O R-Rosen et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11288

1
O R-Rosen et al. Nature 000, 1-5 (2012) doi:10.1038/nature11288 Systematic mapping of binary interactions and protein complex associations between viral and host proteins.

description

Systematic mapping of binary interactions and protein complex associations between viral and host proteins. O R-Rosen et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11288. - PowerPoint PPT Presentation

Transcript of O R-Rosen et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11288

Page 1: O R-Rosen et al. Nature 000 , 1-5 (2012) doi:10.1038/nature11288

O R-Rosen et al. Nature 000, 1-5 (2012) doi:10.1038/nature11288

Systematic mapping of binary interactions and proteincomplex associations between viral and host proteins.

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo6

GI Motility online (May 2006) | doi:10.1038/gimo6

17 September 2009 doi:10.1038/nature08355 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×− ...

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature05202 LETTERS

doi:10.1038/nature05202 LETTERS

Nature Biotechnology: doi:10.1038/nbt

Nature Biotechnology: doi:10.1038/nbt

GI Motility online (May 2006) | doi:10.1038/gimo48

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592