NtrC-Dependent Regulatory Network for Nitrogen Assimilation in ...

JOURNAL OF BACTERIOLOGY, Oct. 2009, p. 6123–6135 Vol. 191, No. 190021-9193/09/$08.00�0 doi:10.1128/JB.00744-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

NtrC-Dependent Regulatory Network for Nitrogen Assimilation inPseudomonas putida�

Ana B. Hervas,1 Ines Canosa,1* Richard Little,2 Ray Dixon,2 and Eduardo Santero1

Centro Andaluz de Biología del Desarrollo, Universidad Pablo de Olavide/CSIC, Carretera de Utrera, Km. 1, 41013 Seville, Spain,1

and Department of Molecular Microbiology, John Innes Centre, Norwich NR4 7UH, United Kingdom2

Received 9 June 2009/Accepted 24 July 2009

Pseudomonas putida KT2440 is a model strain for studying bacterial biodegradation processes. However, verylittle is known about nitrogen regulation in this strain. Here, we show that the nitrogen regulatory NtrCproteins from P. putida and Escherichia coli are functionally equivalent and that substitutions leading topartially active forms of enterobacterial NtrC provoke the same phenotypes in P. putida NtrC. P. putida has onlya single PII-like protein, encoded by glnK, whose expression is nitrogen regulated. Two contiguous NtrC bindingsites located upstream of the �N-dependent glnK promoter have been identified by footprinting analysis. Invitro experiments with purified proteins demonstrated that glnK transcription was directly activated by NtrCand that open complex formation at this promoter required integration host factor. Transcription of genesorthologous to enterobacterial codB, dppA, and ureD genes, whose transcription is dependent on �70 and whichare activated by Nac in E. coli, has also been analyzed for P. putida. Whereas dppA does not appear to beregulated by nitrogen via NtrC, the codB and ureD genes have �N-dependent promoters and their nitrogenregulation was exerted directly by NtrC, thus avoiding the need for Nac, which is missing in this bacterialspecies. Based upon these results, we propose a simplified nitrogen regulatory network in P. putida (comparedto that in enterobacteria), which involves an indirect-feedback autoregulation of glnK using NtrC as anintermediary.

Global nitrogen regulation is a complex regulatory networkinvolving a number of signal transduction and effector pro-teins, which has been studied intensively for enterobacteria(reviewed in references 35 and 49). PII proteins play an essen-tial role in nitrogen regulation in different bacteria (24). Theirfunction is modulated by different effectors, by uridylylation bythe uridylyltransferase/uridylyl-removing enzyme (GlnD), orby other posttranslational modifications in other bacteria (7,50, 54). PII proteins control transcription of many nitrogen-regulated genes by regulating the kinase and phosphatase ac-tivities of NtrB, the sensor of the global two-component reg-ulatory NtrB/NtrC system, thus regulating the phosphorylationstate of the transcriptional activator NtrC. They also controlammonium assimilation through glutamine synthetase by mod-ifying its activity via adenylylation by the adenylyl-transferaseenzyme (GlnE), as well as the functions of other target pro-teins, such as the NifL/NifA regulatory system, controlling theexpression of nitrogen fixation genes, or the DraT/DraG sys-tem, which leads to nitrogenase switch-off in alphaproteobac-teria (18, 24). In enterobacteria, there are two paralogousgenes that encode PII proteins, glnB and glnK (57). The func-tions of GlnB and GlnK are partially redundant, and whileGlnB is produced constitutively, GlnK is expressed only undernitrogen-limiting conditions, as transcription of glnK is depen-dent on NtrC. While the arrangement of the two genes encod-ing PII proteins is conserved in most alpha- and betaproteobac-

teria, a number of gammaproteobacteria, such as Azotobacterand Pseudomonas species, have only the glnK ortholog (1).Expression of glnA-ntrBC and glnK-amtB is constitutive in Azo-tobacter vinelandii (41), but both operons appear to be nitrogenregulated in Pseudomonas putida (30; also see below). Simi-larly, most gram-positive bacteria possess only a GlnK-like PII

protein, while cyanobacteria possess a GlnB-like PII protein(1, 24).

In enterobacteria, most of the operons regulated by nitrogenhave promoters recognized by the alternative form of RNApolymerase holoenzyme containing the sigma factor �N. Tran-scription from �N-dependent promoters is strictly dependenton activation by an enhancer binding protein, which, in thecase of nitrogen-regulated promoters, is the phosphorylatedform of NtrC (NtrC-P). The mechanism of transcription acti-vation at these promoters involves initial phosphorylation ofthe NtrC dimer and further oligomerization facilitated by bind-ing of NtrC-P to specific DNA sequences that function asenhancers located at a position relatively distant from thepromoter. Subsequently, the enhancer-bound activator inter-acts with �N RNA polymerase bound to the promoter viaformation of a DNA loop of the intervening DNA to catalyzethe isomerization of the closed promoter complexes into thetranscriptionally productive open complexes in a reaction thatrequires ATP hydrolysis (59–61). Efficient transcription activa-tion at a number of �N-dependent promoters, some of whichare activated by NtrC, also requires the nucleoid-associatedprotein integration host factor (IHF). IHF binds between thepromoter and the enhancer and induces a bend in the DNAupon binding that assists the interaction of the closed complexand the enhancer-bound transcriptional activator (31, 52),while preventing activation by other transcriptional activators

* Corresponding author. Mailing address: Centro Andaluz deBiología del Desarrollo, Universidad Pablo de Olavide/CSIC, Car-retera de Utrera, Km. 1, 41013 Seville, Spain. Phone: 34-954349052.Fax: 34-954349376. E-mail: [email protected].

� Published ahead of print on 31 July 2009.

6123

on April 11, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

that are not bound to the DNA at the appropriate location(47, 58).

A subset of nitrogen-regulated operons in Escherichia coliand Klebsiella species contain promoters that are recognized by�70 RNA polymerase holoenzyme. Transcription of theseoperons is regulated by the nitrogen assimilation control pro-tein (Nac), a LysR-type regulator (8, 49). Genes or operonsactivated by Nac in E. coli are involved in transport of nitro-genated molecules that may serve as nitrogen sources (63). InKlebsiella pneumoniae, utilization of urea and some amino ac-ids is activated by Nac as well as the codBA operon (8, 16, 32,37). Nac does not respond to nitrogen availability, but its tran-scription is nitrogen regulated via NtrC (8, 22). Thus, Nac actsas an adapter that couples the transcription of �70-dependentoperons to the nitrogen regulation exerted by the global tran-scriptional activator of �N-dependent promoters by NtrC (63).

P. putida KT2440 is a model strain for studying bacterialbiodegradation processes because of its versatility and ease ofmanipulation. It has more than 65 sensor-regulator pairs,which make it able to adapt to very different conditions, in-cluding nutrient deprivation (44, 55). In spite of this, much lessis known about nitrogen regulation in pseudomonads than inother bacteria. A number of studies suggest that the regulatorysystem in Pseudomonas may share many features with that inenterobacteria. The ntrB, ntrC, and rpoN genes are found inthe genomes of different Pseudomonas species. Mutants lack-ing �N are impaired in utilization of a number of nitrogensources (34, 56). Similarly, mutational analysis of the ntrCorthologs identified in Pseudomonas indicates that NtrC is themaster nitrogen regulator, which is required to activate theexpression of a number of genes involved in nitrogen uptakeand metabolism (30), including the glnA-ntrBC operon and theatzDEF operon, required for utilization of cyanuric acid as anitrogen source (26), utilization of nitrite and trinitrotoluenein P. putida JLR11 (12), and nitrogen fixation in Pseudomonasstutzeri (17). However, other features of nitrogen regulation inPseudomonas are different from those in enterobacteria. First,there is only one gene encoding a PII protein, which was des-ignated glnK because of the similarity of its product to otherGlnK PII proteins and its immediacy to the amtB gene, encod-ing the high-affinity ammonium transporter. Global transcrip-tome analysis of P. putida suggests that both glnK and amtB areregulated by nitrogen availability via NtrC (30). Second, P.putida lacks an ortholog of Nac, the adapter that allows co-regulation by nitrogen of �N- and �70-dependent promoters inenterobacteria. Finally, a different two-component regulatorysystem, designated CbrA/CbrB, appears to regulate operonsfor utilization of amino acids that can be used as carbon andnitrogen sources, which are also regulated by the NtrB/NtrCsystem (45, 62).

