1

New tricks from an old cow: Infective endocarditis caused by Streptococcus 1

dysgalactiae subsp. dysgalactiae 2

3

Stina Jordal a, Marte Glambek b, Oddvar Oppegaard c, Bård Reiakvam Kittang b, d # 4

Department of Microbiology, Haukeland University Hospital, Bergen, Norway a, 5

Department of Medicine, Haraldsplass Deaconess Hospital, Bergen, Norway b, 6

Department of Medicine, Haukeland University Hospital, Bergen, Norway c, and 7

Department of Clinical Science, University of Bergen, Bergen, Norway d 8

9

Running title: Streptococcus dysgalactiae subsp. dysgalactiae endocarditis 10

11

# Address correspondence to Bård Reiakvam Kittang, bki081@k2.uib.no 12

13

14

15

16

17

18

19

20

JCM Accepts, published online ahead of print on 3 December 2014J. Clin. Microbiol. doi:10.1128/JCM.02437-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

2

CASE REPORTS 21

22

New tricks from an old cow: Infective endocarditis caused by Streptococcus 23

dysgalactiae subsp. dysgalactiae 24

We present a case of infective endocarditis caused by Streptococcus dysgalactiae subsp. 25

dysgalactiae; a major cause of bovine mastitis and previously thought to be an animal 26

restricted pathogen. The patient reported no direct contact with animals, and the clinical 27

course was severe and complicated. 28

29

30

A sixty-five year old male patient was admitted to Haukeland University Hospital in 31

western Norway with radiating pain in his left shoulder, fever and muscle ache. One 32

month earlier he had been admitted to a hospital in Spain with similar symptoms but 33

was rapidly discharged with a diagnosis of shoulder tendinitis. He had a family history of 34

sudden cardiac death, and his previous medical history included hypertrophic 35

obstructive cardiomyopathy and a normal coronary angiography seven years prior to 36

the actual admission. 37

Upon admission he had a pulse rate of 100/min., a temperature of 39 °C and a 38

respiratory frequency of 24/min, thus fulfilling the criteria of Systemic inflammatory 39

response syndrome (SIRS). He was pale, with a blood pressure of 118/59 mmHg, and a 40

holosystolic murmur was heard at the apex. No local signs of infection were observed 41

over his left shoulder. 42

The initial blood chemistry results were as follows, with normal range values in 43

parentheses: Hemoglobin 8.5 g/dl (13.4 – 17.0) , C-reactive protein 277 mg/l (<5), 44

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

3

leucocytes 20.8 x 10 9 /l (3.5 – 11.0) , neutrophils 18.5 x 10 9 /l (1.7 – 8.2), 45

sedimentation rate 102 mm/h (0-20), procalcitonin 12.1 µg/L (<0,10) and troponin T 46

896 ng/l (<25). Thrombocytes were within normal range. The electrocardiogram (ECG) 47

demonstrated ST-segment elevation in leads V1-V2 and T-inversion in leads V4-V6 48

indicative of ischemia. 49

Antibiotic therapy was started on day one, and included meropenem and vancomycin. 50

A broader initial regimen than recommended in the Norwegian National Antibiotic 51

Guidelines was chosen since the patient had recently been admitted to hospital in Spain. 52

The following day all four blood cultures grew non-hemolytic bacteria on blood agar. 53

Species identification was performed using MALDI-TOF MS, and showed that the isolate 54

was Streptococcus dysgalactiae. Subsequently, group C carbohydrate specificity was 55

documented using a slide agglutination test (Oxoid, Cambridge, UK). The antimicrobial 56

susceptibility testing showed that the GCS was fully susceptible to all tested antibiotics, 57

with the following minimal inhibitory concentrations (mg/l): penicillin-G 0.008, 58

ceftriaxone< 0.016, clindamycin 0.25, vancomycin 0.25, teicoplanin 0.25 and linezolid 1. 59

