Neuroscience Letters 594 (2015) 133–136

Contents lists available at ScienceDirect

Neuroscience Letters

journa l homepage: www.e lsev ier .com/ locate /neule t

Research article

Long-term effects of prenatal stress and diazepam on D2 receptorexpression in the nucleus accumbens of adult rats

S. Lakehayli a,∗, N. Saida, M. El Khachibib, M. El Ouahli c, S. Nadifib, F. Hakkoua, A. Tazia

a Laboratory of Pharmacology, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Moroccob Genetics and Molecular Pathology Laboratory, Faculty of Medicine and Pharmacy of Casablanca, 19 Rue Tarik Bnou Ziad, Casablanca, Moroccoc Sultan My Slimane University, Fac Sciences & Tecniques Beni-Mellal, Life Sciences, Morocco

h i g h l i g h t s

• Prenatal stress has long lasting effects on the dopaminergic system in the nucleus accumbens.• Offspring from prenatally stressed dams exhibited significantly elevated Drd2 mRNA expression.• Repeated adult diazepam exposure down-regulated Drd2 expression and prevented the effect of prenatal stress.

a r t i c l e i n f o

Article history:Received 13 February 2015Received in revised form 27 March 2015Accepted 30 March 2015Available online 1 April 2015

Keywords:Drd2 expressionPrenatal stressNucleus accumbensMesocorticolimbic pathwayDiazepam

a b s t r a c t

Early life stress during the gestational period alters specific neuronal circuits leading to behavioralalterations later in life. In the present study, we assessed the effects of prenatal stress and repeatedbenzodiazepine administration on dopamine receptor 2 expression in the nucleus accumbens of adultoffspring.

Our results show elevated Drd2 expression levels in the nucleus accumbens (NAcc) of prenatallystressed rats compared to control subjects, while repeated diazepam administration in adulthood down-regulated Drd2 expression and prevented the effect of prenatal stress. These observations suggest thatprenatal stress may induce permanent alterations in the corticolimbic pathway implicated in drug-seeking behavior.

© 2015 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

It is well known that dopamine exerts its functions via bindingto DA receptors, which are divided into two classes (D1-like andD2-like receptors) on the basis of their biochemical and physiolog-ical effects [1]. The D2 receptors are the most abundant subtypesof D2-like receptors critically involved in drug addiction and thereward pathway [2]. Many studies have shown that stress altersdopaminergic function and elicits specific responses depending onthe type and duration of aversive stimulation [3–5].

Benzodiazepines are some of the most commonly prescribedmedications used to treat anxiety and insomnia. Despite thestrong anxiolytic potential, chronic benzodiazepine treatment

∗ Corresponding author. Tel.: +212 22471289; fax: +212 22267091.E-mail address: Lakehayli.sara@gmail.com (S. Lakehayli).

elicits adaptive responses in the central nervous system, seenbehaviorally as functional tolerance and physical dependence [6].Furthermore, benzodiazepines modulate chloride ion flux throughGABAA receptor channels leading to an overall hyperpolarizationof GABA interneurons and a decrease in their activity. As a conse-quence, a reduction in the release of GABA induces a disinhibitionof dopamine (DA) neurons and produces a strong increase in extra-cellular DA in the mesolimbic reward circuit [7].

Based on the specific involvement of DA system in drug-seekingbehavior, it was important to evaluate the long-lasting effects ofprenatal stress on this system in adult life. In this report, we aimedto examine whether prenatal stress exposure may have a detrimen-tal impact on the dopamine receptor 2 expression and its responseto chronic benzodiazepine administration. We therefore, exposedfemale rats to chronic stress during their last ten days of pregnancyand measured the levels of D2-like receptors by real time PCR inthe nucleus accumbens of adult offspring.

http://dx.doi.org/10.1016/j.neulet.2015.03.0650304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.

134 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136

Table 1Primer sequences used for semi-quantitative real-time PCR.

Gene Gene bank Primer sequences (5′–3′) Amplification size

Hprt NM 012583.2 Fwd: GACCGGTTCTGTCATGTCG 61Rev:ACCTGGTTCATCATCACTAATCAC

Drd2 NM 012547 Fwd AAGCGCCGAGTTACTGTCAT 111Rev GGCAATGATACACTCATTCTGGT

2. Materials and methods

2.1. Animals

Experiments were carried out in male and female Wistar rats(Laboratory of Pharmacology Casablanca), weighing 200–250 g.Rats were housed three per cage and allowed free access to food andwater. Animals were handled daily for 7 days before each experi-ment. Constant temperature (22 ± 1 ◦C) and lighting conditions (12L:12 D cycle) were maintained in the housing room. All experimentswere approved by the Ethical Committee for biomedical researchof the Faculty of Medicine and Pharmacy of Casablanca, Morocco(Comité d’Éthique pour la Recherche Biomédicale de Casablanca:CERBC).