In this paper, we show that E. coli and P. putida NtrCproteins are functionally equivalent. We have characterizedthe P. putida glnK promoter and its transcriptional activationby NtrC in vitro. Furthermore, we show that P. putida nitrogen-regulated genes orthologous to those activated by Nac in en-terobacteria have �N-dependent promoters that are directlyactivated by NtrC; therefore, nitrogen-regulated expression ofthese genes in P. putida does not require a second tier ofregulation exerted by Nac on �70-dependent genes.

MATERIALS AND METHODS

Bacterial strains and growth conditions. The bacterial strains used in thiswork and their genotypes are summarized in Table 1. Cells were grown inminimal medium (39) containing 25 mM sodium succinate for P. putida or 11mM glucose for E. coli. Nitrogen sources were ammonium chloride (1 g liter�1)or L-serine (1 g liter�1) for P. putida and ammonium chloride (1 g liter�1) orL-glutamine (0.15 g liter�1) for E. coli. When required, Luria-Bertani (LB)medium was used as a rich medium. Cultures were grown in culture tubes orflasks with shaking (180 rpm) at 30°C for P. putida and 37°C for E. coli. Antibi-otics and other additions were used at the following concentrations, when re-quired: ampicillin (only for E. coli), 100 mg liter�1; carbenicillin (only for P.putida), 500 mg liter�1; rifampin (rifampicin), 20 mg liter�1; tetracycline, 5 mgliter�1; chloramphenicol, 15 mg liter�1; kanamycin, 20 mg liter�1; and 5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside (X-Gal), 25 mg liter�1. All reagentswere purchased from Sigma-Aldrich.

Construction of plasmids. The plasmids used in this work are summarized inTable 1. All DNA manipulations were performed according to standard proce-dures (51). Plasmid DNA preparation and purification kits were purchased fromMacherey-Nagel and GE Healthcare, respectively, and used according to themanufacturer’s instructions. Plasmid DNA was transferred by transformation(15) to E. coli strains or by triparental mating to P. putida strains (20). E. coliDH5� was used as a host strain in cloning procedures.

Transcriptional lacZ gene fusions to the promoters of interest were con-structed by PCR amplification of the promoter region, using genomic DNAfrom P. putida KT2442 as a template. The oligonucleotides used for PCRamplification were the following: for pMPO313 (glnK fusion), P5234_fwd andP5234_rev; for pMPO340 (dppA [PP0885] long fusion), P0885_fwd andP0885_rev; for pMPO341 (dppA [PP0885] short fusion), P0885_fwd_cortoand P0885_rev; for pMPO342 (codB long fusion), PcodB_fwd and PcodB_rev;for pMPO343 (codB short fusion), PcodB_fwd_corto and PcodB_rev; and forpMPO346 (ureD fusion), PureD_fwd and PureD_rev. Oligonucleotide sequencesare listed in Table 1. These PCR products were cloned in the transcriptional fusionvector pMPO234. Plasmid pMPO316 was constructed by cloning in pTE103 thesame fragment obtained by PCR with the oligonucleotides P5234_fwd andP5234_rev as for the glnK fusion. The NtrC(D55E,S161F) overproduction plasmidpMPO321, based on the pT7-7 vector, was constructed by substitution of wild-typentrC in pMPO231 with ntrC(D55E,S161F) from pMPO310 (see below). All clonedPCR products were subsequently sequenced.

Construction of ntrC(D55E,S161F). The D55E mutation was generated byPCR with the mutagenic primer NtrCasp55-rev and the nonmutagenic primerNtrCasp55-fwd, using pMPO230 as the template. The PCR product was digestedwith SphI and NdeI and cloned in the expression vector pMPO243 digested withSphI and NdeI, thus yielding pMPO308.

The S161F mutation was generated by overlap extension PCR essentially asdescribed previously (13), using pMPO305 as the template and the mutagenicoligonucleotides NtrCser161-rev1 and NtrCser161-fwd2 with the external non-mutagenic oligonucleotides NtrCser161-fwd1 and NtrCser161-rev2, respectively.The final PCR product was cloned in pMPO243 to yield pMPO309.

The double mutant ntrC version encoding the D55E and S161F substitutionswas finally generated by replacement of the wild-type 5� end of ntrC in pMPO309with the same fragment carrying the D55E mutation from pMPO308, resulting inplasmid pMPO310, which carries ntrC(D55E,S161F).

Purification of NtrC(D55E,S161F). Two liters of culture of E. coli NCM631harboring pMPO321 and pIZ227 was grown to an optical density at 600 nm of 0.3to 0.5 at 37°C and then transferred to a 20°C shaker. After 20 min, IPTG(isopropyl-�-D-thiogalactopyranoside) was added to a final concentration of 0.5mM, and the culture was incubated at 20°C overnight. Cells were then harvestedby centrifugation, resuspended in 20 ml of sonication buffer (50 mM Tris-HCl,pH 8, 10% glycerol, 0.1 mM EDTA, 1 mM dithiothreitol [DTT], and 10 mMNaCl), and broken by sonication. After elimination of cell debris by centrifuga-tion, NtrC(D55E,S161F) was purified from the supernatant by selective precip-itation with ammonium sulfate in the range of 30% to 40% saturation, resus-pended in storage buffer (50 mM Tris-HCl, pH 8, 20% glycerol, 0.1 mM EDTA,1 mM DTT, and 10 mM NaCl), and dialyzed against 2 liters of the same bufferat 4°C overnight to remove ammonium sulfate. Purity was estimated visually bysodium dodecyl sulfate-polyacrylamide gel electrophoresis to be �90%. Concen-tration was determined by the Bradford protein assay (10) and is expressed in nMof a dimer. Protein samples were stored at �80°C.

�-Galactosidase assays. To assay the nifLA-lacZ translational fusion in E. coli,preinocula grown in minimal medium under nitrogen excess conditions (ammo-nium chloride and L-glutamine) were diluted in the same medium or minimalmedium with L-glutamine as the nitrogen source (nitrogen-limiting conditions).

6124 HERVAS ET AL. J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

TABLE 1. Bacterial strains, plasmids, and oligonucleotides used in this work

Name Relevant characteristic(s) or sequence Reference or source

StrainsE. coli

DH5� �80dlacZ�M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17 supE44 thi-1 gyrA relA1 29ET8556 rbs lacZ::IS1 gyrA hutCk ntrC1488 38NCM631 hsdS gal DE3::lacI lacUV5::gene1 (T7 RNA polymerase) �lac linked to Tn10 27

P. putidaKT2440 mt-2 hsdR1 hsdM� 6KT2440-IHF3 mt-2 hsdR1 hsdM� �ihfA::Km 40KT2442 mt-2 hsdR1 hsdM� Rifr 25MPO201 mt-2 hsdR1 hsdM� Rifr �ntrC::Tc 26

PlasmidspIZ227 pACYC184 containing lacIq and the T7 lysozyme gene, Cmr 27pMPO224 nifLA-lacZ translational fusion in a broad-host-range vector Garcıa-Gonzalez et al.,

unpublishedpMPO230 pUC19-derived plasmid with P. putida wild-type ntrC, Apr Garcıa-Gonzalez et al.,

unpublishedpMPO231 Expression vector based on pT7-7 to overproduce NtrC, Apr Garcıa-Gonzalez et al.,

unpublishedpMPO234 Broad-host-range trp-lacZ transcriptional fusion vector, based on pBBR1MCS-4, Apr Garcıa-Gonzalez et al.,

unpublishedpMPO243 NtrC (with an NdeI site at the first ATG) expressed from PlacUV5 in a pACYC184-

derived plasmid, CmrGarcıa-Gonzalez et al.,

unpublishedpMPO305 pUC19-derived plasmid with a glnA-ntrBC operon, Apr UnpublishedpMPO308 NtrC(D55E) expressed from PlacUV5 in a pACYC184-derived plasmid, Cmr This workpMPO309 NtrC(S161F) expressed from PlacUV5 in a pACYC184-derived plasmid, Cmr This workpMPO310 NtrC(D55E,S161F) expressed from PlacUV5 in a pACYC184-derived plasmid, Cmr This workpMPO313 glnK-lacZ transcriptional fusion in pMPO234 carrying the sequence between

positions �371 and �151,a AprThis work

pMPO316 glnK upstream sequence between positions �371 and �151 in pTE103,a Apr This workpMPO321 Expression vector derived from pMPO231 to overproduce NtrC(D55E,S161F) This workpMPO340 dppA-lacZ transcriptional fusion in pMPO234 carrying the sequence between

positions �319 and �219bThis work

pMPO341 dppA-lacZ transcriptional fusion in pMPO234 carrying the sequence betweenpositions �122 and �219b