A more thorough anamnestic interview revealed a history of weight loss of 6 kg, 60

bloody stools, increasing pain in the left shoulder and inaccuracy of vision. On 61

examination he had no peripheral vascular phenomena indicative of septic embolization. 62

He was delirious and hallucinated. 63

Infective endocarditis (IE) with possible septic embolization to the brain and left 64

shoulder was suspected. Since ceftriaxone penetrates the blood brain barrier better than 65

penicillin, the antimicrobial treatment was subsequently changed to ceftriaxone in 66

combination with gentamicin. Transthoracic echocardiography (TTE) confirmed the 67

clinical suspicion of IE and revealed a vegetation on the anterior mitral cusp. MRI of the 68

brain and left shoulder showed septic embolization to both cerebral and cerebellar 69

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

4

hemispheres as well as fluid in left subdeltoideal bursa. Abdominal CT scan performed 70

after ten days confirmed embolization to the spleen after which clindamycin was 71

temporarily added to the antimicrobial regimen for two weeks to optimize abscess 72

penetration. 73

During the treatment course, a colonoscopy was performed due to persistent bloody 74

stools, and revealed a malignant tumor in the rectum. 75

Subsequent examinations with TTE and transesophageal echocardiography revealed 76

an increasing mitral insufficiency, a vegetation on the aortic valve and a severe aortic 77

insufficiency grade III-IV. Cardiac CT showed normal coronary arteries and a significant 78

difference in heart-minute volume (5 l/min in left ventricle, 7.8 l/min right ventricle), 79

confirming severe valve insufficiencies on the left side of the heart. It thus became clear 80

that surgical replacement of the valves was needed. However, the persisting bleeding 81

from his rectal tumor maintained anemia and inoperable conditions. Radiation therapy 82

was successfully reducing the bleeding from his rectal tumor and treatment with 83

recombinant human erythropoietin helped correcting his anemia. 84

Two months after admission, he suffered from a fulminant pulmonary edema and 85

underwent acute, life-saving thoracic surgery with both biological aortic and mitral 86

valve replacement. Aortic perivalvular abscess formation was also documented and 87

debrided. Cultures were performed on the excised aortic and mitral valves, without 88

bacterial growth. Unfortunately, direct 16rRNA sequencing on the valve specimens was 89

not performed. The patient rapidly recovered after surgery and received intravenous 90

antibiotic therapy during the first six post-operative weeks. 91

Four months after admission his rectal tumor, a differentiated adenocarcinoma, was 92

radically resected, with acute complications causing re-operation after which his 93

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

5

hemoglobin level was 3, 3 g/dl at the lowest. His temporary ileostomy was removed six 94

months later without further complications. 95

He was followed on an outpatient basis for 18 months, with no clinical or 96

echocardiographic signs of recurring endocarditis. 97

98

The GCS isolate (T534) was stored on Greaves medium at – 80 ° C until further testing. 99

Lack of hemolysis on blood agar, along with the MALDI-TOF MS species identification, 100

could indicate that this strain did not belong to Streptococcus dysgalactiae subsp. 101

equisimilis (SDSE), which, together with Streptococcus belonging to the Anginosus group 102

are responsible for the vast majority of human GCS infections (3,6,19). In order to assign 103

correct streptococcal subgroup, the isolate was therefore subjected to selected 104

molecular analyses: 105

First, 16S rRNA sequencing was performed with the following primers: 5’-CGG-CCC-106

AGA-CTC-CTA-CGG-GAG-GCW-GCA - 3’ (F-primer) and 5’-GCG-TGG-ACT-ACC-AGG-GTA-107

TCT-AAK-CC - 3’ (R-primer), under previously reported PCR conditions (9). This 108

analysis confirmed that T534 was of the species Streptococcus dysgalactiae, with 99.7 % 109

and 99.6% homology to SDSE and Streptococcus dysgalactiae subsp. dysgalactiae 110

