnT3-1 (18-mer) TTTGGCTGGCACCGTTCA hZnT3-2 (18-mer) GCGGACGAAGGCCAGGTA

hZnT4 hZnT4-1 (22-mer) AACCAGTCTGGTCACCGTCACTh hZnT4-2 (20-mer) CTATCCTGCCCATGGTTACG

hZnT5 hZnT5-1 (22-mer) CATGGAGCTTCTCAAGGAAGCT hZnT5-2 (23-mer) ACACCCCTCATGTTAGCATTCAT

hZnT6 hZnT6-1 (23-mer) TCCTTTTTTGGCAAGTTGTTACG hZnT6-2 (25-mer) AAGCAGGAAGCCAGTACATATCAAG

hZnT7 hZnT7-1 (19-mer) TTGCCCCTGTCCATCAAAG hZnT7-2 (22-mer) AGACCTAAACCAGCCCGAGATC

hZIP1 hZIP1-1 (22-mer) GCCCTGAGCCTAGTAAGCTGTT hZIP1-2 (23-mer) TCATCTATGGCAGCCAGGTAGTC

hZIP2 hZIP2-1 (18-mer) ATGGAGTCGCTGGCATTG hZIP2-2 (23-mer) GGCTGTGGAGTTCGAAGATATGA

hZIP3 hZIP3-1 (19-mer) GAGCCTCGGCCACATCAGC hZIP3-2 (20-mer) CTGATCCTGACCTTCCGCAA

hZIP4 hZIP4-1 (18-mer) TCAGGAGCGGGTCTTGCT hZIP4-2 (19-mer) TGCTGTGCTGCTGGAACAC

GAPDH GAPDH-1 (18-mer) CCACCCATGGCAAATTCC GAPDH-2 (21-mer) TGGGATTTCCATTGATGACAA


43 | P a g e

2.2.3 Quantification of zinc transporter protein levels

2.2.3.1 Total protein isolation

Cell pellets harvested as described in section 2.1.3 above, were re-suspended in 500

Lysis buffer (1% sodium dodecyl sulfate (SDS) in 10 mM Tris-hydrochloric acid (HCl),

at a pH of 6.8). One Mini EDTA-free protease inhibitor cocktail tablet (Roche Applied

Science, Castle Hill, NSW, Australia) was added for every 10 mL of lysis buffer prior to

pipetting onto pellet, to prevent protein degradation. Cells were placed on ice and

homogenized by passaging through a Terumo 21G needle for approximately 10 times.

Cell samples were then sonicated (40% power output, 30% duty cycle) thrice for 15 s

with 30 s break between each sonication, using a Microson ultrasonic cell disrupter

(Misonix Incorporated, New York, USA). The homogenate was centrifuged at 16,000

X g at room temperature for 10 mins, and the supernatant was collected and

transferred to a new tube.

2.2.3.2 Total protein quantification

The supernatant was quantified using the Pierce BCA Protein Assay Reagent Kit

(Perbio, Rockford, USA), according to the manufacturer’s Microplate Procedure

instructions, adapted from Smith et al. (Smith, 1985). Changes from this protocol

included, reading the samples at a wavelength of 595 nm, instead of the specified


44 | P a g e

562 nm, and only using 10 μL of each unknown sample, hence the sample to working

reagent ratio was 1:20 (v/v), which minimises the effects of interfering substances.

Absorbance readings were obtained by Labsystems Multiscan Plate Reader and

Genesis Lite 3.03 computer Software. A standard curve was constructed using

Microsoft Excel 2007 computer software, from the absorbance of the known bovine

serum albumin (BSA) standards, a trendline was added and a linear equation

calculated. The protein concentration for each sample was then calculated using this

equation.

2.2.4 Gel electrophoresis of proteins

2.2.4.1 Preparing the gels

Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) technique

was used to separate proteins according to their size. 12% SDS-Acrylamide gel

mixture was prepared according to Table 2.5 and poured into upright gel cassettes

(Invitrogen, Melbourne, Australia). First, three quarters of the cassettes were poured

with the resolving gel mixture and the top quarter was filled with deionised water

(dH2O) and left to set for about 1 hour (hr). Once set, the water layer was displaced

with the stacking gel mixture up to the top. A comb was then inserted, into each

cassette and the gel left to set for another 1 hr. Then the gels were sealed in airtight


45 | P a g e

plastic bags, with a small volume of 1× running buffer (6 g Tris, 29 g Glycine, 2 g SDS

and dH2O water up to 2 L) to prevent dehydration and stored at 4oC until further use.

2.2.4.2 Protein loading

An aliquot of 40 μg of protein was loaded to each well, combined with 3.3 μL of 6×

loading buffer and milliQ water to a total volume of 15 μL. Before loading, each

sample was boiled for 10 mins, allowed to cool to room temperature, and

centrifuged for 15 s at 1,000 X g. The samples were separated, along with 5 μL of

Pageruler Prestained Protein Ladder Plus (Fermentas from Quantum Scientific, QLD,

Australia) using the XCell Surelock Mini-Cell (Invitrogen, Melbourne, Australia)

system and following the manufactures instructions. Tanks were connected to a

PowerPac300 (BIORAD, Gladesville, New South Wales) and protein electrophoresis

was performed for 90 mins at 125 volts (V) in 1 × running buffer. For each sample, 5

gels were prepared since there were 5 zinc transporter specific antibodies available

(hZnT1, 3 & 4, hZIP 1 & 3).


46 | P a g e

Table 2.5: SDS-Acrylamide gel mixture

12% SDS- Acrylamide gel were prepared following the tabulated volumes and

guidelines.

Component 12% Resolving Gel (1.5 mm thick)

4% Stacking Gel (1.5 mm thick)

Milli Q 2.6 mL 2.3 mL0.5M Tris, pH 6.8 - 1.0 mL1.5M Tris, pH 8.8 1.9 mL -

10% SDS 77.1 μl 38.6 μl30% Acrylamide 3.1 mL 0.5 mL

10% APS 50.3 μl 25.6 μlTEMED 5.5 μl 6.2 μl


47 | P a g e

2.2.4.3 Nitrocellulose membrane transfer

Following electrophoretic separation, proteins were transferred to nitrocellulose

blotting membrane (Pall, Life Sciences, Pensacola, Florida, USA) in 1× Novex Tris–

glycine transfer buffer (Invitrogen) and 10% methanol for 120 mins at 25 V using an

XCell Surelock Mini Cell (Invitrogen, Melbourne, Australia). Upon completion of the

transfer, membranes were stained briefly with 1× Ponceau red (0.2 (w/v) Ponceau

stain, 3% (w/v) trichloroacetic acid and 3% (w/v_ sulfosalicylic acid) to confirm the

integrity of protein transfer. Ponceau red was removed with a brief wash in 0.1 NaOH

followed by rinsing in dH2O.

2.2.4.4 Membrane protein detection

To detect specific protein bands, membranes were blocked for 12 hrs in 5% (w/v)

skim milk powder in Tris buffered saline (TBS) (50 mM Tris-HCL (pH 7.5), 150 mM

NaCl) at 4ºC with gentle agitation. Antibodies were then diluted appropriately (Table

2.6) in 0.1% skim milk in TBS. Membranes were then incubated with primary

antibodies for 2 hrs in sealed bags on an orbital rotator. Following that, membranes

were given 2×5 mins washes in 2× TBS, then 2×10 min washes with 1× TBS (with 0.1%

(v/v) Tween-20 (Sigma-Aldrich, St. Louis, USA) with gentle agitation. The membranes

were then incubated with horseradish peroxidase (HRP) conjugated anti-sheep

secondary antibody (1 in 2,000 diluted in 0.1% skim milk in TBS) for 1hr at room

temperature, again in sealed bags and on an orbital rotator. After incubation,


48 | P a g e

membranes were given 4×10 mins washes in TBST prior to the exposure. Proteins

were detected using a chemiluminescence kit according to the manufacturer’s

instructions (Roche Applied Science, Castle Hill, NSW, Australia). Membranes were

developed using a Fujifilm Luminescent Image Analyser LAS-3000. Densitometry to

quantify results was performed using Fujifilm Multi Gauge V2.3 computer software.

Then the membranes were stripped for 5-10 mins (depending on band intensity) at

room temperature, using 1 mL of Re-Blot Plus-Strong (Chemicon International,

Temecula, CA, USA) diluted 1:10 in Milli Q water. In order to show equal protein

loading, all membranes were re-probed for β-actin. Membranes were re-blocked for

30 min in 5% (w/v) skim milk powder in TBS and incubated with β-actin primary and

then anti-mouse secondary and exposed, then quantified following the same

procedure as mentioned above.


49 | P a g e

Table 2.6: Antibodies used in the study.

Dilution factors and the source of the antibodies used in the study and there

secondary antibodies and the dilution factors.

Chapter 2.3: Results

50 | P a g e

CHAPTER 2.3: Results

2.3.1 Zinc transporters and their expression pattern in neuronal cells

2.3.1.1 Basal zinc transporter levels in human neuronal cells

The expression level of zinc transporters (Zip1-4 & ZnT1-7) was tested using QPCR on

two different human neuronal cell lines (M17, SY5Y) and a neuronally committed

human tetra carcinoma cell line (NT2). Human skin cell line HaCaT was used to test

the neuronal specificity of the each transporter. Results obtained from QPCR was

normalised using GAPDH as the internal control. The expression levels of these

transporters are shown, relative to expression of hZnT3 (Figure 2.2). The four cell

lines expressed all the transporters tested.

2.3.1.2 Relative zinc transporter levels in human cell lines

In HaCaT cells (Figure 2.3A) the most highly expressed zinc transporters were hZnT6

and hZnT7. In M17 cells (Figure 2.3B), Zip3 and hZnT2 expression was very low

compared to hZnT3 expression. All the other transporters were about 5 to 10 fold

higher in their expression level compared to hZnT3 levels.


51 | P a g e

hZnT1 was the most expressed transporter in SY5Y cells (Figure 2.3C). hZip1, hZnT4,

hZnT6 & hZnT7 also showed high expression levels in SY5Y cells, whilst the expression

of the remaining transporters were very similar to the hZnT3 level with the exception

of hZip3. hZip3 expression was about 27 fold lower than hZnT3 levels in SY5Y cells.

NT2 cells (Figure 2.3D) exhibited a very interesting expression pattern in comparison

to other cell lines. Apart from hZnT1 & hZnT7, all the other transporter expression

levels were lower than hZnT3. Of these two transporters, only hZnT1 had a

considerable fold difference (approximately 50 fold lower) compared to ZnT3 levels.

2.3.2 Effects of DHA and zinc on zinc transporter expression levels

Real time PCR (QPCR) was performed to test the mRNA levels of zinc transporters

hZnT1 to hZnT7 and hZIP1 to hZIP4 following DHA treatment. The cDNA used in QPCR

was obtained from cells which were subjected to different doses of DHA (0, 2.5, 10,

20 & 40 μg/mL) in the presence (5 μM) or absence of zinc. Therefore, for each cell

line there were 10 different treatment regimes, totalling 40 for all the four cell lines.

The cycle threshold (Ct) values obtained were used in calculating the fold difference

and then plotted against the DHA dose. However, Ct values which were above 30

were not included in further calculations to ensure specificity and accuracy of the

results. Each experiment was repeated three times with independent sets of cells

and only the results which are most consistent with the other two experiments are

presented here. In literature, an increase or decrease of more than two-fold


52 | P a g e

difference is considered significant (Bubner et al., 2004) and the rest is considered as

non-specific. Therefore, the changes below two fold difference, is presented with

grey shading in the figures presented.


53 | P a g e

Figure 2.2: Expression levels of zinc transporters mRNA levels relative to ZnT3.

Fold-difference of mRNA levels of the different putative zinc influx (Zip1-Zip4) and

efflux (ZnT1-ZnT7) transporters measured relative to that of ZnT3 in M17, SY5Y, NT2

& HaCaT cells. Relative mRNA expression level is indicated according to the zinc

transporter.


54 | P a g e

Figure 2.3: Relative zinc transporter mRNA levels in HaCaT, M17, SY5Y and NT2 cells

compared to ZnT3 levels.

Fold-difference of mRNA levels of the different putative zinc influx (Zip1-Zip4) and

efflux (ZnT1-ZnT7) transporters measured relative to that of ZnT3 in M17, SY5Y, NT2

& HaCaT cells. Relative mRNA expression level is indicated according to the cell line.


55 | P a g e

2.3.2.1 hZnT1

In HaCaT cells, without zinc, the cell response to DHA doses was not significant with

only a slight increase in hZnT1 expression levels observed, and no obvious DHA dose

dependent pattern was seen (Figure 2.4A). However, in the presence of zinc the

increase was more dose dependent except for the maximum dose, and reaching

significance at the 20 μg/mL DHA dose (Figure 2.4B).

SY5Y and M17 cells reacted in a contrasting pattern to HaCaT cells, suggesting that

the hZnT1 expression change due to DHA is more neuronal cell specific. In SY5Y cells

with no zinc (Figure 2.4A), a downregulation could be seen in response to many DHA

doses, and when in the presence zinc (Figure 2.4B) this downregulation was even

more pronounced, being consistent across all three independent experiment sets.

Even though a downregulation pattern could be seen with M17 cells, dose

dependency and the consistency was lacking in comparison to SY5Y cells. Both with

(Figure 2.4A) and without (Figure 2.4B) zinc treatment, hZnT1 expression reached

significance at a very limited number of doses.

From the four cell lines, NT2 cells showed the most promising downregulation

pattern in the presence of DHA treatment with no zinc (Figure 2.4A). hZnT1

expression at all four DHA doses reached beyond the significance threshold, and the

changes were consistent across the triplicates. However, when zinc was present

(Figure 2.4B), the reaction was not consistent in response to DHA. Downregulation


56 | P a g e

was most commonly seen as a response to DHA treatment with the neuronal cell lines

and the tetra-carcinoma cell line.

2.3.2.2 hZnT2

The expression level of hZnT2 in all four cell lines showed a significant decrease with

different DHA doses in the absence of zinc (Figure 2.5A). In SY5Y cells, hZnT2

expression was decreased with the increase in DHA dose, apart from at the DHA 40

μg/mL dosage. HaCaT cells showed a similar pattern of hZnT2 downregulation,

although to a much lower extent than in SY5Y cells. Similarly, M17 cells showed

significant downregulation of hZnT2 at DHA 10 μg/mL dosage, but this was much

lower than what was seen with SY5Y cells. A dose dependent pattern was also not

visible in SY5Y cells. Though the levels were much lower than in SY5Y cells, NT2 cells

showed a consistent dose dependent downregulation when treated with DHA in the

absence of zinc.

In the presence of zinc (Figure 2.5B), the downregulation of hZnT2 was more

pronounced and higher for HaCaT cells when compared with no zinc treatment.

However, in NT2 cells the downregulation became much less consistent and less dose

dependent, while in SY5Y cells the downregulation was reduced. Similarly, in M17

cells the downregulation was reduced with the addition of zinc, resulting in an

upregulation of hZnT2. However, most of the Ct values for hZnT2 were relatively


57 | P a g e

higher than that of other transporters, and for the entire second set of experiments

it did not produce any conclusive data. Therefore, interpretation of hZnT2 results

should be done with caution. The large error bars seen in M17 cells treated with zinc

is a result of these high Ct values.


58 | P a g e

Figure 2.4: hZnT1 expression levels following DHA treatment in different cell lines.

Expression profile of hZnT1 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A)

and supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using

QPCR analysis. Fold differences above and beyond x5 is noted on the figure.


59 | P a g e






60 | P a g e

2.3.2.3 hZnT3

In HaCaT cells treated with DHA in the absence of zinc, the expression level of hZnT3

was significantly downregulated as much as 73 fold difference compared to the DHA

depleted cells. This down regulation was also consistent in all DHA treatment groups

(Figure 2.6A), where a dose dependent bell shaped curve could be seen, with the 10

μg/mL DHA dose giving the largest downregulation. Significant and dose dependent

downregulation could also be seen in M17 cells (Figure 2.6A) with up to 12 fold

difference in hZnT3 expression at the 40 μg/mL DHA dose. In SY5Y cells (Figure 2.6A),

the transporter expression level was not consistent or significant, except at the

highest DHA doses where significant upregulation was detected. In NT2 cells (Figure

2.6A), the downregulation was very similar to M17 cells, and dose dependent when

treated with DHA in the absence of zinc. With higher DHA concentrations there was

a significant downregulation in the expression levels of almost 16 fold difference.

DHA plus zinc treatment (Figure 2.6B) of HaCaT cells did not give a reliable pattern

for hZnT3 but a general upregulation trend could be seen across the triplicate

experiments. M17 cells followed a similar pattern (Figure 2.6B) to that of HaCaT

cells, and addition of zinc impaired the original downregulation seen with no zinc

treatment, to a significant upregulation with some DHA doses. SY5Y cells showed a

slight downregulation with the addition of zinc (Figure 2.6B), which is opposite to the

upregulation seen in the absence of zinc (Figure 2.6A). However, NT2 cells lost its

consistency in the hZnT3 expression pattern when treated with both zinc and DHA

(Figure 2.6B). In these cells, the two middle DHA doses showed gradually decreasing


61 | P a g e

downregulation, which was then followed by and an upregulation at the highest

dose. When the four cell lines treated with DHA and zinc were compared, the

expression patterns and levels of hZnT3 were not consistent. However, when

treated with DHA with no additional zinc, M17 and NT2 cells displayed a dose

dependent significant downregulation (Figure 2.6A). In contrast, HaCaT and SY5Y

cells were not consistent even in the absence of zinc, suggesting that SY5Y cells may

be behaving more like a keratinocyte cell line under these conditions with respect to

this transporter.

2.3.2.4 hZnT4 and hZnT5

In HaCaT and M17 cells, hZnT4 expression was almost consistently downregulated in

response to DHA treatment without zinc (Figure 2.7A). In HaCaT cells, fold

differences were significant only at 5 and 10 μg/mL DHA doses. However, the

downregulation seen in M17 cells were significant at 10, 20 and 40 μg/mL DHA doses

(Figure 2.7A). NT2 cells also showed a significant downregulation at 5, 10 and 20

μg/mL DHA doses, but at the highest dose the fold difference could not be calculated

due to the lack of consistency. With zinc treatment, a downregulation pattern could

still be seen in HaCaT cells, although the results lack a dose dependent pattern. In

M17 cells, compared to the no zinc treatment, the level of hZnT4 downregulation was

lower, which was closer to the non-significance threshold area in cells treated with

most doses of DHA plus zinc (Figure 2.7B). These changes were also seen in NT2 cells


62 | P a g e

apart from at one DHA dose (20 μg/mL), where a significant upregulation could be

seen (Figure 2.7B). SY5Y cells showed significant downregulation in hZnT4

expression in response to all DHA doses, however these changes were not dose

dependent (Figure 2.7B). Moreover, all the Ct values for hZnT4 were around the mid-

twenties, indicating a positive and specific amplification pattern throughout all the

three replicate experiments.

In all the three experiment sets, no reasonable Ct values could be obtained for hZnT-

5 in any of the cell lines, so a graph is not shown for this transporter. This may be

due to the primers used for this transporter or very low transcript levels in the cell

lines examined in this study.


63 | P a g e






64 | P a g e






65 | P a g e

2.3.2.5 hZnT6

In HaCaT and SY5Y cells treated without zinc (Figure 2.8A), DHA doses did not cause

much change in the expression level of hZnT6, with both cell lines being in the non-

significance zone. In contrast, a staggering change was detected in M17 cells, where

a significant downregulation was detected in a dose dependent manner, apart from

at the 40 μg/mL concentration, which was the toxic level. This downregulation was

consistent in replicates and Ct values were again closer to mid-twenties indicating

significance and accuracy. NT2 cells also showed downregulation of hZnT6 at some

DHA doses, although a consistent DHA dose dependent pattern could not be

identified.

Following zinc treatment (Figure 2.8B), downregulation of hZnT6 expression in M17

cells was significantly reduced and this was consistent between the replicate

experiments. HaCaT, SY5Y and NT2 cells also did not show a significant change,

though they showed a general downregulation pattern. At the maximum DHA dose,

NT2 cells reached significance where a 5 fold downregulation was observed (Figure

2.8B).


66 | P a g e

2.3.2.6 hZnT7

In HaCaT, M17 and SY5Y cell lines this transporter did not show a significant alteration

in its expression in response to DHA and with or without zinc treatment (Figure 2.9A

& 2.9B). However, there was a significant upregulation of hZnT7 in SY5Y cells at the

40 μg/mL DHA dose (without zinc), but this finding was disregarded as this dosage

was toxic to some cells. In contrast, in NT2 cells DHA treatment without zinc resulted

in a consistent downregulation of hZnT7 (Figure 2.9A). However, this

downregulation was not significant. When NT2 cells were treated with DHA plus zinc,

a downregulation pattern was also observed, although this was not prominent or

consistent as with the no zinc treatment group. In all cell lines, Ct values obtained for

this transporter were low, indicating significant and accurate amplification.


67 | P a g e






68 | P a g e






69 | P a g e

2.3.2.7 hZIP1

In general, M17 cells showed an upregulation of hZIP1 expression levels with (Figure

2.10A) and without zinc (Figure 2.10B) treatment. Cells treated without zinc

displayed a dose dependent pattern, although the results did not reach significance.

NT2 cells showed a significant downregulation pattern when treated with DHA in the

absence of zinc. When zinc was present, the effect was reversed and the transporter

showed an inconsistent upregulation pattern, but most of these values were not

significant. Likewise, HaCaT and SY5Y cells did not show any significant changes in

hZIP1 expression with or without zinc treatment.

2.3.2.8 hZIP2

In the absence of zinc, HaCaT, M17 and SY5Y cell lines demonstrated a

downregulation pattern for the expression of this transporter (Figure 2.11A). Once

again, M17 showed more significant downregulation than the other cell lines when

treated without zinc (Figure 2.11A), and the same pattern could be seen to a lesser

extent when treated with the combination of both zinc and DHA (Figure 2.11B).

However, SY5Y cells treated with zinc and DHA showed an upregulation of hZip2

(Figure 2.11B), which was the opposite of what was observed without zinc (Figure

2.11A). HaCaT cells did not show any significant difference in hZip2 expression in

response to DHA and zinc.


70 | P a g e

Figure 2.10: hZip1 expression levels following DHA treatment in different cell lines.

Expression profile of hZip1 in HaCaT, Sy5Y, M17 and NT2 cells in zinc deficient (A) and

supplemented (B) media containing 0, 2.5, 5, 10 and 20 μg/mL of DHA, using QPCR

analysis. Fold differences above and beyond x5 is noted on the figure.


71 | P a g e






72 | P a g e

Moreover, the Ct values were substantially high for all these three cell lines indicating

possible non-specific amplification.

No reasonable Ct values could be obtained with the NT2 cell line for this transporter,

therefore a graph is not shown. This may be due to the absence or very low transcript

levels of this transporter in the NT2 cells used in this study.

2.2.9 hZIP3 and hZIP4

In M17 cells, a significant downregulation of hZip3 (Figure 2.12A) was identified in

two doses of DHA without zinc. However, this was not dose dependent or consistent

across all of the DHA doses. This downregulation was more pronounced in the

presence zinc (Figure 2.12B), and at the 20 μg/mL DHA dose a 2 fold downregulation

was detected. NT2 cells also showed a similar pattern to M17 cells in the DHA

without zinc treatment groups. However, this downregulation was more consistent

and significant compared to M17 cells. Results obtained for the zinc added treatment

groups of NT2 cells were not consistent (Figure 2.12B).

Although high error bars are present due to high Ct values, HaCaT cells showed an

upregulation of hZip3 expression in DHA treatment groups without zinc (Figure

2.12A). These error bars were much smaller in DHA plus zinc treatment groups (Figure

2.12B). SY5Y cells did not show any significant difference in hZip3 expression in

response to DHA over time with or without zinc.


73 | P a g e

In contrast, changes in the hZIP4 expression without zinc were similar in HaCaT, M17

and NT2 cell lines, with the exception of some DHA doses in M17 and NT2 cells (Figure

2.13A). In general, HaCaT, M17 and NT2 cell lines displayed downregulation without

zinc treatment (Figure 2.13A). With the combination of both zinc and DHA treatment

(Figure 2.13B), HaCaT, SY5Y and NT2 cells showed upregulation in hZIP4 expression,

but expression in M17 cells was consistently downregulated. In the absence of added

zinc SY5Y cells displayed an opposite trend to the other two cell lines, indicating a

possible cell specific importance for this transporter. However, in the presence of

zinc it behaved more like HaCaT and NT2 cells showing an upregulation of hZIP4,

though the values did not reach significance.

Based on the results obtained from these experiments, hZnT3 was selected as the

transporter of choice for further experiments.


74 | P a g e






75 | P a g e






76 | P a g e

2.3.3 DHA effect on cell survival

The effect of DHA on cell survival was studied using four different DHA doses (0, 2.5,

10, 40 μg/mL). M17 cells were grown with or without supplements for 2 days and

then tested for apoptosis end marker caspase-3 and an apoptosis regulator protein

Bcl-2, using Western blotting.

M17 cells exposed to 20 μg/mL DHA for 2 days demonstrated a marked reduction in

caspase-3 protein levels when compared to untreated cells (Figure 2.14A). Equal

protein loading of the gel lanes was assessed by Western blot analysis for the

housekeeping gene, β-actin (Figure 2.14B). Caspase-3 protein levels were then

normalised against the β-actin protein levels and densitometry analysis was

performed to quantify the changes in the expression levels. Following densitometry

analysis, it was revealed that there was more than 66% reduction in caspase-3 protein

levels with the 20 μg/mL DHA treatment when compared to untreated cells (Figure

2.14C). This reduction in the caspase-3 protein levels was significant and consistent

across the replicates.

In contrast, Bcl-2 protein levels were upregulated following DHA treatment (Figure

2.15A) suggesting that DHA has initiated an apoptosis suppression mechanism in

these cells. Again, equal protein loading of the gel lanes was assessed by Western

blot analysis for the β-actin housekeeper gene (Figure 2.15B). Following

normalization to the house keeping gene, densitometric analysis was performed.

Densitometry analysis also confirmed the increase in Bcl-2 protein expression levels


77 | P a g e

(Figure 2.15C). DHA treated cell lysates showed a significant increase in band

intensity compared to untreated cells. Quantification through densitometric analysis

showed a 110% increase in Bcl-2 protein levels when subjected to 20 μg/mL DHA

treatment in comparison to untreated cells.


78 | P a g e

Figure 2.14: Western blot analysis of Caspase-3 protein levels following DHA

treatment in M17 cells.

Caspase-3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17

cells cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were

detected with specific antibodies. (C) Densitometric analysis of caspase-3 protein

levels (normalised with the β -actin protein levels) are shown in arbitrary units (AU).

Molecular mass protein markers (Mr) are indicated on the left of each gel. This result

is representative of three similar independent experiments.


79 | P a g e

Figure 2.15: Western blot analysis of Bcl-2 protein levels following DHA treatment

in M17 cells.

Bcl-2 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells

cultured in the absence and presence (2.5, 10 and 40 μg/ml) of DHA were detected

with specific antibodies. (C) Densitometric analysis of Bcl-2 protein levels (normalised

with the β -actin protein levels) are shown in arbitrary units (AU). Molecular mass

protein markers (Mr) are indicated on the left of each gel. This result is representative

of three similar independent experiments.


80 | P a g e

2.3.4 Effects of DHA on ZnT3 protein levels

The expression level of ZnT3 was analysed in extracts from HaCaT, M17, SY5Y and

NT2 cells treated with different concentrations of DHA (0, 5, 10 and 20 μg/mL). A

ZnT3 transporter specific antibody was used to identify the proteins. The predicted

band size of the proteins were identified from ExPASy database

(http://au.expasy.org/) and by using the protein amino acid sequence from NCBI

database (http://www.ncbi.nlm.nih.gov/).

2.3.4.1 ZnT3 protein expression levels in M17 cells following DHA treatments

ZnT3 expression was identified in the lysates of all treated M17 cells by the presence

of a band of approximately 41.9 kDa in all lanes (Figure 2.16A). Protein levels showed

a dose dependent reduction when treated with DHA. ZnT3 protein levels were

markedly reduced in the cells exposed to 20 μg/ml DHA, when compared with the

untreated cells. To ensure equal lane protein loading of the gels, protein levels of the

β-actin housekeeping gene were assessed (Figure 2.16B). When the ZnT3 protein

levels were normalised with the β-actin protein levels, densitometry analysis

revealed more than 55% reduction in ZnT3 protein levels with the 20 μg/ml DHA

treatment when compared with the untreated cells (Figure 2.16C).


81 | P a g e

Figure 2.16: ZnT3 protein levels following DHA treatment in M17 cells.

ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells


with specific antibodies. (C) Densitometric analysis of ZnT3 protein levels (normalised





82 | P a g e

2.3.4.2 ZnT3 protein expression levels in SY5Y cells following DHA treatments

ZnT3 expression was identified by the presence of a band approximately 41.9 kDa in

size in all lanes containing lysates of treated SY5Y cells (Figure 2.17A). The β-actin

housekeeping gene levels were assessed to ensure equal protein loading (Figure

2.17B), followed by a densitometric analysis to quantify the changes (Figure 2.17C).