This work

pMPO342 codB-lacZ transcriptional fusion in pMPO234 carrying the sequence betweenpositions �251 and �191b

This work

pMPO343 codB-lacZ transcriptional fusion in pMPO234 carrying the sequence betweenpositions �67 and �191b

This work

pMPO346 ureD-lacZ transcriptional fusion in pMPO234 carrying the sequence betweenpositions �268 and �199b

This work

pRK2013 Helper plasmid in conjugation, Kmr Tra� 23pTE103 In vitro transcription vector derived from pUC8 19

Oligonucleotidesfoot0885-1 GCAAGAAAGCTTGGTGGATGGCACGGGCTTfoot0885-2 GAAAGTAAGCTTAACGTAAATGGATGTCGCfootcodB1 GACCGTAAGCTTCGCCGTGGGCTGGGTGATfootcodB2 CTCCGGAAGCTTAGTTGGGAGCAGAAAGAGfootglnK1 CAGCATAAGCTTACAAATCTTGGGGGGCGCfootglnK2 GCCAGTAAGCTTAAAGCGCCGAAAAACAGCfootureD1 GCCGTGAAGCTTTTCGATTACTGAGGCTTGfootureD2 CAAATTAAGCTTCTGGATATAGCAGGTTGCNtrCasp55-fwd ATACCGCTCGCCGCAGCCGAACNtrCasp55-rev CCAGGCATGCGAATTTCGGAAATGATCACGTCNtrCser161-fwd1 CATACCGCCTTCTCGATTTACCTNtrCser161-fwd2 GCCGCCTCAGCCACTTCAACATCACCGTGCTNtrCser161-rev1 AGCACGGTGATGTTGAAGTGGCTGAGGCGGCNtrCser161-rev2 TGAGGATCTTCGGCTCGACTGCP0885_fwd GCCGAATTCAAGTGCAGATGCCATAAGP0885_fwd_corto GAAGAATTCCGCAAAACGCCATCATTTP0885_rev GAAGGATCCCCCGGTGGTGTACTGCCCP5234_fwd GCGGAATTCTGGGGCTGTCCACTGAAAP5234_rev GACGGATCCCATGAAACTCTCTCCCGAPcodB_fwd TTCGAATTCCTGGCAGGGATTTTTGGCPcodB_fwd_corto GCTGAATTCTGCACAGTGCATATGGATPcodB_rev CAAGGATCCATGCCATGCCCAGCTTGCPEX0885 GCCTTCGGAGCAGAACACCAGGTTGGATGCPEXglnK CAGGAAAACAAACCCGTCTCAAGTCTAAGC

Continued on following page

VOL. 191, 2009 NITROGEN REGULATION IN P. PUTIDA 6125


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

After incubation for 2 h, IPTG to a final concentration of 0.1 mM was added toinduce expression of P. putida ntrC from the plasmids. Samples were taken 3.5 hlater, and �-galactosidase activity was measured as previously described (42).

For transcriptional fusions, preinocula of E. coli or P. putida strains grown inminimal medium under nitrogen excess conditions (ammonium chloride plusL-serine for P. putida and ammonium chloride plus L-glutamine for E. coli) werediluted in minimal medium under nitrogen excess or under nitrogen limitation(L-serine for P. putida and L-glutamine for E. coli) conditions. Samples of thecultures grown to mid-exponential phase were taken 6 h later, and �-galactosi-dase activity was assayed (42).

Values of �-galactosidase activity are the averages from assays performed withat least three independent cultures.

RNA preparation and primer extension. Total RNA from P. putida KT2442 orMPO201 grown to mid-exponential phase under nitrogen excess or nitrogenlimitation conditions was prepared essentially as previously described (26).Primer extension reactions were performed as previously described (28), with 20g of RNA from each condition as the template, using the 32P-end-labeledprimers PEXglnK and PEX0885 in reaction mixtures containing Superscript IIreverse transcriptase (Invitrogen, Carlsbad, CA). Sequencing reactions wereperformed with a Thermo Sequenase cycle sequencing kit (USB, Cleveland,OH), according to the manufacturer’s instructions. Samples were run on 6%polyacrylamide-urea sequencing gels, and the gels were dried, exposed to radi-osensitive screens, and finally scanned with a Typhoon 9410 scanner (GE Health-care).

DNase I footprinting. DNase I footprinting assays were run essentially asdescribed previously (48), except for the footprinting buffer (10 mM Tris-acetate,pH 8, 100 mM potassium acetate, 8 mM magnesium acetate, 27 mM ammoniumacetate, 5% glycerol, 0.67 mM CaCl2, 1 mM DTT, 5 g bovine serum albumin).As competitor DNA, 0.33 mg ml�1 salmon sperm DNA for NtrC or 20 g ml�1

of poly(dI-dC) for IHF footprinting was used in the reaction buffer. Probes forDNase I footprinting were generated by PCR amplification using the followingoligonucleotides: for NtrC and IHF footprinting at the glnK promoter, footglnK1and P5234_rev for the top strand and footglnK2 and P5234_fwd for the bottomstrand; for the PP0885 promoter, foot0885-1 and P0885_rev for the top strandand foot0885-2 and P0885_fwd for the bottom strand; for the codB promoter,footcodB1 and PcodB_rev for the top strand and footcodB2 and PcodB_fwd forthe bottom strand; and for the ureD promoter, footureD1 and PureD_rev for thetop strand and footureD2 and PureD_fwd for the bottom strand. Amplifiedprobes were digested with HindIII and strand specifically labeled with[�-32P]dCTP by Klenow filling in the 5� overhanging ends. A sequencing reactionperformed with a Sequenase 2.0 kit (USB) using an oligonucleotide specific forthe labeled strand in each case (secglnK1 and -2 for glnK, sec0885-1 and -2 fordppA, seccodB1 and -2 for codB, and secureD1 and -2 for ureD) was run with thepartially digested DNA as a size marker. Gels were processed and analyzed asdescribed for primer extension analysis.

Open complex assays. Open complex assays to test glnK promoter activationby NtrC were performed essentially as described previously (36). Linearizedtemplate DNA was obtained by digestion of pMPO316 to yield a 540-bp frag-ment containing the upstream intergenic region of glnK. The fragment waslabeled with [�-32P]dCTP. Reaction mixtures were made in a final volume of 15l in binding buffer with 40,000 cpm 32P-labeled template, 3.4 ng l�1 denaturedsalmon sperm DNA, 7.5 g bovine serum albumin, 4 mM ATP, 100 nM P. putidacore RNA polymerase, and 200 nM P. putida �N. This mixture was incubated for2 min at 30°C, and then reactions were initiated by the addition of 200 nM of

NtrC and 0.5 mM of GTP, UTP, or CTP, as an additional nucleotide. Whenrequired, 75 nM of E. coli IHF was added at the same time as NtrC. After 20 minof incubation at 30°C, reaction products were mixed with 3 l of a solutioncontaining 20% glycerol, 0.033% bromophenol blue, 0.033% xylene cyanol, 6.67mM Tris-HCl, pH 8, 0.67 mM EDTA, and 2 g of heparin. Reaction mixtureswere loaded in 4% polyacrylamide gels (acrylamide-bisacrylamide, 29:1) whichhad been prerun at 4°C. The gels were run at 4°C, dried, exposed to radiosen-sitive screens, and finally scanned with a Typhoon 9410 scanner (GE Health-care).

RESULTS

Construction of a P. putida ntrC constitutive allele. In orderto study the function of P. putida NtrC in the absence of NtrBin vitro, we constructed a derivative of ntrC encoding the sub-stitutions D55E and S161F, equivalent to D54E and S160F inSalmonella enterica NtrC, which give rise to a form of the activatorthat does not require phosphorylation by NtrB to activate tran-scription (33). The function of P. putida NtrC(D55E,S161F) inthe NtrC� mutant strain of E. coli ET8556 was then charac-terized by analyzing the expression of a Klebsiella oxytoca trans-lational nifLA-lacZ fusion known to be activated by NtrC in K.oxytoca (43), A. vinelandii (53), and other diazotrophs. Asshown in Fig. 1, �-galactosidase activity levels in the mediumcontaining glutamine as the sole nitrogen source indicated thatboth the mutant and the wild-type alleles of P. putida ntrCcomplemented NtrC function in E. coli. Under nitrogen excessconditions, the levels of �-galactosidase activity of the nifLA-lacZ fusion in the strain producing wild-type NtrC were 30-foldlower than those under nitrogen-limiting conditions, thusshowing that the activity of P. putida NtrC can be regulatedin E. coli in response to nitrogen availability, presumablythrough E. coli NtrB. On the other hand, the strain produc-ing NtrC(D55E,S161F) expressed nifLA under nitrogen ex-cess conditions to 60% of the levels obtained under nitro-gen-limiting conditions, which indicated that the activity ofNtrC(D55E,S161F) was independent of NtrB activation.