(SDSD), respectively. However, neither MALDI-TOF MS nor 16S rRNA sequencing could 111

separate SDSD from SDSE. 112

Next, we performed targeted PCR on genes or gene segments previously reported to be 113

frequently present in SDSE-isolates associated with human infections, and not in isolates 114

belonging to SDSD; namely genes encoding streptokinase (ska), streptolysin O (slo), C5 a 115

peptidase (scpA) (5), along with surface lipoprotein DppA (dppA), immunogenic 116

secreted protein (isp) and laminin-binding protein (lmb) (15). As shown in table 1, none 117

of those genes were detected in T534. Six SDSE-isolates associated endocarditis in 118

western Norway were also tested, and all were PCR- positive for those six genes. 119

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

6

Based on the whole-genome sequence of a SDSD strain ATCC 27957 associated with 120

bovine udder infection (17), primers targeting the rihC- gene were constructed, since a 121

BLAST search of the rihC- sequence from this particular SDSD showed that it lacks 122

significant homology with genes from streptococcal isolates associated with human 123

infections. 124

T534 possessed a rihC-gene, and the DNA sequence showed 100 % homology to that of 125

the rihC-gene in SDSD from fish. 126

Finally, a multilocus sequence analysis (MLSA) scheme consisting of the seven 127

housekeeping genes map, pfl, ppaC, pyk, rpoB, sodA and tuf was used, with primers and 128

thermal profiles as previously described (1,6). A BLAST search of the trimmed 129

consensus sequences of all these seven genes showed that T354 had identical MLSA 130

profile with Streptococcus dysgalactiae subsp. dysgalactiae strain CCUG 27439, isolated 131

from cow (6). 132

133

SDSD has until lately been regarded as an animal restricted pathogen, and is a principal 134

cause of bovine mastitis (14). SDSD has also shown the ability to cause severe cellulitis 135

and toxic shock syndrome in cattle (4), septicemia in fish and dogs (12,20) and infective 136

arthritis in sheep (16). To our knowledge, SDSD possesses either Lancefield group 137

antigen C or L, and most often grow large colonies with surrounding alpha-hemolysis, or 138

lack of hemolysis, on blood agar (6,19). Human GCS infections, however, are most often 139

caused by beta-hemolytic SDSE, or more rarely Streptococcus belonging to the 140

Anginosus group, with a wide range of clinical manifestations, including severe soft 141

tissue infections, primary bacteremia, osteomyelitis, arthritis, pneumonia, meningitis, 142

peritonitis, toxic shock syndrome and endocarditis (3). 143

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

7

The incidence of infective endocarditis (IE) appears to be rising. In the United States, a 144

2.4 % annual increase in admission rate of IE from 1998-2009 was documented, leading 145

to an incidence rate of 12.7 per 100.000 inhabitants in 2009 (2). Approximately 70 % of 146

the cases of IE occur on native valves, the mitral and aortic valves are most often 147

affected. IE is caused by either Staphylococcus aureus or viridans group streptococci in 148

around 50 % of the cases (11), whereas IE caused by GCS belonging to SDSE is indeed a 149

rarity (3,7,18). To our knowledge, SDSD has never been associated with human carriage, 150

and infection possibly caused by this bacterium has previously only been reported 151

twice: 152

SDSD was associated with a prosthetic joint infection after total knee arthroplasty in a 153

case report from Korea. However, the mode of species identification of this bacterial 154

isolate was not described (13). Furthermore, SDSD was associated with cellulitis in a 155

patient with a poking injury of a finger after handling raw fish (8). The species 156

identification in this study was based on the results from API STREP 20, along with 157

partial sequencing of the 16s rRNA and sodA genes; none of which unequivocally 158

discriminates SDSD from SDSE (6). 159

Our patient fulfilled the modified Duke Criteria for definitive endocarditis (10), with 160

one major criteria (evidence of endocardial involvement) and four minor criteria 161