Densitometric results obtained with SY5Y cells were not significant or consistent.

These protein results were in line with the QPCR results for SY5Y cells.

2.3.4.3 ZnT3 protein expression levels in HaCaT cells following DHA treatments

All treated HaCaT cells were identified to express ZnT3 by the presence of a band of

approximately 41.9 kDa in size (Figure 2.18A). Following normalisation using β-actin

as the housekeeping gene (Figure 2.18B), the results showed a decrease in ZnT3

expression with some DHA doses. Densitometric results also showed a decrease in

ZnT3 protein levels (Figure 2.18C) at 5 & 10 μg/mL DHA doses. However, this

decrease was reversed at the 20 μg/mL DHA concentration, where a similar level of

expression as the untreated cells was detected for ZnT3 protein. Changes in ZnT3

expression was not dose dependent between the replicates.


83 | P a g e

Figure 2.17: ZnT3 protein levels following DHA treatment in SY5Y cells.

ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of SY5Y cells







84 | P a g e

Figure 2.18: ZnT3 protein levels following DHA treatment in HaCaT cells.

ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of HaCaT cells







85 | P a g e

2.3.4.4 ZnT3 protein expression levels in NT2 cells following DHA treatments

ZnT3 expression was also identified in lysates of NT2 cells. All the lanes with different

DHA doses displayed a band of approximately 41.9 kDa in size (Figure 2.19A). A

reduction in the band intensity was visible with increasing DHA dose. The expression

levels were normalized to the house keeping gene β-actin and lane loading was also

normalized using the house keeper gene (Figure 2.19B). Results were quantified

using densitometric analysis (Figure 2.19C). Approximately a 9 fold decrease was

present in protein expression levels between untreated and 20 μg/mL DHA treated

cells. This decrease was significant and displayed a dose dependent pattern similar

to M17 cells.


86 | P a g e

Figure 2.19: ZnT3 protein levels following DHA treatment in NT2 cells.

ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of NT2 cells







87 | P a g e

2.3.5 DHA effect with and without vitamin E on the ZnT3 transporter

DHA is known to be a highly oxidative substance. Thus, DHA effects on a culture

system may not be effective for the entire incubation time. In these instances,

vitamin E can be used as a free radical scavenger to enhance the effects of DHA on

cells.

2.3.5.1 Vitamin E working concentration

Firstly, three different vitamin E doses were tested to find the optimal working

concentration of vitamin E for further studies. M17 cells were incubated for 2 days

with vitamin E (0, 0.5, 0.05, 0.005 mol/L) and DHA (20 μg/mL). Following treatments,

QPCR was performed to test the influence on ZnT3 transporter levels. When there

was DHA present, ZnT3 expression was significantly downregulated at all three

vitamin E doses (Figure 2.20). However, at the 0.5 mol/L vitamin E concentration

some cells started dying suggesting this dosage is closer to the toxic level. Therefore,

the middle dose of 0.05 mol/L vitamin E was selected for further experiments.

2.3.5.2 ZnT3 mRNA expression levels with DHA and vitamin E

Following DHA treatment with vitamin E, ZnT3 mRNA levels in M17 cells were

analysed using QPCR. M17 cells were treated with four different DHA concentrations


88 | P a g e

(0, 5, 10, 20 and 40 μg/mL) for 2 days with 0.05 mol/L vitamin E and then tested for

changes in ZnT3 expression. Results obtained were normalised using the internal

control GAPDH and presented relative to expression level in untreated cells. Both 5

and 10 μg/mL DHA doses showed a significant downregulation of more than 80 fold

in ZnT3 expression (Figure 2.21). This downregulation was dose dependent apart

from at the 40 μg/mL dose and the results were consistent among three individual

sets of experiments.


89 | P a g e

Figure 2.20: Calculating vitamin E working concentration.

Three different Vitamin E (0, 0.5, 0.05, 0.005 mol/L) doses were analysed using with

QPCR to test optimal working concentration for vitamin E. Fold differences above

and beyond x5 is noted on the figure.


90 | P a g e

Figure 2.21: hZnT3 mRNA levels following DHA treatment in the presence of vitamin

E in M17 cells.

hZnT3 expression levels were analysed following DHA (0, 5, 10, 20 and 40 μg/mL)

treatment in the presence of vitamin E (0.05 mol/L), using QPCR analysis. Fold

differences above and beyond x5 is noted on the figure.


91 | P a g e

2.3.5.3 ZnT3 protein levels with DHA and vitamin E

Vitamin E (0.05 mol/L) and DHA (0, 5, 10,20 and 40 μg/mL) treated M17 cells were

collected, lysed and the protein was analysed using Western blotting. ZnT3 was

expressed in treated M17 cells indicated by a band of approximately 41.9 kDa in all

lanes (Figure 2.22A). ZnT3 protein levels were markedly reduced in cells exposed to

DHA and vitamin E, when compared to untreated cells. To ensure equal protein

loading across gel lanes, levels of the β-actin housekeeper gene was assessed (Figure

2.22B). Densitometric analysis also confirmed a significant reduction in ZnT3 protein

when treated with vitamin E and DHA (Figure 2.22C).


92 | P a g e

Figure 2.22: ZnT3 protein levels following DHA treatment in the presence of vitamin

E in M17 cells.

ZnT3 protein (A) and the housekeeping gene β-actin protein (B) levels of M17 cells

cultured in the absence and presence (0, 5, 10,20 and 40 μg/mL) of DHA and vitamin

E (0.05 mol/L) were detected with specific antibodies. (C) Densitometric analysis of

ZnT3 protein levels (normalised with the β -actin protein levels) are shown in arbitrary

units (AU). Molecular mass protein markers (Mr) are indicated on the left of each gel.

This result is representative of three similar independent experiments.

Chapter 2.4: Discussion

93 | P a g e


Cellular zinc and omega-3 FA levels are both known to be vital in many biological and

biochemical pathways in the human body. Moreover, altered metabolism of zinc and

omega-3 FAs are known to cause diverse health effects. Thus, the human body

contains specific yet complex mechanisms to closely regulate the absorption and

excretion of these compounds. Both zinc and omega-3 FAs are present abundantly

in neuronal membranes and many neural cellular functions as well as the structural

integrity of the cells are greatly reliant on the presence of zinc and omega-3 FAs.

Thus, neurodegenerative disorders such as AD have been linked with their

deficiencies. Recent studies have revealed a link between DHA (an omega-3 FA)

levels and zinc metabolism in rats, indicating possible synergistic effects at the

cellular level (Jayasooriya et al., 2005b). Combined with many epidemiological

studies, this finding has opened up a new level of mental health research in regard to

DHA and zinc. However, there is a lack of studies conducted using human cell models

to investigate this relationship between DHA and zinc homeostasis. Thus, this study

aimed to understand a possible relationship between DHA and zinc in cultured

human neuronal cells. This was carried out in three major steps; first to investigate

the effects of DHA and zinc levels on zinc transporter gene expression levels in

neuronal cells. Then the zinc transporter protein levels were analysed in relation to

different DHA and zinc levels. Thirdly, to understand the effect of vitamin E as a free

radical scavenger and thus prevent oxidisation of DHA and increase the effects of


94 | P a g e

DHA at the cellular level.

2.4.1 Effects of DHA and zinc on zinc transporter expression levels

Cells treated with different doses of DHA (0, 5, 10, 20 and 40 μg/mL) in the presence

or the absence of zinc were used to isolate total RNA, and then RNA was reverse

transcribed to cDNA, and used in a QPCR assay to measure the changes in gene

expression levels. hZnT 1–7 and hZip 1–4 transporters along with GAPDH as the

internal control were analysed for any changes in expression. Overall, down

regulation of zinc transporters was prominent at mRNA level in all four cell lines

regardless of the treatment. However, some significant changes could be seen in the

expression levels of several transporters in response to different treatments.

2.4.1.1 hZnT1

Changes observed in hZnT1 expression levels were different between the control and

the neuronal cell lines (Figure 2.4). HaCaT, the control cell line showed an overall up-

regulation pattern in regard to hZnT1 expression levels (Figure 2.4A). With zinc

treatment NT2 cells also displayed some level of hZnT1 upregulation (Figure 2.4B). In

contrast, NT2 cells treated with DHA in the absence of zinc showed a significant

downregulation. However, these changes were not dose dependent. In addition, in

both neuronal cell lines SY5Y and M17, hZnT1 expression was mainly downregulated,


95 | P a g e

again more significant with zinc treatment than without. In general, hZnT

transporters have been identified as facilitators of zinc efflux from the cytosol to the

luminal compartments (Jayasooriya et al., 2005b). hZnT1 was the first zinc

transporter family member to be identified (Palmiter, 1995a) and it’s ubiquitously

expressed in tissues, with the highest expression in the cerebral cortex and

cerebellum (Sekler et al., 2002). A rat neuronal cell line (PC12) study with

overexpressed and negative dominant ZnT1 gene has shown that zinc induced

apoptosis in neuronal cells is influenced by ZnT1 transporter (Kim et al., 2000).

Another mouse study intended to knockout ZnT1 expression has failed due to the

embryonic lethality of knockout mice (Andrews et al., 2004), thus indicating the

importance of the ZnT1 transporter in cellular functions. Moreover, hZnT1 is

identified as one of the main zinc transporter proteins in human cells (Liuzzi et al.,

2004; Sekler et al., 2002). Cells highly sensitive to extracellular zinc concentration

normally have less hZnT1 expression levels (McMahon, 1998).

As discussed above, higher expression of hZnT1 levels facilitate more efflux of zinc

into extracellular matrix. Thus, this decrease in hZnT1 expression level in response

to high DHA doses can reduce internal zinc accumulation in extracellular matrix. In

neurodegenerative conditions such as AD a high level of zinc accumulation could be

seen (Huang et al., 2000). Moreover, zinc is closely related to the formation if

neurofibrillary tangles (Bush et al., 1994b). High levels of zinc have been linked with

Aβ aggregation and induced amyloid plaque formation (Bush et al., 1994a; Bush et

al., 1994b). Amyloid plaque is one of the main pathological features in AD (Vickers et

al., 2000). Thereby, this finding indicates a possible mechanism of DHA in preventing


96 | P a g e

neurodegenerative diseases. However, the dose dependent pattern could not be

seen with DHA treatments in any of the cell lines indicating that hZnT1 might not be

the most prominent or the most important pathway of DHA induced neuro-

protection in these cell lines.

2.4.1.2 hZnT2

hZnT2 mRNA levels were downregulated in all cell lines subjected to DHA treatment

in the absence of added zinc (Figure 2.5). In HaCaT cells this downregulation was not

significant. However, in the other three cell lines multiple DHA doses were able to

downregulate hZnT2 levels beyond the significance threshold. A similar

downregulation pattern to a lesser extent was seen in zinc treated cells, suggesting

the extra zinc availability has created a higher demand for this specific zinc

transporter. One study has shown a significant downregulation in hZnT2 levels in

response to low zinc availability (Liuzzi et al., 2003), which was also confirmed in this

study. In M17 cells, an upregulation of hZnT2 was detected when treated with DHA

and zinc. This suggests a possible specificity or importance of hZnT2 transporter in

M17 cells.

The ZnT2 transporter is known to be present in unique tissues where zinc

requirement is high, such as in mammary and prostate glands (Lopez and Kelleher,

2009). Immunohistochemistry studies conducted with ZnT2 transporter has


97 | P a g e

identified its vesicular localisation pattern (Kelleher and Lonnerdal, 2002). It has also

been reported that ZnT2 transporters exhibits transient regulation (Lopez and

Kelleher, 2009), localises to vesicles and functions in the sequestration of zinc into

vesicles. Studies performed with ZnT2 and mammary epithelial cells have shown a

link between the ZnT2 availability and zinc exportation across the cell membrane

(Chowanadisai et al., 2006). Though the exact mechanism by which ZnT2 works to

maintain the zinc homeostasis is yet unknown, intracellular localization and a positive

correlation between zinc exposure and ZnT2 presence has led to the suggestion that

this transporter participates in vesicular zinc sequestration and possible export or

secretion from the tissues (Liuzzi and Cousins, 2004a).

2.4.1.3 hZnT3

ZnT3 expression, like that of ZnT2, also shows a restricted distribution pattern. It has

been identifies in both the rodent brain and testis (Palmiter, 1995a), and in the

human breast epithelial cells (Michalczyk et al., 2002). Distribution of this transporter

in the rat brains is found to be limited to the synapses and axons of glutamatergic

neurons, indicating a possible role for this transporters in neuronal health (Liuzzi et

al., 2004). Vascularisation of zinc and the triggered zinc release from synaptic vesicles

is mainly controlled by ZnT3 transporters (Palmiter, 1995a).

Changes in the hZnT3 expression at the mRNA level was one of the most interesting


98 | P a g e

and important findings of this study. In response to DHA doses without zinc

treatment, M17 and NT2 cells showed a significant and dose dependent

downregulation in hZnT3 mRNA levels (Figure 2.6). HaCaT cells also showed a bell

shaped downregulation when treated with DHA in the absence of zinc, although this

downregulation was not dose dependent. hZnT3 mRNA expression levels in SY5Y

cells were not significant in the presence of DHA with no zinc treatment. When

treated with zinc and DHA, an upregulation pattern was prominent in HaCaT, M17

and NT2 cells (Figure 2.6). All four cell lines exhibited converse expression patterns

with zinc and without zinc, indicating a possible zinc responsive mechanism in the

expression of this transporter. Protein studies done with the ZnT3 also confirmed the

mRNA results in all the cell lines. In M17 cells, ZnT3 protein levels were significantly

downregulated in a dose dependent manner when treated with DHA and no zinc

(Figure 2.16). HaCaT cells and SY5Y cells displayed dissimilarities in the ZnT3 protein

levels when treated with different DHA doses (Figure 2.17 & 2.18). Protein results

obtained with NT2 cells also correlate with mRNA results, where a significant dose

dependent downregulation was seen (Figure 2.19). Observations made in this study

for this transporter expression was in line with the previous rat study done by

Jayasooriya and colleagues (2005). Altered ZnT3 expression levels in rat brains have

been linked to abnormal zinc metabolism, and moreover, the same study has

revealed a link between increased ZnT3 expression levels with the decrease DHA

consumption (Jayasooriya et al., 2005b). Thus, it can be postulated that this is the

key transporter in both humans and rats, which links DHA, zinc and AD. The human

ZnT3 protein has 388 amino acids and shares more than 85% homology with rat and

mouse ZnT3 proteins (Smidt and Rungby, 2012). Hence, the correlation seen


99 | P a g e

between the two transporters when treated with DHA can be understood. Another

study done with amyloid-β protein precursor (AβPP)/presenilin 1 (PS1) transgenic

mice has shown elevated levels of ZnT3 protein in these mice (Zheng et al., 2010).

These findings suggest a possible link between ZnT3 and amyloid-β at the cellular

level. Extracellular plaque deposits of the amyloid-β peptide are one of the hallmark

pathologies required for the diagnosis of AD (Murphy and LeVine, 2010). In addition,

ZnT3 knock-out mice display reduced synaptic localization of amyloid-β

oligomerization compared to its wild type counterpart (Deshpande et al., 2009). A

further study done with ZnT3 knock-out mice demonstrated a significant reduction in

the quantity and size of plaque build-up compared to the wild type mice (Lee et al.,

2002). Moreover, post-mortem AD brains has shown high expression of ZnT3 in the

zinc containing plaques and amyloidangiopathy diseased vessels (Zhang et al., 2008).

Collectively, these published data highlight the importance of the ZnT3 transporter,

especially in relation to neurodegeneration. Thus, an understanding of the decrease

in expression of ZnT3 in such conditions will be of vital importance to at least mange

if not cure these diseases. The findings of this study shed light on such a pathway,

where a DHA induced downregulation was prominent in two human cell lines.

2.4.1.4 hZnT4

Changes in hZnT4 expression levels were consistent in all cell lines (Figure 2.7), except

for NT2 cells treated with zinc, which showed a slight upregulation. However, the

changes in mRNA levels for hZnT4 was not dose dependent in many cases. In

neuronal cells, hZnT4 is mainly localised on the Golgi apparatus and endoplasmic


100 | P a g e

reticulum, hence sequestrating zinc into intracellular compartments (Wang et al.,

2005). Increased intercellular zinc accumulation is known to promote

neurodegenerative conditions. A study with mutant mice carrying pathogenic forms

of the human APP and deficient in intracellular zinc has shown less severe AD

pathological features than mice with normal zinc levels (Lee et al., 2002). Therefore,

the decrease in hZnT4 expression levels hZnT with high DHA doses again provides

evidence for a possible link between omega-3 FA availability and AD conditions.

2.4.1.5 hZnT6

Cells from liver, brain and small intestine has shown the highest concentration of

hZnT6 mRNA levels (Huang et al., 2002). Immunofluorescence studies conducted

with this transporter have identified a localisation, mainly concentrated in Golgi

network and in the cell periphery (Huang et al., 2002). hZnT6 transporter is known

to be vital in allocating cytoplasmic zinc into trans-Golgi network. In an experiment

with AD and early AD brain subjects, it has been shown that a significant (P<0.05)

increase in hZnT6 expression levels has occurred in hippocampus / parahippocampal

gyrus regions (Smith et al., 2006). Moreover, AD conditions are widely related to

decrease DHA consumption (Connor and Connor, 2007; Horrocks and Yeo, 1999).

Following the DHA treatment, a consistent downregulation at the mRNA level was

observed for hZnT6 transporter in all four cell lines. However, significance was only

reached with M17 cells, indicating a potential specificity of the behaviour or a


101 | P a g e

functional importance for this zinc transporter in M17 cells. No zinc treatment

resulted in a significant downregulation compared with zinc treatment, suggesting a

zinc dependent mechanism in gene regulation.

2.4.1.6 hZnT5 and hZnT7

With regard to hZnT7 expression levels, some changes could be observed when

treated with DHA. However, even with low Ct values most of the changes observed

were under the 2 fold significance level for hZnT7 mRNA in all four cell lines.

hZnT7 is mainly localised vascularly and found to have a function in accumulating zinc

into Golgi apparatus and is predominantly expressed in the small intestine, liver and

spleen and to a lesser extent in the kidney, lung and brain (Kirschke and Huang, 2003).

Thus, hZnT7 may not have a significant role in either neuronal cells or skin cells. The

Ct values for hZnT5 were extremely low (data not shown), indicating non-specific,

self-annealing or pair annealing of the primer had most likely occurred.

2.4.1.7 hZip 1-4

Analysis of hZip expression levels in general, did not produce significant or consisting

regulation patterns. However, in M17 cells a consistent downregulation was present

and this was more prominent in NT2 cells (Figure 2.10).


102 | P a g e

Zip family facilitates zinc movement into the cytosol, either from the extracellular

environment or intracellular compartments (Gaither and Eide, 2000). Thus, it could

be assumed that the expression levels would increase in the absence of zinc.

However, this phenomenon could not be clearly visible with any of the Zip

transporters during this study. In most cases a higher degree of downregulation was

seen without zinc than in the zinc treatment. If DHA has a down-regulatory effect on

Zip transporter family, this change could be interpreted as a zinc effect, which would

be consistent with the previous assumption. However, DHA effects on Zip

transporter family expression levels has not been adequately studied. Therefore,

there is a lack of information to support this observation. The changes in expression

of hZip mRNA levels in regards to zinc levels have been shown to be more efficient in

younger rats when compared with older rats (Wang et al., 2004a). This suggests a

possible age related discrepancy in zinc metabolism with this transporter. The same

phenomena of altered metabolism of zinc with the age is a common pathological

feature with AD conditions as well.

At the same time, the importance of the Zip family on zinc homeostasis is well

documented. Zip4 is the gene that is thought to be the most important for zinc

homoeostasis since it is responsible for a rare recessive-lethal human genetic

disorder Acrodermatitis enteropathica (Dufner-Beattie et al., 2003). Patients with

this genetic disease exhibit zinc malabsorption and suffer from a severe zinc

deficiency due to a mutation of the Zip4 gene. Moreover, translational and post-

translational modification processes are thought to affect Zip transporter expression


103 | P a g e

levels (Gaither and Eide, 2000). Zip family members have been found to transit

between the plasma membrane and intracellular compartments in zinc replete cells.

However, with zinc deprivation, Zip family members have been found to be localised

more on the plasma membrane, by decreasing their rate if endocytosis (Dufner-

Beattie et al., 2003; Wang et al., 2004a). Therefore, a putative link between the post-

translational control and zinc levels with Zip family members exist. However, this

study was more focussed on mRNA and protein levels, and not the protein

localisation patterns. Therefore, it is possible that no significant expression changes

had occurred, but the localisation patterns were different following the DHA

treatment. Such changes could not be deduced in this study. A localisation study

with different DHA and zinc levels would therefore, be beneficial to our

understanding of the behaviour if these Zip proteins.

2.4.2 Effects of DHA and zinc on neuronal cell survival

As discussed in published data, DHA treated M17 cells were tested for apoptotic

marker levels. Caspase-3 and Bcl-2 were used to assess the apoptosis levels after

treating the cells with relevant DHA doses for 48 hours. Caspase-3 is a frequently

activated death protease, and one of its main functions is to catalyse the specific

cleavage of many key proteins at the cellular level (Porter and Janicke, 1999).

Caspase-3 is also required in apoptotic chromatin condensation and DNA

fragmentation, thus making it essential in the apoptotic process (Porter and Janicke,

1999).


104 | P a g e

When treated with DHA, M17 cells display a clear reduction in caspase-3 protein

levels (Figure 2.14). More than a 60% reduction was seen at the 20 μg/mL DHA dose

when compared with control cells. On the other hand, a clear increase could be seen

with Bcl-2 protein levels when treated with DHA (Figure 2.15). The Bcl-2 family act

as either anti- or pro-apoptotic regulators and are mainly responsible for determining

whether a cell should live or die (Vaux et al., 1988). Bcl-2 protein is a member of the

Bcl-2 family of regulator proteins and is considered as an important anti-apoptotic

protein in human cells (Cory et al., 2003). Thus, the decrease seen in the Bcl-2 levels

when treated with DHA indicates a protective mechanism at the cellular level against

programmed cell death.

2.4.3 Vitamin E and DHA effect on ZnT3 expression level

DHA is well known for its susceptibility to spontaneous oxidation. A long chain of 22

carbons and 6 double bonds in its structure has given this extreme nature to DHA

(Stillwell and Wassall, 2003). Thus, many studies have shown the importance of using

a free radical scavenger such as vitamin E with DHA to minimize oxidation and also to

enhance the effects of PUFAs (Kubo et al., 1997; Piche et al., 1988; Wander et al.,

1996). Thus, M17 cells were used to test vitamin E effect when treated with DHA.

Firstly, the working concentration for vitamin E was established using three different

doses and by assessing ZnT3 expression levels after 48 hours of treatment. Though

the highest difference observed was with 0.5 mol/L vitamin E, this was not used in

subsequent experiments (Figure 2.20), due to some cells showing toxicity towards


105 | P a g e

the high vitamin E levels and undergoing cell death. 0.05 mol/L was selected as the

optimal dose and used in the following experiments. Use of vitamin E appeared to

have further reduced the hZnT3 expression level up to almost 10 fold than the control

where no vitamin E was used.

When treated with different DHA doses in the presence of vitamin E, M17 cells

showed a significant downregulation in hZnT3 at the mRNA levels. The dose

dependent pattern was similar to results obtained without vitamin E. However, the

downregulation appears to be greater than what was achieved without vitamin E

(Figure 2.21). When treated with only vitamin E, ZnT3 expression levels were

upregulated, however introduction of DHA reversed the upregulation significantly.

Both mRNA results and protein results (Figure 2.22) obtained from this study are in

line with the previous reported data in literature. In the presence of Vitamin E, DHA

effect on ZnT3 was amplified, suggesting prolonged DHA availability and a slower

depletion of DHA through oxidation, due to the presence of vitamin E.

Chapter 3.1: Introduction

106 | P a g e


3.1.1 DHA effect on zinc fluxes

Zinc is the second most abundant trace element in the human body, and considered

as one of the most essential trace elements for life (Weiss et al., 2000). Zinc serves

as a structural and functional element at the cellular level, including as a component

of over 300 different enzymes (Wallwork, 1987). Zinc is also essential in many cellular

functions such as growth, differentiation (Vallee and Falchuk, 1993), gene expression

and DNA synthesis (Chai et al., 1999). In addition to these functions, many cell types

are known to have stored labile Zn2+ pools for proper cellular functions. Relative

concentrations of this labile Zn2+ pools can vary from 1 nM in the cytoplasm of some

cell types to about 1 mM in some vesicles (Lippard, 1994). In neuronal cells, these

Zn2+ pools are believed to play an important role in synaptic plasticity (Li et al., 2001;

Sensi et al., 2000). Furthermore, the adult human brain has the highest concentration

of zinc (150 μM) compared to the other organs (Wallwork, 1987). This labile zinc in

the human brain is very tightly regulated, and in normal conditions is believed to be

around 10-20 nM (Frederickson et al., 2005b).

Although zinc is vital for life, excessive amount of zinc is known to be toxic to cells.

Under exposure to excessive amounts of zinc, neuronal cells exhibit neurotoxicity and

neuro-degeneration (Sheline et al., 2000a). The translocation of zinc from


107 | P a g e

presynaptic to postsynaptic neurons is the main mechanism suspected to be involved

in neurotoxicity (Weiss et al., 2000). This zinc translocation is responsible for inducing

the cell injuries encountered in conditions such as brain trauma (Suh, 2000), epilepsy

and transient global ischemia (Weiss et al., 2000). Excessive zinc is also capable of

inhibiting Ca2+ and Na+ voltage gated channels (Akaike, 1989; Ravindran et al., 1991;

Winegar and Lansman, 1990) and upregulating the cellular levels of reactive oxygen

species (ROS) (Kim et al., 1999b). Elevated ROS levels can be directly detrimental to

cell survival by damaging key macromolecules such as nucleic acids, proteins and

lipids and cause rapid cell death. Moreover, high levels of zinc is found in AD brains,

indicating a possible zinc related neuro-degeneration (Weiss et al., 2000). A study

conducted using mouse neuronal cells has shown that exposure to high levels of zinc

(40 μM) for just 24 hours is sufficient to degenerate the cells (Sheline et al., 2000b).

Thus, it’s reasonable to conclude the importance of having a proper and detailed

understanding of the localization and the availability of free zinc inside the cells.

Moreover, in a therapeutic aspect, it will be beneficial to understand and develop a

mechanism where the freely available zinc pool can be regulated.


108 | P a g e

3.1.2 DHA and zinc

A link between zinc and PUFAs has been widely discussed in scientific literature. Zinc

deficient pregnant rats have shown a whole-body depletion of the maternal stores of

both omega-3 and omega-6 PUFAs (Cunnane and Yang, 1995). Furthermore, studies

have shown DHA intake or absence can alter the zinc transporter expression levels,

which in turn modulate cellular zinc levels. Hence, a putative link between DHA and

zinc is thought to exist. For example, perinatal PUFA deficiency in rats resulted in

upregulated levels of zinc transporter 3 (ZnT3) in the brain. This was associated with

increased hippocampal and decreased plasma levels of zinc (Jayasooriya et al.,

2005b). Furthermore, DHA-treated human neuronal M17 cells showed a

downregulation in ZnT3 levels compared to untreated cells (Suphioglu et al., 2010a).

ZnT3 is a putative transporter of zinc into synaptic vesicles in human neuronal cells

(Palmiter et al., 1996) and thus a reduction in its levels following DHA treatment

allows for a reduction in free zinc levels in the cellular matrix.

3.1.3 Zinc fluorophores

As discussed above, due to the importance of zinc, especially labile zinc in cells and

tissues, it is vital to study and understand the concentration, distribution, localization,

kinetics and functions of free zinc. However, unlike its counterparts Fe2+, Mn2+ or

Cu2+, Zn2+ is not capable of producing many spectroscopic signals due to its 3d104s0

configuration (Dai and Canary, 2007). Thus, use of many spectral techniques such as


109 | P a g e

UV-vis or nuclear magnetic resonance (NMR) is either not possible or limited (Dai and

Canary, 2007; Zhang et al., 2005). Other techniques such as atomic absorption

spectrometry, synchrotron radiation X-ray (SRXRF) spectrometry (R. Ishihara et al.,

2003) and microparticle-induced X-ray emission (micro-PIXE) (Lovell et al., 1998) may

be useful in some applications, although they might be expensive and will require

special instrumentation. Thus, a more simple and economical fluorescent sensors of

free zinc have become a more popular and widely used technique among

researchers. Much of this work has focused on the use of zinc fluorophores as the

fluorescent sensor (Thompson, 2005). 6-methoxy-8-p-toluenesulfonamide-quinoline

(TSQ) is the first reported zinc fluorophore to be used as it binds to Zn2+ selectively

by the quinoline moiety (Frederickson et al., 1987). Few other commonly used zinc

fluorophores are Zinquin, Zinpyr, RhodZin and the ZnAF family (Thompson, 2005).