Nitrogen regulation of glnK. Previous global transcriptomeanalysis showed that expression of glnK, encoding the onlyPII-like protein in P. putida, is likely to be subject to nitrogenregulation mediated by NtrC (30). With the aim of character-izing the role of NtrC in the activation of glnK, the expressionof a glnK-lacZ gene fusion in the wild-type P. putida strainKT2442 and its �ntrC derivative MPO201 (26) was studied(Table 2). When serine was used as the sole nitrogen source(nitrogen-limiting conditions), expression of the glnK-lacZ fu-

TABLE 1—Continued

Name Relevant characteristic(s) or sequence Reference or source

PureD_fwd AAGGAATTCACCTGTCGATTGCGCAGAPureD_rev CCGGGATCCTGGACAAAGCGCAACTGCsec0885-1 ACGGCGGTGGATGGCACGGGCTTsec0885-2 GTACGAACGTAAATGGATGTCGCseccodB1 TAAACCGCCGTGGGCTGGGTGATseccodB2 TTTGTAGTTGGGAGCAGAAAGAGsecglnK1 AAGGCACAAATCTTGGGGGGCGCsecglnK2 CCGACAAAGCGCCGAAAAACAGCsecureD1 ACCGCTTCGATTACTGAGGCTTGsecureD2 GCAGGCTGGATATAGCAGGTTGC

a Coordinates are related to the transcriptional start of the gene.b Coordinates are related to the to the first G of the �24 box of the promoter.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

sion was induced almost 30-fold, thus demonstrating that ex-pression of glnK is nitrogen regulated in P. putida. On the otherhand, there was no glnK-lacZ induction (less than twofold) inthe �ntrC mutant strain, thus indicating that NtrC directly orindirectly mediates nitrogen regulation of glnK in the wild-typestrain.

Regulation of P. putida glnK expression in the wild-type andntrC mutant strains of E. coli complemented with either P.putida ntrC or ntrC(D55E,S161F) was also analyzed. As shownin Table 2, glnK-lacZ expression in wild-type E. coli was in-duced more than 100-fold under nitrogen-limiting conditions,while it was barely induced (2.5-fold) in the ntrC mutant strain.Complementation with P. putida ntrC resulted in 33-fold in-duction under nitrogen-limiting conditions, while complemen-tation with ntrC(D55E,S161F) resulted in high constitutive ex-pression under all conditions.

Nitrogen regulation of glnK expression was also observed

by mapping the glnK transcriptional start site under nitro-gen-limiting and nitrogen excess conditions. As shown inFig. 2A, a single glnK transcript starting at a G was evidentonly when the total RNA used for the 5� mapping came fromP. putida KT2442 grown under nitrogen-limiting conditions.Upstream from the transcription initiation site, a sequence fora potential �N-dependent promoter bearing the consensusGG-N10-GC was identified (Fig. 2B). Farther upstream, twoputative NtrC binding sites were also identified. Both putativesites are on the same face of the DNA helix, since their centersare separated by 33 bp. The most proximal binding site, whichis separated from the putative �N-dependent promoter by 73bp, is centered at position �110 with respect to the transcrip-tional start site. Both sequence similarity and relative positionsof the cis-acting sequences fit well with the arrangement of aregulated �N-dependent promoter directly activated by NtrC(14, 30).

In vitro characterization of NtrC-mediated activation of glnK.To study P. putida NtrC function in vitro, transcription and trans-lation of ntrC(D55E,S161F) were coupled to the expression vectorpT7-7. After induction with IPTG, NtrC(D55E,S161F) was thepredominant product in the soluble fraction and was easilypurified by selective precipitation to �90% homogeneity, asassessed by Coomassie blue staining of sodium dodecyl sulfate-polyacrylamide gels (data not shown).

Interaction of purified NtrC(D55E,S161F) with the pro-moter region was analyzed by DNase I footprinting (Fig. 3).For each strand, two windows of protection, spanning from�101 to �125 and from �133 to �159 on the top strand andfrom �95 to �120 and from �131 to �154 on the bottomstrand, were evident. Each protected window covered the cor-responding NtrC binding site previously identified by sequenceanalysis (Fig. 3A and B). Regardless of the labeled strand, aposition showing increased sensitivity to DNase I was also veryevident within each protected window. These data clearly in-dicate that NtrC binds to two binding sites in the glnK pro-moter regulatory region.

We examined the NtrC dependence of transcription fromthe glnK promoter region by analyzing open complex forma-

FIG. 1. Expression of a nifLA-lacZ translational fusion in E. colintrC mutant strain ET8556 complemented with P. putida ntrC. Blackbars, empty vector control; gray bars, wild-type P. putida ntrC; whitebars, P. putida constitutive ntrC(D55E,S161F) mutant. Values are av-erages from at least three independent measurements. Error barsindicate standard deviations of the means.

TABLE 2. Expression of glnK-lacZ fusion in P. putida and E. coli

Fusionplasmid Structure Strain Other plasmid

�-Galactosidase activitya

(Miller units � SD)

Nitrogen excess Nitrogen limitation

P. putidapMPO313 glnK-lacZ KT2442 1,167 � 166 33,204 � 4,453pMPO234 Empty vector KT2442 177 � 22 153 � 19pMPO313 glnK-lacZ MPO201 (NtrC�) 908 � 126 1,477 � 90pMPO234 Empty vector MPO201 (NtrC�) 192 � 31 152 � 12

E. colipMPO313 glnK-lacZ ET8000 130 � 35 13,783 � 1,774pMPO234 Empty vector ET8000 741 � 178 1,024 � 260pMPO313 glnK-lacZ ET8556 (NtrC�) pMPO243 (ntrC) 259 � 31 8,474 � 201pMPO234 Empty vector ET8556 (NtrC�) pMPO243 (ntrC) 535 � 48 626 � 70pMPO313 glnK-lacZ ET8556 (NtrC�) pMPO310 ntrC(D55E,S161F)� 10,087 � 1,714 10,212 � 678pMPO234 Empty vector ET8556 (NtrC�) pMPO310 ntrC(D55E,S161F)� 755 � 101 754 � 139pMPO313 glnK-lacZ ET8556 (NtrC�) 189 � 17 469 � 68pMPO234 Empty vector ET8556 (NtrC�) 875 � 148 1,637 � 205

a For P. putida, serine was the nitrogen source, and for E. coli, glutamine was the nitrogen source under nitrogen-limited conditions (see Materials and Methods).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

tion using purified components. The formation of open pro-moter complexes may be stabilized by the addition of theinitiating nucleotide, which allows assessment of activation atpromoters where open complexes are unstable (21). We there-fore tested open complex formation using a labeled DNAfragment covering the glnK promoter region from �371to �151 by adding the required ATP and an additional nucle-otide. As shown in Fig. 4, NtrC stimulated the isomerization ofthe closed promoter-polymerase complex to the open complexcompetent for transcription initiation in the presence of IHF,ATP, and an initiator nucleotide. Open complex formation wasmost efficient in the presence of GTP, which is consistent withthe results of the 5� mapping of the glnK transcript (Fig. 2).

The addition of IHF was required to detect open complexesunder our in vitro experimental conditions. Requirement ofthe coactivator IHF was also observed in vivo by analyzingexpression of the glnK-lacZ gene fusion in strain KT2440 andits derivative IHF-deficient strain KT2440-IHF3. Induction ofglnK under nitrogen-limiting conditions in KT2440 resulted inthe expression of 46,327 � 2,733 Miller units. Expression ofglnK in the IHF-deficient strain was also induced under nitro-gen-limiting conditions, but the expression level in this casewas only 10,312 � 2,872 Miller units, 22% of the level for thewild-type strain. Although the requirement for IHF is not sostrong in vivo, these data clearly indicate a direct involvementof IHF in transcriptional activation at the glnK promoter of P.putida. This implies binding of IHF to the promoter regulatoryregion between the promoter and the activator binding sites.Sequence inspection revealed a T-rich region closely upstreamof the GG-N10-GC promoter sequence, which might constitutean IHF binding site. A DNase I footprinting assay of IHFshowed its binding to this region, covering from coordinates�38 to �72 from the transcription start site (Fig. 5). Thisregion coincides very well with the previously predicted bind-ing site for IHF in the promoter region of glnK (Fig. 2B).

