Non-Invasive Prenatal Diagnosis for Aneuploidies · The total number of ccf-fetal fragments vs....
Transcript of Non-Invasive Prenatal Diagnosis for Aneuploidies · The total number of ccf-fetal fragments vs....
Non-Invasive Prenatal Diagnosis
Philip Bayliss, M.D.
Maternal Fetal Medicine
Women & Babies Hospital
NIPD
• Financial Disclosure
– Dr. Bayliss is on the Board of Directors of RAVGEN, Inc. He owns stock in the company which is involved with NIPD.
– RAVGEN is the holder of several patents in the area of free fetal DNA
– Dr Bayliss has researched and published studies in the field of NIPD , directly associated with RAVGEN
– Several of the slides today have come from the commercial labs involved in today’s talk
NIPD
• At the end of the discussion participants should be able to
– Discuss a brief overview of the testing field of prenatal diagnosis
– Understand the evolution of NIPD
– Understand the utility of NIPD for the common trisomies (13, 18, 21)
– Recognize expanding research and clinical use of NIPD
Prenatal Diagnosis
• Purpose
– Provide information to prospective parents regarding fetal diagnosis / condition
– Manage pregnancy, delivery, & neonatal period to optimize outcome
– Counseling & support for reproductive decisions
Prenatal Diagnosis
• Screening
– Maternal serum markers • 1st & 2nd trimesters
– Fetal US
– Combination tests • 1st trimester screen
• Sequential screen
• Diagnostic
– CVS
– Amniocentesis
– PUBS
– Fetal skin biopsy
– Preimplantation diagnosis
– Fetal US
NIPD
• Non-Invasive Prenatal Diagnosis
• Should be called NIPalmostD
• Question are we ready to forgo invasive fetal testing?
– Answer: No
• But we are ENTERING a new period of testing over the next decade
Overall Goals of NIPD
• Minimize anxiety surrounding multi-
step screening and reduce false
positive results
• Reduce exposure to risks associated
with invasive prenatal procedures
Why use NIPT? The verifi™ prenatal test in the current spectrum
© 2012 Verinata. Content is proprietary and confidential.
8
Non-definitive Risk Score (ie,
1/300 vs. 1/10,000)
Invasive, but gives definite
answer
Definitive answer (presence or absence of
trisomy)
Two ways to access fetal DNA in maternal blood
• Fetal cells – 1 in a billion of total cell
population
– Requires fetal cell isolation via mechanical and/or biochemical means
• Cell-free DNA – 5-20% of total cfDNA is fetal
– Requires DNA isolation and counting
© 2012 Verinata. Content is proprietary and confidential.
Effect of Increasing fDNA
DNA
Single Nucleotide Polymorphisms
Schematic illustration of the allelic ratio strategy.
Go A T et al. Hum. Reprod. Update 2011;17:372-382
© The Author 2010. Published by Oxford University Press on behalf of the European Society of
Human Reproduction and Embryology. All rights reserved. For Permissions, please email:
Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing
The total number of ccf-fetal fragments vs. ccf-maternal
fragments of any one chromosome is proportional to the
size of the chromosome, and is consistent from sample to
sample, and patient to patient.
Chromosome 1 Chromosome 21
Sequencing tells you which chromosome the combined
maternal and fetal fragments come from.
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
Principles of Fetal Trisomy 21 Testing From a Maternal Blood Sample Using DNA Sequencing
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14
GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10
Sequencing tells you which
chromosome the ccf fragment
comes from
TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y
Principles of Fetal Trisomy 21 Detection Using DNA Sequencing
DNA MPS* does not differentiate which fragments come from the
mother and which from the fetus.
Unaffected Fetus Fetus with Trisomy 21
The quantitative over-representation of Trisomy 21
fragments in an affected pregnancy is significant and can be
measured with high precision.
* MPS - Massively Parallel Sequencing
Massively Parallel Sequencing of Cell Free DNA
cfDNA 150-200bp length
36bp sequence reads (millions)
cgatttaactggagagttcaaacctcgaatcgattc gtaccccgcgtattttagcctctcgaaatcggtatag
Align reads to the genome
cgatttaactggagagttcaaacctcgaatcgattc tatcggctaaattgacctctcaagtttggagcttagctaaggtaccccgcgtattttagcctctcgaaatcggtt
© 2012 Verinata. Content is proprietary and confidential.
© 2012 The American College of Obstetricians and Gynecologists. Published by The American College of Obstetricians and Gynecologists.