2.2. Drugs

Diazepam (Roche, Morocco), was obtained as solution(1 g/100 ml) and diluted in 0.9% NaCl. Animals received saline (0.9%NaCl) or drug (Diazepam: 2.5 mg/kg) injections, as appropriate ina volume of 5 ml/kg body weight of animal.

2.3. Prenatal stress procedure

Prenatal stress was conducted as previously described [8]: Preg-nant female rats were assigned randomly to prenatal stress (PS) andcontrol (Ctrl) groups. Stress was performed each day of the last tendays of pregnancy in which the neural development of the fetus issupposed to occur in rats [9].

Stressed dams were taken to an experimental box with a gridfloor that allowed delivering daily 80 electric shocks (0.5 mA, for5 s, 1–2 min apart) on a random basis during 100-min sessionscarried out between 08:00 and 16:00 h. Control females were leftundisturbed in their home cages. After birth, the litter sizes wererecorded and adjusted to the same litter size (8 pups per litter).All offspring were fostered by their own mothers. The pups wereweaned at 21 days of age and housed in groups of three per cage. Atotal of 5 randomly selected litters per group was used in this study.A maximum of three pups per litter was used for each experimentalgroup to avoid any litter effect [10]. The experiments were carriedout during the light phase of the light-dark cycle.

2.4. Injection treatments

Adult control (Ctrl) and PS offspring (80 days of age) wereweighed and randomly assigned to either a saline or diazepam(DZP) group (n = 6 for each group). Saline groups received four dailyintraperitoneal (i.p) injections of NaCl 0.9%, while the DZP groupsreceived four daily i.p injections of diazepam (2.5 mg/kg).

2.5. Tissue collection

Adult treated and untreated rats were euthanized by decapita-tion 24 h after the last injection. Brains were quickly removed andplaced on ice. The nucleus accumbens was dissected out from thissection, a rat brain atlas [11] being used for reference. Two coronalcuts were made at right angles to the axis of the brain. The first

cut was made 1 mm anterior to the optic chiasma while the secondcut was 1.5 mm anterior to the first cut. The nucleus accumbens(NAcc) was dissected, frozen on dry ice and stored at −80 ◦C untilmolecular analysis.

2.6. Real-time PCR analysis

Total RNA was extracted from frozen tissues using Tri-zol (Invitrogen) according to manufacturer’s instructions. RNAconcentration and quantified using the NanoVueTM Plus Spec-trophotometer (GE Healthcare, UK). RNA extracts were kept frozenuntil use.

For RT-PCR, cDNAs were obtained by reverse transcription from2 �g of RNA using 4 �l of M-MLV reverse transcriptase (Invitrogen),1 �l random Examer (Invitrogen), 10 nM dNTP (Invitrogen) and 1 �lde RT Superscript at 200 U/�l (Invitrogen, Morocco).

From resulting cDNAs (2 �l per sample), each sequence of inter-est was amplified in a final volume of 25 �l of a commercial reactionmixture, containing: 5× reaction buffer, 1.5 mM MgCl2, 50 �Mprimers, 0.25 U Taq polymerase (BIOLINE, LONDON, UK) and 50 ngof cDNA.

Thermal cycling parameters were: 35 cycles of DNA denatura-tion (5 min at 95 ◦C), primer hybridization (30 s at 95 ◦C), elongation(30 s at 72 ◦C) and a final elongation step (7 min at 72 ◦C). PCRproducts were separated by electrophoresis on 2% agarose gel andvisualized by ethidium bromide staining. Each sample was ana-lyzed in triplicate and to ensure measurements form different PCRruns were cross-comparable. Real time PCR was performed usingreal time PCR Applied Biosystem FAST 7500 apparatus and SyberGreen according to manufacturer’s protocol.

Relative quantification was used to determine fold changes(control vs PS), using the ��CT method. Primer sequences areshown in Table 1. Hprt was used as a housekeeping gene.

2.7. Statistical analysis

Data were analyzed using parametric analysis of variance(ANOVA), with group (control vs PS) and treatment (vehicle vsdiazepam) as between-subject variables, followed by student’s t-test. Significance was set at p < 0.05.

3. Results

As shown in Table 2, no differences in litter sizes, number ofmales and females per litter and male/female ratio were foundbetween prenatally stressed and non-stressed animals (p > 0.05).