NtrC directly activates nitrogen-regulated genes that areactivated by the Nac regulator in enterobacteria. Out of the 22Pseudomonas genomes surveyed, a Nac ortholog showing at

least 50% identity to Nac from enterobacteria was detected inonly 3 of them. In addition, mutational analysis of the putativeNac ortholog of P. fluorescens strain SBW25 indicated thatexpression of the hut operon, which is regulated by NtrB/Cand CbrA/B, was not affected (62). Therefore, it appears thatPseudomonas strains do not generally have a Nac protein,which serves as an adaptor between NtrC and certain nitro-gen-regulated genes. We were thus interested to investigatewhether P. putida has genes orthologous to those activatedby Nac in enterobacteria and, if so, to determine how theirexpression is regulated.

In P. putida, we found potential orthologues of the six Nac-activated operons in enterobacteria, but only dpp, ure, and codwere previously identified as being regulated by nitrogen andNtrC (30). In fact, nitrogen regulation and NtrC dependenceof P. putida dppA were not very obvious from the genomicmicroarray analysis, since this gene barely meets the require-ments to be unambiguously considered nitrogen regulated byNtrC (30). Analysis of sequences upstream of the first gene ofeach operon, carried out using the algorithm to identify NtrCbinding sites in the P. putida genome (30), revealed the exis-tence of potential binding sites for NtrC in all of them. Inaddition, putative GG-N10-GC �N-dependent promoter se-quences were identified upstream of the respective coding se-quences. The putative NtrC binding sites of ureD, dppA, andcodB were centered at positions �78, �161, and �72, respec-tively, from the GG dinucleotide at �24, which is characteristicof �N-dependent promoters.

Transcriptional lacZ fusions to the first gene of each operonwere constructed. In the case of dppA and codB, transcrip-tional fusions that lacked the putative NtrC binding sites in therespective promoters were also constructed. In spite of thesubstantial basal level of expression of the ureD-lacZ genefusion under nitrogen excess, its expression was induced inKT2442 under nitrogen-limiting conditions almost 10-fold. Inthe �ntrC strain, ureD-lacZ basal expression was slightly higherthan that in the wild-type strain, but it was not substantiallyinduced under nitrogen-limiting conditions (1.2-fold induc-

FIG. 2. Primer extension analysis of the glnK transcript. (A) Primer extension reaction mixture with total RNA prepared from cultures of P.putida KT2442 grown under nitrogen-sufficient (NS, ammonium plus serine) or nitrogen-limiting (S, serine) conditions. GATC lanes show thesequencing ladder (noncoding strand). (B) Sequence of the glnK promoter region, showing the putative NtrC binding sites (open boxes), the �N

promoter (sequence underlined with black boxes), and the IHF binding site (dotted box). The transcription initiation site (G in bold with an arrow)and the translation initiation site (underlined ATG) are also highlighted for comparison.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

FIG. 3. NtrC DNase I footprint of the glnK promoter region. (A) Top- and bottom-strand footprint patterns. Predicted NtrC binding sites (openboxes), protected regions (black bars), and hypersensitive positions (dots) are marked. NtrC(D55E,S161F) concentrations were 0, 50, 100, 200, and500 nM for each strand. The coordinates are relative to the glnK transcriptional start site. (B) Schematic representation of the protected regionson the sequence of the glnK promoter, with the same indications as for the footprint pattern.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

tion). This confirmed the NtrC requirement for high levels ofexpression from the ureD promoter (Fig. 6A).

Similarly, expression of the codB-lacZ gene fusion contain-ing the complete upstream region of the codB promoter wasvery efficiently induced (50-fold induction) under nitrogen-limiting conditions in the KT2442 strain (Fig. 6B). This induc-tion was severely reduced in the codB-lacZ fusion lacking theputative NtrC binding site (17,848 versus 1,165 Miller units).About 70% of this residual activity still appears to be depen-dent on NtrC. In the �ntrC strain, codB-lacZ expression wasclearly reduced (fivefold lower than that for the wild-typestrain), thus showing the NtrC requirement for activation.However, a residual activation of codB independent of NtrCwas still evident. Intriguingly, this activation requires DNAsequences upstream from the promoter.

The expression pattern of dppA was clearly different fromthose of the other two genes (Fig. 6C). In the first place,expression of the dppA-lacZ gene fusion containing the com-plete promoter sequence was very high under nitrogen-suffi-cient conditions, and this expression was independent of NtrC,since the expression level was even higher in the �ntrC back-ground. Deletion of the putative NtrC binding site upstream ofthe dppA promoter resulted in a 2.5-fold reduction of expres-sion levels. However, this reduction was also observed in the�ntrC background, suggesting that the observed decrease inpromoter activity is not associated with the loss of the NtrCbinding site. Under nitrogen-limiting conditions, the expres-sion levels of the dppA-lacZ fusion containing the completedppA promoter sequence increased by a factor of �2-fold butagain the level of dppA expression was not influenced by thepresence of NtrC, which indicated a major expression of dppAindependent of NtrC-mediated nitrogen regulation.

To shed more light on the regulation of dppA, 5� mapping ofdppA transcripts isolated from cultures grown under nitrogen-sufficient and nitrogen-limiting conditions was performed withstrain KT2442 and its �ntrC derivative. As shown in Fig. 7, amajor transcript initiating at a G residue was evident in bothstrains under all conditions. However, a minor transcript ini-

tiating at a C residue 2 nucleotides upstream was inducedunder nitrogen-limiting conditions. Sequences resembling thatof a �N-dependent promoter were found 12 nucleotides up-stream from the nitrogen-regulated transcription start site

FIG. 4. Open complex formation at the glnK promoter. The pres-ence (�) or absence (�) of NtrC(D55E,S161F) and/or IHF in eachreaction mixture is indicated. ATP (final concentration, 4 mM) waspresent in all reaction mixtures to promote catalysis of open complexformation by NtrC. Where indicated above each lane, an additionalnucleotide (final concentration, 0.5 mM) was added to provide thepotential initiating nucleotide.

FIG. 5. IHF DNase I footprint of the glnK promoter region. Thecoordinates are relative to the glnK transcriptional start site. IHFconcentrations were 0.5, 1, and 2 M of dimer. The protected regions(black bars) and hypersensitive positions (dots) are marked in thefootprint and on the promoter sequence beside it. The �N promoterand the putative IHF binding site identified by sequencing are alsomarked on the sequence, as described in the legend for Fig. 2.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

(Fig. 8). These results suggest that there are two overlappingpromoters in this region, with the weakest apparently nitrogenregulated and potentially �N dependent. However, from ourdata, it is not clear that this transcript is dependent on NtrC.

Binding of NtrC to the ureD, codB, and dppA promoterregions was also tested in order to assess whether the require-ment for NtrC for high-level expression of these genes wasdirect. DNase I footprinting analysis demonstrated binding ofNtrC to all probes (Fig. 8). Binding to dppA (Fig. 8A) resultedin a clear protected region from �145 to �170 with respect tothe putative �N-dependent promoter, which encompassed theputative NtrC binding site centered at �161. Within the pro-tected region, position �162 showed enhanced sensitivity toDNase I. This was the only protection observed in this pro-moter region. However, more-extensive protections were evi-dent in the other promoter regions. In the case of codB, aproximal protected region spanning from �63 to �79 thatmatched the putative NtrC binding site centered at �72 wasvisible (Fig. 8B). In addition, two protected regions spanningfrom �109 to �122 and from �130 to �141 on the top strand

FIG. 6. In vivo expression from the ureD, dppA, and codB promot-ers of P. putida. Expression was measured as �-galactosidase activity oflacZ transcriptional fusions under nitrogen excess or nitrogen-limitingconditions. Values are averages from at least three independent assays.Error bars indicate standard deviations of the means. (A) ureD-lacZ

fusion expression in KT2442 (wild-type [wt]) and MPO201 (�ntrC)strains. Black bars, control empty vector (pMPO234); white bars,ureD-lacZ fusion (pMPO346). (B) codB-lacZ fusion expression un-der the same conditions as for ureD-lacZ fusion. Black bars, controlempty vector (pMPO234); white bars, codB-lacZ complete fusion(pMPO342); gray bars, codB-lacZ fusion lacking the putative NtrCbinding site (pMPO343). (C) dppA-lacZ fusion activity under thesame conditions as for ureD-lacZ fusion. Black bars, control emptyvector (pMPO234); white bars, dppA-lacZ complete fusion(pMPO340); gray bars, dppA-lacZ fusion lacking the putative NtrCbinding site (pMPO341).