(microorganism consistent with IE, predisposing heart disease, fever and septic 162

embolization). The identification of this particular GCS endocarditis isolate as SDSD 163

relied on a combination of phenotypic characteristics, MALDI-TOF MS and 16s rRNA 164

analysis, virtually excluding other pathogens than SDSD and SDSE, along with the lack of 165

virulence genes typically present in SDSE, namely ska, slo, scpA, dppA, isp and lmb (5,15), 166

the presence of rihC, previously only identified in SDSD, and finally an MLSA profile 167

exactly matching that of an SDSD strain derived from cow. 168

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

8

This case illustrates the zoonotic potential of SDSD. Despite a thorough, retrospective 169

interview on animal exposure, the clinical history of the patient did not reveal the source 170

and mode of transmission of the bacterium. The clinical course was complicated, and it 171

cannot be excluded that his concurrent malignancy contributed to the severity of the 172

infection. 173

We have not yet any molecular data that can explain the virulence of our SDSD-strain. 174

A recent study, comparing the genome content of one SDSD and two SDSE showed a high 175

degree of genetic similarity between them, and the presence of two putative phages in 176

SDSD with homology to M3 GAS prophages, carrying possible virulence genes like 177

hyaluronidase and streptodornase (17). That particular SDSD isolate also possessed 178

putative integrative and conjugative (ICE) elements, which are known to be particularly 179

abundant in S. agalactiae, another major agent of bovine mastitis. Hence, it appears that 180

SDSD can accommodate both phages and ICEs from related streptococcal species, which 181

might be crucial in the development of virulence attributes. 182

In conclusion, this first documented case of human bacteremia and endocarditis 183

caused by SDSD calls for a broader molecular analysis of the bacterial isolate in order to 184

explore the zoonotic potential and virulence of this pathogen. 185

186

187

188

189

190

191

192

193

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

9

Reference List 194

195

1. Bishop, C. J., D. M. Aanensen, G. E. Jordan, M. Kilian, W. P. Hanage, and B. G. 196

Spratt. 2009. Assigning strains to bacterial species via the internet. BMC.Biol. 7:3. 197

doi:1741-7007-7-3 [pii];10.1186/1741-7007-7-3 [doi]. 198

2. Bor, D. H., S. Woolhandler, R. Nardin, J. Brusch, and D. U. Himmelstein. 2013. 199

Infective endocarditis in the U.S., 1998-2009: a nationwide study. PLoS.One. 200

8:e60033. doi:10.1371/journal.pone.0060033 [doi];PONE-D-12-37257 [pii]. 201

3. Broyles, L. N., B. C. van, B. Beall, R. Facklam, P. L. Shewmaker, P. Malpiedi, P. 202

Daily, A. Reingold, and M. M. Farley. 2009. Population-Based Study of Invasive 203

Disease Due to beta-Hemolytic Streptococci of Groups Other than A and B. 204

Clin.Infect.Dis. 48:706-712. 205

4. Chenier, S., M. Leclere, S. Messier, and G. Fecteau. 2008. Streptococcus 206

dysgalactiae cellulitis and toxic shock like syndrome in a Brown Swiss cow. 207

J.Vet.Diagn.Invest 20:99-103. doi:20/1/99 [pii]. 208

5. Ikebe, T., S. Murayama, K. Saitoh, S. Yamai, R. Suzuki, J. Isobe, D. Tanaka, C. 209

Katsukawa, A. Tamaru, A. Katayama, Y. Fujinaga, K. Hoashi, and H. 210

Watanabe. 2004. Surveillance of severe invasive group-G streptococcal 211

infections and molecular typing of the isolates in Japan. Epidemiol.Infect. 212

132:145-149. 213

6. Jensen, A. and M. Kilian. 2012. Delineation of Streptococcus dysgalactiae, its 214

subspecies, and its clinical and phylogenetic relationship to Streptococcus 215

pyogenes. J.Clin.Microbiol. 50:113-126. doi:JCM.05900-11 216

[pii];10.1128/JCM.05900-11 [doi]. 217

7. Kittang, B. R., T. Bruun, N. Langeland, H. Mylvaganam, M. Glambek, and S. 218

Skrede. 2011. Invasive group A, C and G streptococcal disease in western 219

Norway: virulence gene profiles, clinical features and outcomes. 220

Clin.Microbiol.Infect. 17:358-364. doi:CLM3253 [pii];10.1111/j.1469-221

0691.2010.03253.x [doi]. 222

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

10

8. Koh, T. H., L. H. Sng, S. M. Yuen, C. K. Thomas, P. L. Tan, S. H. Tan, and N. S. 223

Wong. 2009. Streptococcal cellulitis following preparation of fresh raw seafood. 224