Two-way analysis of variance showed a significantstress/treatment interaction (Fig 1: F(3,20) = 32.108; p < 0.001).

Table 2Litter parameters analyzed in control and prenatally stressed litters.

Parameter Control Prenatal stress

Litter size 9.6 ± 0.74 10.2 ± 0.37Number of males per litter 5.2 ± 0.31 5.0 ± 0.22Number of females per litter 4.4 ± 0.51 5.2 ± 0.37Male/female ratio 1.17 ± 0.08 0.99 ± 0.11

Data are expressed as mean ± SEM of PS (n = 10) and control (n = 10) litters.

S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136 135

.0

.5

1.0

1.5

2.0

2.5

Ctrl-Saline PS-Saline Ctrl-DZP PS-DZP

***

** ≠≠≠+

DRD2

rela

�ve

Fold

cha

nge

Fig. 1. Real-time quantitative RT-PCR analysis of the effect of prenatal stress anddiazepam (2.5 mg/kg) injections on Drd2 mRNA level in the NAcc.Data are expressed as mean ± SEM of Drd2 levels in the NAc (n = 6 for eachgroup). **p < 0.01 and ***p < 0.001 vs Ctrl-Saline. +p < 0.05 vs Ctrl-DZP group, /= /= /=p < 0.001 vs PS-Saline group.

Statistical analyses of the group means revealed a significantupregulation of Drd2 mRNA (p < 0.001) in the NAcc of PS animalscompared with Ctrl-Saline group. Moreover, repeated exposureto diazepam in control and prenatally stressed adult rats led to asignificant decrease in the expression of Drd2 mRNA in the NAccin the control rats (p < 0.01, compared with Ctrl-saline group) andthe PS-DZP treated group (p < 0.001, compared with PS-Salinegroup). Strikingly, a significant downregulation of Drd2 mRNA wasobserved in the NAcc of PS group treated with DZP compared tocontrol rats treated with the same drug.

4. Discussion

Stress exposure during early life has long been considered asan etiological factor in psychiatric disorders and enhanced drug-seeking behavior later in life [12–16]. These effects are mediatedby exposure to elevated levels of glucocorticoids which can readilytraverse the placental barrier and influence brain development inutero, leading to behavioral alterations and dysfunction of specificneural substrates [17,18,14]. We previously showed that adult ratsthat had been exposed to prenatal stress display increased placepreference for the diazepam-paired side and are more sensitive tothe anxiolytic actions of benzodiazepines compared with controls[8]. Furthermore, many studies have shown that prenatal stressinfluenced dopamine receptor expression in the nucleus accum-bens of adult offspring [19,20], which were more responsive tostress and cocaine [21,22,14,15], suggesting that early life eventscan program the mesolimbic circuit.

Since the mesolimbic dopaminergic system is strongly impli-cated in motivational and reward aspects of addictive behaviors[23,24], the present investigation was undertaken to determinethe long-term effects of prenatal stress exposure on D2 receptorsexpression.

Our results indicate that prenatal stress induced changes in thenucleus accumbens (NAcc) of adult offspring. Drd2 mRNA expres-sion levels were markedly upregulated in the NAcc of prenatallystressed rats. Moreover, repeated diazepam exposure significantlydown-regulated Drd2 expression in adult PS rats compared withcontrols.

These findings are in agreement with other studies whichreported a similar increase in D2 receptors and a decrease in D3receptors in the nucleus accumbens of adult male offspring sub-jected to prenatal restraint stress [12]. Another study has foundsimilar results in Drd2 overexpression following prenatal dexam-ethasone exposure within the NAcc of adult offspring associatedwith low intra-NAcc levels of dopamine and an impoverishment

in dopaminergic inputs in the NAcc indicating a hypodopamin-ergic state [16]. Other investigators have reported that PS ratshad reduced neuronal numbers in the NAcc and fewer dopamineinputs from the VTA [25]. In addition, PS rats displayed a higherDA turnover in prefrontal cortex and a lower turnover in corpusstriatum and nucleus accumbens [26,27].

All these findings suggests that the increased mRNA levels ofDrd2 in the NAc of prenatal stress exposed animals may appearas a compensatory mechanism due to the low dopamine levelsobserved in this structure. The alteration of dopaminergic systemdue to the prenatal stress may provide a biochemical basis forthe behavioral abnormalities previously reported in adult rats sub-jected to prenatal stress which demonstrate that prenatal stressenhanced the abuse potential of benzodiazepines in the offspringduring adulthood [8].