FIG. 7. Primer extension analysis of dppA transcript. A primer ex-tension reaction mixture with total RNA was prepared from cultures ofP. putida KT2442 (wild type [wt]) and MPO201 (�ntrC) grown onminimal medium under nitrogen-sufficient (NS, ammonium plusserine) or nitrogen-limiting (S, serine) conditions. GATC lanes indi-cate the sequencing ladder (noncoding strand). A 13-nucleotide se-quence around the transcriptional start (coding strand) is shown. Ar-rows indicate the mapped 5� ends of the transcripts.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6132


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

were evident. The putative NtrC binding site identified bysequence inspection in the ureD promoter region was centeredat �78, and a protected region covering this position, from�68 to �83, was evident (Fig. 8C). A second protected regionfurther downstream extended from �62 to �37. The regionspanning these two protected regions showed enhanced sensi-tivity to DNase I (positions �64 to �67), which suggestedDNA distortion between the two protected regions. Additionalprotections were also found farther upstream, from �89 to�114. All seven protected regions revealed palindromic se-quences resembling those of NtrC binding sites, although fourof them were not initially identified as NtrC binding sites.

DISCUSSION

Our current studies have demonstrated intergeneric comple-mentation of an E. coli ntrC mutant by P. putida ntrC, resultingin nitrogen-regulated expression of the K. oxytoca nifL pro-moter (Fig. 1). These results indicate that P. putida NtrC canfunction in this heterologous system and that its activity can beregulated by E. coli NtrB. In addition, amino acid substitutionsequivalent to D54E and S160F in S. enterica NtrC (33) give riseto similar effects in P. putida NtrC, resulting in partially con-stitutive forms (data not shown) which, when combined, func-tion synergistically to result in a more constitutive phenotype(60% of the derepressed transcription levels under nitrogen-sufficient conditions [Fig. 1]). These data clearly indicate thatNtrC function is highly conserved between enterobacteria andpseudomonads and that NtrC proteins from both origins areprobably fully exchangeable.

Our studies show that transcription of glnK, the only PII-encoding gene in P. putida, is strongly regulated in response tothe nitrogen source (Table 2 and Fig. 2). As with the E. coliglnK promoter (2), this regulation is exerted directly by NtrC,as shown by footprinting of the glnKp region (Fig. 3) and invitro open complex formation at this promoter (Fig. 4). TwoNtrC binding sites have been identified in P. putida, comparedto the one (and a half) found in E. coli (3, 57). In addition,open complex formation at P. putida glnKp was strongly de-pendent on IHF, unlike with E. coli glnKp (2), and this require-ment for IHF was also observed in vivo. Involvement of IHFtogether with the presence of two contiguous NtrC bindingsites on the same face of the helix suggests that transcriptionalactivation at P. putida glnKp may be very sensitive to lowNtrC-P concentrations, unlike E. coli glnKp expression (2).This difference may be relevant for efficient nitrogen repres-sion in the absence of a constitutively produced GlnB protein(see below).

The function of PII is required under all nitrogen regimensfor proteobacteria. Under nitrogen excess conditions, unmod-ified GlnB stimulates adenylylation of glutamine synthetase. It

also inhibits the kinase activity and activates the phosphataseactivity of NtrB, thus resulting in dephosphorylation of NtrCand consequently preventing it from activating transcription.This in turn influences the level of expression of ntrC, which istranscribed under the control of the glnAp1 and ntrBp promot-ers in enterobacteria. Strict control of P. putida glnK expressionby NtrC could imply that this organism is limited in PII func-tion under nitrogen-sufficient conditions, which could poten-tially result in poorer repression under these conditions. How-ever, the amount of GlnK has to be sufficient to keep mostNtrC in its inactive form under nitrogen-replete conditions,because otherwise NtrC-P would activate glnK transcription.Thus, we postulate a complex autoregulatory feedback circuitfor GlnK production that adjusts the level of GlnK to theminimum concentration needed to maintain nitrogen repres-sion under nitrogen-sufficient conditions. The basal expressionof the other genes activated by NtrC-P would also be con-trolled, their levels depending on the relative sensitivities oftheir promoters to the activator concentration compared tothat of glnKp. This allows efficient nitrogen regulation withoutthe need for an additional, constitutively produced PII protein,unless the two proteins have different target specificities ordifferent sensitivities to effectors. Strict control of the PII con-centration under different conditions could also provide anadditional level of regulation by PII, if it could interact with aparticular target regardless of its uridylylation state or theconcentration of potential effectors. GlnK autoregulation canalso explain the nitrogen regulation phenotype of a GlnB mu-tant of E. coli (4, 11). Under nitrogen-sufficient conditions,GlnB represses NtrC-mediated activation of all target genes,including glnK. In the absence of GlnB, GlnK takes over ni-trogen repression under nitrogen-sufficient conditions. Lack ofthe constitutive GlnB repressor function would be compen-sated by an increase in the levels of GlnK (4), consistent withan autoregulatory feedback loop in which NtrC-P activatesglnK expression once GlnK levels become limiting. Intrigu-ingly, although GlnK can efficiently maintain low basal expres-sion levels in most of the nitrogen-repressed operons in the E.coli GlnB� mutant strain, glnA escapes nitrogen repression.However, this may be explained because the glnA promoterregion is much more sensitive to low concentrations of NtrC-Pthan E. coli glnK or the other nitrogen-regulated genes (2).Although such a comparative analysis has not been carried outwith P. putida, glnA expression is regulated by nitrogen in thisspecies (30), thus suggesting that the sensitivities of P. putidaglnA and glnK to NtrC-P should not be as different as they arein E. coli.

Although there is no Nac ortholog in P. putida, three of theoperons activated by Nac in enterobacteria were identified asnitrogen regulated in P. putida (30). Although binding of NtrC

FIG. 8. DNase I footprints of dppA, codB, and ureD promoter regions. The strand with the most informative footprint pattern is shown in eachcase. Predicted NtrC binding sites (open boxes), protected regions (black bars), and hypersensitive positions (dots) are marked. Dotted boxesrepresent palindromic sequences within the protected regions that may serve as NtrC binding sites, which were not initially identified. Coordinatesare relative to the first G of the �24 box of the promoter. (A) DNase I footprint pattern of dppA. NtrC(D55E,S161F) concentrations were 0, 0.2,0.5, 1, 2, and 4 M. (B) DNase I footprint pattern of codB. NtrC concentrations were 0, 0.5, 1, 1.5, and 2 M. (C) DNase I footprint pattern ofureD. NtrC concentrations were 0, 0.2, 0.35, 0.5, and 1 M. (D) Sequences of the promoter regions covering the putative �N promoter (markedas a sequence underlined with black boxes) and the regions bound by NtrC (marked as boxes).



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

to their promoter regions (Fig. 8) indicated that NtrC coulddirectly activate transcription from these promoters, transcrip-tion from the dppA promoter region does not appear to de-pend on NtrC and has a very weak nitrogen regulation, if any.This promoter region contains a single NtrC binding site, whileureD and codB, the genes truly regulated by nitrogen via NtrC,have promoter regions with up to three binding sites. In bothcases, the two most distal binding sites are aligned on the sameface of the helix (�1 bp) and are separated by two turns of thehelix, which suggests that NtrC may efficiently oligomerize atthese sites. The third, most proximal NtrC binding sites arelocated too close to their respective �24/�12 promoters to beconsidered activation binding sites. However, these sites maywork as “governors,” as defined by Atkinson et al. (5), to limitthe maximal level of expression when the activator concentra-tion is very high, similarly to the low-affinity NtrC binding sitesin the glnAp2 promoter of E. coli.