There are two main families of zinc fluorophores, one is membrane permeable and

the other is membrane impermeable. Membrane permeable fluorophores get

modified into a membrane impermeable derivative through an enzymatic

modification such as hydrolysis of an ethyl ester group by an esterase in the cell. This

modified derivative will then be able to bind the target cation, thus emitting its

signalling (Kimber et al., 2000).

This study was carried out to investigate the effects of DHA as a neuro-protective

agent by analysing free zinc availability. In the preliminary studies, four different zinc

fluorophores (Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) were tested for zinc fluxes

in human neuronal cells and the compatibilities were evaluated under living and fixed

conditions. Following this, the most compatible fluorophore was used to measure


110 | P a g e

free zinc availability following DHA treatment. A time-point study was performed to

gain a complete understanding of DHA effects and the specificity of DHA effects were

verified using linoleic acid (LA).


111 | P a g e


3.2.1 Cell culture

The human neuroblastoma cell lines BE(2)-M17 and neuronally committed human

teratocarcinoma cell line NT2 used in the present experimental study were obtained

from Professor Leigh Ackland, Centre for Cellular and Molecular Biology, Deakin

University, (VIC, Australia).

NT2 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10%

heat inactivated foetal bovine serum (FBS), while BE(2)-M17 cells were cultured in

OPTI-MEM (modified Eagles Minimum Essential Medium) with 2.5% heat inactivated

FBS. Both cell lines were grown as monolayers in 12 well disposable plates on glass

cover slips and incubated at 37°C in a humidified atmosphere of 5% carbon dioxide.

3.2.2 Compatibility study of four different zinc fluorophores

Free zinc availability was measured in M17 cells with four different fluorophores

(Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) to test their compatibility under fixed

and non-fixed conditions. All of the four fluorophores were maintained in DMSO

stock solution (1–5 mM) and diluted down to a final concentration of 1–5 μM in

appropriate culture media. M17 cells were grown on glass coverslips until they


112 | P a g e

reached confluence. Media was replaced every 2–3 days. Once cells reached

confluence, one set was used as it was and the second set was permeabilized before

incubating with one of the fluorophores for 30 minutes. Fixing was performed

following the protocol as previously described (Hardman et al., 2007). Briefly, treated

cells cultured on glass coverslips or coated filters were rinsed 3 times with PBS, fixed

with 4% (w/v) paraformaldehyde (PFA/PBS) (Sigma-Aldrich, Sydney, Australia) for 5

minutes at room temperature and rinsed again with PBS 3 times. The cells were

permeabilised with 0.1% (v/v) Triton X-100/PBS (Amresco Inc. Solon, USA) for 10

minutes at room temperature and rinsed 3 times with PBS. Following the incubation,

cells were washed 3 times with PBS and mounted with Bio-Rad FluoroGuardTM Anti-

fade Reagent (Bio-Rad, Hercules, USA). Confocal images were obtained as previously

described (Hardman et al., 2007).

3.2.3 DHA effect on zinc fluxes across the cell membrane

Cells were tested for the zinc fluxes following DHA treatment using Znpyr-1 as the

zinc fluorophore. DHA (20 μg/mL) and control (0 μg/mL) media were incubated at

37oC overnight on an orbital rotator before treating the cells. This was to allow DHA

to conjugate with proteins in the media to ensure maximum delivery into the cells.


appropriate media per well and left for two days before harvesting, followed by

further 30 minutes incubation with Znpyr-1 and subsequently checked under the


113 | P a g e

microscope. Following the incubation, cells were washed 3 times with PBS and

mounted with Bio-Rad FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA).

Confocal images were obtained as previously described (Hardman et al., 2007).

3.2.4 LA effect on zinc fluxes across the cell membrane

Cells were tested for the zinc fluxes following LA treatment using Znpyr-1 as the zinc

fluorophore. LA (20 μg/mL) and control (0 μg/mL) media were incubated at 37oC

overnight on an orbital rotator before treating the cells. This was to allow LA to

conjugate with proteins in the media to ensure maximum delivery into the cells.


appropriate media per well and left for two days before harvesting, followed by

further 30 minutes incubation with Znpyr-1 and subsequently checked under the



Confocal images were obtained as previously described (Hardman et al., 2007).


114 | P a g e

3.2.5 DHA treatment - time point study

Cells were treated with DHA (20 μg/mL) and control (0 μg/mL) and tested for the zinc

fluxes using Znpyr-1 at different time points (0, 4, 8, 26, 24 & 48 hours) to identify

DHA effects at different stages. DHA (20 μg/mL) and control (0 μg/mL) media were

incubated at 37oC overnight on an orbital rotator before treating the cells. This was

to allow DHA to conjugate with proteins in the media to ensure maximum delivery

into the cells. When cells were about 100% confluent, old media was replaced by 2

mL of appropriate media per well and left for two days before harvesting, followed

by further 30 minutes incubation with Znpyr-1 and subsequently checked under the



Confocal images were obtained as previously described (Hardman et al., 2007)

3.2.6 Serum starvation study with DHA enrichment

Cells were cultured in serum free media (-FBS) for 48 hours, and then treated with

one of the following combinations for another 48 hours followed by a 30-minute

incubation with the zinc fluorophore Znpyr-1. (a) –DHA and –FBS, (b) –DHA and +FBS,

(c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS. Appropriate FBS

concentrations were used according to the cell line as described on the Section 3.2.1.

Treatment with –DHA and –FBS was just the relevant serum free media according to


115 | P a g e

the cell line. All of the four treatment media were incubated at 37oC overnight on an

orbital rotator before treating the cells. This was to allow DHA to conjugate with

proteins in the media to ensure maximum delivery into the cells. When cells were

about 100% confluent, old media was replaced by 2 mL of appropriate media per well

and left for two days before harvesting, followed by further 30 minutes incubation

with Znpyr-1 and subsequently checked under the microscope. Following the

incubation, cells were washed 3 times with PBS and mounted with Bio-Rad

FluoroGuardTM Anti-fade Reagent (Bio-Rad, Hercules, USA). Confocal images were

obtained as previously described (Hardman et al., 2007)


116 | P a g e



The purpose of this study was to evaluate the compatibility of four different

fluorophores (Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) in M17 cells. Free zinc

availability of M17 cells was tested using these fluorophores under live or fixed

conditions and then samples were assessed by microscopy to determine the most

compatible fluorophore under the given conditions.

Cells were grown on cover slips for two days, then incubated with one of the

fluorophores for 30 minutes. Following incubation, one set was used as is and the

second one was permeabilized, fixed and tested for fluorescence signals. Live cells

incubated with FluoZin-3 displayed scattered and very minimal fluorescence labelling

(Figure 3.1.4-b). Conversely, all the other three fluorophores produced strong signals

in live M17 cells (Figure 3.1.b). Among these three fluorophores, Zinquin signalling

was weaker than that of Zinpyr-1 and RhodZin-3. However, fluorescence signalling

with these three fluorophores showed a very similar and specific staining pattern.

Signalling appeared to be confined mainly to the endoplasmic reticulum (ER), Golgi

and the nucleus. In contrast, the cytoplasmic region did not exhibit a strong

fluorescence signalling with these three fluorophores in live cells. Fluorescence

signalling in dead and fixed M17 cells incubated with Zinpyr-1, RhodZin-3 and Zinquin


117 | P a g e

appeared to be diffuse and weaker when compared to live cells, suggesting it is not

specific or confined (Figure 3.1.a). Cytoplasmic staining was also visible when

incubated with fixed cells. Interestingly, FluoZin-3 produced contrasting results with

the fixed cells in comparison to the live cells (Figure 3.1.4-a). Very strong ER and Golgi

labelling was present and the signalling appeared to be specific and confined. Three

independent replicates were performed for this experiment and the results obtained

were consistent across the three replicates. Thus, based on the results, Zinpyr-1 was

selected as the fluorophore of choice for non-permeabilized (live) cells. FluoZin-3

was selected as the fluorophore of choice for staining of permeabilized (dead) cells,

as it gave the best zinc specific results.


M17 cells were tested for zinc fluxes following DHA treatment using Znpyr-1 as the

zinc fluorophore. M17 cells were incubated for 48hrs in the presence of DHA (20

μg/mL) or in its absence as the control, followed by a further 30 minutes incubation

with Znpyr-1, and subsequently assessed by microscopy. Control M17 cells displayed

very strong zinc labelling when incubated with Znpyr-1 (Figure 3.2.1-a). Signalling

was stronger close to the endoplasmic reticulum (ER) and the Golgi, and was

consistent among all the cells present. In contrast, DHA treated cells displayed

minimal labelling indicating a very low levels of free zinc in the cytoplasm, thus

producing low levels of fluorescence signalling compared to untreated cells. Bright


118 | P a g e

field imaging indicates the presence of cells, however, green fluorescence was almost

negligible and was limited to a few insignificant scattered spots (Figure 3.2.1-b).

These results were verified with three individual experimental sets and the results

were highly consistent.


119 | P a g e

Figure 3.1: Fluorescence signalling from four different zinc fluorophores in M17

cells.

Free zinc availability of M17 cells was tested using four different fluorophores

(Zinquin, Zinpyr-1, RhodZin-3 and FluoZin-3) to evaluate the compatibility of them

under live (A) or fixed (B) conditions.


120 | P a g e

Figure 3.2: Comparison of zinc fluxes following DHA and LA treatments in M17 cells

using Znpyr-1.

M17 cells were tested for changes in free zinc levels using Znpyr-1 in the presence

(1-b) and absence (1-a) of DHA (20 μg/mL) treatments. M17 cells were also tested

for the fluorescence labelling in the presence (2-b) and absence (2-a) of LA to test the

DHA specificity.


121 | P a g e

3.3.3 Linoleic acid effect on Zn fluxes across the cell membrane

In this experiment, omega-3 fatty acid DHA was replaced by an omega-6 fatty acid LA

to test the DHA-specific results obtained in the previous study. M17 cells were

treated for 48hrs with either 20 μg/mL LA as the test sample, or without LA as the

control. Cells were then incubated for another 30 minutes with Znpyr-1 and

subsequently checked under the microscope.

Once again, the untreated control cells produced very strong green fluorescence

signalling when incubated with Znpyr-1 (Figure 3.2.2-a). This indicates the presence

of free zinc in the untreated cells. The red staining demonstrates ethidium bromide

staining of the nucleus. Green fluorescence signalling was mainly seen in the Golgi

and ER regions, and the strong staining pattern was universal in all cells present. In

comparison to the control sample signal, there was no substantial difference in the

staining pattern of cells treated with LA (Figure 3.2.2-b). The strong green

fluorescence signalling prominent in the Golgi and cell membrane regions were in

response to Znpyr-1 treatment, and the red signalling was from nuclear ethidium

bromide staining. This finding indicates that the free zinc availability in cells is not

affected by LA, as it was with DHA, suggesting DHA specificity in this mechanism.


122 | P a g e

3.3.4 DHA treatment - timepoint study

DHA treated M17 cells were tested for zinc fluxes using Znpyr-1 at different time

points to identify DHA effects at different stages. M17 cells were incubated with DHA

(20 μg/mL), followed by a further 30 minutes incubation with Znpyr-1 and

subsequently assessed under the microscope. M17 cells were tested at 0, 4, 8, 16,

24 and 48 hour timepoints to assess the effects of DHA.

At 0 hours, cells showed a very high concentration of free zinc which was visualised

by a strong green fluorescence signal (Figure 3.3.1-a). The magnified image shows

distinctive and specific labelling of free zinc around the ER and Golgi areas (Figure

3.3.1-b). This labelling pattern was consistent among experiment replicates and also

consistent with previous observations made in the preliminary studies. After 4 hours

of DHA incubation, M17 cells still illuminated very high levels of green fluorescence

when treated with Znpyr-1 (Figure 3.3.2-a). This suggests that at this timepoint there

is still a significant amount of free zinc available inside the cells, and the incubation

time is not sufficient for DHA to act upon the cells. The magnified image again shows

more detail of the zinc localisation pattern, which was very similar to the 0 hour time

point (Figure 3.3.2-b). The next time point was at 8 hours, which again did not show

any significant changes in the fluorescence labelling (Figure 3.3.3), or the labelling

pattern. However, after 16 hours of incubation the fluorescence signalling was

slightly reduced compared to the first three time points (Figure 3.4.1). Most of the

cells still displayed fluorescence signalling but there were some cells with almost no

specific or confined labelling pattern. This tendency was more prominent after 24


123 | P a g e

hours of incubation with DHA (Figure 3.4.2). The strength of the Znpyr-1 labelling was

reduced and more diffuse than the sharp and intense signalling patterns which were

visible with previous time points. By the 48 hour time point zinc signalling had almost

disappeared indicating the absence of free zinc in DHA treated M17 cells (Figure

3.4.3). These results were consistent across the replicates and with previous

observations.


124 | P a g e

Figure 3.3: Timepoint (0 – 8 hours) analysis of M17 cells with DHA treatment.

DHA (20 μg/mL) treated M17 cells were tested for free zinc availability using Znpyr-1

at different time points to identify DHA effects at different stages. M17 cells were

tested at 0 hour (1-a), 4 hours (2-a), 8 hours (3-a) for the green fluorescence labelling

by Znpyr-1 treatment, and the red signalling was from nuclear ethidium bromide

staining. Magnified image is presented next to the corresponding image to gain

better understanding of the zinc localisation pattern (1-b, 2-b & 3b).


125 | P a g e

Figure 3.4: Timepoint (16 – 48 hours) analysis of M17 cells with DHA treatment.

DHA (20 μg/mL) treated M17 cells were tested for free zinc availability using Znpyr-1

at different time points to identify DHA effects at different stages. M17 cells were

tested at 16 hour (1-a), 24 hours (2-a), 48 hours (3-a) for the green fluorescence

labelling by Znpyr-1 treatment, and the red signalling was from nuclear ethidium

bromide staining. Magnified image is presented next to the corresponding image to

gain better understanding of the zinc localisation pattern (1-b, 2-b & 3b).


126 | P a g e


M17 cells were cultured in serum free media (-FBS) for 48 hours, and treated with

one of the following combinations for another 48 hours followed by a 30-minute

incubation with the zinc fluorophore Znpyr-1. (a) –DHA and –FBS, (b) -DHA and +FBS,

(c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS.

When assessed under the microscope, M17 cells showed very strong zinc labelling

within the no zinc and no FBS treated cells (Figure 3.5-a). However, most of the cells

appeared to be dying and unhealthy after a total of 4 days of serum starvation. Zinc

labelling was also strong in the second treatment condition of FBS with no added

DHA, following 2 days of serum starvation (Figure 3.5-b). With this condition, cells

were healthier compared to the previous “no FBS and no DHA” treatment. More

specific localization patterns of zinc could be seen with this condition. The most

interesting results were produced with the next combination where cells were

treated with 20μg/mL of DHA but no FBS, after 2 days of serum starvation (Figure 3.5-

c). Even though there was no FBS present, cells appeared to be healthier compared

to the first experimental set with no FBS and no DHA. This suggests DHA alone can

promote cell survival, which validates our previous (Chapter 2) results obtained with

DHA treatment and caspase-3 and Bcl-2 studies. Green fluorescence signalling was

also very low in this experimental condition (Figure 3.5-c), suggesting lack of free zinc.

When cells were treated with both DHA and FBS after the serum starvation period,

once again the cells did not produce any green fluorescence labelling when incubated


127 | P a g e

with the zinc fluorophore (Figure 3.5-d). These results were consistent across the

replicates and validate previous studies done with DHA and zinc fluorophores.

3.3.6 DHA effects on zinc fluxes across the cell membrane in NT2 cells

NT2 cells were tested for zinc fluxes following DHA treatment using Znpyr-1 as the

zinc fluorophore. NT2 cells were incubated with DHA (20 μg/mL) for 48 hours

followed by a further 30 minute incubation with Znpyr-1, and then examined under

the microscope. NT2 cells displayed a very similar fluorescence signalling pattern to

M17 cells following DHA treatment. Cells treated with no DHA showed strong

signalling with the fluorophores (Figure 3.6.1-a), indicating high levels of free zinc

present in the cells. DHA treated NT2 cells had a lesser amount of free zinc, hence

produced a significantly less fluorescence signal in comparison to untreated cells

(Figure 3.6.1-b). This experiment was repeated independently three times and the

results were consistent.


128 | P a g e

Figure 3.5: Serum starvation study with DHA enrichment.

48 hour serum starved (-FBS) M17 cells were tested for free zinc levels in the cells

following DHA treatment with one of the following combinations for another 48

hours followed by a 30-minute incubation with the zinc fluorophore Znpyr-1.

(a) –DHA and –FBS, (b) -DHA and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA

and +FBS.


129 | P a g e

3.3.7 Linoleic acid effect on zinc fluxes across the cell membrane in NT2 cells

When NT2 cells were treated with 20 μg/mL LA instead of DHA, no significant

difference could be seen compared to the control sample. Untreated control cells

produced strong green fluorescence signalling in response to incubation with Znpyr-

1 (Figure 3.6.2-a). This result was in line with the observations made with M17 cells.

Strong green florescence labelling indicates the presence of free zinc in untreated

NT2 cells. Ethidium bromide was used as the nuclear stain and red fluorescence

signalling corresponds to this nuclear staining. Green fluorescence signalling was

mainly seen in the Golgi and ER regions and the strong staining pattern was universal

to all cells present. When cells were treated with LA there was no visible difference

in the staining pattern in comparison to the control sample (Figure 3.6.2-b). Strong

green fluorescence signalling was still present after LA treatment and was mainly

confined to the Golgi and cell membrane regions. The lack of change in fluorescence

labelling patterns following LA confirms that free zinc levels were not altered by the

treatment, and that the changes observed on zinc availability with DHA treatment

are DHA specific.


130 | P a g e

Figure 3.6: Comparison of zinc fluxes following DHA and LA treatment in NT2 cells

using fluorophores.

NT2 cells were tested for changes in free zinc levels using Znpyr-1 in the presence

(1-b) and absence (1-a) of DHA (20 μg/mL) treatments. NT2 cells were also tested for

the fluorescence labelling in the presence (2-b) and absence (2-a) of LA to test the

DHA specificity.


131 | P a g e

3.3.8 DHA treatment - timepoint study with NT2 cells

NT2 cells were tested at different timepoints following DHA treatment for zinc fluxes

using the zinc fluorophore Znpyr-1. NT2 cells were incubated with DHA (20 μg/mL)

and its effects on NT2 cells were tested at 0, 4, 8, 16, 24 and 48 hours with use of the

Znpyr-1 zinc fluorophore.

Similar to M17 cells, NT2 cells also showed a high fluorescence labelling with Znpyr-

1 at 0 hours indicating a high concentration of labile zinc (Figure 3.7.1). The

localisation patterns are visible on the magnified image, where a strong signal is seen

in the ER and Golgi areas (Figure 3.7.1-b). No significant changes could be seen after

the first 4 hours of DHA incubation, NT2 cells still illuminated very high levels of green

fluorescence when treated with Znpyr-1 (Figure 3.7.2-a). The magnified image

highlights the zinc location pattern and is also very similar to the 0 hour image (Figure

3.7.2-b). After 8 hours of DHA treatment NT2 cells showed a similar strength in

fluorescence labelling (Figure 3.7.3). No real changes could be seen with regard to

the signal strength or localisation at this time point. Other than a slight decrease in

fluorescence signalling, no significant changes were visible at the 16-hour (Figure

3.8.1) and 24-hour (Figure 3.8.2) timepoints either. This suggest that at these

timepoints there is still a significant amount of free zinc available inside the cells, and

the incubation time is not sufficient for DHA to act upon the cells. Following 48 hours

of DHA treatment, a significant change in the zinc fluorescence labelling could be

seen. At the 48 hour timepoint zinc signalling had almost disappeared indicating the

absence of free zinc in NT2 cells (Figure 3.8.3). Observations made in NT2 cells were


132 | P a g e

the same as with M17 cells, indicating a strong similarity between both cell types in

relation to the effect of DHA treatment on labile zinc.

3.3.9 DHA and serum starvation study with NT2 cells

The effect of DHA on NT2 cell survival was tested by a serum starvation study. In this

study, NT2 cells were cultured in serum free media (-FBS) for 48 hours, and then

treated with one of the following combinations for another 48 hours followed by a

30 minute incubation with the zinc fluorophore Znpyr-1: (a) –DHA and –FBS, (b) -DHA

and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS.

Though many cells were distressed and dying following the no zinc and no FBS

treatment, a strong zinc fluorescence labelling could still be seen (Figure 3.9-a). Zinc

labelling was also strong in NT2 cells with the second experimental condition, which

was treatment with FBS in the absence of DHA, following 2 days of serum starvation

(Figure 3.9-b). Following this treatment, cells appeared healthier compared to the

previous “no FBS and no DHA treatment”. In addition, a more specific localization

pattern for zinc could be seen with this second experimental condition. The most

interesting results were produced with the third condition, where cells were treated

with 20 μg/mL of DHA without FBS, after serum starvation for 2 days (Figure 3.9-c).

Even though there was no FBS present, cells appeared to be healthier compared to

the first experimental condition of no FBS and no DHA. This suggests DHA alone can

promote cell survival, which validates our previous (Chapter 2) results obtained with


133 | P a g e

DHA treatment and caspase-3 and Bcl-2 studies. Green fluorescence signalling was

also very low in cells exposed to the third experimental condition (Figure 3.9-c),

suggesting the lack of free zinc. When cells were treated with both DHA and FBS after

the serum starvation period, once again the cells did not produce any green

fluorescence labelling when incubated with the zinc fluorophore (Figure 3.9-d).

These results were consistent among the replicates and validate the results of

previous studies done with DHA and zinc fluorophores. Moreover, both M17 and

NT2 cells produced similar results with the serum starvation study.


134 | P a g e

Figure 3.7: Timepoint (0 – 8 hours) analysis of NT2 cells with DHA treatment.

DHA (20 μg/mL) treated NT2 cells were tested for free zinc availability using Znpyr-1

at different time points to identify DHA effects at different stages. NT2 cells were

tested at 0 hour (1-a), 4 hours (2-a), 8 hours (3-a) for the green fluorescence labelling

by Znpyr-1 treatment, and the red signalling was from nuclear ethidium bromide

staining. Magnified image is presented next to the corresponding image to gain

better understanding of the zinc localisation pattern (1-b, 2-b & 3b).


135 | P a g e

Figure 3.8: Timepoint (16 – 48 hours) analysis of NT2 cells with DHA treatment.

DHA (20 μg/mL) treated NT2 cells were tested for free zinc availability using Znpyr-1

at different time points to identify DHA effects at different stages. NT2 cells were

tested at 16 hour (1-a), 24 hours (2-a), 48 hours (3-a) for the green fluorescence

labelling by Znpyr-1 treatment, and the red signalling was from nuclear ethidium

bromide staining. Magnified image is presented next to the corresponding image to

gain better understanding of the zinc localisation pattern (1-b, 2-b & 3b).


136 | P a g e

Figure 3.9: Serum starvation study with DHA enrichment.

48 hour serum starved (-FBS) NT2 cells were tested for free zinc levels in the cells

following DHA treatment with one of the following combinations for another 48

hours followed by a 30-minute incubation with the zinc fluorophore Znpyr-1.

(a) –DHA and –FBS, (b) -DHA and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA

and +FBS.


137 | P a g e

CHAPTER 3.4: Discussion

Zinc is considered as an indispensable element in the molecular economy of

mammalian cells. Gene transcription and metalloenzyme activity is highly dependent

on zinc availability (Berg and Shi, 1996; Vallee and Falchuk, 1993). In addition, cell-

cell signalling in the CNS is mediated by zinc (Frederickson, 1989). The glutamategic

terminal in mammalian brains are known to contain high levels of labile zinc

(Danscher, 1984). Zinc exists as three main forms in the human brain. Firstly, as

vesicular pools localized in synaptic vesicles of nerve ends. Zinc also exists as

metalloproteins or protein-metal complexes, and thirdly as ionic pools of free or

loosely bound zinc in the cell cytoplasm (Frederickson, 1989). Independent from the

dietary zinc availability, cerebral zinc is maintained at a steady level, highlighting the

importance of zinc in brain function (O'Neal et al., 1970; Wallwork et al., 1983).

Despite the importance of zinc in neuronal cells, neurons only have a very narrow

window of zinc tolerability compared to other cell types. In vivo and in vitro studies

have shown excessive amounts of zinc can induce both necrotic and apoptotic death

in neuronal cells (Choi et al., 1988; Chuah et al., 1995; Cuajungco and Lees, 1997b;

Duncan et al., 1992; Yokoyama et al., 1986). Labile zinc in the cytosol is considered

as an apoptotic marker in neuronal cells (Lee et al., 2006). Many neurodegenerative

conditions including AD, is linked with altered zinc homeostasis (Cuajungco and Lees,

1997a; Cuajungco and Lees, 1997b; Joseph et al., 2009; Mizuno and Kawahara, 2013;


138 | P a g e

Mocchegiani et al., 2005; Weiss et al., 2000). However, the exact intracellular

mechanism(s) of zinc induced toxicity in neuronal cells are not yet known.

Therefore, this study was done to examine the possible protective mechanism of DHA

through decreasing the amount of labile zinc in human neuronal cells. Generally, DHA

is known as a neuro-protective agent (Akbar et al., 2005a; Cole et al., 2005; Horrocks

and Yeo, 1999; Treen et al., 1992). Studies conducted have also shown anti-apoptotic

properties of DHA in many cell types (Akbar and Kim, 2002; German et al., 2006).

When treated with DHA, serum starved Neuro 2 cells showed increase in anti-

apoptotic markers (Kim et al., 2000) indicating a possible protective mechanism over

programmed cell death. These reported observations were re-tested using human

M17 and NT2 cells to identify a link between DHA and cellular levels of free zinc.


The first part of this study was to analyse four different free zinc markers to assess

the usability of those markers under specific conditions. There are two main families

of zinc fluorophores, membrane permeable and membrane impermeable. Once

inside the cell, membrane permeable fluorophores undergo an esterase modification

and is converted into membrane impermeable derivatives (Kimber et al., 2000), thus

enabling the modified derivative to bind free zinc.


139 | P a g e

When incubated with fluorophores for 30 minutes, cultures of M17 cells exhibit

specific results under fixed or live conditions (Figure 3.1). Fluozin-3, the only

membrane impermeable fluorophore tested displayed very weak signalling when

examined under live conditions. In contrast, in fixed cells Fluozin-3 was the only

fluorophore which produced specific signalling. In permeabilized cells, the other

three fluorophores exhibit non-specific signalling which was more diffuse across the

entire cell. These results confirm that there are specific conditions ideally suited for

the use of different zinc fluorophores.


M17 and NT2 cells were used to assess the effect of DHA on zinc fluxes across the cell

membrane. Cells were treated with 20 μg/mL or 0 μg/mL of DHA for 48 hours and

subsequently incubated with the zinc fluorophore for an additional 30 minutes.

Interestingly, both cell types showed similar results when incubated with Zinpyr-1,

following DHA treatment. The strong zinc labelling seen in cells not exposed to DHA

(Figure 3.2.1-a & 3.6.1-a) almost disappeared following the DHA treatment (Figure

3.2.1-b & 3.6.1-b), indicating a possible effect of DHA on free zinc availability. As

indicted in our published data, 65Zn studies showed a decrease in cellular zinc

accumulation following DHA treatment in M17 cells (Suphioglu et al., 2010a). The

significantly reduced florescence labelling observed in both cell lines following Zinpyr-

1 incubation also confirms the above findings. As evident in the findings of Chapter

2, ZnT3 transporter levels were also downregulated in both these cell lines following


140 | P a g e

DHA treatment, suggesting the high likelihood of a link between DHA, labile zinc and

ZnT3 transporter expression levels in these two cell lines. However, the exact

mechanism or the order in which DHA acts on these cells is not yet confirmed.

3.4.3 Linoleic acid effect on zinc fluxes across the cell membrane

The specificity of the results obtained with DHA treatment on zinc flux was tested

using LA as a substitute for DHA. Cells were incubated with LA (0 or 20 μg/mL) for 48

hours, followed by 30 minutes incubation of Zinpyr-1 and examined under the

microscope. Control cells incubated in the absence of LA displayed strong zinc

labelling following exposure to zinc fluorophores (Figure 3.2.2-a & 3.6.2-a).

Interestingly, no significant changes could be seen following the LA treatment in both

M17 and NT2 cells (Figure 3.2.2-b & 3.6.2-b). The results observed in LA treated cells

were contrary to what was observed when treated with DHA, where following LA

treatment strong zinc labelling was still visible, as same as the control cells. LA (18:2n-

6) is a polyunsaturated omega-6 FA with a18 carbon chain and two cis double bonds.