The mesolimbic dopaminergic system is known to be involvedin motivational and reward aspects of addictive behaviors [23,24].Furthermore, chronic administration of benzodiazepine stimulateddopamine levels in the NAcc by reducing the inhibition of dopamin-ergic neurons [28]. Moreover, a previous study in rats suggestedthat ventral tegmental area (VTA) DA neurons are disinhibited afterdiazepam injection [29]. Besides, activation of GABAA receptors bydirect administration of muscimol (GABAA receptor agonist) intothe VTA significantly increased dopamine release in the NAcc [30].High levels of dopamine within the nucleus accumbens mediatethe rewarding effects of drug of abuse [31].

The results of the present study showed that repeated diazepamadministration down-regulated Drd2 expression in the nucleusaccumbens of PS and control animals treated with diazepam.This down-regulation seems to be an adaptive mechanism inresponse to the potential increased dopamine levels followingsuch treatment. Moreover, the down-regulation of D2 receptorsfollowing diazepam administration was more marked in adultprenatally stressed animals compared with non-stressed ani-mals, suggesting a hypersensitivity of dopamine receptors due tothe hypo-dopaminergic state induced by prenatal stress. There-fore, prenatal stress exposure changed the sensitivity of themesencephalic dopaminergic transmission to benzodiazepine inadulthood.

Interestingly, a recent study has shown that L-DOPA admin-istration normalized the hypodopaminergic state and the Drd2responses to subsequent morphine and ethanol exposure ofprenatal DEX exposed animals [16] suggesting that a simple rein-statement of dopaminergic homeostasis may prevent drug abusein vulnerable individuals.

More studies are needed to determine the precise mechanismsunderlying the susceptibility to later substance abuse.

5. Conclusion

In summary, we demonstrate that prenatal stress has long last-ing effects in prenatally stressed offsprings that extend into theadulthood. Prenatally stressed rats displayed an increased Drd2mRNA expression levels in the nucleus accumbens which was sig-nificantly down-regulated after repeated adult administration ofdiazepam.

References

[1] J.M. Beaulieu, R.R. Gainetdinov, The physiology, signaling, and pharmacologyof dopamine receptors, Pharmacol. Rev. 63 (2011) 182–217.

[2] H.S. Bateup, E. Santini, W. Shen, S. Birnbaum, E. Valjent, D.J. Surmeier, et al.,Distinct subclasses of medium spiny neurons differentially regulate striatalmotor behaviors, Proc. Natl. Acad. Sci. U. S. A. 107 (2010) 14845–14850.

[3] S. Puglisi-Allegra, E. Kempf, C. Schleef, S. Cabib, Repeated stressfulexperiences differently affect brain dopamine receptor subtypes, Life Sci. 48(1991) 1263–1268.

136 S. Lakehayli et al. / Neuroscience Letters 594 (2015) 133–136

[4] S. Cabib, S. Puglisi-Allegra, F.R. D’Amato, Effects of postnatal stress ondopamine mesolimbic system responses to aversive experiences in adult life,Brain Res. 604 (1993) 232–239.

[5] J.M. Finlay, M.J. Zigmond, The effect of stress on central dopaminergicneurons: possible clinical implications, Neurochem. Res. 22 (1997)1387–1394.

[6] J.H. Woods, J.L. Katz, G. Winger, Benzodiazepines: use, abuse, andconsequences, Pharmacol. Rev. 4 (1992) 151–347.

[7] K.R. Tan, M. Brown, G. Labouèbe, C. Yvon, C. Creton, J.M. Fritschy, U. Rudolph,C. Lüscher, Neural bases for addictive properties of benzodiazepines, Nature463 (2010) 769–774.

[8] S. Lakehayli, N. Said, O. Battas, F. Hakkou, A. Tazi, Prenatal stress alters placeconditioning and sensitivity to benzodiazepines in adult rats, Neurosci. Lett.591 (2015) 187–191.

[9] B. Clancy, R.B. Darlington, B.L. Finlay, Translating developmental time acrossmammalian species, Neuroscience 105 (2001) 7–17.

[10] R. Chapman, J. Stern, Failure of severe maternal stress or ACTH duringpregnancy to affect emotionality of male rat offspring: implications of littereffects for prenatal studies, Dev. Psychobiol. 12 (1979) 255–269.

[11] G. Paxinos, C. Watson, The Rat Brain, sixth ed., Elsevier academic Press,Burlington, MA, USA, 2007.

[12] C. Henry, G. Guegant, M. Cador, E. Arnauld, J. Arsaut, M. Le Moal, J.Demotes-Mainard, Prenatal stress in rats facilitates amphetamine-inducedsensitization and induces long lasting changes in dopamine receptors in thenucleus accumbens, Brain Res. 685 (1995) 179–186.