The additional level of nitrogen regulation in Klebsiella andE. coli mediated by the activation cascade of a number of�70-dependent genes through the adapter Nac does not seemto operate in Pseudomonas. This level of regulation is appar-ently not essential for enterobacteria, since some do not havea nac gene. This is the case for S. enterica serovar Typhi-murium, which appears to have lost Nac recently, since itcannot control the expression of these �70-dependent genes inresponse to nitrogen. However, the promoter for the genehutC in S. enterica is still susceptible to activation by K. aero-genes Nac (9, 46). In contrast, for P. putida, some of these genesare still regulated by nitrogen but their promoters are �N

dependent and are directly regulated by NtrC, thus avoiding anadditional tier of regulation.

Thus, it appears that the nitrogen regulatory network in P.putida is a simplified version of that operating in enterobacte-ria, with only one PII protein and no cascade regulation by theNac regulatory protein. The differences in the nitrogen regu-latory networks that allow this simplification apparently do notreside in the functions of the regulatory factors but are deter-mined by the structures of the target promoters that are reg-ulated by nitrogen.

ACKNOWLEDGMENTS

We are grateful to Victoria Shingler for providing P. putida purifiedproteins for in vitro analysis, Guadalupe Martín Cabello for technicalhelp, and all members of the Santero laboratory for their insights andhelpful suggestions.

Work in our laboratories is funded by the Spanish Ministry of Sci-ence and Innovation, grants BIO2005-03094, BIO2008-01805, andCSD2007-00005, and by the Andalusian government, grants P05-CVI-131 and P07-CVI-2518.

REFERENCES

1. Arcondeguy, T., R. Jack, and M. Merrick. 2001. PII signal transductionproteins, pivotal players in microbial nitrogen control. Microbiol. Mol. Biol.Rev. 65:80–105.

2. Atkinson, M. R., T. A. Blauwkamp, V. Bondarenko, V. Studitsky, and A. J.Ninfa. 2002. Activation of the glnA, glnK, and nac promoters as Escherichiacoli undergoes the transition from nitrogen excess growth to nitrogen star-vation. J. Bacteriol. 184:5358–5363.

3. Atkinson, M. R., T. A. Blauwkamp, and A. J. Ninfa. 2002. Context-dependentfunctions of the PII and GlnK signal transduction proteins in Escherichiacoli. J. Bacteriol. 184:5364–5375.

4. Atkinson, M. R., and A. J. Ninfa. 1998. Role of the GlnK signal transductionprotein in the regulation of nitrogen assimilation in Escherichia coli. Mol.Microbiol. 29:431–447.

5. Atkinson, M. R., N. Pattaramanon, and A. J. Ninfa. 2002. Governor of theglnAp2 promoter of Escherichia coli. Mol. Microbiol. 46:1247–1257.

6. Bagdasarian, M., B. Lurz, B. Ruckert, F. C. H. Franklin, M. M. Bagdasar-ian, J. Frey, and K. N. Timmis. 1981. Specific-purpose plasmid cloningvectors. II. Broad host range, high copy number, RSF1010-derived vectorsfor gene cloning in Pseudomonas. Gene 16:237–247.

7. Beckers, G., J. Strosser, U. Hildebrandt, J. Kalinowski, M. Farwick, R.Kramer, and A. Burkovski. 2005. Regulation of AmtR-controlled gene ex-pression in Corynebacterium glutamicum: mechanism and characterizationof the AmtR regulon. Mol. Microbiol. 58:580–595.

8. Bender, R. A. 1991. The role of the NAC protein in the nitrogen regulationof Klebsiella aerogenes. Mol. Microbiol. 5:2575–2580.

9. Best, E. A., and R. A. Bender. 1990. Cloning of the Klebsiella aerogenes nacgene, which encodes a factor required for nitrogen regulation of the histidineutilization (hut) operons in Salmonella typhimurium. J. Bacteriol. 172:7043–7048.

10. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dye bind-ing. Anal. Biochem. 72:248–254.

11. Bueno, R., G. Pahel, and B. Magasanik. 1985. Role of glnB and glnD geneproducts in regulation of the glnALG operon of Escherichia coli. J. Bacteriol.164:816–822.

12. Caballero, A., A. Esteve-Nunez, G. J. Zylstra, and J. L. Ramos. 2005. As-similation of nitrogen from nitrite and trinitrotoluene in Pseudomonas putidaJLR11. J. Bacteriol. 187:396–399.

13. Camacho, E. M., and J. Casadesus. 2005. Regulation of traJ transcription inthe Salmonella virulence plasmid by strand-specific DNA adenine hemi-methylation. Mol. Microbiol. 57:1700–1718.

14. Cases, I., D. W. Ussery, and V. de Lorenzo. 2003. The sigma54 regulon(sigmulon) of Pseudomonas putida. Environ. Microbiol. 5:1281–1293.

15. Chung, C. T., S. L. Niemela, and R. H. Miller. 1989. One-step preparation ofcompetent Escherichia coli: transformation and storage of bacterial cells inthe same solution. Proc. Natl. Acad. Sci. USA 86:2172–2175.

16. Collins, C. M., D. M. Gutman, and H. Laman. 1993. Identification of anitrogen-regulated promoter controlling expression of Klebsiella pneu-moniae urease genes. Mol. Microbiol. 8:187–198.

17. Desnoues, N., M. Lin, X. Guo, L. Ma, R. Carreno-Lopez, and C. Elmerich.2003. Nitrogen fixation genetics and regulation in a Pseudomonas stutzeristrain associated with rice. Microbiology 149:2251–2262.

18. Dixon, R., and D. Kahn. 2004. Genetic regulation of biological nitrogenfixation. Nat. Rev. Microbiol. 2:621–631.

19. Elliot, T., and E. P. Geiduschek. 1984. Defining a bacteriophage T4 latepromoter: absence of a “�35” region. Cell 36:211–219.

20. Espinosa-Urgel, M., A. Salido, and J. L. Ramos. 2000. Genetic analysis offunctions involved in adhesion of Pseudomonas putida to seeds. J. Bacteriol.182:2363–2369.

21. Eydmann, T., E. Soderback, T. Jones, S. Hill, S. Austin, and R. Dixon. 1995.Transcriptional activation of the nitrogenase promoter in vitro: adenosinenucleotides are required for inhibition of NIFA activity by NIFL. J. Bacte-riol. 177:1186–1195.

22. Feng, J., T. J. Goss, R. A. Bender, and A. J. Ninfa. 1995. Activation oftranscription initiation from the nac promoter of Klebsiella aerogenes. J.Bacteriol. 177:5523–5534.

23. Figurski, D. H., and D. R. Helinski. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. USA 76:1648–1652.

24. Forchhammer, K. 2008. P(II) signal transducers: novel functional and struc-tural insights. Trends Microbiol. 16:65–72.

25. Franklin, F. C., M. Bagdasarian, M. M. Bagdasarian, and K. N. Timmis.1981. Molecular and functional analysis of the TOL plasmid pWWO fromPseudomonas putida and cloning of genes for the entire regulated aromaticring meta cleavage pathway. Proc. Natl. Acad. Sci. USA 78:7458–7462.

26. García-Gonzalez, V., F. Govantes, O. Porrua, and E. Santero. 2005. Regu-lation of the Pseudomonas sp. strain ADP cyanuric acid degradation operon.J. Bacteriol. 187:155–167.

27. Govantes, F., J. A. Molina-Lopez, and E. Santero. 1996. Mechanism ofcoordinated synthesis of the antagonistic regulatory proteins NifL and NifAof Klebsiella pneumoniae. J. Bacteriol. 178:6817–6823.

28. Govantes, F., J. A. Albrecht, and R. P. Gunsalus. 2000. Oxygen regulation ofthe Escherichia coli cytochrome d oxidase (cydAB) operon: roles of multiplepromoters and the Fnr-1 and Fnr-2 binding sites. Mol. Microbiol. 37:1456–1469.

29. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plas-mids. J. Mol. Biol. 166:557–580.

30. Hervas, A. B., I. Canosa, and E. Santero. 2008. Transcriptome analysis ofPseudomonas putida in response to nitrogen availability. J. Bacteriol. 190:416–420.

31. Hoover, T. R., E. Santero, S. Porter, and S. Kustu. 1990. The integration hostfactor stimulates interaction of RNA polymerase with NIFA, the transcrip-tional activator for nitrogen fixation operons. Cell 63:11–22.