9
Fig. 4
Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing. Bianchi, Diana; Platt, Lawrence; Goldberg, James; Abuhamad, Alfred; Sehnert, Amy; Rava, Richard Obstetrics & Gynecology. 119(5):890-901, May 2012. DOI: 10.1097/AOG.0b013e31824fb482
Fig. 4 . Massively parallel sequencing normalized chromosome values compared with karyotype classifications for chromosomes 21, 18, and 13. Circles display classifications for chromosome 21, squares display classifications for chromosome 18, and triangles display classifications for chromosome 13. Unclassified samples with trisomy karyotypes have been circled.Fig. 4. Bianchi. Genome-Wide Fetal Aneuploidy Detection. Obstet Gynecol 2012.
Results: MPS Performance
Classified Sensitivity
(%)
95% CI Specificity
(%)
95% CI
Trisomy 21
(n=493)
100·0
(89/89)
95·9 - 100·0 100·0
(404/404)
99·1 - 100·0
Trisomy 18
(n=496)
97·2
(35/36)
85·5 - 99·9 100
(460/460)
99·2 - 100·0
Trisomy 13
(n=499)
78·6
(11/14)
49·2 - 99·9 100·0
(485/485)
99·2 - 100·0
Monosomy X
(n=433)
93·8
(15/16)
69·8 – 99·8 99·8
(416/417)
98·7 - >99·9
Female
(n=433)
99·6
(232/233)
97·6 - >99·9 99·5
(199/200)
97·2 - >99·9
Male
(n=433)
100·0
(184/184)
98·0 –100·0 100·0
(249/249)
98·5 – 100·0
Bianchi, et al, Obstetrics and Gynecology, Vol 119, No. 5, May 2012, e-pub ahead
© 2012 The American College of Obstetricians and Gynecologists. Published by The American College of Obstetricians and Gynecologists.
3
Fig. 2
Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing. Bianchi, Diana; Platt, Lawrence; Goldberg, James; Abuhamad, Alfred; Sehnert, Amy; Rava, Richard Obstetrics & Gynecology. 119(5):890-901, May 2012. DOI: 10.1097/AOG.0b013e31824fb482
Fig. 2 . Study design (A) and random sampling plan (B).Fig. 2. Bianchi. Genome-Wide Fetal Aneuploidy Detection. Obstet Gynecol 2012.
© 2012 The American College of Obstetricians and Gynecologists. Published by The American College of Obstetricians and Gynecologists.
5
Table 2
Genome-Wide Fetal Aneuploidy Detection by Maternal Plasma DNA Sequencing. Bianchi, Diana; Platt, Lawrence; Goldberg, James; Abuhamad, Alfred; Sehnert, Amy; Rava, Richard Obstetrics & Gynecology. 119(5):890-901, May 2012. DOI: 10.1097/AOG.0b013e31824fb482
Table 2 . Censored Karyotypes
Testing Available
• Three commercial labs are in the market in the last 6 months – Using same sequencer, sample prep – Slight differences in reporting
• Darwin’s “Survival of the Fittest”
– Multiple lawsuits / patent infringements – Intrigue of a fictional novel
Implementation • High risk population
– AMA – Prior OB history – Fetal US findings
• After a positive first or second trimester screening result
– Reduce unnecessary invasive procedures with concomitant reduction in procedure related adverse events
• Patients should receive thorough pre-test counseling – Ensure the limitations implications of the test are understood – Continued role for invasive tests for complex findings/ use of genomic hybridization
• Cost / Payment
• Eventually becomes primary screen – Ultimately noninvasive diagnostic test
Future Directions
• Testing in low-risk populations
• Further testing in multiple gestation
• Further study of mosaic conditions – Fetus, Placenta, and Patient
• Detection of sub-chromosomal abnormalities – Examples previously observed in sequencing data:
• Small deletion chromosome 11
• Duplication chromosome 6
• Microdeletion chromosome 12
NIPD: Other Applications
• Rh D disease – Decrease need for Rhogam
– Decrease need for serial evaluation in sensitized pregnancies
• Paternity – Medical-legal
– Social
• Certain single gene diseases
• Beta thalassemia
Fetal Whole Genomic Testing
• June 2012
• University if Washington reported entire fetal genome mapped using ffDNA in 18 week pregnancy
– Detailed 44 new mutations not seen in either parent
• ? New definition of opening Pandora’s box
Questions?