Nucleic Acid Design Applications Polymerase Chain Reaction (PCR) Calculating Melting Temperature...

Nucleic Acid Design Applications

Polymerase Chain Reaction (PCR)

Calculating Melting Temperature (Tm)

PCR Primers Design

When Science named PCR and the polymerase that it employs as its first "Molecule of the Year" in 1989, the editor, Daniel Koshland Jr., provided a succinct explanation of PCR. He wrote:

"The starting material for PCR, the 'target sequence,' is a gene or segment of DNA. In a matter of hours, this target sequence can be amplified a million fold. The complementary strands of a double-stranded molecule of DNA are separated by heating. Two small pieces of synthetic DNA, each complementing a specific sequence at one end of the target sequence, serve as primers. Each primer binds to its complementary sequence. Polymerases start at each primer and copy the sequence of that strand. Within a short time, exact replicas of the target sequence have been produced. In subsequent cycles, double-stranded molecules of both the original DNA and the copies are separated; primers bind again to complementary sequences and the polymerase replicates them. At the end of many cycles, the pool is greatly enriched in the small pieces of DNA that have the target sequences, and this amplified genetic information is then available for further analysis."

PCR Concept: Amplification of a relatively short piece of DNA for manipulation or sequencing.

Driving phenomena of PCR: Heating and Cooling

Heating: Double-stranded DNA “comes apart” when heated to near boiling. This is also called “denaturing” or “melting”.

Cooling: Complementary DNA “comes together” when cooled. This is also called “renaturing”, “annealing” or “hybridizing”.

HEATING

COOLING

Double-Stranded DNA

Single-Stranded DNA

Molecular Basis of PCR: Polymerase Activity

A Polymerase is an enzyme that synthesizes DNA.1) DNA can ONLY be synthesized using the complementary strand!2) Polymerases synthesize DNA in the 5’ 3’ direction!

5’-GTCGATGTCTGATCAATTGGGCTGATCATGTCGATGATGCTAGAAT-3’ 3’CTACGATCTTA-5’

5’-GTCGATGTCTGATCAATTGGGCTGATCATGTCGATGATGCTAGAAT-3’ ACTAGTACAGCTACTACGATCTTA-5’

PCR uses the following reagents to AMPLIFY sections of DNA…

1) DNA template2) Polymerase3) Free Nucleotides (which are incorporated during DNA synthesis)4) PCR Primers

Primers are two short pieces of DNA (each with a unique sequence) that are complementary to the two different strands of the DNA template.

In line diagrams, the primers are designated as arrows, where the arrows point in the direction of 3’ DNA synthesis.

HEATING

Double-Stranded DNA

Single-Stranded DNA

5’

3’

3’

5’PCR Primers

This section of the DNA templatewill be amplified.

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3’3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5’

Double-Stranded DNA

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3’

3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5’

HEAT (95ºC, 30 seconds)

Single-Stranded DNA

COOL (60ºC, 30 seconds)

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3’ 3’-CCCTCCCCCACCGACCCCA-5’

5’-GGATGGAACACTGGGGGGA-3’3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5’

PCR Primer Annealing

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGT-3’ CTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5’

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGA3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCCCTCCCCCACCGACCCCA-5’

Polymerase Elongation

HEAT (72ºC, 30 seconds)



DNA Synthesis after 1 “cycle” of PCR = 1 double stranded DNA is now 2 “copies”

95ºC30 Sec.

60ºC30 Sec.

72ºC30 Sec.

1) Denaturing Step2) Primer Annealing Step3) Elongation Step

Time

Tem

pera

ture

95ºC30 Sec.

60ºC30 Sec.

72ºC30 Sec.

95ºC30 Sec.

60ºC30 Sec.

72ºC30 Sec.

95ºC30 Sec.

60ºC30 Sec.

72ºC30 Sec.

95ºC30 Sec.

60ºC30 Sec.

72ºC30 Sec.

“THERMOCYCLING”

Most PCR applications use 30 cycles (230 = 1.07 billion), representing an amplification of about 1 billion fold.

PCR Primers Design

1) Requires knowledge of the target sequence (i.e. we can’t use PCR to amplify an unknown sequence)

2) Use can designate subsection of gene to amplify.

3) Primers must have similar “melting temperatures” (e.g. 60ºC)


Based on thermodynamic binding properties of double-stranded DNA.

G-C pairing has higher energy than A-T binding!

There are many methods for calculating Tm, and generally speaking it is more important to use the same method (consistency) rather than making exact predictions (accuracy).

Common method;

Every G or C is assigned a value of 4ºC, and every A or T is assigned a value of 2ºC.

Tm = 4(G + C) + 2(A + T) ºC

Tm = 4(G + C) + 2(A + T) ºC

5’-ACGTGTGTCAGCTGTAGTCG-3’

=4 x C=7 x G

=3 x A=6 x T

= 11

= 9

Tm = 4(11) + 2(9)

Tm = 62ºC

This method of calculating Tm is limited to short sequences, and really only useful in PCR primer design, where the annealing temperature is expected to be near 60ºC.