The main structural difference between omega-3 FAs and omega-6 FAs is the position

of the first double bond. In omega-3 FAs it’s on the third carbon atom and in omega-

6 FAs it’s on the sixth carbon atom, counting from the methyl end. Omega-6 FAs are

considered to be essential in maintaining biochemical functions in the human body

(Simopoulos, 2002). At the cellular level, omega-6 FAs tend to have an opposing

effect when compared to omega-3 FAs. As an example, at high concentrations

omega-6 FAs can increase the formation of prostaglandins and thereby increase


141 | P a g e

inflammatory processes. In contrast, the reverse can be seen with increased omega-

3 FAs in the body. Many biochemical factors such as thromboxane A2 (TXA2),

leukotriene B4 (LTB4), IL-1, IL-6, tumour necrosis factor (TNF), and C-reactive protein,

which are related to various health conditions have been shown to increase with high

levels omega-6 FAs. Thus, suggesting a clear difference between omega-3 and

omega-6 FAs at the cellular level. The difference in the results obtained from this

study could be due to the functional differences between these two FAs, and

therefore, the changes seen in cellular free zinc levels can be classified as DHA-

specific. A previous study done with mouse Neuro 2A cells have shown a DHA specific

decrease in apoptotic cell death, induced by serum starvation. In contrast, oleic acid

was unable to illicit similar anti-apoptotic properties in serum starved Neuro 2A cells

(Kim et al., 2000). In another study where Neuro 2A cells were treated with

docosapentaenoic acid, was less effective in inducing

phosphatidylserine accumulation and Akt translocation, and therefore was less

effective as an anti-apoptotic agent when compared to DHA. Oleic and arachidonic

acids were also less effective in reducing the caspase-3 activity, DNA strand breaking

and laddering in mouse cells compared to DHA (Akbar and Kim, 2002). Hence,

observations made in our study also falls in line with these previously reported

findings, re-establishing the specificity of DHA in preventing apoptosis.


142 | P a g e

3.4.4 DHA treatment - timepoint study

In this study, the effect of DHA on both M17 and NT2 cells were studied at different

timepoints to gain a better understanding of the mechanism involved. The

timepoints selected for this study were 0, 4, 8, 16, 24 and 48 hours after DHA

treatment. As predicted, both cell lines showed the maximum intensity in

fluorescence labelling at 0 hours, and the lowest at 48 hours. No notable changes

were seen during the first three timepoints. However, from the fourth timepoint

onwards, a slight decrease was visible. These observations provide an insight into

DHA effects at the functional level in M17 and NT2 cells. A time course study done

with rat pheochromocytoma PC12 cells have shown that DHA effects were visible

only after 24 hours and was at the highest at 48 hours (Kim et al., 2000). In PC12

cells, DNA fragmentation induced by serum starvation was reduced when the cells

were enriched with DHA for a longer period of up to 48 hours. In addition in HL-60

cells, sphingosine-induced apoptosis was only reduced following a pre-incubation of

cells with DHA for at least 24 hours (Kishida et al., 1998).

The changes in zinc levels following DHA treatment can be due to the direct influence

DHA has on membrane composition and fluidity. DHA is able to readily incorporate

into membrane phospholipids and esterified into phospholipids. DHA can influence

many basic membrane properties such as acyl chain order, phase behaviour,

membrane elasticity, membrane permeability, flip-flop and protein activity (Stillwell

and Wassall, 2003). DHA’s ability to interact with cholesterol and other membrane

lipids may have an important role in its ability to modify the structure and functions


143 | P a g e

of the cell membrane (Stillwell and Wassall, 2003). In addition to the changes in the

lipid profile of the cell membrane, DHA has a shown tendency to alter gene

transcription levels in many cells (Kim et al., 2000; Sadli et al., 2012; Suphioglu et al.,

2010b). In fact, during our study we have also observed this in regard to the ZnT3

expression levels (Chapter 2).


M17 and NT2 cells were cultured in serum free media (-FBS) for 48 hours, and then

treated with one of the following combinations for another 48 hrs followed by a 30

minute incubation with the zinc fluorophore Znpyr-1: (a) –DHA and –FBS, (b) -DHA

and +FBS, (c) 20 μg/mL DHA and –FBS, (d) 20 μg/mL DHA and +FBS. Following

incubation with Znpyr-1, both cell lines showed a very similar zinc labelling pattern in

response to different treatments. With –DHA and –FBS treatment, both cell lines

indicated significant zinc labelling (Figure 3.5-a & 3.9-a). However, with this

treatment cells were distressed and dying. When treated with –DHA and +FBS cells

were healthier than the previous treatment and a strong zinc labelling pattern was

still present (Figure 3.5-b & 3.9-b). When treated with both DHA and FBS cells

appeared healthier, but zinc labelling was not present indicating a possible DHA

modulation of free zinc availability (Figure 3.5-d & 3.9-d). However, the most

significant results came with the +DHA and –FBS treatment. With this treatment

regime both the cell lines displayed minimum zinc labelling, which is in line with

previous observations. Despite the absence of FBS, cells looked healthier when


144 | P a g e

treated with only DHA (Figure 3.5-c & 3.9-c), indicating the anti-apoptotic effects of

DHA. Many studies done with DHA have also reported similar anti-apoptotic

properties of DHA. In cultured mouse Neuro 2A cells, DHA increased phosophatidyl

serine levels resulting in membrane translocation/activation of Akt through its

capacity to increase phosphatidylserine, thus promoting cell survival (Akbar et al.,

2005b). DHA enrichment of Neuro 2A cells prior to serum starvation has shown a

protective effect against apoptotic death (Kim et al., 2000). In addition, DHA

enrichment has also elicited a protective effect on staurosporine (ST) induced

apoptosis in Neuro 2A cells (Akbar and Kim, 2002). Thus, observations made during

this study are well in line with the reported literature linking DHA, zinc levels and

apoptosis.

3.5.6 Conclusion

Zinc fluxes across the membrane in both M17 and NT2 cells displayed interesting

changes in response to DHA treatment. A significant decrease in free zinc levels was

visible following 48 hours of DHA treatment. Changes in labile zinc levels were only

seen upon incubation of cells with DHA. LA showed no effect on labile zinc levels in

both M17 and NT2 cell lines. In general, elevated levels of free zinc is associated with

neurodegeneration and apoptosis. Thus, the reported depletion in free zinc levels

following DHA treatment could potentially be linked with the well-known anti-

apoptotic properties of DHA. In the second chapter of my study, I was able to


145 | P a g e

re-establish the anti-apoptotic nature of DHA. The current study provides strong

evidence for a DHA mediated zinc-dependent pathway of neuroprotection.


146 | P a g e


4.1.1 Cell culture models in neuro-research

Neurosciences have advanced significantly over the last few decades with the

development in molecular biology, electron microscopy and computer technology.

However, the key limitation of neuroscience, aside from its high cost, is the lack of

relevant in vitro models which can mimic the structure, function and expression of

the proteins present in mature human neurons. With the increase in the incidence

of neurodegenerative diseases such as AD (Hebert et al., 2001), there is a greater

need for high-throughput neuroscience research. Neuroscience research, especially

research into AD use animal models or rodent neurons or other immortalized cells

such as neuroblastoma cells as a substitute, due to the lack of live mature human

neuronal cells.

Animal models can be a good in vivo substitute for the human system, although

immortalized human cell lines can be more advantageous due to their homogenous

nature and also because cellular mechanisms such as cell death can be more easily

and closely studied using a specific cell line rather than an animal system.

Immortalized human cell lines also allow investigations into species specific effects of

drugs. Using an animal model instead of a human cell line may restrict obtaining

similar results due to the species or environmental specificity of certain drugs (Allen


147 | P a g e

et al., 2014). In addition, study of mutations through genetic manipulation is much

easier to conduct in cell lines compared to animal models.

Thus, there is a high demand to develop a system to grow human neuronal cells in

vitro. If such a system can be developed, it will deliver experimental material for

studying cell therapies for central nervous system (CNS) disorders and may ultimately

assist as a source for neural transplantation and brain repair. Many research groups

have attempted to address this need in the past using different approaches. One of

the most popular methods used is to differentiate neuroblastoma cell lines into a

more neuronal-like state.

Neuroblastoma is one of the most common solid tumours in children which accounts

for more than 9% of all childhood cancers. It is known to have a neural crest origin,

with over half the incidences arising within or near the adrenal gland (Beckwith and

Perrin, 1963; Imashuku et al., 1976). Originally, short term in vitro culture of

neuroblastoma tumours was used as a tool for diagnosis (Murray and Stout, 1947),

and they found that explants of neuroblastoma tumours grown in plasma-clot

cultures readily expressed axons. The long term culture of neuroblastoma cells and

their propensity to differentiate in vivo and in vitro under special culture conditions

have attracted the interest of many researchers (Goldstein, 1968).

However, under normal culture conditions most of the neuroblastoma cell lines do

not demonstrate many neuronal features such as neuronal morphology, inhibited cell

division and expression of neuron-specific markers. More importantly, expression of


148 | P a g e

neuron-specific proteins such as β-III tubulin and mature tau isoforms are

significantly lower in neuroblastoma cells in comparison to mature neurons (Agholme

et al., 2010). Previous studies have shown that M17 cells are resistant to retinoic acid

(RA) differentiation, and M17 cells continued to proliferate after RA treatment

(Draoui et al., 1997). However, one published study has successfully demonstrated

differentiation of SY5Y cells using RA (Simpson et al., 2001).

A likely alternative to neuroblastoma cells is the well-characterized neuronally

committed teratocarcinoma cell line Ntera2 (NT2). NT2 cells were derived from a

human testicular cancer (Andrews, 1984). According to published literature, NT2

cells can be induced to differentiate into fully functional, post-mitotic neurons and

other cell types of the neuronal lineage which display a variety of neurotransmitter

phenotypes when treated with RA (Guillemain et al., 2000). NT2 cells have been used

extensively in neuroscience studies in the past few decades (Paquet-Durand and

Bicker, 2007). Published work by Nelson et al. reveal that terminally differentiated

NT2 cells were successfully transplanted into a human stroke patient (Nelson et al.,

2002).

4.1.2 Differentiation agents

Differentiation of neuroblastoma and teratocarcinoma cells can be induced using a

few different differentiation agents. These agents can be classified under three


149 | P a g e

groups according to their biological functions: growth factors, kinase

activators/inhibitors and serum withdrawal. RA, insulin, insulin like growth factors

(IGF), brain derived neurotrophic factors (BDNF) and nerve growth factors (NGF) are

the most widely used growth factors (Pahlman et al., 1984; Recio-Pinto et al., 1984;

Sidell, 1982; Sonnenfeld and Ishii, 1982). Protein kinase C activators such as 12-O-

tetradecanolyphorbol-13-acetate (TPA) is a widely used kinase activator to induce

differentiation (Pahlman et al., 1981; Spinelli et al., 1982). Non-specific protein

kinase inhibitors such as staurosporine are also used extensively to induce

differentiation in many neuroblastoma cell lines (Jalava et al., 1992; Leli et al., 1992).

Serum withdrawal is also widely used to differentiate many neuroblastoma cell lines

(Diaz-Nido et al., 1991; Evangelopoulos et al., 2005; Wang et al., 2004b). However,

none of the methods are considered to be more effective than the other.

Effectiveness can vary with the cell line and the conditions used. Many researchers

tend to use at least a combination of these methods to maximise the outcome of the

differentiation process.

4.1.3 Traditional culture system versus 3D system

The traditional method of culturing cell lines is in monolayers in cell culture vessels,

flasks or petri dishes. Flat and hard plastic or glass substrate is used in this method

as the adherent material for the cells. However, many have questioned the use of

this 2 dimensional (2D) method of cell culture, especially in neuroscience research. It


150 | P a g e

is generally accepted that a 2D cell culture method is not capable of mimicking the

cellular environment found in organisms. Growth, cell expansion, cell to cell

interaction and cell to drug interaction are hindered in traditional 2D culture systems,

thus the accuracy of many studies can be embattled (Abbott, 2003).

In contrast to the traditional 2D method, cells grown in a 3 dimensional (3D) matrix

has many advantages. Firstly, it’s a better representation of the cell’s growth

patterns and interactions in vivo. The 3D system allows cells to form more natural cell

to cell attachments including gap junctions. The native configuration of cells and their

tissue-like flexibility and pliability can be achieved using the 3D culture method. The

microenvironment of the 3D culture system promotes many natural cellular

characteristics such as cell morphology, polarity, motility, differentiation, gene

expression, cellular migration and many other biochemical activities compared to the

2D system (Pampaloni et al., 2007). Studies done using cancer cells have shown

decreased chemo-sensitivity (Loessner et al., 2010) and decreased radiation-induced

cytotoxicity (Sowa et al., 2010) in the 3D culture system relative to the 2D monolayer

system. Thus, these studies highlight the importance of a 3D culture system to gain

a better understanding of the pathophysiological events seen in patients.

However, as with any system the 3D culture system has its own disadvantages. The

high costs associated with 3D culture is a key limitation in its infrequent use in a

majority of academic research settings. Variations between 3D matrix to matrix, over

time structural changes of the matrix and difficulty in harvesting cells from the matrix

are a few other limitations. In addition to these disadvantages, one of the basic


151 | P a g e

difficulties with many differentiation attempts is the prolonged cell culture and

treatment period. In particular, the time consuming process of NT2 cell

differentiation has been widely reported (Pleasure et al., 1992).

4.1.4 Outline of the study

Thus, this study was conducted with several aims. The main focus of this study was

to differentiate three different human cell lines including two neuroblastoma cell

lines (SY5Y, M17) and a teratocarcinoma cell line (NT-2). The second main focus was

to test egg white as a low cost alternative to ECM matrigel using M17 cells. Thirdly,

to develop a differentiation method with a shorter culture/treatment period in order

to maximise economical out turn and productivity. Differentiation achieved by these

three improved methods was tested for neuronal-specific markers using

immunocytochemistry and Western blotting techniques.


152 | P a g e


4.2.1 Cell culture

The human neuroblastoma cell lines BE(2)-M17, SH-SY5Y and neuronally committed

human teratocarcinoma cell line NT2 used in the present experimental study were

obtained from Professor Leigh Ackland, Centre for Cellular and Molecular Biology,

Deakin University, (VIC, Australia).

NT2 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10%

heat inactivated foetal bovine serum (FBS). SH-SY5Y cells were grown in Roswell Park

Memorial institute 1640 (RPMI) medium supplemented with 20% heat inactivated

FBS, while BE(2)-M17 cells were cultured in OPTI-MEM (modified Eagles Minimum

Essential Medium) with 2.5% heat inactivated FBS. All three cell lines were grown as

monolayers in 75 cm2 disposable culture flasks (NuncTM, Roskilde, Denmark) and

incubated at 37°C in a humidified atmosphere of 5% carbon dioxide. At ~90%

confluence, cells were harvested or passaged using 0.025% trypsin/EDTA.


153 | P a g e

4.2.2 M17 differentiation using a conventional 2D cell culture system

M17 cells were grown on glass coverslips or in a culture flask in the presence of 10

μM retinoic acid [all-trans-retinoic acid (RA); Sigma, St. Louis, MO] for a period of 14

days. Media was replaced every 2–3 days. Cells grown in flasks were harvested for

Western blot analysis and the coverslips were processed for immunocytochemistry

studies.

4.2.3 M17 differentiation using 3D culture system

Following primary culture, cells were cultured onto Costar Transwell Clear Insert

(Costar, Cambridge, MA). Four inserts were coated with 200μl of matrigel and egg

white. Briefly, thawed egg white or matrigel was pipetted directly into the middle of

6-well plate wells and spread using a 25 mL pipette. The coated filters were left to

set at 37°C for approximately 2-3 hours. Any excess liquid was aspirated before

seeding of cells. From the following day, two egg white coated filters and two

matrigel coated filters were treated with 10 μM RA for 14 days. Media was replaced

every 2–3 days. Concurrently, control filters were treated with media in the absence

of RA. Subsequently, cells were either processed for immunocytochemistry or

harvested for Western blot analysis.


154 | P a g e

4.2.4 Modified 3D culture system for differentiation

The protocol developed for this study was performed by modifying and shortening

previously reported cell aggregation methods (Paquet-Durand et al., 2003, Jain P et

al., 2007). A summary of the method employed is exhibited in Figure 4.1. Cells (1–

1.5 × 106) were grown in corresponding medium (as described previously) on

bacteriological plates or on filers coated with matrigel to induce neurosphere

formation. On day 2, 10 μM RA was added, and medium was replaced every 2-3 days

for 14 days. One set of cells grown on bacteriological plates were divided into culture

flasks and glass coverslips. The second set was transferred onto filters coated with

matrigel. All three sets were then treated with corresponding medium containing

either 5% FBS (SY5Y & NT2 cells) or 1% FBS (M17 cells) and mitotic inhibitors (10 lM

FUdR, 10 lM Urd, 10 lM araC) for 7 days. Low FBS and mitotic inhibitors were used

to reduce non-neuronal cell proliferation. Neurons were maintained in culture media

with 5% FBS and mitotic inhibitors, and media was replaced twice a week. Neurons

could be maintained for approximately 2 months.


155 | P a g e

Figure 4.1: Schematic diagram of the modified 3D cell culture system developed for

cellular differentiation.

A summary of the method employed during the study for 3D cellular differentiation.

Filter Filter method (A), Suspension culture Filter method (B) and Suspension

culture Flask method were the tree different methods used.


156 | P a g e

4.2.5 Protein isolation and Western blot analysis

Harvested cells were re-suspended in 500 μL lysis buffer (1% sodium dodecyl sulfate

(SDS) in 10 mM Tris-hydrochloric acid (HCl), pH 6.8). To prevent protein degradation,

a mini EDTA-free protease inhibitor cocktail tablet (Roche Applied Science, Castle Hill,

NSW, Australia) was added to every 10 mL of lysis buffer prior to pipetting onto cell

pellet. Cells were placed on ice and homogenized by passing through a 21-gauge

needle ~10 times and sonicated (40% power output, 30% duty cycle) three times for

15 seconds with a 30 second break between each sonication, using a Microsone

ultrasonic cell disrupter (Misonix Incorporated, NY, USA). The homogenate was

centrifuged at 16,000 X g at room temperature for 10 minutes and the supernatant

was collected and stored at -80°C until further analysis. Quantification of protein

concentration was performed using the Pierce BCA Protein Assay Reagent Kit (Perbio,

Rockford, USA), according to the manufacturer’s Microplate Procedure instructions,

adapted from Smith et al. (Smith, 1985).

For Western blot analysis, cell lysates (described above) were resolved on 12% SDS-

PAGE gels, transferred onto a nitrocellulose membrane (Pall, Life Sciences, Pensacola,

Florida, USA) and blocked with 1% (w/v) casein in TBS. Membranes were incubated

with either rabbit anti-Beta III tubulin, mouse anti-Tau, mouse anti-DBH or mouse

anti-MAP antibodies overnight at 4°C. After washing, antibody binding was detected

with anti-mouse or anti-rabbit (HRP) horseradish-peroxidase conjugated (Chemicon

International, CA, USA) secondary antibodies (diluted 1:10,000 in TBS), as previously

described (Suphioglu et al., 2010b). Proteins were detected using Immobilan


157 | P a g e

Western chemiluminesence HRP substrate (Millipore Corporation, CA, USA) following

the manufacturer’s instructions. Membranes were developed using a Fujifilm

Luminescent Image Analyser LAS-3000.

Developed membranes were stripped for 10 mins at room temperature using 1 mL

Re-blot Plus-strong (Chemicon International, Temecula, CA, USA) diluted 1:10 in

MilliQ water. In order to confirm equal protein loading, membranes were re-probed

for β-actin using a mouse anti-β-actin (Sigma-Aldrich) primary antibody (diluted

1:5000 in TBS), followed by an anti-mouse HRP antibody (Chemicon International),

and developed as described above. Densitometry to quantify results was performed

using Fujifilm Multi Gauge V2.3 computer software.

4.2.6 Immunocytochemistry experiments

Immunocytochemistry was performed as previously described (Hardman et al.,

2007). Briefly, treated cells cultured on glass coverslips or coated filters were rinsed

3 times with PBS, fixed with 4% (w/v) paraformaldehyde (PFA/PBS) (Sigma-Aldrich,

Sydney, Australia) for 5 minutes at room temperature and rinsed again with PBS 3

times. The cells were permeabilised with 0.1% (v/v) Triton X-100/PBS (Amresco Inc.

Solon, USA) for 10 minutes at room temperature, rinsed 3 times with PBS and blocked

with 1% (w/v) BSA for 10 minutes at room temperature. Cells were incubated

overnight at 4°C with either rabbit anti-Beta III tubulin, mouse anti-Tau, mouse anti-


158 | P a g e

DBH or mouse anti-MAP primary antibodies at a 1:1000 dilution in 1% (w/v) BSA/PBS.

Samples were then rinsed with PBS 3 times, incubated with either Alexa Flour 488

anti-mouse (1:10,000) or Alexa Flour 488 anti-rabbit (1:10,000) antibody for 2 hours

at room temperature, washed 3 times with PBS and mounted with Bio-Rad

FluoroGuard anti-fade reagent (Bio-Rad, Hercules, USA). Confocal images were

obtained as previously described (Hardman et al., 2007).


159 | P a g e


4.3.1 M17 cells are resistant to retinoic acid in a conventional 2D cell culture

system

Previous studies conducted with the M17 cell line and RA suggest that it is resistant

to RA and continue to proliferate even after treatment with RA (Draoui et al., 1997).

These observations were re-tested in a study where M17 cells were cultured in a

conventional 2D cell culture system. After 14 days of RA treatment, cells were tested

for cellular differentiation by assessing the expression levels of neuronal markers β-

tubulin III, Tau, DBH and MAP2 using immunocytochemistry and Western blotting

techniques.

Immunocytochemistry analysis of these RA treated M17 cells demonstrated low

levels of neuronal markers β-tubulin III (Figure 4.2.1a), Tau (Figure 4.2.2a), DBH

(Figure 4.2.3a) and MAP2 (Figure 4.2.3a) as visualized by green fluorescence labelling.

Magnified cell images are also shown to give a more detailed understanding of the

neuronal marker labelling patterns (Figure 4.2.1b), (Figure 4.2.2b), (Figure 4.2.3b),

(Figure 4.2.4b). Green fluorescence labelling was lowest with the DBH antibody and

the rest displayed very minimal levels of labelling, indicating possible low levels of

these markers within the M17 cells under these conditions.


160 | P a g e

Immunocytochemistry results were verified by Western blot analysis using the four

neuronal marker antibodies. M17 cells treated with RA under the conventional 2D

cell culture method did not demonstrate a significant difference in neuronal marker

levels compared to untreated cells (Figure 4.3A). Equal protein loading of the gel

lanes was assessed by Western blot analysis for the housekeeping gene, β-actin

(Figure 4.3B). Neuronal marker protein levels were then normalized against the

corresponding β-actin protein levels and densitometry analysis was performed to

quantify the changes in expression. Following densitometry analysis, it was

confirmed that there was no significant changes in the levels of any neuronal markers

in RA-treated cells compared to untreated control cells (Figure 4.3C) in the 2D culture

system. These results were consistent across the three individual experimental sets

and the findings corroborated published literature regarding differentiation of M17

cells using RA under a conventional 2D cell culture method.


161 | P a g e

Figure 4.2: Immunocytochemistry analysis of M17 cell differentiation using the

traditional 2D culture system.

Immunocytochemistry analysis of RA treated M17 cells for neuronal markers β-

tubulin III (1-a), Tau (2-a), DBH (3-a) and MAP2 (4-a) as visualized by green

fluorescence labelling. Magnified cell images are also shown next to the

corresponding image to give a more detailed understanding of the neuronal marker

labelling patterns (Figure 4.2-b). Red signalling was from nuclear ethidium bromide

staining


162 | P a g e

Figure 4.3: Western blotting analysis of M17 cell differentiation using traditional

2D culture system.

Neuronal markers, β-tubulin III, Tau, DBH and MAP2 (A) and the housekeeping β-

actin (B) protein levels of M17 cells cultured in 2D system in the presence of RA

were measured with specific antibodies. (C) Densitometric analysis of neuronal

marker protein levels (normalised with the β-actin protein levels) are shown in

arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left

of each gel. This result is representative of three similar independent experiments.


163 | P a g e


presence of RA in a 3D cell culture system

Since M17 showed resistance to RA in a 2D cell culture, a novel method was

developed to culture cells in a 3D matrix to promote RA induced differentiation. The

3D culture system was developed using cell culture filters and coating them with

matrigel or the cheaper alternative egg white, as the 3D cell adhesive media. Cells

cultured using the 3D system were treated with 10 μM RA for 14 days. Following

treatment, cells were harvested and analysed for expression levels of neuronal

markers β-tubulin III, Tau, DBH and MAP2 using immunocytochemistry and Western

blotting techniques.

4.3.2.1 Immunocytochemistry results revealed a clear difference between 2D and

3D culture systems

The dichotomy between 2D and 3D cell culture systems was clearly demonstrated by

the immunocytochemistry results. A dramatic increase was clearly visible in all four

neuronal markers tested (Figure 4.4). Green fluorescence labelling in RA treated

experimental groups under 3D conditions showed a marked increase in fluorescence

labelling compared to the 2D culture system. Under the microscope, most of the cells

showed neuronal morphology, including elongated axons and dendrites. With the

3D culture system, labelling of neuronal markers was stronger and unanimous among

the cells. Also importantly, despite of the cell adhesive media used, both matrigel


164 | P a g e

and the cheaper alternative egg white produced strong labelling with all four

neuronal markers with only a slight difference in the labelling intensity. Nuclear

labelling is indicated in red by ethidium bromide staining. β-tubulin III labelling of

differentiated M17 cells showed very strong signalling with the matrigel system

(Figure 4.4.1-a) compared to the egg white system (Figure 4.4.1-b). Elongated and

fluorescence labelled axons were visible in both matrigel and egg white grown cells.

A similar pattern was observed with the tau antibody as well, where cells grown on

matrigel (Figure 4.4.2-a) showed a slight increase in antibody labelling compared to

cells grown on egg white (Figure 4.4.2-b). β-tubulin III is mainly present in

microtubules and tau is a microtubule-associated protein. Thus, an elongated

labelling pattern was visible with antibody binding. However, fluorescence labelling

with DBH was more intracellular in its localisation pattern. Matrigel grown cells

(Figure 4.4.3-a) still produced stronger signalling with the antibody labelling

compared to cells grown on egg white (Figure 4.4.3-b). An antibody specific to MAP2

proteins also produced similar results as the other three antibodies. Strong and well-

defined antibody staining was visible with cells grown on matrigel (Figure 4.4.4-a),

and a slightly reduced but still well defined antibody labelling was present with cells

grown on egg white (Figure 4.4.4-b).


165 | P a g e

Figure 4.4: Immunohistochemistry analysis of M17 cells differentiated on matrigel

and egg white matrixes.

M17 cell were grown in either matrigel (a) or egg white (b) and Immunocytochemistry

analysis of RA treated cells were done to test the neuronal marker levels. β-tubulin

III (1), Tau (2), DBH (3) and MAP2 (4) antibody labelling are visualized by green

fluorescence signals. Red signalling was from nuclear ethidium bromide staining


166 | P a g e

4.3.2.2 Analysis of protein expression levels in RA treated M17 cells using a 3D

culture system

M17 cells from both matrigel and egg white matrixes were collected and lysed to

extract protein, and then analysed by Western blotting. Four antibodies were used

to assess changes in the protein expression levels of neuronal cell markers. The

experiment was repeated three times and the results were consistent among the

three independent replicates.

β-tubulin III expression was significantly increased in lysates of all RA treated M17

cells compared to untreated cells, which was demonstrated by a strong band of

approximately 50-55 kDa by Western blot analysis. This strong band was visible in

both egg white and matrigel systems (Figure 4.5-A). The band corresponding to

untreated cell lysates was very faint suggesting low levels of β-Tubulin-III. Protein

loading was normalized using β-actin levels (Figure 4.5-B), and densitometric analysis

was performed to quantify changes in the expression levels (Figure 4.5-C).

Densitometry results demonstrated an approximately 7-fold increase in β-tubulin III

protein levels in cells grown on matrigel compared to control cells. In cells grown on

egg white, the fold difference was lower (3-fold) but still significant similar to the cells

grown on matrigel.

A second Western blot incubated with antibodies specific for tau protein displayed a

band of approximately 80 kDa in all lanes confirming expression of the protein. Band

intensity was much weaker in untreated control cells compared to RA-treated cells


167 | P a g e

(Figure 4.5-A). This suggested that tau protein levels have increased following RA

treatment in the 3D culture method. Both egg white and matrigel showed very

similar results, with tau signalling having only about 1-fold difference between the

two adhesive media. β-actin levels were then tested to ensure equal protein loading

across all the lanes (Figure 4.5-B), followed by quantification using densitometry

analysis (Figure 4.5-C), which showed approximately a 9-fold increase in tau

expression in response to RA treatment compared to untreated cells in the matrigel

system.

When incubated with an antibody specific for DBH, a band of approximately 70 kDa

was visible in all lanes confirming expression of the protein. Moreover, an increase

in band intensity was noticeable in RA treated cells compared to untreated cells

(Figure 4.5-A). Band intensity was highest with the matrigel system followed by the

egg white system, with very faint signalling visible in control samples using both

systems. This suggests that DBH protein expression levels have increased following

RA treatment using the 3D culture method. β-actin levels were then tested to ensure

equal protein loading across all the lanes (Figure 4.5-B), followed by the densitometry

analysis (Figure 4.5-C). Quantification analysis revealed that using the matrigel

system, over 7-fold increase in DBH expression was seen at the protein level in RA-

treated cells compared to the control M17 cells. With the egg white system, a 5-fold

increase in DBH protein levels was detected than in control cells.