32. Janes, B. K., C. J. Rosario, and R. A. Bender. 2003. Isolation of a negativecontrol mutant of the nitrogen assimilation control protein, NAC, in Kleb-siella aerogenes. J. Bacteriol. 185:688–692.

33. Klose, K. E., D. S. Weiss, and S. Kustu. 1993. Glutamate at the site of



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

phosphorylation of nitrogen-regulatory protein NTRC mimics aspartyl-phos-phate and activates the protein. J. Mol. Biol. 232:67–78.

34. Kohler, T., S. Harayama, J. L. Ramos, and K. N. Timmis. 1989. Involvementof Pseudomonas putida RpoN sigma factor in regulation of various metabolicfunctions. J. Bacteriol. 171:4326–4333.

35. Leigh, J. A., and J. A. Dodsworth. 2007. Nitrogen regulation in Bacteria andArchaea. Annu. Rev. Microbiol. 61:349–377.

36. Little, R., F. Reyes-Ramirez, Y. Zhang, W. C. van Heeswijk, and R. Dixon.2000. Signal transduction to the Azotobacter vinelandii NIFL-NIFA regula-tory system is influenced directly by interaction with 2-oxoglutarate and thePII regulatory protein. EMBO J. 19:6041–6050.

37. Liu, Q., and R. A. Bender. 2007. Complex regulation of urease formationfrom the two promoters of the ure operon of Klebsiella pneumoniae. J.Bacteriol. 189:7593–7599.

38. MacNeil, T., D. MacNeil, and B. Tyler. 1982. Fine-structure deletion mapand complementation analysis of the glnA-glnL-glnG region in Escherichiacoli. J. Bacteriol. 150:1302–1313.

39. Mandelbaum, R. T., L. P. Wackett, and D. L. Allan. 1993. Mineralization ofthe s-triazine ring of atrazine by stable bacterial mixed cultures. Appl. En-viron. Microbiol. 59:1695–1701.

40. Marques, S., M. T. Gallegos, M. Manzanera, A. Holtel, K. N. Timmis, andJ. L. Ramos. 1998. Activation and repression of transcription at the doubletandem divergent promoters for the xylR and xylS genes of the TOL plasmidof Pseudomonas putida. J. Bacteriol. 180:2889–2894.

41. Meletzus, D., P. Rudnick, N. Doetsch, A. Green, and C. Kennedy. 1998.Characterization of the glnK-amtB operon of Azotobacter vinelandii. J. Bac-teriol. 180:3260–3264.

42. Miller, J. H. 1992. A short course in bacterial genetics: a laboratory manual.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

43. Minchin, S. D., S. Austin, and R. A. Dixon. 1989. Transcriptional activationof the Klebsiella pneumoniae nifLA promoter by NTRC is face-of-the-helixdependent and the activator stabilizes the interaction of sigma 54-RNApolymerase with the promoter. EMBO J. 8:3491–3499.

44. Nelson, K. E., C. Weinel, I. T. Paulsen, R. J. Dodson, H. Hilbert, V. A.Martins dos Santos, D. E. Fouts, S. R. Gill, M. Pop, M. Holmes, L. Brinkac,M. Beanan, R. T. DeBoy, S. Daugherty, J. Kolonay, R. Madupu, W. Nelson,O. White, J. Peterson, H. Khouri, I. Hance, P. Chris Lee, E. Holtzapple, D.Scanlan, K. Tran, A. Moazzez, T. Utterback, M. Rizzo, K. Lee, D. Kosack, D.Moestl, H. Wedler, J. Lauber, D. Stjepandic, J. Hoheisel, M. Straetz, S.Heim, C. Kiewitz, J. A. Eisen, K. N. Timmis, A. Dusterhoft, B. Tummler, andC. M. Fraser. 2002. Complete genome sequence and comparative analysis ofthe metabolically versatile Pseudomonas putida KT2440. Environ. Micro-biol. 4:799–808.

45. Nishijyo, T., D. Haas, and Y. Itoh. 2001. The CbrA-CbrB two-componentregulatory system controls the utilization of multiple carbon and nitrogensources in Pseudomonas aeruginosa. Mol. Microbiol. 40:917–931.

46. Parada, J. L., and B. Magasanik. 1975. Expression of the hut operons ofSalmonella typhimurium in Klebsiella aerogenes and in Escherichia coli. J.Bacteriol. 124:1263–1268.

47. Perez-Martin, J., and V. De Lorenzo. 1995. Integration host factor sup-presses promiscuous activation of the sigma 54-dependent promoter Pu ofPseudomonas putida. Proc. Natl. Acad. Sci. USA 92:7277–7281.

48. Porrua, O., M. Garcia-Jaramillo, E. Santero, and F. Govantes. 2007. TheLysR-type regulator AtzR binding site: DNA sequences involved in activa-tion, repression and cyanuric acid-dependent repositioning. Mol. Microbiol.66:410–427.

49. Reitzer, L. 2003. Nitrogen assimilation and global regulation in Escherichiacoli. Annu. Rev. Microbiol. 57:155–176.

50. Reuther, J., and W. Wohlleben. 2007. Nitrogen metabolism in Streptomycescoelicolor: transcriptional and post-translational regulation. J. Mol. Micro-biol. Biotechnol. 12:139–146.

51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, NY.

52. Santero, E., T. R. Hoover, A. K. North, D. K. Berger, S. C. Porter, and S.Kustu. 1992. Role of integration host factor in stimulating transcription fromthe sigma 54-dependent nifH promoter. J. Mol. Biol. 227:602–620.

53. Schmitz, R. A., K. Klopprogge, and R. Grabbe. 2002. Regulation of nitrogenfixation in Klebsiella pneumoniae and Azotobacter vinelandii: NifL, trans-ducing two environmental signals to the nif transcriptional activator NifA. J.Mol. Microbiol. Biotechnol. 4:235–242.

54. Strosser, J., A. Ludke, S. Schaffer, R. Kramer, and A. Burkovski. 2004.Regulation of GlnK activity: modification, membrane sequestration andproteolysis as regulatory principles in the network of nitrogen control inCorynebacterium glutamicum. Mol. Microbiol. 54:132–147.

55. Timmis, K. N. 2002. Pseudomonas putida: a cosmopolitan opportunist parexcellence. Environ. Microbiol. 4:779–781.

56. Totten, P. A., J. C. Lara, and S. Lory. 1990. The rpoN gene product ofPseudomonas aeruginosa is required for expression of diverse genes, includ-ing the flagellin gene. J. Bacteriol. 172:389–396.

57. van Heeswijk, W. C., S. Hoving, D. Molenaar, B. Stegeman, D. Kahn, andH. V. Westerhoff. 1996. An alternative PII protein in the regulation ofglutamine synthetase in Escherichia coli. Mol. Microbiol. 21:133–146.

58. Wassem, R., E. M. De Souza, M. G. Yates, F. D. Pedrosa, and M. Buck. 2000.Two roles for integration host factor at an enhancer-dependent nifA pro-moter. Mol. Microbiol. 35:756–764.

59. Wigneshweraraj, S., D. Bose, P. C. Burrows, N. Joly, J. Schumacher, M.Rappas, T. Pape, X. Zhang, P. Stockley, K. Severinov, and M. Buck. 2008.Modus operandi of the bacterial RNA polymerase containing the sigma54promoter-specificity factor. Mol. Microbiol. 68:538–546.

60. Wyman, C., I. Rombel, A. K. North, C. Bustamante, and S. Kustu. 1997.Unusual oligomerization required for activity of NtrC, a bacterial enhancer-binding protein. Science 275:1658–1661.

61. Zhang, X., M. Chaney, S. R. Wigneshweraraj, J. Schumacher, P. Bordes, W.Cannon, and M. Buck. 2002. Mechanochemical ATPases and transcriptionalactivation. Mol. Microbiol. 45:895–903.

62. Zhang, X. X., and P. B. Rainey. 2008. Dual involvement of CbrAB andNtrBC in the regulation of histidine utilization in Pseudomonas fluorescensSBW25. Genetics 178:185–195.

63. Zimmer, D. P., E. Soupene, H. L. Lee, V. F. Wendisch, A. B. Khodursky, B. J.Peter, R. A. Bender, and S. Kustu. 2000. Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogenlimitation. Proc. Natl. Acad. Sci. USA 97:14674–14679.



http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

NtrC-Dependent Regulatory Network for Nitrogen Assimilation in ...

Documents

Transcript of NtrC-Dependent Regulatory Network for Nitrogen Assimilation in ...