Zoonoses.Public Health 56:206-208. doi:JVB1213 [pii];10.1111/j.1863-225

2378.2008.01213.x [doi]. 226

9. Kommedal, O., K. Kvello, R. Skjastad, N. Langeland, and H. G. Wiker. 2009. 227

Direct 16S rDNA sequencing from clinical specimens with special focus on poly-228

bacterial samples and interpretation of mixed DNA chromatograms. 229

J.Clin.Microbiol. 230

10. Li, J. S., D. J. Sexton, N. Mick, R. Nettles, V. G. Fowler, Jr., T. Ryan, T. Bashore, 231

and G. R. Corey. 2000. Proposed modifications to the Duke criteria for the 232

diagnosis of infective endocarditis. Clin.Infect.Dis. 30:633-638. doi:CID990870 233

[pii];10.1086/313753 [doi]. 234

11. Murdoch, D. R., G. R. Corey, B. Hoen, J. M. Miro, V. G. Fowler, Jr., A. S. Bayer, A. 235

W. Karchmer, L. Olaison, P. A. Pappas, P. Moreillon, S. T. Chambers, V. H. 236

Chu, V. Falco, D. J. Holland, P. Jones, J. L. Klein, N. J. Raymond, K. M. Read, M. 237

F. Tripodi, R. Utili, A. Wang, C. W. Woods, and C. H. Cabell. 2009. Clinical 238

presentation, etiology, and outcome of infective endocarditis in the 21st century: 239

the International Collaboration on Endocarditis-Prospective Cohort Study. 240

Arch.Intern.Med. 169:463-473. doi:169/5/463 241

[pii];10.1001/archinternmed.2008.603 [doi]. 242

12. Netto, L. N., C. A. Leal, and H. C. Figueiredo. 2011. Streptococcus dysgalactiae as 243

an agent of septicaemia in Nile tilapia, Oreochromis niloticus (L.). J.Fish.Dis. 244

34:251-254. doi:10.1111/j.1365-2761.2010.01220.x [doi]. 245

13. Park, M. J., I. S. Eun, C. Y. Jung, Y. C. Ko, Y. J. Kim, C. K. Kim, and E. J. Kang. 246

2012. Streptococcus dysgalactiae subspecies dysgalactiae infection after total 247

knee arthroplasty: a case report. Knee.Surg.Relat Res. 24:120-123. 248

doi:10.5792/ksrr.2012.24.2.120 [doi]. 249

14. Rato, M. G., R. Bexiga, C. Florindo, L. M. Cavaco, C. L. Vilela, and I. Santos-250

Sanches. 2013. Antimicrobial resistance and molecular epidemiology of 251

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

11

streptococci from bovine mastitis. Vet.Microbiol. 161:286-294. doi:S0378-252

1135(12)00445-2 [pii];10.1016/j.vetmic.2012.07.043 [doi]. 253

15. Rato, M. G., A. Nerlich, R. Bergmann, R. Bexiga, S. F. Nunes, C. L. Vilela, I. 254

Santos-Sanches, and G. S. Chhatwal. 2011. Virulence gene pool detected in 255

bovine group C Streptococcus dysgalactiae subsp. dysgalactiae isolates by use of 256

a group A S. pyogenes virulence microarray. J.Clin.Microbiol. 49:2470-2479. 257

doi:JCM.00008-11 [pii];10.1128/JCM.00008-11 [doi]. 258

16. Rutherford, S. J., A. N. Rycroft, and A. L. Ridler. 2014. Sources of Streptococcus 259

dysgalactiae in English and Welsh sheep flocks affected by infectious arthritis 260