MAP2 also displayed a similar trend to the other three neuronal markers. When

treated with RA, M17 cells showed an increase in MAP2 band intensity when cultured


168 | P a g e

in a 3D culture model. Expression of the MAP2 protein was confirmed by the

presence of an approximately 75 kDa band in all lanes (Figure 4.5-A). Once again, the

band intensity was highest with the matrigel system (approximately 4-fold increase)

compared to the control sample. Cells grown on egg white also showed an increase

of about 2.5-fold than the control M17 cells. β-actin levels were then tested to

ensure equal protein loading across all lanes (Figure 4.5-B), followed by the

densitometry analysis (Figure 4.5-C).

The increase observed in the protein expression levels of neuronal markers with the

3D culture system was contradictory to findings from the 2D culture system and the

reported observations in published literature. These findings are significantly

important considering the level of differentiation achieved with the novel 3D culture

method. Findings made in this study reiterate the importance of a 3D culture system

in achieving a better differentiation, at least in M17 cells.


169 | P a g e

Figure 4.5: Changes in protein expression levels in M17 cells following 3D culture

differentiation.

Neuronal markers, β-tubulin III, Tau, DBH and MAP2 (A) and the housekeeping β-

actin (B) protein levels of M17 cells grown in 3D culture system in the presence of

RA were measured with specific antibodies. (C) Densitometric analysis of neuronal

marker protein levels (normalised with the β-actin protein levels) are shown in

arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left

of each gel. This result is representative of three similar independent experiments.


170 | P a g e

4.3.3 Modified 3D culture method with reduced differentiation time

The following modified 3D culture method was used to differentiate neuronal cell

lines, and consequently develop a differentiation method with a reduced treatment

period.

METHOD 1: Cells grown on matrigel with RA (for 2weeks) Cells grown on

matrigel for 1 week with anti-mitotic agents, no RA.

METHOD 2: Suspension culture of cells with RA (for 2weeks) Cells grown on

matrigel for 1 week with anti-mitotic agents, no RA.

METHOD 3: Suspension culture of cells with RA (for 2weeks) Normal cell culture

flasks for 1 week with anti-mitotic agents, no RA.

Immunocytochemistry was performed to assess the neuronal marker protein levels

using antibodies specific for β-tubulin III, tau, DBH and MAP proteins. MAP2 and DBH

are classified as markers of later stages of differentiation, while β-tubulin III is

classified as a more early stage differentiation marker in neuronal cells (Gingras et

al., 2007). The cells used for these experiments were cultured using the three

different cell culture methods (detailed above) for three weeks in the presence of RA.

Cells were cultured in 10 μM RA for the first two weeks followed by one week of

treatment with mitotic inhibitors. Three different human cell lines, which include the

neuroblastoma M17 and SY5Y cells, and the teratocarcinoma NT2 cells, were cultured

using these three different culture methods. Therefore, there were 9 different

treatment regimens and with four neuronal markers, 36 samples per set in total.


171 | P a g e

4.3.3.1 Filter method

This was the most basic method out of the three methods tested. Cells were grown

on filters which were coated with matrigel as the culture media, and after three

weeks of treatment, filter pieces were cut out to be used in immunocytochemistry,

and the rest of the cells were used to perform Western blotting.

4.3.3.1.1 M17 cells

M17 cells, which were cultured on filters, produced a strong fluorescence signal for

all four neuronal markers (Figure 4.6.1-a, 4.6.2-a, 4.6.3-a & 4.6.4-a,). This was

consistent with the previous study done with M17 cells cultured on a basic 3D system

using RA. Red ethidium bromide labelling was used as the nuclear marker and green

Alexa 488 labelling corresponds to the neuronal marker primary antibody.

β-tubulin III protein expression was seen in M17 cells with very strong green

fluorescence labelling present in both the cytoplasm and nucleus (Figure 4.6.1-a).

This labelling was seen in almost all and was consistent across the three individual

experimental sets. Tau labelling was also very strong (Figure 4.6.2-a) in M17 cells

grown on filters with RA. Tau protein is predominantly found in the axons of neurons,

in the cytosol and in association with plasma membrane components. DBH also

produced strong cytoplasmic fluorescence labelling in differentiated M17 cells

(Figure 4.6.3-a). This is an indication of late stage differentiation of these particular


172 | P a g e

cells. Strong MAP2 labelling was present in M17 cells (Figure 4.6.4-a), indicating that

the cells have reached a later stage of differentiation. With the tested samples,

almost all the cells unanimously produced positive fluorescence labelling suggesting

universal expression of these specific neuronal marker proteins.

4.3.3.1.2 SY5Y cells

All four antibodies for neuronal markers produced strong fluorescence labelling in

SY5Y cells (Figure 4.6.1-b, 4.6.2-b, 4.6.3-b & 4.6.4-b,). Specific neuronal marker

signals are identified by green labelling, while the red labelling indicates nuclear

staining by ethidium bromide. DBH green labelling visible was more concentrated in

the cytoplasmic area, and with other antibodies they were detected more towards

the neurites. Differentiated SY5Y cells were more elongated compared to normal

undifferentiated cells. Tau and MAP2 labelling was especially distinctive in neurite

projections in RA treated cells. Both DBH and MAP2 labelling were once again very

strong in RA treated SY5Y cells, suggesting full differentiation of the cells. The

antibody staining of these cells were consistent indicating complete differentiation

of the systems as a whole. Results obtained were consistent among the replicates

demonstrating convincing differentiation of SY5Y cells under these conditions.


173 | P a g e

4.3.3.1.3 NT2 cells

Strong fluorescence labelling was visible with all four antibodies when NT2 cells were

treated with RA (Figure 4.6.1-c, 4.6.2-c, 4.6.3-c & 4.6.4-c,). Similar with other cells

discussed above, red fluorescence staining indicates ethidium bromide labelling of

the nucleus and green staining corresponds to the neuronal marker primary

antibody. In general, using the filter method, NT2 cells had a tendency to grow as

cluster-like formations, which made it difficult to identify individual cells.

Nevertheless, fluorescence labelling was present abundantly with all neuronal

marker antibodies. Published literature suggests that at least 5-6 weeks of RA

treatment of NT2 cells can achieve their complete differentiation (Jain et al., 2007).

However, the presence of DBH and MAP2 after just 3 weeks of RA treatment using

the new method employed in this study suggests otherwise. Following RA treatment,

neurite bearing cells were clearly visible, while non-neuronal cells had almost

disappeared, thus producing ubiquitous labelling of the cells with all four antibodies.


174 | P a g e

Figure 4.6: 3D Cell differentiation – filter method.

Immunocytochemistry analysis of cells cultures with 3D filter method and treated

with RA. Fluorescence signalling from neuronal markers β-tubulin III (1), Tau (2), DBH

(3) and MAP2 (4) were present in all the three cell lines, M17 (a), SY5Y (b) and NT2

(c). Red signalling was from nuclear ethidium bromide staining


175 | P a g e

4.3.3.2 Suspension filter method

Cells were grown in a suspension culture with RA for two weeks, then transferred

onto filters coated with matrigel and then cultured for another week with mitotic

inhibitors prior to use in immunocytochemistry.

4.3.3.2.1 M17 cells

Antibody specific labelling was detected with all four neuronal markers in RA treated

M17 cells (Figure 4.7). Green fluorescence signifies labelling by neuronal marker

antibodies and red labelling indicates nuclear staining by ethidium bromide.

M17 cells displayed a more cluster forming tendency with this method compared to

the filter only method used previously. However, clear neurite outgrowth was

present and the cells were more elongated under RA treatment compared to the

normal spindle shape (Figure 4.7).

Strong green labelling was visible with β-tubulin III antibodies suggesting expression

of this neuronal marker protein (Figure 4.7.1.a). This labelling was present in almost

90-95% cells grown on coverslips. The same expression pattern was seen with tau,

which also produced strong green fluorescence labelling (Figure 4.7.2.a). Since most

of the cells were in a cluster formation, a defined labelling pattern in terms of protein

localisation could not be identified.


176 | P a g e

Both MAP2 (Figure 4.7.3.a) and DBH (Figure 4.7.4.a) neuronal markers were present

in RA treated M17 cells as shown by green fluorescence labelling. Presence of these

two neuronal markers suggests cells have reached the final stages of differentiation.

The majority of M17 cells were positive for green fluorescence labelling.


SY5Y cells treated with RA demonstrated positive fluorescence labelling for the four

neuronal marker antibodies tested (Figure 4.7.1.b, Figure 4.7.2.b, Figure 4.7.3.b,

Figure 4.7.4.b). Signals from the neuronal specific marker are shown by green

fluorescence and red labelling indicates nuclear staining by ethidium bromide.

Neuronal projections from SY5Y cells can be clearly identified using antibodies

specific for β-tubulin III (Figure 4.7.1.b), tau (Figure 4.7.2.b) and MAP2 (Figure

4.7.3.b). However, more prominent elongations were seen with the later neuronal

marker. DBH (Figure 4.7.4.b) was more confined to the cytoplasmic area, which was

consistent with previous experiments. Once again, by the presence of fluorescence

labelling for DBH and MAP2, it can be concluded that the cells are at a more end stage

of differentiation. All cells on the slide were universally fluorescent labelled and this

was consistent among the individual experimental sets.


177 | P a g e

4.3.3.2.3 NT2 cells

All four neuronal marker antibodies produced strong fluorescence labelling in NT2

cells cultured using the suspension and filter method and treated with RA (Figure

4.7.1.c, Figure 4.7.2.c, Figure 4.7.3.c, Figure 4.7.4.c). As mentioned previously, red

labelling signifies nuclear labelling from ethidium bromide and green labelling

corresponds to the neuronal marker primary antibody. NT2 cells still exhibited a

cluster formation tendency, however the tendency was decreased compared to the

Filter method. Both end stage neuronal markers were also present, as highlighted by

green labelling indicating the cells are fully differentiated. Specific labelling

localisations or patterns were again hard to identify due to the cluster like formations

displayed by NT2 cells.


178 | P a g e

Figure 4.7: 3D Cell differentiation – Suspension filter method.

Immunocytochemistry analysis of cells cultures with suspension culture filter

method and treated with RA. Fluorescence signalling from neuronal markers β-

tubulin III (1), Tau (2), DBH (3) and MAP2 (4) were present in all the three cell lines,

M17 (a), SY5Y (b) and NT2 (c). Red signalling was from nuclear ethidium bromide

staining


179 | P a g e

4.3.3.3 Suspension flask method

Cells were grown in a suspension culture for two weeks in the presence of RA, then

transferred into cell culture flasks and cultured for another week with mitotic

inhibitors prior to use in immunocytochemistry.

4.3.3.3.1 M17 cells

When cultured using this method, M17 cells produced specific fluorescence labelling

for all four neuronal markers tested. Green fluorescence labelling corresponded to

specific neuronal marker antibodies and red labelling represented nuclear staining

from ethidium bromide. This method promoted cell growth in a monolayer enabling

easier detection by immunocytochemistry compared to the other two culture

methods.

The β-tubulin III antibody produced strong green labelling indicating a very high

expression level of the protein in M17 cells (Figure 4.8.1.a). This protein was

expressed by all of the cells present on the coverslip. A similar expression pattern

was seen with the tau antibody, which produced strong green fluorescence labelling

(Figure 4.8.2.a) in M17 cells. Cell elongation and the presence of neurites were

identified when M17 cells were cultured using this method. MAP2 (Figure 4.8.3.a)

and DBH (Figure 4.8.4.a) neuronal markers were also present in RA treated M17 cells,

which were identified by green fluorescence labelling. Positive labelling for MAP2


180 | P a g e

and DBH neuronal markers suggests these cells have reached the final stages of

differentiation.


Strong green fluorescence labelling detected in SY5Y cells demonstrated positive

expression of the four neuronal marker antibodies tested (Figure 4.8.1.b, Figure

4.8.2.b, Figure 4.8.3.b, Figure 4.8.4.b). Red labelling present in the images are nuclear

staining by ethidium bromide. As seen with M17 cells, the presence of fluorescence

labelling for both DBH and MAP2 suggests that the cells are in a later stage of

differentiation. Florescent-labelled cells comprised almost 100% of cells present on

the slide and this phenomenon was consistent across the individual experimental

sets.

4.3.3.3.3 NT2 cells

When cultured using the suspension and flask method in the presence of RA, NT2

cells indicated positive labelling for all four neuronal marker antibodies used (Figure

4.8.1.c, Figure 4.8.2.c, Figure 4.8.3.c, Figure 4.8.4.c). Even with this culture method,

NT2 cells displayed a cluster-forming tendency although this was almost negligible

when compared with the previous two methods. Neuronal projections and cell

elongations could be clearly identified as the morphological changes the cells have


181 | P a g e

undergone when cultured using this method. NT2 cells produced green fluorescence

labelling for both DBH and MAP2 end stage neuronal markers, indicating the cells

were fully differentiated.


182 | P a g e

Figure 4.8: 3D Cell differentiation – suspension flask method.

Immunocytochemistry analysis of cells cultures with suspension culture flask

method and treated with RA. Fluorescence signalling from neuronal markers β-

tubulin III (1), Tau (2), DBH (3) and MAP2 (4) were present in all the three cell lines,

M17 (a), SY5Y (b) and NT2 (c). Red signalling was from nuclear ethidium bromide

staining


183 | P a g e

4.3.4 Analysis of protein expression levels in RA treated cells using the modified 3D

culture systems

Cells cultured with RA using three different 3D culture systems were collected and

lysed to extract proteins. Extracted proteins were then analysed using Western

blotting. The same four antibodies (β-tubulin III, tau, DBH and MAP2) used in

immunocytochemistry were used in Western blotting to assess changes in protein

expression levels of neuronal markers.

A strong band of approximately 50 kDa was visible in all the lanes indicating the

presence of β-tubulin III protein (Figure 4.9.A). The intensity of the bands

corresponding to β-tubulin III was lower in the 1st, 5th and the 9th lanes where proteins

were from the untreated M17, SY5Y and NT2 cells, respectively. Furthermore,

Western blotting of M17 cell proteins showed the largest increase in band intensity

between control cells and RA treated lanes (Figure 4.9.A), followed by NT2 and SY5Y

cells. Protein loading was normalized using β-Actin levels (Figure 4.9.B), which

verified consistent loading across all lanes. Densitometric analysis was performed to

quantify protein levels and the results are presented as a graph (Figure 4.9.C).

Suspension culture followed by culture in filters showed the highest increase in the

levels of β-tubulin III protein in both M17 and NT2 cells. The increase in the levels of

this neuronal marker was relatively lower in SY5Y cells compared to the other two

cell lines. However, the increase in β-tubulin III protein levels in RA treated cells was

still significant when compared to untreated control SY5Y cells.


184 | P a g e

A band of approximately 80 kDa in size was visible when incubated with antibodies

specific for tau protein (Figure 4.10.A). Once again, the lanes corresponding to

untreated control cells displayed the weakest band relative to RA treated lanes. This

observation suggests that tau protein levels have increased following RA treatment.

The most significant increase in tau protein was displayed in SY5Y cells. Increase in

the tau levels following the RA treatment was consistent and verified the previous

observations made with M17 cells in the basic 3D culture system. Equal protein

loading across all lanes were evaluated using the housekeeper gene β-actin (Figure

4.10B), followed by quantification using densitometry analysis (Figure 4.10.C).

Similar to β-tubulin III expression levels, tau expression was highest with the

suspension filter method.

Western blots incubated with an antibody specific for DBH also produced a strong

band of approximately 70 -75 kDa in all lanes (Figure 4.11.A), revealing the presence

of this neuronal marker in all samples. The intensity of the band was lower in the 1st,

5th and 9th untreated samples compared to the RA treated protein samples. Increase

in the band intensity of this neuronal marker with RA treatment suggests the

acquisition of neuronal cell-like properties following RA treatment. Blots were re-

probed with β-actin to ensure equal protein loading across all lanes (Figure 4.11.B).

Subsequently, densitometric analysis was performed to quantify the changes

observed (Figure 4.11.C). All 3 cell lines showed a significant increase in DBH

expression in response to RA, and of these M17 cells exhibited the most prominent

change.


185 | P a g e

MAP2 expression was significantly increased in lysates of all RA treated cells

compared to untreated cells (Lanes 1, 8 and 15), which was demonstrated by a strong

band of approximately 70 kDa by Western blot analysis (Figure 4.12.A). Presence of

these strong bands suggests high expression of this neuronal specific marker in RA

treated samples compared to untreated cells. Protein loading was normalized using

β-actin (Figure 4.12.B) and densitometric analysis was done to quantify the findings

(Figure 4.12.C). SY5Y cells showed the largest increase in MAP2 expression. Both

NT2 and M17 cells showed similar levels of change in MAP2 levels following RA

treatment. All three cell lines showed the highest change in expression using the

suspension filter method when treated with RA.

This increase in MAP2 and DBH levels when treated with RA using these 3D culture

systems demonstrates that the cells have progressed to a later stage of neuronal

differentiation.


186 | P a g e

Figure 4.9: Changes in β-tubulin III protein expression levels in cells following 3D

culture differentiation.

Western blot analysis of β-tubulin III protein levels in cells cultures with novel 3D

culture methods and treated with RA. The housekeeping β-actin (B) protein levels of

cells were also analysed using Western blotting. Densitometric analysis (C) of β-

tubulin III protein levels (normalised with the β-actin protein levels) are shown in

arbitrary units (AU). Molecular mass protein markers (Mr) are indicated on the left of

each gel. Corresponding control cells (WT) were used to analyse the difference in the

expression levels (lanes 1, 5 & 9). This result is representative of three similar

independent experiments.


187 | P a g e

Figure 4.10: Changes in tau protein expression levels in cells following 3D culture

differentiation.

Western blot analysis of tau levels in cells cultures with novel 3D culture methods

and treated with RA. The housekeeping β-actin (B) protein levels of cells were also

analysed using Western blotting. Densitometric analysis (C) of tau protein levels

(normalised with the β-actin protein levels) are shown in arbitrary units (AU).

Molecular mass protein markers (Mr) are indicated on the left of each gel.

Corresponding control cells (WT) were used to analyse the difference in the




188 | P a g e

Figure 4.11: Changes in DBH protein expression levels in cells following 3D culture

differentiation.

Western blot analysis of DBH levels in cells cultures with novel 3D culture methods


analysed using Western blotting. Densitometric analysis (C) of DBH protein levels







189 | P a g e

Figure 4.12: Changes in MAP2 protein expression levels in cells following 3D

culture differentiation.

Western blot analysis of MAP2 levels in cells cultures with novel 3D culture methods


analysed using Western blotting. Densitometric analysis (C) of MAP2 protein levels







190 | P a g e

CHAPTER 4.4: Discussion

RA induced cellular differentiation is one of the most common and widely used

methods in differentiating cells, including neuronal cell lines. Currently, the

neuroscience field is lacking a successful and economical method to differentiate

neuronal cells into the primary neuronal stage. Many studies reported in the

literature with different cell lines have been unable to develop a successful,

economical and universal method to differentiate human neuronal cells. In this

study, we were able to compare and further develop the current methods used into

a more economical and efficient method. This study also obtained very conclusive

evidence to elucidate the importance of a 3D cell culture system in neuronal cell

differentiation.

4.4.1 M17 cells are resistant to retinoic acid in a conventional 2D cell culture system

When M17 cells were cultured using a conventional 2D system, they showed

resistance towards RA treatment. This was concluded by both immunocytochemistry

and Western blotting techniques. With both methods, M17 cells showed no

significant increase in neuronal marker levels (Figure 4.2 and Figure 4.3) following a

14-day RA treatment.


191 | P a g e

Green fluorescence labelling indicative of neuronal marker expression (Figure 4.2)

was very limited for all four tested neuronal marker antibodies (β-tubulin III, tau, DBH

& MAP2). Western blotting results also showed (Figure 4.3) no significant increase

when quantified using densitometric analysis. These findings are in agreement with

literature where it has been reported that following RA treatment, proliferation

rather than differentiation or apoptosis occurs (Draoui et al., 1997; Ramkumar and

Adler, 1999). Although RA resistance of M17 cells with the conventional 2D culture

method has been widely reported, the mechanism involved in RA resistance remains

to be investigated (Melino et al., 1996). Nevertheless, cell-cell interaction is well

known to be important in neuronal development. Cell-cell interaction is crucial

during neural development. Many aspects of neuronal development, including

migration of neural cells and the establishment of functional interactions between

axons and their target cells are highly dependent on cell-cell interactions (Cole et al.,

1986). Cellular interaction and the environment has also been directly linked with

neuronal cell differentiation and cellular morphogenesis (Letourneau et al., 1994).

Moreover, the ECM and neuronal cell interaction has also been linked to neuronal

cell migration, cell shape, cytoskeletal architecture and neurite growth (Damsky and

Werb, 1992; Strittmatter and Fishman, 1991). Both cell-cell interaction and cell-ECM

interaction are limited in a conventional 2D cell culture model. This may be the

underlying reason for the limited cellular differentiation observed with M17 cells in a

2D culture.


192 | P a g e


presence of RA in a 3D cell culture system

The conventional method of cell culture involves growing cells on a flat 2D substrate,

hence far different from the physiological environment of the in vivo state. Under

physiological conditions, cells acquire their natural 3D structure where it is supported

by a complex ECM, which facilitates the cells to function in their optimal condition.

However, the widely used 2D cell culture models does not allow for such support or

cell-cell interactions and contacts thus, failing to provide the sufficient physical and

chemical cues which underlie their characteristics and functions in vivo (Ben-Ze'ev,

1991). As a consequence, there has been widespread concern and discussion

regarding the validity and resemblance of the data obtained from 2D cell culture

models to a 3D culture model (Geckil et al., 2010).

As mentioned previously, M17 cells have been reported to be RA resistant in a normal

2D culture system. Thus, a novel method was developed in my PhD studies to culture

cells in a 3D matrix to promote RA-induced cell differentiation. A 3D culture system

was developed using cell culture filters and coating them with matrigel or the cheaper

alternative, egg white as the 3D cell adhesive media. Cells cultured on the 3D systems

were treated with either 10 μM RA as the experimental group or without RA as the

control group. After 14 days, cells were harvested and analysed for the expression

levels of neuronal markers using immunocytochemistry and Western blotting.


193 | P a g e

The dichotomy between a 2D and 3D cell culture system was clearly demonstrated

by the immunocytochemistry results alone. A dramatic increase was clearly evident

in all the neuronal marker protein levels (Figure 4.4), compared to the 2D culture

method (Figure 4.2). With 2D differentiation, neuronal marker labelling of M17 cells

was very limited and could not be seen in all the cells present. However, with the 3D

culture system, RA treated cells displayed strong and unanimous labelling of the

neuronal markers. Most importantly, despite the type of cell adhesive media used,

both matrigel and the cheaper alternative egg white produced strong labelling for the

tested neuronal markers. However, signals produced with egg white were slightly

weaker than with the matrigel system. After 14 days of RA treatment, the matrigel

matrix was holding marginally better than the egg white matrix. Considering the

prolonged time (3-4 weeks) of the next study, matrigel was selected as the preferred

matrix for further studies. However, after considering the results obtained during

the current study and given its cost effectiveness and readily availability, egg white

can be classified as a very cost effective alternative for matrigel.

The immunocytochemistry results were re-confirmed by Western blotting results

where there was a significant increase in neuronal marker protein levels in 3D

cultured cells when compared to that in control M17 cells (Figure 4.5). Only a minor

and almost negligible difference could be seen in the expression levels of the

neuronal marker proteins between matrigel and egg white matrixes.

This increase in neuronal marker levels observed in M17 cells was contradictory from

the results obtained with the 2D method and also with the reported literature where


194 | P a g e

conventional 2D culture method and RA was used on M17 cells (Draoui et al., 1997).

Though this observation is novel and not previously reported in the literature, similar

kind of differences in the expression levels have been reported in relation to 2D and

3D cell culture methods. Studies done with PMC4 cells have shown an increase in

milk-specific gene expression when treated with hormone in a 3D matrix system

compared to the flat 2D system (Ackland et al., 2001). Extensive studies done with

human endothelial cells have also shown the importance of a 3D cell culture system

over a 2D method. A study conducted by Davis and colleague have shown that when

cultured in a 3D system, human endothelial cells develop intracellular vacuoles that

coalesce to form capillary lumens and tubes (Davis and Camarillo, 1996). In another

study, Sacharidou and colleagues have shown the importance of a 3D culture over a

2D system where they reported a 3D culture specific endothelial lumen signalling

complexes involved in the formation of lumen and tube structures of endothelial cells

(Sacharidou et al., 2010). Culture of human skin cells have also shown marked

increase in their ability to withstand cytotoxic agents when cultured in a 3D method.

This study reported up to 50% increase in resistance and a difference in the way cells

respond to small molecules under a 3D culture method (Sun et al., 2006).

There are more compelling evidence highlighting the difference in the way cells react

and interact when grown in a 3D culture system rather than using the conventional

method. Thus, the observations made by the current study re-iterate the importance

of a 3D culture system over a conventional 2D system. Though many publications

have reported M17 cells as RA resistant and not differentiable, this study

demonstrates that under the correct conditions it can be induced to differentiate into


195 | P a g e

a more neuronal cell-like stage. Thus, the current study allows the usage of a cell

culture model that is more readily available for neuronal research.

4.4.3 Modified 3D culture methods

NT2 cells in general are considered to have a rather prolonged differentiation

process. Published literature reports that they can take between 42 and 54 days to

differentiate into post-mitotic neurons (Andrews, 1984). Another study has

suggested the use of suspension cultures to reduce the differentiation time of NT2

cells (Jain et al., 2007; Paquet-Durand and Bicker, 2007; Paquet-Durand et al., 2003).

One of the disadvantages of suspension cultures is their susceptibility for infections.

Suspension cultures need regular agitation to keep cells in suspension and

centrifuging to passage cells (Mustafa et al., 2011). The absence of an ECM and cell

interactions may be a limiting factor with this method in achieving terminal

differentiation with some cell types. Hence, the following modified 3D culture

methods were used to differentiate neuronal cell lines with a reduced treatment

period and a better 3D model of cellular matrix:

1. Cells grown on matrigel with RA (for 2weeks) Cells grown on matrigel for 1

week with anti-mitotic agents, no RA;

2. Suspension culture of cells with RA (for 2weeks) Cells grown on matrigel

for 1 week with anti-mitotic agents, no RA;

3. Suspension culture of cells with RA (for 2weeks) Normal cell culture flasks

for 1 week with anti-mitotic agents, no RA.


196 | P a g e

Immunocytochemistry and Western blotting were performed to assess neuronal

marker protein levels using antibodies for β-tubulin III, tau, DBH and MAP proteins

following the treatment periods. MAP2 and DBH are classified as markers of late

stage differentiation, while β-tubulin III is classified as an early stage marker of

neuronal cell differentiation (Gingras et al., 2007).

Immunocytochemistry analysis of the three cell lines displayed positive and specific

labelling with the four neuronal marker antibodies tested (Figure 4.6, 4.7 and 4.8) ,

and Western blotting confirmed the findings of immunocytochemistry analysis

(Figure 4.9, 4.10, 4.11 & 4.12). Western blotting and densitometry analysis confirmed

that the increase in neuronal marker protein levels were significant in all three cell

lines with all three different methods tested. In summary, cells grown in suspension

with RA followed by the filter method demonstrated the highest level of significance.

However, cells grown on the filter for the entire period also showed similar results to

the suspension filter method. Cells grown on suspension culture and transferred

onto cell culture flasks also showed an increase in neuronal marker protein levels.

However, compared to the other two methods the increase in expression of the

neuronal markers was considerably low. This observation suggests that the extra one

week of 3D culture can promote cellular differentiation even further. As discussed

above, this might be due to the cell-cell interaction and ECM-cell interaction, which

is more conceivable with the 3D matrix than with monolayer flasks.

The positive labelling, which was seen with both MAP2 and DBH neuronal markers,

signifies that the cells have reached the final stages of neuronal differentiation


197 | P a g e

(Dehmelt and Halpain, 2005; Gingras et al., 2007). Published literature reports the

necessity for longer RA treatment periods to achieve terminal differentiation

(Pleasure et al., 1992). However, one study that used a simple suspension method

to achieve neuronal differentiation has reported a shorter turnover period, although

the yield of post-mitotic neurons was considerably reduced with this method (Cheung

et al., 1999). Immunocytochemistry results obtained from our study failed to identify

any non-stained cells, suggesting that the majority of cells have reached the terminal

stages of differentiation. After 3 weeks of RA treatment, cells appeared healthy and

very little dead cells were present, confirming the suitability of these methods to

differentiate cells for further studies.

4.4.4 Conclusion

In conclusion, the findings of this study have successfully identified a novel method

to differentiate M17 cells in vitro, which has previously been reported as RA resistant.