For longer DNA-DNA melting temperature calculations, the following formula is suggested;

Tm = 81.5 + 16.6log(M of NaCl) + 0.41(%GC) – 0.65(%Formamide) – (500/length)

Amount of Salt (NaCl)in the reaction buffer

Percent of GC in theDNA hybridization

Length theDNA hybridization

Amount of Formamidein the reaction buffer

This method is commonly used in calculating the Tm of oligonucleotideprobes used in the DNA microarray assay platform (discussed later).


PCR Primers Design

Designate subsection of gene to amplify.

-OR –

Designate the desired length of the PCR product (amplified DNA).

GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGG

Example of PCR Primer Design

1) Target Sequence:

GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGCCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCC

2) Note that the complementary strand is present (but not shown in sequence file):

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGG-3’ 3’-CCTCCGTTGGCAATAGGTGGAGT-5’

5’-ATGGAACACTGGGGGGAGCC-3’ 3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCC-5’

3) Primers are extracted from sequence:

Amplified Region, which includes Primer Sequences

Primers (WRITTEN 5’ to 3’ !!!)

“Forward” Primer: ATGGAACACTGGGGGGAGCC“Reverse” Primer: TGAGGTGGATAACGGTTGCCTCC

5’-GGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGG-3’ 3’-CCTCCGTTGGCAATAGGTGGAGT-5’

5’-ATGGAACACTGGGGGGAGCC-3’ 3’-CCTACCTTGTGACCCCCCTCGGCTATGGGTCCTGTCCCGTCAGGACCTCCGTTGGCAATAGGTGGAGTCC-5’

Computationally, PCR Primer design involves the coordination of;

1) Selecting 2 different primers that are:a) Any distance apart (there are length limits in PCR!)b) -OR- A specified distance apart (e.g. “PCR product will be 300 base-pairs long”)c) -OR- Span a specific subsequence or “motif”

(e.g. “PCR product includes exons #1 and #2”)

2) Selecting 2 different primers that are nearly/exactly the same meltingtemperature (Tm). This is usually 60ºC.

3) Many times PCR Primers are designed with a “GC Clamp”. This simplymeans that the 3’ end of the primers is a G or a C, which binds moretightly (than AT) and the Polymerase initiates synthesis moreefficiently.

4) Finally, better results from PCR reactions occur if the two primers are not complementary to each other, or contain extensive palindromesequence.

>unknown gene provided by Dr. KaneGGATGGAACACTGGGGGGAGCCGATACCCAGGACAGGGCAGTCCTGGAGGCAACCGTTATCCACCTCAGGGAGGGGGTGGCTGGGGTCAGCCCCATGGAGGTGGCTGGGGCCAGCCTCATGGAGGTGGCTGGGGCCAACCTCATGGAGGTGGCTGGGGTCAGCTCCATGGTGGTGGCTGGGGACAGCCACATGGTGGTGGCTGGGGACAGCCACATGGTGGTGGAGGCTGGGGTCAAGGTGGTACCCACGGTCAATGGAACAAACCCAGTAAGCCAAAAACCAACATGAAGCATGTGGCAGGAGCTGCTGCAGCTGGAGCAGTGGTAGGGGGCCTTGGTGGCTACATGCTGGGAAGTGCCATGAGCAGGCCTCTTATACATTTTGGCAGTGACTAT

PCR Primer Design Demonstration:

70 Nucleotides Wide

Primer Specifications: 60ºC, product bigger that 100 bp, GC clamps.

1) Forward Primer: GAGCCGATACCCAGGACAGG (20 bases, Tm = 66)2) Reverse Primer: CCATGTGGCTGTCCCCAGCC (20 bases, Tm = 68)

1) Forward Primer: GAGCCGATACCCAGGACAGG (18 bases, Tm = 60)2) Reverse Primer: CCATGTGGCTGTCCCCAGCC (18 bases, Tm = 60)

xx

xx

xxxx

PCR Primer Design Process.

1) Establish Specificationsa) Target Geneb) PCR Product Size (not needed)c) Tm of Primer pair (must be nearly/exactly the same)d) GC Clamp (not needed)

2) Identify Candidate Primers START WITH 20 BASE PRIMER LENGTH!!!a) “Forward” Primer is derived from Target Sequence (5’-3’)b) “Reverse” Primer is;

i) To the “right” or “3’ direction” of the Forward Primerii) It is Complementary to the Target Sequence (3’-5’)!!!iii) It must be written 5’-3’ (inverted) to be correct convention.

3) Calculate Tm for each Primera) If calculated Tm is NOT at specified temperature, ADD or DELETE bases from end.

* OR *b) If calculated Tm is NOT at specified temperature, MOVE Primer sequence 1 or more bases.

4) Check Primers for “Primer-pair binding” (i.e. if the are primers significantly complementary with each other, they will bind to each other and decrease PCR reaction performance).

Nucleic Acid Design Applications Polymerase Chain Reaction (PCR) Calculating Melting Temperature...

Documents

Transcript of Nucleic Acid Design Applications Polymerase Chain Reaction (PCR) Calculating Melting Temperature...