[13] M. Vallée, S. Maccari, F. Dellu, H. Simon, M. Le Moal, Long term effects ofprenatal stress and postnatal handling on age-related glucocorticoid secretionand cognitive performance: a longitudinal study in the rat, Eur. J. Neurosci. 11(1999) 2906–2916.

[14] P.V. Piazza, M. Le Moal, Pathophysiological basis of vulnerability to drugabuse: role of an interaction between stress, glucocorticoids, anddopaminergic neurons, Annu. Rev. Pharmacol. Toxicol. 36 (1996) 359–378.

[15] R. Sinha, Chronic stress, drug use, and vulnerability to addiction, Ann. N.Y.Acad. Sci. 1141 (2008) 105–130.

[16] A.J. Rodrigues, P. Leao, J.M. Pego, D. Cardona, M.M. Carvalho, M. Oliveira, et al.,Mechanisms of initiation and reversal of drug-seeking behavior induced byprenatal exposure to glucocorticoids, Mol. Psychiatry 17 (2012)1295–1305.

[17] A.J. Rodrigues, P. Leao, M. Carvalho, O.F. Almeida, N. Sousa, Potentialprogramming of dopaminergic circuits by early life stress,Psychopharmacology 214 (2010) 107–120.

[18] J.J. Cerqueira, J.M. Pego, R. Taipa, J.M. Bessa, O.F. Almeida, N. Sousa,Morphological correlates of corticosteroid-induced changes in prefrontalcortex-dependent behaviors, J. Neurosci. 25 (2005) 7792–7800.

[19] A.L. Jongen-Relo, G.J. Docter, A.J. Jonker, E. Vreugdenhil, H.J. Groenewegen, P.Voorn, Differential effects of dopamine depletion on the binding and mRNAlevels of dopamine receptors in the shell and core of the rat nucleusaccumbens, Brain Res. Mol. Brain Res. 25 (1994) 333–343.

[20] M.A. Berger, V.G. Barros, M.I. Sarchi, F.I. Tarazi, M.C. Antonelli, Long-termeffects of prenatal stress on dopamine and glutamate receptors in adult ratbrain, Neurochem. Res. 27 (2002) 1525–1533.

[21] T.E. Kippin, K.K. Szumlinski, Z. Kapasova, B. Rezner, R.E. See, Prenatal stressenhances responsiveness to cocaine, Neuropsychopharmacology 33 (2008)769–782.

[22] P.V. Piazza, J.M. Deminiere, M. Le Moal, H. Simon, Factors that predictindividual vulnerability to amphetamine self-administration, Science 245(1989) 1511–1513.

[23] G.F. Koob, N.D. Volkow, Neurocircuitry of addiction,Neuropsychopharmacology 35 (2010) 217–238.

[24] M.J. Meaney, W. Brake, A. Gratton, Environmental regulation of thedevelopment of mesolimbic dopamine systems: a neurobiologicalmechanism for vulnerability to drug abuse? Psychoneuroendocrinology 27(2002) 127–138.

[25] M. Carlsson, A. Carlsson, Interactions between glutamatergic andmonoaminergic systems within the basal ganglia implications forschizophrenia and Parkinson’s disease, Trends Neurosci. 13 (1990) 272–276.

[26] S.J. Alonso, E. Navarro, C. Santana, M. Rodríguez, Motor lateralizationbehavioral despair and dopaminergic brain asymmetry after prenatal stress,Pharmacol. Biochem. Behav. 58 (2) (1997) 443–448.

[27] E. Fride, M. Weinstock, Prenatal stress increases anxiety related behavior andalters cerebral lateralization of dopamine activity, Life Sci. 42 (1988)1059–1065.

[28] K.R. Tan, U. Rudolph, C. Luscher, Hooked on benzodiazepines: GABAA receptorsubtypes and addiction, Trends Neurosci. 34 (4) (2011) 188–197.

[29] D.P. O’Brien, F.J. White, Inhibition of non-dopamine cells in the ventraltegmental area by benzodiazepines: relationship to A10 dopamine cellactivity, Eur. J. Pharmacol. 142 (1987) 343–354.

[30] Z.X. Xi, E.A. Stein, Nucleus accumbens dopamine release modulation bymesolimbic GABAA receptors-an in vivo electrochemical study, Brain Res. 798(1998) 156–165.

[31] G.F. Koob, M. Le Moal, Drug addiction, dysregulation of reward, and allostasis,Neuropsychopharmacology 24 (2) (2001) 97–129.