In contrast to the conventional 2D culture method, a 3D cell culture model in

conjunction with RA has resulted in a significant overexpression of neuronal marker

levels in M17 cells, making this the most significant discovery of this study. This

finding also reiterates the importance of the cell culture media and culture

environment used in experiments. As a well-established and widely used cell line in

neuroscience research, the current findings allows M17 cells to be used in a wide

variety of studies and experiments. Their ability to terminally differentiate into a


198 | P a g e

more neuronal state means better access to cheaper and widely available culture

models in the future.

The modified 3D differentiation culture model, which was tested during this study,

enables a shorter, efficient and more economical approach to generate terminally

differentiated neurons. This novel method with a shorter period of RA treatment will

facilitate all studies involving primary neurons and will enable study and greater

understanding of the bio-mechanisms involved in cell differentiation and

pathophysiology.

In summary, the findings of the current study will be valuable in developing a cell

culture model, which can be used as an alternative to animal models in neuroscience

research and drug screening studies.

Chapter 5: General Discussion

199 | P a g e

CHAPTER 5: General Discussion

A diet high in PUFAs, mainly omega-3 FAs, have been reported to reduce the risk of

some common cancers, notably those of breast, colon, and perhaps, prostate cancer

(Berquin et al., 2007; Brasky et al., 2010; Hall et al., 2008; Wolk et al., 2006). It has

also been reported that omega-3 FAs can inhibit the growth of tumours in animal

models (Kato et al., 2007; Zhang et al., 2013), and increase the rate of apoptosis in

cancer cells (Abdi et al., 2014; Serini et al., 2008). Epidemiological and pre-clinical

studies have shown that a diet rich in omega-3 FAs, such as DHA, inhibits colon

tumours by modulating signalling pathways that alter gene expression related to

tumour growth and inducing apoptosis (Chapkin et al., 2008; Reddy, 2002; Skender

et al., 2014). Anti-inflammatory properties have also been observed in diets rich in

omega-3 acids. In vitro studies have revealed an ability of omega-3 FAs to promote

apoptotic death of pro-inflammatory T helper cell-1 lymphocytes through

incorporating into the cell membrane (Switzer et al., 2004). Thus, many protective

effects of omega-3 FAs have been reported over the years. The importance of DHA

in neuronal cells has also been reported widely. One of the most important findings

to support the effect of DHA in neuronal cells is the binding affinity DHA has to these

cells. DHA has the highest reported fatty acid-binding protein/ligand interaction ratio

in human neuronal cells. The binding affinity of DHA has a Kd value of approximately

10 nM, which is even greater than the RA affinity towards its binding proteins (Xu et

al., 1996).


200 | P a g e

Similarly, zinc is considered to be one of the most important trace elements for

cellular and biochemical functions (Bitanihirwe and Cunningham, 2009; Takeda,

2000). However, excessive amounts of zinc is considered to be cytotoxic (Szewczyk,

2013). Many neurodegenerative conditions such as AD has been linked to excessive

amounts of free zinc (Watt et al., 2010). Thus, the homeostasis of zinc is very

important at the cellular level. Two main groups of proteins are involved in

maintaining the zinc balance at the cellular level. The ZnT family that mediates zinc

efflux from cells to ECM or into cellular compartments or organelles (Cousins and

McMahon, 2000), and the Zip family that transport zinc from the ECM or from

intracellular vesicles into the cytosol (Cousins et al., 2006).

The main focus of the current PhD project was to evaluate the effect of DHA on

neuronal cell survival and zinc homeostasis. In summary, the current study was able

to demonstrate a link between DHA and free zinc availability, and also link DHA with

zinc transporter expression levels. Importantly, the current study was able to confirm

the link between DHA and apoptosis, which has been discussed above.


201 | P a g e

5.1 DHA effect on neuronal cell survival and zinc homeostasis

5.1.1 DHA effect on apoptosis levels

To establish the role of DHA as a neuro-protector, apoptosis marker levels were

tested in DHA-treated neuronal cells using Western blotting (Figure 1.14 & Figure

1.15). When treated with 20 μg/ml DHA for 48 hours, M17 cells demonstrated a

marked reduction in caspase-3 protein levels compared to untreated cells (Figure

1.14). Densitometry analysis revealed a significant decrease in caspase-3 protein

levels (66%) with the DHA treatment, when compared with untreated cells. In

contrast, Bcl2 levels were upregulated following DHA treatment (Figure 1.15). Bcl2

is known to promote cell survival by inhibiting apoptotic death and by regulating

programmed cell death (Miyashita et al., 1994; Oltvai et al., 1993; Reed, 1994).

Caspase-3 on the other hand is a well-known end stage marker of apoptosis (Gown

and Willingham, 2002; Jeruc et al., 2006). Therefore, the findings of this study

corroborate published literature, where DHA has been reported as a regulator for

apoptosis.

5.1.2 DHA and zinc transporter levels

When tested for zinc transporter expression levels following the DHA treatment,

ZnT3 expression exhibited a significant downregulation at both the mRNA (Figure 2.6)

and protein levels in M17 and NT2 cells (Figure 2.16 & Figure 2.19). ZnT3 is prominent


202 | P a g e

in the human brain and testis, and within the brain it’s more pronounced in the

hippocampus and cerebral cortex (Palmiter et al., 1996). Zinc accumulation in

synaptic vesicles are known to be facilitated by the ZnT3 transporter (Palmiter et al.,

1996), highlighting the importance of the ZnT3 transporter in neuronal cells. In the

current study, we demonstrated a significant downregulation of ZnT3 mRNA levels

when grown in DHA enriched culture medium compared to the control cells (Figure

2.6). These findings suggest a possible DHA dependent regulation of cellular zinc

levels in these tested human cells. To test this theory further, cellular levels of “free

zinc” availability was tested using zinc fluorophores and these results are reported in

Chapter 3 of this thesis.

5.1.3 DHA and free zinc availability

M17 and NT2 cells were grown in a culture medium enriched with DHA (20 μg/mL)

prior to exposure to Zinpyr-1 for a period of 30 minutes. DHA treated cells showed a

marked reduction in fluorescence labelling compared to untreated cells at the 48

hour timepoint (Figure 3.3, Figure 3.4, Figure 3.7 & Figure 8). At the 0, 4, 8, 16 & 24

hour timepoints there were no significant changes observed in fluorescence labelling

patterns, apart from a minor decrease in the intensity at later timepoints. Results

observed were tested for DHA specificity using LA, where no differences were visible

in fluorescence signalling (Figure 3.2 & (Figure 3.6). Similarly, DHA specific cellular

responses have been reported with many different cell types. When treated with

metabolites derived from omega-6 arachidonic acid (epoxyeicosatrienoic acid)


203 | P a g e

angiogenesis and tumour progression was increased in mice. In contrast, when

treated with DHA, more than 70% reduction in primary tumour growth and

metastasis was observed (Zhang et al., 2013). In a study performed with using U937

cells, DHA induced a rapid increase in Ca2+, suggesting an ability of DHA to mobilise

Ca2+ from intracellular pools. However, when tested with other structural analogues

of DHA, this same effect was not visible (Aires et al., 2007). Many other studies also

have shown similar DHA-specific effects on cellular apoptosis in cancer cells. (Iigo et

al., 1997; Merendino et al., 2003; Rahman et al., 2013; Suzuki et al., 1997).

The ability of DHA to regulate apoptosis was also established in the present serum

starved study conducted using M17 and NT2 cells. DHA alone was sufficient to rescue

cells, which were serum starved for 48 hours (Figure 3.5 & Figure 3.9). As discussed

above, both pro and anti-apoptotic effects of DHA have been reported in literature.

The combination of results obtained in both Chapters 2 and 3 suggest possible DHA

regulation of apoptosis. Results obtained in Chapter 3 also reveal a significant

decrease in cellular free zinc levels with DHA treatment. Elevated levels of free zinc

have been linked to both necrotic and apoptotic death in neuronal cells (Choi et al.,

1988; Chuah et al., 1995; Cuajungco and Lees, 1997b; Duncan et al., 1992; Yokoyama

et al., 1986). Taken together, these results indicate a potential link between DHA,

free zinc availability and apoptosis.

Following analysis of the results, we propose that the apoptotic regulatory effects of

DHA are mediated through control of cellular zinc homeostasis. In neuronal cells, this

mechanism may contribute to the positive effects of DHA as a neuro-protector by


204 | P a g e

reducing neuronal cell death and neurodegenerative diseases such as AD (Figure 5.1),

whose incidence is reduced in populations with a high omega-3 FA diet.

5.2 Cellular differentiation

Scientific research into cellular, molecular and pharmaceutical aspects is in desperate

need of improved in vitro models to aid the identification and assessment of many

biological functions and reactions. The widely used traditional cell culture models

involve growing cells on a 2D substrate. Though this practice is common, easy and

economical than any complex cell culture model, there are certain flaws attached to

this system. With the 2D method, cells adapt to a synthetic 2D environment, thus

changing the characteristics of normal cells and becoming flattened. Cell-cell

interaction becomes hindered and ultimately cells fail to express and perform at the

peak level. Therefore, the demand for a more efficient and economical 3D cell culture

model has grown over the years. A 3D culture model will allow cells to grow in an

environment which is closer to the native physiological conditions. In a 3D cell

culture, cells are able to acquire a natural 3D phenotype, thus favouring improved

cell proliferation, differentiation and function. In the current study, we succeeded in

overcoming M17 cell resistance to RA by using a 3D model, thus enabling cells to

acquire a more neuronal phenotype.

In the second part of the study, we also managed to develop a shorter and more

efficient 3D culture model to use with cellular differentiation.


205 | P a g e

Figure 5.1: Schematic diagram of the proposed apoptotic regulatory effect of DHA.

Following the analysis of the key findings of this study, we propose that the apoptotic

regulatory effects of DHA are mediated through control of cellular zinc homeostasis.

In turn this mechanism may contribute to the positive effects of DHA as a neuro-

protector by reducing neuronal cell death and neurodegenerative diseases such as

AD. The key findings of this study are represented by the solid (black) arrows. Empty

(white) arrows represent possible benefits of DHA in neuroprotection (NP) and

therefore contributing to lower incidence of neurodegenerative diseases (ND), such

as Alzheimer’s disease (AD).


206 | P a g e

5.2.1 Differentiating M17 cells

M17 cells are a subclone of the parental cell line SK-N-BE(2). The parental cell line

was originally isolated in 1972 from the bone marrow of a two year old Caucasian

male suffering from disseminated neuroblastoma (Ciccarone et al., 1989). M17 cells

have been long reported as a RA resistant cell line, thus been deemed not suitable

for differentiation (Carvalho et al., 1993; Draoui et al., 1997; Melino et al., 1993).

During the current study we managed to differentiate M17 cells to acquire mature

neuronal cell properties by using a 3D culture model instead of the traditional 2D

monolayer model.

Immunocytochemistry performed on M17 cells which were grown on 3D culture and

treated with RA, showed a clear increase in all neuronal marker protein levels (Figure

4.3) compared with M17 cells grown on 2D culture flasks (Figure 4.2). In M17 cells

grown on 2D flasks, neuronal marker labelling was very limited and not ubiquitous

among all the cells present. However, RA treated cells grown under a 3D culture

system displayed strong and universal labelling of the neuronal markers.

This study yet again establishes the importance of a 3D culture model over the

conventional 2D model. Due to its versatility and availability, M17 cells have become

a widely used cell culture model. However, many attempts to differentiate M17 cells

have failed in the past. As discussed above, 3D differentiated cells allow a closer

resemblance to the structure and function of their in situ counterparts. Having a

greater resemblance to the actual physiological conditions allows researchers to


207 | P a g e

carry out more accurate in vitro investigations of complex biological processes.

Studies have shown a clear difference in cell-cell interactions, drug delivery methods

and cellular responses in neuroblastoma cells and primary neuronal cells (Haghighat

et al., 2000; LePage et al., 2005; Storch et al., 2000). Therefore, the current M17 cell

differentiation protocol we have developed has the potential to provide substantial

benefits for further neuroscience studies.

5.2.2 Novel differentiation method

One of the disadvantages of the current differentiation methods are the lengthy

periods of RA treatment. As an example, NT2 cells take between 42 and 54 days to

differentiate into post-mitotic neurons (Andrews, 1984). Shorter RA treatment

periods have resulted in a reduced yield of post-mitotic neurons (Cheung et al., 1999).

During this study, we were able to develop a novel differentiation method with a

reduced RA treatment time, without compromising the yield or the quality of cells.

Cells grown in suspension culture followed by the filter method showed the highest

increase in neuronal marker levels compared to the other two methods tested. This

novel combination of suspension culture and filter enables cells to have a better cell-

cell and cell-matrix interaction than the suspension culture alone. Moreover, this

method cuts down the differentiation period in half to just 21 days, making the entire

differentiation process more economical and efficient. The simplicity of the method

and the quick turnaround period allows this method to be used easily and routinely

in laboratory experiments.


208 | P a g e

A readily available method of producing human neurons in the lab has many

advantages. Due to the lack of availability and ethical complications linked with

primary human neuronal cells, many scientists rely on using animal models or other

substitutions for neuronal studies. Thus, the current model provides an easy and

cheaper alternative for obtaining pure post mitotic neuronal cells. Ultimately, a

similar method of producing human neuronal cells can be used in gene therapy,

neurogenesis and neural transplantation. This will greatly facilitate in combating the

increasing incidence of neurodegenerative cases and treating other brain related

injuries (Paquet-Durand and Bicker, 2007; Trojanowski et al., 1997).

5.3 Limitations of the present study

One of the main aims of this study was to identify any possible link between DHA and

zinc homeostasis. Human cells treated with different doses of DHA in the presence

or absence of zinc displayed several important patterns in the expression levels of

zinc transporters and the availability of free zinc. The ZnT3 transporter exhibited the

most significant change in expression following DHA treatment. Labile zinc levels

were also significantly altered following DHA treatment. Moreover, the apoptosis

marker caspase-2, was downregulated in M17 and NT2 cells following DHA

treatment.


209 | P a g e

The cells used in Chapters 2 and 3 of the current study were not differentiated cells,

thus were not a true and accurate representation of primary neuronal cells.

Therefore, more work needs to be carried out before proposing an overall model for

ZnT or ZIP transporter expression. It will be interesting to ascertain the outcome if

the experiments were conducted using differentiated cells. However, studies have

shown that both undifferentiated M17 and SY5Y cell lines express neuronal markers

to a certain extent (Ciccarone et al., 1989). In general, SY5Y cells are more

predisposed to environmental parameter induced variations in gene expression, and

are influenced by factors such as the health of the culture media, nutrient

composition and the growth substrates utilized (Buttiglione et al., 2007). A study

conducted using SY5Y cells and different types of growth media and substrates

suggests that the expression of neuronal differentiation markers can be reduced by

the use of FBS on carboxylic group containing surfaces (Buttiglione et al., 2007).

Therefore, fewer neuronal characteristics exhibited by SY5Y cells in some cases can

be attributed to this reason.

5.4 Future directions

To ascertain a better understanding of the effect of DHA on neuronal survival and

zinc homeostasis under natural physiological conditions, it will be beneficial to repeat

the Chapter 2 & 3 studies with differentiated cells using the methods proposed in

Chapter 4. As discussed extensively, differentiated cells can mimic actual


210 | P a g e

physiological conditions better than undifferentiated cells. Thus, their cellular

responses will be more accurate and similar to in situ conditions. Though the cells

used in Chapters 2 and 3 have many neuronal properties, as reported extensively in

literature, they are very different to primary neuronal cells. Therefore, it will be

interesting to find out whether differentiated cells possessing more neuronal

properties will respond likewise when treated with DHA. A study conducted in mice

have reported similar results to that obtained in this study (Jayasooriya et al., 2005b;

Kitajka et al., 2004). If differentiated cells respond to DHA in the same way, this will

provide conclusive evidence to establish the effect of DHA on neuronal survival and

zinc homeostasis.

It will also be beneficial to study the importance of the ZnT3 transporter in neuronal

cells. One of the most resourceful and widely used techniques to study its

importance will be to manipulate the gene expression of ZnT3 at the cellular level.

Overexpression and most importantly silencing of the ZnT3 gene will provide greater

knowledge of the importance of this transporter in neuronal cells. To study gene

manipulation effects, cell lines with silenced or overexpressed ZnT3 will need to be

established, and subsequently analysed for transporter expression levels using QPCR.

Zinc fluorophore studies can assist in the understanding of zinc trafficking in the

silenced and overexpressed cell lines. The effects of both silencing and

overexpression on cell survival must be investigated by analysis of caspase-3 and Bcl2

levels. It will also be interesting to determine whether there is a direct link between

DHA, APP and β-amyloid levels. Both APP and β-amyloid are hallmark proteins in AD

pathophysiology. DHA treated-differentiated neuronal cells can be tested using


211 | P a g e

Western blotting or QPCR techniques to determine if there are any changes to APP

and β-amyloid expression levels. Collectively, these additional studies will benefit in

understanding the importance of these zinc transporters to human cells even further.

5.5 Significance of the current findings

As discussed extensively throughout this thesis, neurodegenerative disorders

including AD are considered a huge health threat and a burden to individuals, and to

the world as a whole. With the rapid increase in rate and no effective cure,

neuroscience research has become a national priority for many countries.

The current study provides a few significant contributions towards the advancement

of neuroscience research, to ultimately find a cure for many neurodegenerative

conditions. There is a significant amount of data that has been reported linking excess

amounts of free zinc to AD. Moreover, many other studies have reported

neuroprotective effects of DHA, especially in relation to AD. However, the exact

mechanism of DHA or zinc involvement in such conditions was not clear until now.

During this study, we successfully elucidated a link between free zinc availability, DHA

levels and apoptosis, thus we are able to suggest a pathway of neuroprotection

following DHA treatment at the cellular level. Understanding the ability of DHA to

regulate apoptosis via altering zinc homeostasis provides a possible platform and a

mechanism for further studies in both cellular and animal models.


212 | P a g e

The other major contribution of this study was to develop a better cell culture model

for neuronal differentiation. Due to the practical difficulties in obtaining primary

neuronal cells for experiments, much research is done with alternatives such as

neuroblastoma cells or animal models. Though, both alternatives share similarities

at the structural and functional level with primary neurons, there are many major

dissimilarities as well. Thus, the validity of the observations seen with alternative

models are somewhat questionable. Therefore, the current PhD project provides an

economical, effective and simple method of differentiating neuronally committed

cells into primary neuronal cells. This method allows quick and easy access to

terminally differentiated neuronal cells for neuroscience research. Therefore,

increasing the productivity and specificity of the research conducted. More

importantly, by further improvement of this method, it can ultimately be used as a

method for producing human neuronal cells, which in turn can be used in gene

therapy, neurogenesis and neural transplantation. This will greatly facilitate

combating the increasing incidence of neurodegenerative cases and treating other

brain related injuries.


213 | P a g e

5.6 Conclusion

In conclusion, the experimental findings of this thesis provide novel information

about DHA involvement in zinc uptake and apoptosis in human cells. Following a

comprehensive analysis of the molecular events in DHA treated M17 and NT2 cell

lines, we conclude that zinc uptake was significantly lowered and ZnT3 mRNA and

protein levels were downregulated in comparison to DHA-depleted cells. Moreover,

the end apoptosis marker caspase-3 displayed a marked reduction in protein levels

when compared with untreated cells. Furthermore, anti- apoptotic Bcl-2 protein

levels were increased following the DHA treatment in both M17 and NT2 cells. In

combination, these observations infer a link between DHA and free zinc availability,

which ultimately can regulate programmed cell death in neuronal cells. However,

with both SY5Y cells and the human keratinocyte cell line HaCaT we did not observe

this same response to DHA, highlighting the neuronal specificity of the findings made

during this study.

The outcomes presented in this thesis re-establish the importance of 3D cell culture

models. M17 cells which were previously reported as RA resistant, when cultured on

3D models responded to RA and expressed neuronal markers. The current study also

presents a novel method with shorter treatment periods for cellular differentiation.

This unique method combining suspension culture and 3D culture facilitate terminal

cellular differentiation of both M17 and NT2 cells to neuronal cells within 21 days,

which is almost half the time of most widely used methods. This novel method


214 | P a g e

provides an efficient, economical and simple method for cellular differentiation in

neuroscience research.

Chapter 6: Bibliography

215 | P a g e

CHAPTER 6: Bibliography

Abbott, A. (2003). Cell culture: biology's new dimension. Nature 424, 870-872.

Abdi, J., Garssen, J., Faber, J., and Redegeld, F.A. (2014). Omega-3 fatty acids, EPA

and DHA induce apoptosis and enhance drug sensitivity in multiple myeloma

cells but not in normal peripheral mononuclear cells. The Journal of nutritional

biochemistry 25, 1254-1262.

Ackland, M.L., and Michalczyk, A. (2006). Zinc deficiency and its inherited disorders -

a review. Genes Nutr 1, 41-49.

Ackland, M.L., Michalczyk, A., and Whitehead, R.H. (2001). PMC42, a novel model

for the differentiated human breast. Exp Cell Res 263, 14-22.

Aggett, P.J. (1983). Acrodermatitis enteropathica. J Inherit Metab Dis 6 Suppl 1, 39-

43.

Agholme, L., Lindstrom, T., Kagedal, K., Marcusson, J., and Hallbeck, M. (2010). An in

vitro model for neuroscience: differentiation of SH-SY5Y cells into cells with

morphological and biochemical characteristics of mature neurons. J Alzheimers

Dis 20, 1069-1082.

Aires, V., Hichami, A., Filomenko, R., Ple, A., Rebe, C., Bettaieb, A., and Khan, N.A.

(2007). Docosahexaenoic acid induces increases in [Ca2+]i via inositol 1,4,5-

triphosphate production and activates protein kinase C gamma and -delta via


216 | P a g e

phosphatidylserine binding site: implication in apoptosis in U937 cells. Mol

Pharmacol 72, 1545-1556.

Akaike, N., Kostyuk, P.G., Osipchuk, Y.V. (1989). Dihydropyridine-Sensitive Low-

Threshold Calcium Channels in Isolated Rat Hypothalamic Neurons. Journal of

Physiology-London 412, 181-195.

Akbar, M., Calderon, F., Wen, Z., and Kim, H.-Y. (2005a). Docosahexaenoic acid: A

positive modulator of Akt signaling in neuronal survival

10.1073/pnas.0502903102. PNAS 102, 10858-10863.

Akbar, M., Calderon, F., Wen, Z., and Kim, H.Y. (2005b). Docosahexaenoic acid: a

positive modulator of Akt signaling in neuronal survival. Proc Natl Acad Sci U S A

102, 10858-10863.

Akbar, M., and Kim, H.Y. (2002). Protective effects of docosahexaenoic acid in

staurosporine-induced apoptosis: involvement of phosphatidylinositol-3 kinase

pathway. J Neurochem 82, 655-665.

Allen, R.C., Popat, R., Diggle, S.P., and Brown, S.P. (2014). Targeting virulence: can

we make evolution-proof drugs? Nature reviews Microbiology 12, 300-308.

Andrews, G.K., Wang, H., Dey, S.K., and Palmiter, R.D. (2004). Mouse zinc

transporter 1 gene provides an essential function during early embryonic

development. Genesis 40, 74-81.


217 | P a g e

Andrews, P.W. (1984). Retinoic acid induces neuronal differentiation of a cloned

human embryonal carcinoma cell line in vitro. Developmental biology 103, 285-

293.

Atwood, C.S.e.a. (1998). Dramatic aggregation of Alzheimer Ab by Cu(II) is induced

by conditions representing physiological acidosis. Journal of Biological Chemistry

273, 12817–12826.

Beckwith, J.B., and Perrin, E.V. (1963). In Situ Neuroblastomas: A Contribution to

the Natural History of Neural Crest Tumors. The American journal of pathology

43, 1089-1104.

Ben-Ze'ev, A. (1991). Animal cell shape changes and gene expression. BioEssays :

news and reviews in molecular, cellular and developmental biology 13, 207-212.

Benolken, R.M., Anderson, R.E., and Wheeler, T.G. (1973). Membrane Fatty Acids

Associated with the Electrical Response in Visual Excitation. Science 182, 1253-

1254.

Berg, J.M., and Shi, Y. (1996). The galvanization of biology: a growing appreciation

for the roles of zinc. Science 271, 1081-1085.

Berquin, I.M., Min, Y., Wu, R., Wu, J., Perry, D., Cline, J.M., Thomas, M.J., Thornburg,

T., Kulik, G., Smith, A., et al. (2007). Modulation of prostate cancer genetic risk by

omega-3 and omega-6 fatty acids. The Journal of clinical investigation 117, 1866-

1875.


218 | P a g e

Biedler, J.L., Roffler-Tarlov, S., Schachner, M., and Freedman, L.S. (1978). Multiple

neurotransmitter synthesis by human neuroblastoma cell lines and clones.

Cancer Res 38, 3751-3757.

Bitanihirwe, B.K., and Cunningham, M.G. (2009). Zinc: the brain's dark horse.

Synapse (New York, NY) 63, 1029-1049.

Bourre, J.M. (2004). Roles of unsaturated fatty acids (especially omega-3 fatty acids)

in the brain at various ages and during ageing. The Journal of Nutrition, Health &

Aging 8.

Bousquet, M., Calon, F., and Cicchetti, F. (2011). Impact of omega-3 fatty acids in

Parkinson's disease. Ageing research reviews 10, 453-463.

Bousquet, M., Saint-Pierre, M., Julien, C., Salem, N., Jr., Cicchetti, F., and Calon, F.

(2008). Beneficial effects of dietary omega-3 polyunsaturated fatty acid on toxin-

induced neuronal degeneration in an animal model of Parkinson's disease. FASEB

journal : official publication of the Federation of American Societies for

Experimental Biology 22, 1213-1225.

Brasky, T.M., Lampe, J.W., Potter, J.D., Patterson, R.E., and White, E. (2010).

Specialty supplements and breast cancer risk in the VITamins And Lifestyle

(VITAL) Cohort. Cancer epidemiology, biomarkers & prevention : a publication of

the American Association for Cancer Research, cosponsored by the American

Society of Preventive Oncology 19, 1696-1708.


219 | P a g e

Bubner, B., Gase, K., and Baldwin, I.T. (2004). Two-fold differences are the detection

limit for determining transgene copy numbers in plants by real-time PCR. BMC

Biotechnol 4, 14.

Burr, G.O., and Burr, M.M. (1930). ON THE NATURE AND RÔLE OF THE FATTY ACIDS

ESSENTIAL IN NUTRITION. Journal of Biological Chemistry 86, 587-621.

Bush, A.I. (2003). The metallobiology of Alzheimer's disease. Trends Neurosci 26,

207-214.

Bush, A.I., Multhaup, G., Moir, R.D., Williamson, T.G., Small, D.H., Rumble, B.,

Pollwein, P., Beyreuther, K., and Masters, C.L. (1993). A novel zinc(II) binding site

modulates the function of the beta A4 amyloid protein precursor of Alzheimer's

disease. J Biol Chem 268, 16109-16112.

Bush, A.I., Pettingell, W.H., Jr., de Paradis, M., Tanzi, R.E., and Wasco, W. (1994a).

The amyloid beta-protein precursor and its mammalian homologues. Evidence

for a zinc-modulated heparin-binding superfamily. J Biol Chem 269, 26618-

26621.

Bush, A.I., Pettingell, W.H., Multhaup, G., d Paradis, M., Vonsattel, J.P., Gusella, J.F.,

Beyreuther, K., Masters, C.L., and Tanzi, R.E. (1994b). Rapid induction of

Alzheimer A beta amyloid formation by zinc. Science 265, 1464-1467.

Bush, A.I., Pettingell, W.H Jr, de Paradis, M, Tanzi, RE., Wasco, W. (1994a). The

amyloid beta-protein precursor and its mammalian homologues. Evidence for a

zinc-modulated heparin-binding superfamily. J Biol Chem 269, 26618-26621.


220 | P a g e

Bush, A.I., Pettingell, W.H. Jr, Paradis, M.D, Tanzi, R.E. (1994b). Modulation of Ab

adhesiveness and secretase site cleavage by zinc. The Journal of Biological

Chemistry 269, 12152–12158.

Buttiglione, M., Vitiello, F., Sardella, E., Petrone, L., Nardulli, M., Favia, P.,

d'Agostino, R., and Gristina, R. (2007). Behaviour of SH-SY5Y neuroblastoma cell

line grown in different media and on different chemically modified substrates.

Biomaterials 28, 2932-2945.

Cai, Y.D., and Chou, K.C. (2005). Predicting enzyme subclass by functional domain

composition and pseudo amino acid composition. Journal of proteome research

4, 967-971.

Calon, F., and Cole, G. (2007). Neuroprotective action of omega-3 polyunsaturated

fatty acids against neurodegenerative diseases: evidence from animal studies.

Prostaglandins, leukotrienes, and essential fatty acids 77, 287-293.

Carvalho, K.M., De Laurenzi, V., Melino, G., and Cohen, P. (1993). Modulation of a

novel thermolysin-like metallo-endopeptidase activity during retinoic acid-

induced differentiation of human neuroectodermal tumor cell lines. Biochemical

and biophysical research communications 191, 172-179.