(joint ill). Vet.Rec. 174:579. doi:vr.101753 [pii];10.1136/vr.101753 [doi]. 261

17. Suzuki, H., T. Lefebure, M. J. Hubisz, P. P. Bitar, P. Lang, A. Siepel, and M. J. 262

Stanhope. 2011. Comparative genomic analysis of the Streptococcus dysgalactiae 263

species group: gene content, molecular adaptation, and promoter evolution. 264

Genome Biol.Evol. doi:evr006 [pii];10.1093/gbe/evr006 [doi]. 265

18. Takahashi, T., K. Sunaoshi, K. Sunakawa, S. Fujishima, H. Watanabe, and K. 266

Ubukata. 2010. Clinical aspects of invasive infections with Streptococcus 267

dysgalactiae ssp. equisimilis in Japan: differences with respect to Streptococcus 268

pyogenes and Streptococcus agalactiae infections. Clin.Microbiol.Infect. 16:1097-269

1103. doi:CLM3047 [pii];10.1111/j.1469-0691.2009.03047.x [doi]. 270

19. Vandamme, P., B. Pot, E. Falsen, K. Kersters, and L. A. Devriese. 1996. 271

Taxonomic study of lancefield streptococcal groups C, G, and L (Streptococcus 272

dysgalactiae) and proposal of S. dysgalactiae subsp. equisimilis subsp. nov. 273

Int.J.Syst.Bacteriol. 46:774-781. 274

20. Vela, A. I., E. Falsen, I. Simarro, E. Rollan, M. D. Collins, L. Dominguez, and J. F. 275

Fernandez-Garayzabal. 2006. Neonatal mortality in puppies due to bacteremia 276

by Streptococcus dysgalactiae subsp. dysgalactiae. J.Clin.Microbiol. 44:666-668. 277

doi:44/2/666 [pii];10.1128/JCM.44.2.666-668.2006 [doi]. 278

279

280

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from

Primer target Annealing Primer sequence (5`-3`) Gene Reference

temperature (°C) SDSD*

T534 T111 T277 T315 T422 T481 T527

ska (forward) AGTCCAAAATCAAAACCATT

ska (reverse) AAATTCTTGGACAGGTTGGG

slo (forward) CTTATCCTATTTCATACAC

slo (reverse) TACTTATAAGTAATCGAACC

scpA (forward) CCATTTGATAAACTTGC

scpA (reverse) TTAATCACCTTAGCTCCC

dppA (forward) CCGTTATGGAGTCCACAATGAA

dppA (reverse) ACTAGCTTTGAGTTTAATAGTAATC

isp (forward) CAACTGAAAAAACCCCAGAGCC

isp (reverse) GGTTGAAGTCAAAGGCACCATAA

lmb (forward) AACCCCAAACAGCCTACGCAAG

lmb (reverse) TAAAACGGGATCCGTCCAGGTAT

rihC (forward) AGGTATTGATGACGCTACTGCT

rihC (reverse) TGAAACAGGTTCGTAGGCTGA

** Six beta-hemolytic group G streptocci associated with infective endocarditis in western Norway. All possessed emm genes belonging to emm types typical of SDSE.

SDSE**

Streptococcals subspecies

TABLE 1. Primer sequences used in PCR and presence of selected genes in SDSD and SDSE endocarditis isolates

52

52

-ska

slo

+

+

+

+

+

+

+

+

58

58

58

58

52

-

+ -

+

scpA

dppA

isp

lmb

rihC

+

+

+

-

-

-

-

+

+

+

+

-

+

+

+

+

-

+

+

+

+

- -

+

+

+

+

+

* One non-hemolytic group C streptococcus belonging to SDSD, emm - nontypeable

15

This study

5

5

5

15

15

+

-

+

+

+

+

+

+

on January 24, 2020 by guesthttp://jcm

.asm.org/

Dow

nloaded from