Chai, F., Truong-Tran, A.Q., Ho, L.H., and Zalewski, P.D. (1999). Regulation of

caspase activation and apoptosis by cellular zinc fluxes and zinc deprivation: A

review. Immunol Cell Biol 77, 272-278.


221 | P a g e

Chapkin, R.S., Seo, J., McMurray, D.N., and Lupton, J.R. (2008). Mechanisms by

which docosahexaenoic acid and related fatty acids reduce colon cancer risk and

inflammatory disorders of the intestine. Chemistry and physics of lipids 153, 14-

23.

Cherny R. A., M.C.L., Beyreuther K., Fairlie D., Tanzi R. E., Bush A. I. (1997). The

aggregation of Aß in human brain is mediated by zinc. . Society for Neuroscience

23, 534.

Cherny, R.A., Atwood, C.S., Xilinas, M.E., Gray, D.N., Jones, W.D., McLean, C.A.,

Barnham, K.J., Volitakis, I., Fraser, F.W., Kim, Y., et al. (2001). Treatment with a

copper-zinc chelator markedly and rapidly inhibits beta-amyloid accumulation in

Alzheimer's disease transgenic mice. Neuron 30, 665-676.

Cheung, W.M., Fu, W.Y., Hui, W.S., and Ip, N.Y. (1999). Production of human CNS

neurons from embryonal carcinoma cells using a cell aggregation method.

BioTechniques 26, 946-948, 950-942, 954.

Choi, D.W., Yokoyama, M., and Koh, J. (1988). Zinc neurotoxicity in cortical cell

culture. Neuroscience 24, 67-79.

Chowanadisai, W., Lonnerdal, B., and Kelleher, S.L. (2006). Identification of a

mutation in SLC30A2 (ZnT-2) in women with low milk zinc concentration that

results in transient neonatal zinc deficiency. J Biol Chem 281, 39699-39707.

Christy, A.A., Egeberg, P.K., and Østensen, E.T. (2003). Simultaneous quantitative

determination of isolated trans fatty acids and conjugated linoleic acids in oils


222 | P a g e

and fats by chemometric analysis of the infrared profiles. Vibrational

Spectroscopy 33, 37-48.

Chuah, M.I., Tennent, R., and Jacobs, I. (1995). Response of olfactory Schwann cells

to intranasal zinc sulfate irrigation. J Neurosci Res 42, 470-478.

Ciccarone, V., Spengler, B.A., Meyers, M.B., Biedler, J.L., and Ross, R.A. (1989).

Phenotypic diversification in human neuroblastoma cells: expression of distinct

neural crest lineages. Cancer Res 49, 219-225.

Cole, G.J., Loewy, A., and Glaser, L. (1986). Neuronal cell-cell adhesion depends on

interactions of N-CAM with heparin-like molecules. Nature 320, 445-447.

Cole, G.M., Lim, G.P., Yang, F., Teter, B., Begum, A., Ma, Q., Harris-White, M.E., and

Frautschy, S.A. (2005). Prevention of Alzheimer's disease: Omega-3 fatty acid and

phenolic anti-oxidant interventions. Neurobiol Aging 26 Suppl 1, 133-136.

Connor, W.E. (2000). Importance of n-3 fatty acids in health and disease1. Am J Clin

Nutr 71, 171S-175.

Connor, W.E., and Connor, S.L. (2007). The importance of fish and docosahexaenoic

acid in Alzheimer disease. Am J Clin Nutr 85, 929-930.

Connor, W.E., Neuringer, M., and Lin, D.S. (1990). Dietary effects on brain fatty acid

composition: the reversibility of n-3 fatty acid deficiency and turnover of

docosahexaenoic acid in the brain, erythrocytes, and plasma of rhesus monkeys.

Journal of lipid research 31, 237-247.


223 | P a g e

Connor, W.E., Neuringer, M., and Reisbick, S. (1992). Essential fatty acids: the

importance of n-3 fatty acids in the retina and brain. Nutr Rev 50, 21-29.

Conquer, J.A., Tierney, M.C., Zecevic, J., Bettger, W.J., and Fisher, R.H. (2000). Fatty

acid analysis of blood plasma of patients with Alzheimer's disease, other types of

dementia, and cognitive impairment. Lipids 35, 1305-1312.

Cory, S., Huang, D.C., and Adams, J.M. (2003). The Bcl-2 family: roles in cell survival

and oncogenesis. Oncogene 22, 8590-8607.

Cousins, R.J., Liuzzi, J.P., and Lichten, L.A. (2006). Mammalian zinc transport,

trafficking, and signals. J Biol Chem 281, 24085-24089.

Cousins, R.J., and McMahon, R.J. (2000). Integrative aspects of zinc transporters. J

Nutr 130, 1384S-1387S.

Crawford, M., Bloom, M., Broadhurst, C., Schmidt, W., Cunnane, S., Galli, C.,

Gehbremeskel, K., Linseisen, F., Lloyd-Smith, J., and Parkington, J. (1999).

Evidence for the unique function of docosahexaenoic acid during the evolution of

the modern hominid brain. Lipids 34, S39-S47.

Cuajungco, M.P., and Lees, G.J. (1997a). Zinc and Alzheimer's disease: is there a

direct link? Brain Research Reviews 23, 219-236.

Cuajungco, M.P., and Lees, G.J. (1997b). Zinc metabolism in the brain: relevance to

human neurodegenerative disorders. Neurobiol Dis 4, 137-169.


224 | P a g e

Cunnane, S.C., and Yang, J. (1995). Zinc deficiency impairs whole-body accumulation

of polyunsaturates and increases the utilization of [1-14C]linoleate for de novo

lipid synthesis in pregnant rats. Canadian journal of physiology and

pharmacology 73, 1246-1252.

Dai, Z., and Canary, J.W. (2007). Tailoring tripodal ligands for zinc sensing. New

Journal of Chemistry 31, 1708.

Damsky, C.H., and Werb, Z. (1992). Signal transduction by integrin receptors for

extracellular matrix: cooperative processing of extracellular information. Current

opinion in cell biology 4, 772-781.

Danscher, G. (1984). Dynamic changes in the stainability of rat hippocampal mossy

fiber boutons after local injection of sodium sulphide, sodium selenite, and

sodium diethyldithiocarbamate. The neurobiology of zinc, Part B New York: Alan

R Liss Inc, 177-191.

Davis, G.E., and Camarillo, C.W. (1996). An alpha 2 beta 1 integrin-dependent

pinocytic mechanism involving intracellular vacuole formation and coalescence

regulates capillary lumen and tube formation in three-dimensional collagen

matrix. Exp Cell Res 224, 39-51.

de la Torre, J.C. (2005). Cerebrovascular gene linked to Alzheimer's disease

pathology. Trends Mol Med 11, 534-536.

Dean, M., Hamon, Y., Chimini, G. (2001). The human ATP-binding cassette (ABC)

transporter superfamily. J Lipid Res 42, 1007-1017.


225 | P a g e

Dehmelt, L., and Halpain, S. (2005). The MAP2/Tau family of microtubule-associated

proteins. Genome biology 6, 204.

Deshpande, A., Kawai, H., Metherate, R., Glabe, C.G., and Busciglio, J. (2009). A role

for synaptic zinc in activity-dependent Abeta oligomer formation and

accumulation at excitatory synapses. The Journal of neuroscience : the official

journal of the Society for Neuroscience 29, 4004-4015.

Diaz-Nido, J., Armas-Portela, R., Correas, I., Dominguez, J.E., Montejo, E., and Avila,

J. (1991). Microtubule protein phosphorylation in neuroblastoma cells and

neurite growth. Journal of cell science Supplement 15, 51-59.

Draoui, M., Bellincampi, L., Hospital, V., Cadel, S., Foulon, T., Prat, A., Barre, N.,

Reichert, U., Melino, G., and Cohen, P. (1997). Expression and retinoid

modulation of N-arginine dibasic convertase and an aminopeptidase-B in human

neuroblastoma cell lines. J Neurooncol 31, 99-106.

Dreostl, I.E. (1983). Zinc and the central nervous system., Vol 1 (New Jersey:

Humana Press).

Dufner-Beattie, J., Wang, F., Kuo, Y.M., Gitschier, J., Eide, D., and Andrews, G.K.

(2003). The acrodermatitis enteropathica gene ZIP4 encodes a tissue-specific,

zinc-regulated zinc transporter in mice. J Biol Chem 278, 33474-33481.

Duncan, M.W., Marini, A.M., Watters, R., Kopin, I.J., and Markey, S.P. (1992). Zinc, a

neurotoxin to cultured neurons, contaminates cycad flour prepared by


226 | P a g e

traditional guamanian methods. The Journal of neuroscience : the official journal

of the Society for Neuroscience 12, 1523-1537.

Eide, D.J. (2004). The SLC39 family of metal ion transporters. Pflugers Archiv :

European journal of physiology 447, 796-800.

Erçelen, N., Mercan, S. (2005). Alzheimer’s disease and genes. Advances in

Moleculer Medicine 1 155-164.

Evangelopoulos, M.E., Weis, J., and Kruttgen, A. (2005). Signalling pathways leading

to neuroblastoma differentiation after serum withdrawal: HDL blocks

neuroblastoma differentiation by inhibition of EGFR. Oncogene 24, 3309-3318.

Evans, D.A., Funkenstein, H.H., Albert, M.S., Scherr, P.A., Cook, N.R., Chown, M.J.,

Hebert, L.E., Hennekens, C.H., and Taylor, J.O. (1989). Prevalence of Alzheimer's

disease in a community population of older persons. Higher than previously

reported. JAMA 262, 2551-2556.

Fenton, W.S., Dickerson, F., Boronow, J., Hibbeln, J.R., and Knable, M. (2001). A

Placebo-Controlled Trial of Omega-3 Fatty Acid (Ethyl Eicosapentaenoic Acid)

Supplementation for Residual Symptoms and Cognitive Impairment in

Schizophrenia. Am J Psychiatry 158, 2071-2074.

Findley, R.D.P.a.S.D. (1995). Cloning and functional characterization of a mammalian

zinc transporter that confers resistance to zinc. EMBO J 14 639–649.


227 | P a g e

Frederickson, C.J. (1989). Neurobiology of zinc and zinc-containing neurons. Int Rev

Neurobiol 31, 145-238.

Frederickson, C.J., Kasarskis, E.J., Ringo, D., and Frederickson, R.E. (1987). A

quinoline fluorescence method for visualizing and assaying the histochemically

reactive zinc (bouton zinc) in the brain. J Neurosci Methods 20, 91-103.

Frederickson, C.J., Koh, J.-Y., and Bush, A.I. (2005a). THE NEUROBIOLOGY OF ZINC IN

HEALTH AND DISEASE. Nature Reviews Neuroscience 6, 449-462.

Frederickson, C.J., Koh, J.Y., and Bush, A.I. (2005b). The neurobiology of zinc in

health and disease. Nature reviews Neuroscience 6, 449-462.

Gaither, L.A., and Eide, D.J. (2000). Functional expression of the human hZIP2 zinc

transporter. J Biol Chem 275, 5560-5564.

Gaither, L.A., Eide, D.J. (2001). Eukaryotic zinc transporters and their regulation.

BioMetals 14, 251-270.

Gamoh, S., Hashimoto, M., Hossain, S., and Masumura, S. (2001). Chronic

administration of docosahexaenoic acid improves the performance of radial arm

maze task in aged rats. Clinical and experimental pharmacology & physiology 28,

266-270.

Geckil, H., Xu, F., Zhang, X., Moon, S., and Demirci, U. (2010). Engineering hydrogels

as extracellular matrix mimics. Nanomedicine (London, England) 5, 469-484.


228 | P a g e

German, O.L., Insua, M.F., Gentili, C., Rotstein, N.P., and Politi, L.E. (2006).

Docosahexaenoic acid prevents apoptosis of retina photoreceptors by activating

the ERK/MAPK pathway. J Neurochem 98, 1507-1520.

Gingras, M., Champigny, M.F., and Berthod, F. (2007). Differentiation of human

adult skin-derived neuronal precursors into mature neurons. Journal of cellular

physiology 210, 498-506.

Goldstein, M.N. (1968). Neuroblastoma cells in tissue culture. Journal of pediatric

surgery 3, 166-169.

Gown, A.M., and Willingham, M.C. (2002). Improved detection of apoptotic cells in

archival paraffin sections: immunohistochemistry using antibodies to cleaved

caspase 3. The journal of histochemistry and cytochemistry : official journal of

the Histochemistry Society 50, 449-454.

Gracious, B.L., Chirieac, M.C., Costescu, S., Finucane, T.L., Youngstrom, E.A., and

Hibbeln, J.R. (2010). Randomized, placebo-controlled trial of flax oil in pediatric

bipolar disorder. Bipolar Disord 12, 142-154.

Guillemain, I., Gaboyard, S., Fontes, G., Saunier, M., Privat, A., and Patey, G. (2000).

Differential expression of Bcl-2-related proteins in differentiating NT2 cells.

Neuroreport 11, 1421-1425.

Gunshin H, M.B., Berger UV, Gunshin Y, Romero MF, et al. (1997). Cloning and

characterization of a mammalian proton-coupled metal-ion transporter. Nature

388, 482–488.


229 | P a g e

Haghighat, N., McCandless, D.W., and Geraminegad, P. (2000). The effect of

ammonium chloride on metabolism of primary neurons and neuroblastoma cells

in vitro. Metabolic brain disease 15, 151-162.

Hall, M.N., Chavarro, J.E., Lee, I.M., Willett, W.C., and Ma, J. (2008). A 22-year

prospective study of fish, n-3 fatty acid intake, and colorectal cancer risk in men.

Cancer epidemiology, biomarkers & prevention : a publication of the American

Association for Cancer Research, cosponsored by the American Society of

Preventive Oncology 17, 1136-1143.

Halsted, J.A., Ronaghy, H. A., Abadi, P. (1972). Zinc deficienc in man. American

Journal of Medicine 53, 277-284.

Hamano, H., Nabekura, J., Nishikawa, M., and Ogawa, T. (1996). Docosahexaenoic

acid reduces GABA response in substantia nigra neuron of rat. J Neurophysiol 75,

1264-1270.

Hanas, J.S., Hazuda, D.J., Bogenhagen, D.F., Wu, F.Y., and Wu, C.W. (1983). Xenopus

transcription factor A requires zinc for binding to the 5 S RNA gene. J Biol Chem

258, 14120-14125.

Hardman, B., Michalczyk, A., Greenough, M., Camakaris, J., Mercer, J., and Ackland,

L. (2007). Distinct functional roles for the Menkes and Wilson copper

translocating P-type ATPases in human placental cells. Cellular physiology and

biochemistry : international journal of experimental cellular physiology,

biochemistry, and pharmacology 20, 1073-1084.


230 | P a g e

Hebert, L.E., Beckett, L.A., Scherr, P.A., and Evans, D.A. (2001). Annual incidence of

Alzheimer disease in the United States projected to the years 2000 through 2050.

Alzheimer disease and associated disorders 15, 169-173.

Hibbeln, J.R. (1998). Fish consumption and major depression. Lancet 351, 1213.

Hobbeln, J.R., Salem, Jr. N. (2001). Omega-3 Fatty Acids and Psychiatric Disorders

Current Status of the field. Fatty acids : physiological and behavioral functions,

311- 330.

Holman, R.T. (1971). Essential fatty acid deficiency. Progress in the Chemistry of

Fats and other Lipids 9, 275-348.

Horrocks, L.A., and Yeo, Y.K. (1999). Health benefits of docosahexaenoic acid (DHA).

Pharmacological research : the official journal of the Italian Pharmacological

Society 40, 211-225.

Huang, L., Kirschke, C.P., and Gitschier, J. (2002). Functional characterization of a

novel mammalian zinc transporter, ZnT6. J Biol Chem 277, 26389-26395.

Huang, X., Cuajungco, M.P., Atwood, C.S., Moir, R.D., Tanzi, R.E., and Bush, A.I.

(2000). Alzheimer's disease, beta-amyloid protein and zinc. J Nutr 130, 1488S-

1492S.

Hurley, L.S. (1981). Teratogenic aspects of manganese, zinc, and copper nutrition.

Physiological reviews 61, 249-295.


231 | P a g e

Hyman, T.L.S.a.B.T. (2005). Transgenic Models of Alzheimer's Disease: Learning from

Animals. NeuroRx 2, 423-437. .

Iigo, M., Nakagawa, T., Ishikawa, C., Iwahori, Y., Asamoto, M., Yazawa, K., Araki, E.,

and Tsuda, H. (1997). Inhibitory effects of docosahexaenoic acid on colon

carcinoma 26 metastasis to the lung. British journal of cancer 75, 650-655.

Ikemoto, A., Ohishi, M., Sato, Y., Hata, N., Misawa, Y., Fujii, Y., and Okuyama, H.

(2001). Reversibility of n-3 fatty acid deficiency-induced alterations of learning

behavior in the rat: level of n-6 fatty acids as another critical factor. Journal of

lipid research 42, 1655-1663.

Imashuku, S., Inui, A., Kusunoki, T., Okabe, H., and Yonezawa, T. (1976).

Acetylcholine synthesis in sympathetic human neuroblastoma. Journal of

pediatric surgery 11, 949-954.

Jain, P., Cerone, M.A., Leblanc, A.C., and Autexier, C. (2007). Telomerase and

neuronal marker status of differentiated NT2 and SK-N-SH human neuronal cells

and primary human neurons. J Neurosci Res 85, 83-89.

Jalava, A., Heikkila, J., Lintunen, M., Akerman, K., and Pahlman, S. (1992).

Staurosporine induces a neuronal phenotype in SH-SY5Y human neuroblastoma

cells that resembles that induced by the phorbol ester 12-O-tetradecanoyl

phorbol-13 acetate (TPA). FEBS letters 300, 114-118.

Jayasooriya, A.P., Ackland, M.L., Mathai, M.L., Sinclair, A.J., Weisinger, H.S.,

Weisinger, R.S., Halver, J.E., Kitajka, K., and Puskas, L.G. (2005a). Perinatal


232 | P a g e

{omega}-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis

during adulthood. PNAS 102, 7133-7138.

Jayasooriya, A.P., Ackland, M.L., Mathai, M.L., Sinclair, A.J., Weisinger, H.S.,

Weisinger, R.S., Halver, J.E., Kitajka, K., and Puskas, L.G. (2005b). Perinatal

omega-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis

during adulthood. Proc Natl Acad Sci U S A 102, 7133-7138.

Jeruc, J., Vizjak, A., Rozman, B., and Ferluga, D. (2006). Immunohistochemical

expression of activated caspase-3 as a marker of apoptosis in glomeruli of human

lupus nephritis. American journal of kidney diseases : the official journal of the

National Kidney Foundation 48, 410-418.

Joseph, J., Cole, G., Head, E., and Ingram, D. (2009). Nutrition, brain aging, and

neurodegeneration. The Journal of neuroscience : the official journal of the

Society for Neuroscience 29, 12795-12801.

Kagi, J.H.R., Vallee, B.L., and With the technical assistance of Janet, M.C. (1961).

Metallothionein: a Cadmium and Zinc-containing Protein from Equine Renal

Cortex. II. PHYSICOCHEMICAL PROPERTIES. J Biol Chem 236, 2435-2442.

Kambe, T., Yamaguchi-Iwai, Y., Sasaki, R., and Nagao, M. (2004a). Overview of

mammalian zinc transporters. Cellular and molecular life sciences : CMLS 61, 49-

68.


233 | P a g e

Kambe, T., Yamaguchi-Iwai, Y., Sasaki, R., and Nagao, M. (2004b). Overview of

mammalian zinc transporters. Cellular and Molecular Life Sciences CMLS 61, 49-

68.

Kato, T., Kolenic, N., and Pardini, R.S. (2007). Docosahexaenoic acid (DHA), a

primary tumor suppressive omega-3 fatty acid, inhibits growth of colorectal

cancer independent of p53 mutational status. Nutrition and cancer 58, 178-187.

Katzman, R. (1986). Alzheimer’s disease. New England Journal of Medicine 314, 964-

973.

Kelleher, S.L., and Lonnerdal, B. (2002). Zinc transporters in the rat mammary gland

respond to marginal zinc and vitamin A intakes during lactation. J Nutr 132, 3280-

3285.

Kim, E.Y., Koh, J.Y., Kim, Y.H., Sohn, S., Joe, E., and Gwag, B.J. (1999a). Zn2+ entry

produces oxidative neuronal necrosis in cortical cell cultures. European Journal

of Neuroscience 11, 327-334.

Kim, E.Y., Koh, J.Y., Kim, Y.H., Sohn, S., Joe, E., and Gwag, B.J. (1999b). Zn2+ entry

produces oxidative neuronal necrosis in cortical cell cultures. The European

journal of neuroscience 11, 327-334.

Kim, H.Y., Akbar, M., Lau, A., and Edsall, L. (2000). Inhibition of neuronal apoptosis

by docosahexaenoic acid (22:6n-3). Role of phosphatidylserine in antiapoptotic

effect. J Biol Chem 275, 35215-35223.


234 | P a g e

Kim, Y.H., Kim, E.Y., Gwag, B.J., Sohn, S., and Koh, J.Y. (1999c). Zinc-induced cortical

neuronal death with features of apoptosis and necrosis: mediation by free

radicals. Neuroscience 89, 175-182.

Kimber, M.C., Mahadevan, I.B., Lincoln, S.F., Ward, A.D., and Tiekink, E.R. (2000).

The synthesis and fluorescent properties of analogues of the zinc(II) specific

fluorophore zinquin ester. The Journal of organic chemistry 65, 8204-8209.

Kirschke, C.P., and Huang, L. (2003). ZnT7, a novel mammalian zinc transporter,

accumulates zinc in the Golgi apparatus. J Biol Chem 278, 4096-4102.

Kishida, E., Yano, M., Kasahara, M., and Masuzawa, Y. (1998). Distinctive inhibitory

activity of docosahexaenoic acid against sphingosine-induced apoptosis.

Biochimica et biophysica acta 1391, 401-408.

Kitajka, K., Sinclair, A.J., Weisinger, R.S., Weisinger, H.S., Mathai, M., Jayasooriya,

A.P., Halver, J.E., and Puskas, L.G. (2004). Effects of dietary omega-3

polyunsaturated fatty acids on brain gene expression. Proc Natl Acad Sci U S A

101, 10931-10936.

Koh, J.Y., and Choi, D.W. (1994). Zinc toxicity on cultured cortical neurons:

involvement of N-methyl-D-aspartate receptors. Neuroscience 60, 1049-1057.

Koh, J.Y., Suh, S.W., Gwag, B.J., He, Y.Y., Hsu, C.Y., and Choi, D.W. (1996). The role of

zinc in selective neuronal death after transient global cerebral ischemia. Science

272, 1013-1016.


235 | P a g e

Krebs, N.F. (2000). Overview of Zinc Absorption and Excretion in the Human

Gastrointestinal Tract. J Nutr 130, 1374S-1377.

Kris-Etherton, P.M., Taylor, D.S., Yu-Poth, S., Huth, P., Moriarty, K., Fishell, V.,

Hargrove, R.L., Zhao, G., and Etherton, T.D. (2000). Polyunsaturated fatty acids in

the food chain in the United States. Am J Clin Nutr 71, 179S-188S.

Kubo, K., Saito, M., Tadokoro, T., and Maekawa, A. (1997). Changes in susceptibility

of tissues to lipid peroxidation after ingestion of various levels of

docosahexaenoic acid and vitamin E. The British journal of nutrition 78, 655-669.

Kuratko, C.N., and Salem, N., Jr. (2009). Biomarkers of DHA status. Prostaglandins,

leukotrienes, and essential fatty acids 81, 111-118.

Kyle, D.J., Schaefer, E., Patton, G., and Beiser, A. (1999). Low serum

docosahexaenoic acid is a significant risk factor for Alzheimer's dementia. Lipids

34 Suppl, S245.

Lee, J.Y., Cole, T.B., Palmiter, R.D., Suh, S.W., and Koh, J.Y. (2002). Contribution by

synaptic zinc to the gender-disparate plaque formation in human Swedish

mutant APP transgenic mice. Proc Natl Acad Sci U S A 99, 7705-7710.

Lee, J.Y., Cole, T.B., Palmiter, R.D., Suh, S.W., Koh, J.Y. (2002). From the Cover:

Contribution by synaptic zinc to the gender-disparate plaque formation in human

Swedish mutant APP transgenic mice. Proceedings of the National Academy of

Sciences 99, 7705-7710.


236 | P a g e

Lee, J.Y., Hwang, J.J., Park, M.H., and Koh, J.Y. (2006). Cytosolic labile zinc: a marker

for apoptosis in the developing rat brain. The European journal of neuroscience

23, 435-442.

Leli, U., Cataldo, A., Shea, T.B., Nixon, R.A., and Hauser, G. (1992). Distinct

mechanisms of differentiation of SH-SY5Y neuroblastoma cells by protein kinase

C activators and inhibitors. J Neurochem 58, 1191-1198.

LePage, K.T., Dickey, R.W., Gerwick, W.H., Jester, E.L., and Murray, T.F. (2005). On

the use of neuro-2a neuroblastoma cells versus intact neurons in primary culture

for neurotoxicity studies. Critical reviews in neurobiology 17, 27-50.

Letourneau, P.C., Condic, M.L., and Snow, D.M. (1994). Interactions of developing

neurons with the extracellular matrix. The Journal of neuroscience : the official

journal of the Society for Neuroscience 14, 915-928.

Li, Y., Hough, C.J., Frederickson, C.J., and Sarvey, J.M. (2001). Induction of mossy

fiber --> Ca3 long-term potentiation requires translocation of synaptically

released Zn2+. The Journal of neuroscience : the official journal of the Society for

Neuroscience 21, 8015-8025.

Lien, E.L. (2009). Toxicology and safety of DHA. Prostaglandins, leukotrienes, and

essential fatty acids 81, 125-132.

Lim, G.P., Calon, F., Morihara, T., Yang, F., Teter, B., Ubeda, O., Salem, N., Jr.,

Frautschy, S.A., and Cole, G.M. (2005). A diet enriched with the omega-3 fatty

acid docosahexaenoic acid reduces amyloid burden in an aged Alzheimer mouse


237 | P a g e

model. The Journal of neuroscience : the official journal of the Society for


Lippard, S.J.a.B., J.M. (1994). Principles of Bioinorganic Chemistry. University

Science Books, Mill Valley.

Liuzzi, J.P., Bobo, J.A., Cui, L., McMahon, R.J., and Cousins, R.J. (2003). Zinc

transporters 1, 2 and 4 are differentially expressed and localized in rats during

pregnancy and lactation. J Nutr 133, 342-351.

Liuzzi, J.P., Bobo, J.A., Lichten, L.A., Samuelson, D.A., and Cousins, R.J. (2004).

Responsive transporter genes within the murine intestinal-pancreatic axis form a

basis of zinc homeostasis. Proc Natl Acad Sci U S A 101, 14355-14360.

Liuzzi, J.P., and Cousins, R.J. (2004a). Mammalian zinc transporters. Annu Rev Nutr

24, 151-172.

Liuzzi, J.P., and Cousins, R.J. (2004b). MAMMALIAN ZINC TRANSPORTERS. Annual

Review of Nutrition 24, 151-172.

Loessner, D., Stok, K.S., Lutolf, M.P., Hutmacher, D.W., Clements, J.A., and Rizzi, S.C.

(2010). Bioengineered 3D platform to explore cell-ECM interactions and drug

resistance of epithelial ovarian cancer cells. Biomaterials 31, 8494-8506.

Logan, A.C. (2004). Omega-3 fatty acids and major depression: a primer for the

mental health professional. Lipids Health Dis 3, 25.


238 | P a g e

Longo, I., Frints, S.G.M., Fryns, J.P., Meloni, I., Pescucci, C., Ariani, F., Borghgraef, M.,

Raynaud, M., Marynen, P., Schwartz, C., et al. (2003). A third MRX family

(MRX68) is the result of mutation in the long chain fatty acid-CoA ligase 4 (FACL4)

gene: proposal of a rapid enzymatic assay for screening mentally retarded

patients. J Med Genet 40, 11-17.

Lopez, V., and Kelleher, S.L. (2009). Zinc transporter-2 (ZnT2) variants are localized

to distinct subcellular compartments and functionally transport zinc. The

Biochemical journal 422, 43-52.

Lovell, M.A., Robertson, J.D., Teesdale, W.J., Campbell, J.L., and Markesbery, W.R.

(1998). Copper, iron and zinc in Alzheimer's disease senile plaques. Journal of the

neurological sciences 158, 47-52.

Lovell, M.A., Smith, J.L., and Markesbery, W.R. (2006). Elevated zinc transporter-6 in

mild cognitive impairment, Alzheimer disease, and pick disease. J Neuropathol

Exp Neurol 65, 489-498.

Lovell, M.A., Smith, J.L., Xiong, S., and Markesbery, W.R. (2005). Alterations in zinc

transporter protein-1 (ZnT-1) in the brain of subjects with mild cognitive

impairment, early, and late-stage Alzheimer's disease. Neurotox Res 7, 265-271.

Lukiw, W.J., Cui, J.-G., Marcheselli, V.L., Bodker, M., Botkjaer, A., Gotlinger, K.,

Serhan, C.N., and Bazan, N.G. (2005). A role for docosahexaenoic acid-derived

neuroprotectin D1 in neural cell survival and Alzheimer disease. J Clin Invest 115,

2774-2783.


239 | P a g e

Manev, H., Kharlamov, E., Uz, T., Mason, R.P., and Cagnoli, C.M. (1997).

Characterization of zinc-induced neuronal death in primary cultures of rat

cerebellar granule cells. Experimental neurology 146, 171-178.

McGowan, A.J., Fernandes, R.S., Verhaegen, S., and Cotter, T.G. (1994). Zinc inhibits

UV radiation-induced apoptosis but fails to prevent subsequent cell death. Int J

Radiat Biol 66, 343-349.

McLennan PL, B.T., Abeywardena MY, Charnock JS. (1992). Dietary lipid modulation

of ventricular fibrillation threshold in the marmoset

monkey. Am Heart J 123, 1555-1561.

McMahon, R.J., and Cousins, R.J. (1998). Mammalian Zinc Transporters1,2. J Nutr

128, 667-670.

McMahon, R.J., Cousins, R. J. (1998). Mammalian Zinc Transporters1,2. J Nutr 128,

667-670.

Melino, G., Draoui, M., Bernardini, S., Bellincampi, L., Reichert, U., and Cohen, P.

(1996). Regulation by retinoic acid of insulin-degrading enzyme and of a related

endoprotease in human neuroblastoma cell lines. Cell Growth Differ 7, 787-796.

Melino, G., Stephanou, A., Annicchiarico-Petruzzelli, M., Knight, R.A., Finazzi-Agro,

A., and Lightman, S.L. (1993). Modulation of IGF-2 expression during growth and

differentiation of human neuroblastoma cells: retinoic acid may induce IGF-2.

Neurosci Lett 151, 187-191.


240 | P a g e

Merendino, N., Molinari, R., Loppi, B., Pessina, G., M, D.A., Tomassi, G., and Velotti,

F. (2003). Induction of apoptosis in human pancreatic cancer cells by

docosahexaenoic acid. Annals of the New York Academy of Sciences 1010, 361-

364.

Michalczyk, A.A., Allen, J., Blomeley, R.C., and Ackland, M.L. (2002). Constitutive

expression of hZnT4 zinc transporter in human breast epithelial cells. The

Biochemical journal 364, 105-113.

Mitchell, D.C., Gawrisch, K., Litman, B.J., and Salem, N., Jr. (1998). Why is

docosahexaenoic acid essential for nervous system function? Biochemical Society

transactions 26, 365-370.

Miyashita, T., Krajewski, S., Krajewska, M., Wang, H.G., Lin, H.K., Liebermann, D.A.,

Hoffman, B., and Reed, J.C. (1994). Tumor suppressor p53 is a regulator of bcl-2

and bax gene expression in vitro and in vivo. Oncogene 9, 1799-1805.

Mizuno, D., and Kawahara, M. (2013). The molecular mechanisms of zinc

neurotoxicity and the pathogenesis of vascular type senile dementia.

International journal of molecular sciences 14, 22067-22081.

Mocchegiani, E., Bertoni-Freddari, C., Marcellini, F., and Malavolta, M. (2005). Brain,

aging and neurodegeneration: role of zinc ion availability. Prog Neurobiol 75,

367-390.

Murphy, M.P., and LeVine, H., 3rd (2010). Alzheimer's disease and the amyloid-beta

peptide. J Alzheimers Dis 19, 311-323.


241 | P a g e

Murray, M.R., and Stout, A.P. (1947). Distinctive Characteristics of the

Sympathicoblastoma Cultivated in Vitro: A Method for Prompt Diagnosis. The

American journal of pathology 23, 429-441.

Mustafa, N.R., de Winter, W., van Iren, F., and Verpoorte, R. (2011). Initiation,

growth and cryopreservation of plant cell suspension cultures. Nature protocols

6, 715-742.

Nair, S.S.D., Leitch, J.W., Falconer, J., and Garg, M.L. (1997). Prevention of cardiac

arrhythmia by dietary (n-3) polyunsaturated fatty acids and their mechanism of

action. Journal of Nutrition 127, 383-393.

Nelson, P.T., Kondziolka, D., Wechsler, L., Goldstein, S., Gebel, J., DeCesare, S., Elder,

E.M., Zhang, P.J., Jacobs, A., McGrogan, M., et al. (2002). Clonal human (hNT)

neuron grafts for stroke therapy: neuropathology in a patient 27 months after

implantation. The American journal of pathology 160, 1201-1206.

Nemets, B., Stahl, Z., and Belmaker, R.H. (2002). Addition of omega-3 fatty acid to

maintenance medication treatment for recurrent unipolar depressive disorder.

Am J Psychiatry 159, 477-479.

Neuringer, M., Anderson, G.J., and Connor, W.E. (1988). The Essentiality of N-3

Fatty Acids for the Development and Function of the Retina and Brain. Annual

Review of Nutrition 8, 517-541.


242 | P a g e

O'Neal, R.M., Pla, G.W., Fox, M.R., Gibson, F.S., and Fry, B.E., Jr. (1970). Effect of zinc

deficiency and restricted feeding on protein and ribonucleic acid metabolism of

rat brain. J Nutr 100, 491-497.

Oltvai, Z.N., Milliman, C.L., and Korsmeyer, S.J. (1993). Bcl-2 heterodimerizes in vivo

with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74,

609-619.

Pahlman, S., Odelstad, L., Larsson, E., Grotte, G., and Nilsson, K. (1981). Phenotypic

changes of human neuroblastoma cells in culture induced by 12-O-

tetradecanoyl-phorbol-13-acetate. International journal of cancer Journal

international du cancer 28, 583-589.

Pahlman, S., Ruusala, A.I., Abrahamsson, L., Mattsson, M.E., and Esscher, T. (1984).

Retinoic acid-induced differentiation of cultured human neuroblastoma cells: a

comparison with phorbolester-induced differentiation. Cell differentiation 14,

135-144.

Palmiter, R.D., Cole, T.B., Quaife, C.J., and Findley, S.D. (1996). ZnT-3, a putative

transporter of zinc into synaptic vesicles. Proc Natl Acad Sci U S A 93, 14934-

14939.

Palmiter, R.D.a.F., S. D. (1995a). Cloning and functional characterization of a

mammalian zinc transporter that confers resistance to zinc. EMBO Journal 14,

639–649.


243 | P a g e

Palmiter, R.D.a.F., S. D. (1995b). Cloning and functional characterization of a

mammalian zinc transporter that confers resistance to zinc.

. EMBO Journal 14, 639–649.

Pampaloni, F., Reynaud, E.G., and Stelzer, E.H. (2007). The third dimension bridges

the gap between cell culture and live tissue. Nature reviews Molecular cell

biology 8, 839-845.

Paquet-Durand, F., and Bicker, G. (2007). Human model neurons in studies of brain

cell damage and neural repair. Current molecular medicine 7, 541-554.

Paquet-Durand, F., Tan, S., and Bicker, G. (2003). Turning teratocarcinoma cells into

neurons: rapid differentiation of NT-2 cells in floating spheres. Developmental

Brain Research 142, 161-167.

Patel, C. (2003). The Effect of Lipid Fluidity Modulating Agents on the Activity of

Secretases. Journal of Undergraduate Research 4.

Pawlosky, R.J., Hibbeln, J.R., Novotny, J.A., and Salem, N., Jr. (2001). Physiological

compartmental analysis of {alpha}-linolenic acid metabolism in adult humans. J

Lipid Res 42, 1257-1265.

Piche, L.A., Draper, H.H., and Cole, P.D. (1988). Malondialdehyde excretion by

subjects consuming cod liver oil vs a concentrate of n-3 fatty acids. Lipids 23,

370-371.


244 | P a g e

Pleasure, S.J., Page, C., and Lee, V.M. (1992). Pure, postmitotic, polarized human

neurons derived from NTera 2 cells provide a system for expressing exogenous

proteins in terminally differentiated neurons. The Journal of neuroscience : the

official journal of the Society for Neuroscience 12, 1802-1815.

Porter, A.G., and Janicke, R.U. (1999). Emerging roles of caspase-3 in apoptosis. Cell

death and differentiation 6, 99-104.

Puskas, L.G., Kitajka, K., Nyakas, C., Barcelo-Coblijn, G., and Farkas, T. (2003). Short-

term administration of omega 3 fatty acids from fish oil results in increased

transthyretin transcription in old rat hippocampus. Proc Natl Acad Sci U S A 100,

1580-1585.

R. Ishihara, T. Kawakami, Y. Mizuno, T. Takeuchi, and Ide, A. (2003). Neuronal

Degeneration from the Perspective of Abnormal Distribution of Cellular Metallic

Elements in Cases of Alzheimer’s Disease.

Biomed Res Trace Elements 14, 204.

Rahman, M.M., Veigas, J.M., Williams, P.J., and Fernandes, G. (2013). DHA is a more

potent inhibitor of breast cancer metastasis to bone and related osteolysis than

EPA. Breast cancer research and treatment 141, 341-352.

Rainulf, A.S., H. Norman Schnitzlein F. Reed Murtagh (1995). An english translation

of alzheimer's 1907 paper, "über eine eigenartige erkankung der hirnrinde".

Clinical Anatomy 8, 429-431.


245 | P a g e

Ramkumar, T., and Adler, S. (1999). A requirement for the POU transcription factor,

Brn-2, in corticotropin-releasing hormone expression in a neuronal cell line.

Molecular endocrinology (Baltimore, Md) 13, 1237-1248.

Ravindran, A., Schild, L., and Moczydlowski, E. (1991). Divalent cation selectivity for

external block of voltage-dependent Na+ channels prolonged by batrachotoxin.

Zn2+ induces discrete substates in cardiac Na+ channels. The Journal of general

physiology 97, 89-115.

Recio-Pinto, E., Lang, F.F., and Ishii, D.N. (1984). Insulin and insulin-like growth

factor II permit nerve growth factor binding and the neurite formation response

in cultured human neuroblastoma cells. Proc Natl Acad Sci U S A 81, 2562-2566.

Reddy, B.S. (2002). Types and amount of dietary fat and colon cancer risk:

Prevention by omega-3 fatty acid-rich diets. Environmental health and

preventive medicine 7, 95-102.

Reed, J.C. (1994). Bcl-2 and the regulation of programmed cell death. The Journal of

cell biology 124, 1-6.

Robert Adalberta, J.G.a.M.P.C. (2007). Ab, tau and ApoE4 in Alzheimer’s disease: the

axonal connection Trends in Molecular Medicine 13, 135-142.

Roberts, S.B., Ripellino, J.A., Ingalls, K.M., Robakis, N.K., and Felsenstein, K.M.

(1994). Non-amyloidogenic cleavage of the beta-amyloid precursor protein by an

integral membrane metalloendopeptidase. J Biol Chem 269, 3111-3116.


246 | P a g e

Sacharidou, A., Koh, W., Stratman, A.N., Mayo, A.M., Fisher, K.E., and Davis, G.E.

(2010). Endothelial lumen signaling complexes control 3D matrix-specific

tubulogenesis through interdependent Cdc42- and MT1-MMP-mediated events.

Blood 115, 5259-5269.

Sadli, N., Ackland, M.L., De Mel, D., Sinclair, A.J., and Suphioglu, C. (2012). Effects of

zinc and DHA on the epigenetic regulation of human neuronal cells. Cellular

physiology and biochemistry : international journal of experimental cellular

physiology, biochemistry, and pharmacology 29, 87-98.

Salem, N., Jr., Abood, L.G., and Hoss, W. (1976). Separation of brain

phosphatidylserines according to degree of unsaturation by thin-layer

chromatography. Anal Biochem 76, 407-415.

Salem, N., Jr., Wegher, B., Mena, P., and Uauy, R. (1996). Arachidonic and

docosahexaenoic acids are biosynthesized from their 18-carbon precursors in

human infants. PNAS 93, 49-54.

Sandra Kalmijn, L.J.L.A.O.J.C.M.W.A.H.M.M.B.B. (1997). Dietary fat intake and the

risk of incident dementia in the Rotterdam study. Annals of Neurology 42, 776-

782.

Sekler, I., Moran, A., Hershfinkel, M., Dori, A., Margulis, A., Birenzweig, N., Nitzan,

Y., and Silverman, W.F. (2002). Distribution of the zinc transporter ZnT-1 in

comparison with chelatable zinc in the mouse brain. J Comp Neurol 447, 201-

209.


247 | P a g e

Sensi, S.L., Yin, H.Z., and Weiss, J.H. (2000). AMPA/kainate receptor-triggered Zn2+

entry into cortical neurons induces mitochondrial Zn2+ uptake and persistent

mitochondrial dysfunction. The European journal of neuroscience 12, 3813-3818.

Serini, S., Trombino, S., Oliva, F., Piccioni, E., Monego, G., Resci, F., Boninsegna, A.,

Picci, N., Ranelletti, F.O., and Calviello, G. (2008). Docosahexaenoic acid induces

apoptosis in lung cancer cells by increasing MKP-1 and down-regulating p-ERK1/2

and p-p38 expression. Apoptosis : an international journal on programmed cell

death 13, 1172-1183.

Shahdat, H., Hashimoto, M., Katakura, M., Miwa, K., Shimada, T., and Shido, O.

(2009). Mechanism of Docosahexaenoic acid-induced inhibition of in vitro

Abeta(1-42) fibrillation and Abeta(1-42)-induced toxicity in SH-S5Y5 cells. Journal

of Neurochemistry 9999.

Shapiro, S., Hamby, C.L., and Shapiro, D.A. (1985). Alzheimer's disease: an emerging

affliction of the aging population. J Am Dent Assoc 111, 287-292.

Sheline, C.T., Behrens, M.M., and Choi, D.W. (2000a). Zinc-induced cortical neuronal

death: contribution of energy failure attributable to loss of NAD(+) and inhibition

of glycolysis. The Journal of neuroscience : the official journal of the Society for


Sheline, C.T., Behrens, M.M., and Choi, D.W. (2000b). Zinc-Induced Cortical

Neuronal Death: Contribution of Energy Failure Attributable to Loss of NAD+ and

Inhibition of Glycolysis. J Neurosci 20, 3139-3146.


248 | P a g e

Sidell, N. (1982). Retinoic acid-induced growth inhibition and morphologic

differentiation of human neuroblastoma cells in vitro. Journal of the National

Cancer Institute 68, 589-596.

Simopoulos, A.P. (1991). Omega-3 fatty acids in health and disease and in growth

and development. Am J Clin Nutr 54, 438-463.

Simopoulos, A.P. (2002). The importance of the ratio of omega-6/omega-3 essential

fatty acids. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie

56, 365-379.

Simpson, P.B., Bacha, J.I., Palfreyman, E.L., Woollacott, A.J., McKernan, R.M., and

Kerby, J. (2001). Retinoic acid evoked-differentiation of neuroblastoma cells

predominates over growth factor stimulation: an automated image capture and

quantitation approach to neuritogenesis. Anal Biochem 298, 163-169.

Skender, B., Hofmanova, J., Slavik, J., Jelinkova, I., Machala, M., Moyer, M.P.,

Kozubik, A., and Hyrslova Vaculova, A. (2014). DHA-mediated enhancement of

TRAIL-induced apoptosis in colon cancer cells is associated with engagement of

mitochondria and specific alterations in sphingolipid metabolism. Biochimica et

biophysica acta 1841, 1308-1317.

Smart, T.G., Xie, X., and Krishek, B.J. (1994). Modulation of inhibitory and excitatory

amino acid receptor ion channels by zinc. Prog Neurobiol 42, 393-441.

Smidt, K., and Rungby, J. (2012). ZnT3: a zinc transporter active in several organs.

Biometals 25, 1-8.


249 | P a g e

Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., Provenzano,

M.D., Fujimoto, E.K., Goeke, N.M., Olson, B.J., Klenk, D.C. (1985). Measurement

of protein using bicinchoninic acid. Analytical Biochemistry 150, 76-85.

Smith, R.A., Miller, T.M., Yamanaka, K., Monia, B.P., Condon, T.P., Hung, G.,

Lobsiger, C.S., Ward, C.M., McAlonis-Downes, M., Wei, H., et al. (2006).

Antisense oligonucleotide therapy for neurodegenerative disease. The Journal of

clinical investigation 116, 2290-2296.

Solfrizzi, V., D'Introno, A., Colacicco, A.M., Capurso, C., Del Parigi, A., Capurso, S.,

Gadaleta, A., Capurso, A., and Panza, F. (2005). Dietary fatty acids intake:

possible role in cognitive decline and dementia. Exp Gerontol 40, 257-270.

Sonnenfeld, K.H., and Ishii, D.N. (1982). Nerve growth factor effects and receptors in

cultured human neuroblastoma cell lines. J Neurosci Res 8, 375-391.

Sowa, M.B., Chrisler, W.B., Zens, K.D., Ashjian, E.J., and Opresko, L.K. (2010). Three-

dimensional culture conditions lead to decreased radiation induced cytotoxicity

in human mammary epithelial cells. Mutation research 687, 78-83.

Spinelli, P., Pizzetti, P., Lo Gullo, C., Rocca, F., Gobbi, A., and Ravasi, G. (1982).

Resection of obstructive bronchial fibrolipoma through the flexible fiberoptic

bronchoscope. Endoscopy 14, 61-63.

Stillwell, W., and Wassall, S.R. (2003). Docosahexaenoic acid: membrane properties

of a unique fatty acid. Chemistry and physics of lipids 126, 1-27.


250 | P a g e

Stoll, A.L.M.D., Severus, W. Emanuel M. D. PhD, Freeman, Marlene P. M. D., Rueter,

Stephanie, Zboyan, Holly A., Diamond, Eli, Cress, Kimberly K. M. D., Marangell,

Lauren B. M. D. (1999). Omega3 Fatty Acids in Bipolar Disorder: A Preliminary

Double-blind, Placebo-Controlled Trial. Archives of General Psychiatry 56, 413–

416.

Stoltenberg, M., Bruhn, M., Sondergaard, C., Doering, P., West, M.J., Larsen, A.,

Troncoso, J.C., and Danscher, G. (2005a). Immersion autometallographic tracing

of zinc ions in Alzheimer beta-amyloid plaques. Histochem Cell Biol 123, 605-611.

Stoltenberg, M., Bruhn, M., Søndergaard, C., Doering, P., West, M.J., Larsen, A.,

Troncoso, J.C., and Danscher, G. (2005b). Immersion autometallographic tracing

of zinc ions in Alzheimer beta-amyloid plaques. Histochemistry and Cell Biology

123, 605-611.

Storch, A., Burkhardt, K., Ludolph, A.C., and Schwarz, J. (2000). Protective effects of

riluzole on dopamine neurons: involvement of oxidative stress and cellular

energy metabolism. J Neurochem 75, 2259-2269.

Strittmatter, S.M., and Fishman, M.C. (1991). The neuronal growth cone as a

specialized transduction system. BioEssays : news and reviews in molecular,

cellular and developmental biology 13, 127-134.

Suh, S.W., Chen, J.W, Motamedi, M, Bell, B, Listiak, K, Pons, NF, Danscher, G,

Frederickson, C.J. (2000). Evidence that synaptically-released zinc contributes to

neuronal injury after traumatic brain injury. Brain Research 852, 268-273.


251 | P a g e

Sun, T., Jackson, S., Haycock, J.W., and MacNeil, S. (2006). Culture of skin cells in 3D

rather than 2D improves their ability to survive exposure to cytotoxic agents.

Journal of biotechnology 122, 372-381.

Suphioglu, C., De Mel, D., Kumar, L., Sadli, N., Freestone, D., Michalczyk, A., Sinclair,

A., and Ackland, M.L. (2010a). The omega-3 fatty acid, DHA, decreases neuronal

cell death in association with altered zinc transport. FEBS letters 584, 612-618.

Suphioglu, C., Sadli, N., Coonan, D., Kumar, L., De Mel, D., Lesheim, J., Sinclair, A.J.,

and Ackland, L. (2010b). Zinc and DHA have opposing effects on the expression

levels of histones H3 and H4 in human neuronal cells. The British journal of

nutrition 103, 344-351.

Suzuki, H., Park, S.J., Tamura, M., and Ando, S. (1998). Effect of the long-term

feeding of dietary lipids on the learning ability, fatty acid composition of brain

stem phospholipids and synaptic membrane fluidity in adult mice: a comparison

of sardine oil diet with palm oil diet. Mech Ageing Dev 101, 119-128.

Suzuki, I., Iigo, M., Ishikawa, C., Kuhara, T., Asamoto, M., Kunimoto, T., Moore, M.A.,

Yazawa, K., Araki, E., and Tsuda, H. (1997). Inhibitory effects of oleic and

docosahexaenoic acids on lung metastasis by colon-carcinoma-26 cells are

associated with reduced matrix metalloproteinase-2 and -9 activities.

International journal of cancer Journal international du cancer 73, 607-612.

Svennerholm, L. (1968). Distribution and fatty acid composition of

phosphoglycerides in normal human brain. Journal of lipid research 9, 570-579.


252 | P a g e

Switzer, K.C., Fan, Y.Y., Wang, N., McMurray, D.N., and Chapkin, R.S. (2004). Dietary

n-3 polyunsaturated fatty acids promote activation-induced cell death in Th1-

polarized murine CD4+ T-cells. Journal of lipid research 45, 1482-1492.

Szewczyk, B. (2013). Zinc homeostasis and neurodegenerative disorders. Frontiers

in aging neuroscience 5, 33.

Takeda, A. (2000). Movement of zinc and its functional significance in the brain.

Brain research Brain research reviews 34, 137-148.

Thelwell, C., Robinson, N.J., and Turner-Cavet, J.S. (1998). An SmtB-like repressor

from Synechocystis PCC 6803 regulates a zinc exporter. Proceedings of the

National Academy of Sciences 95, 10728-10733.

Thompson, R.B. (2005). Studying zinc biology with fluorescence: ain't we got fun?

Current opinion in chemical biology 9, 526-532.

Treen, M., Uauy, R.D., Jameson, D.M., Thomas, V.L., and Hoffman, D.R. (1992).

Effect of docosahexaenoic acid on membrane fluidity and function in intact

cultured Y-79 retinoblastoma cells. Arch Biochem Biophys 294, 564-570.

Trojanowski, J.Q., Kleppner, S.R., Hartley, R.S., Miyazono, M., Fraser, N.W., Kesari,

S., and Lee, V.M. (1997). Transfectable and transplantable postmitotic human

neurons: a potential "platform" for gene therapy of nervous system diseases.

Experimental neurology 144, 92-97.


253 | P a g e

Vallee, B.L., and Auld, D.S. (1990). Active-Site Zinc Ligands and Activated H2O of Zinc

Enzymes. PNAS 87, 220-224.

Vallee, B.L., and Auld, D.S. (1992). Active zinc binding sites of zinc metalloenzymes.

Matrix 1, 5-19.

Vallee, B.L., and Falchuk, K.H. (1993). The biochemical basis of zinc physiology.

Physiological reviews 73, 79-118.

Vaux, D.L., Cory, S., and Adams, J.M. (1988). Bcl-2 gene promotes haemopoietic cell

survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440-

442.

Vickers, J.C., Dickson, T.C., Adlard, P.A., Saunders, H.L., King, C.E., and McCormack,

G. (2000). The cause of neuronal degeneration in Alzheimer's disease. Prog

Neurobiol 60, 139-165.

Wall, S. (2007). Alzheimer's Cases Could Soar by Midcentury. In Wall Street Journal -

Eastern Edition, pp. B7.

Wallwork, J.C. (1987). Zinc and the central nervous system. Prog Food Nutr Sci 11,

203-247.

Wallwork, J.C., Milne, D.B., Sims, R.L., and Sandstead, H.H. (1983). Severe zinc

deficiency: effects on the distribution of nine elements (potassium, phosphorus,

sodium, magnesium, calcium, iron, zinc, copper and manganese) in regions of the

rat brain. J Nutr 113, 1895-1905.


254 | P a g e

Wander, R.C., Du, S.H., Ketchum, S.O., and Rowe, K.E. (1996). Effects of interaction

of RRR-alpha-tocopheryl acetate and fish oil on low-density-lipoprotein oxidation

in postmenopausal women with and without hormone-replacement therapy. Am

J Clin Nutr 63, 184-193.

Wang, F., Dufner-Beattie, J., Kim, B.E., Petris, M.J., Andrews, G., and Eide, D.J.

(2004a). Zinc-stimulated endocytosis controls activity of the mouse ZIP1 and ZIP3

zinc uptake transporters. J Biol Chem 279, 24631-24639.

Wang, Z., Wang, D.Z., Hockemeyer, D., McAnally, J., Nordheim, A., and Olson, E.N.

(2004b). Myocardin and ternary complex factors compete for SRF to control

smooth muscle gene expression. Nature 428, 185-189.

Wang, Z.Y., Stoltenberg, M., Huang, L., Danscher, G., Dahlstrom, A., Shi, Y., and Li,

J.Y. (2005). Abundant expression of zinc transporters in Bergman glia of mouse

cerebellum. Brain Res Bull 64, 441-448.

Watt, N.T., Whitehouse, I.J., and Hooper, N.M. (2010). The role of zinc in

Alzheimer's disease. Int J Alzheimers Dis 2011, 971021.

Webber, K.M., Raina, A.K., Marlatt, M.W., Zhu, X., Prat, M.I., Morelli, L., Casadesus,

G., Perry, G., and Smith, M.A. (2005). The cell cycle in Alzheimer disease: a

unique target for neuropharmacology. Mech Ageing Dev 126, 1019-1025.

Weiss, J.H., Sensi, S.L., and Koh, J.Y. (2000). Zn(2+): a novel ionic mediator of neural

injury in brain disease. Trends Pharmacol Sci 21, 395-401.


255 | P a g e

Winegar, B.D., and Lansman, J.B. (1990). Voltage-dependent block by zinc of single

calcium channels in mouse myotubes. The Journal of physiology 425, 563-578.

Wolk, A., Larsson, S.C., Johansson, J.E., and Ekman, P. (2006). Long-term fatty fish

consumption and renal cell carcinoma incidence in women. JAMA 296, 1371-

1376.

Wolozin, B. (2001). Peering into proteolysis with presenilins. J Alzheimers Dis 3, 191-

193.

Xiao, Z., D. Prieto, et al. (2005). Proteomic patterns: their potential for disease

diagnosis. Molecular and Cellular Endocrinology 230, 95-106.

Xu, L.Z., Sanchez, R., Sali, A., and Heintz, N. (1996). Ligand specificity of brain lipid-

binding protein. J Biol Chem 271, 24711-24719.

Yamamoto, N., Saitoh, M., Moriuchi, A., Nomura, M., and Okuyama, H. (1987).

Effect of dietary alpha-linolenate/linoleate balance on brain lipid compositions

and learning ability of rats. J Lipid Res 28, 144-151.

Yin HZ, L.A., Weiss JH. (1994). Kainate injury to cultured basal forebrain cholinergic

neurons is Ca21 dependent. . Neuroreport 5, 1477–1480.

Yokoyama, M., Koh, J., and Choi, D.W. (1986). Brief exposure to zinc is toxic to

cortical neurons. Neurosci Lett 71, 351-355.

Zhang, G., Panigrahy, D., Mahakian, L.M., Yang, J., Liu, J.Y., Stephen Lee, K.S.,

Wettersten, H.I., Ulu, A., Hu, X., Tam, S., et al. (2013). Epoxy metabolites of


256 | P a g e

docosahexaenoic acid (DHA) inhibit angiogenesis, tumor growth, and metastasis.

Proc Natl Acad Sci U S A 110, 6530-6535.

Zhang, L.H., Wang, X., Stoltenberg, M., Danscher, G., Huang, L., and Wang, Z.Y.

(2008). Abundant expression of zinc transporters in the amyloid plaques of

Alzheimer's disease brain. Brain Res Bull 77, 55-60.

Zhang, Y., Mukherjee, S., and Oldfield, E. (2005). (67)Zn NMR chemical shifts and

electric field gradients in zinc complexes: a quantum chemical investigation.

Journal of the American Chemical Society 127, 2370-2371.

Zheng, W., Wang, T., Yu, D., Feng, W.Y., Nie, Y.X., Stoltenberg, M., Danscher, G., and

Wang, Z.Y. (2010). Elevation of zinc transporter ZnT3 protein in the cerebellar

cortex of the AbetaPP/PS1 transgenic mouse. J Alzheimers Dis 20, 323-331.

Zlokovic, B.V. (2005). Neurovascular mechanisms of Alzheimer's

neurodegeneration. Trends Neurosci 28, 202-208.

Zlokovic, B.V., Deane, R., Sallstrom, J., Chow, N., and Miano, J.M. (2005).

Neurovascular pathways and Alzheimer amyloid beta-peptide. Brain Pathol 15,

78-83.

Omega-3 Fatty Acids and Zinc in Neuronal Cell Homeostasis...

Documents

Transcript of Omega-3 Fatty Acids and Zinc in Neuronal Cell Homeostasis...