NEUROPROTECTIVE SIGNALING THROUGH METABOTROPIC GLUTAMATE RECEPTOR 1
Transcript of NEUROPROTECTIVE SIGNALING THROUGH METABOTROPIC GLUTAMATE RECEPTOR 1
NEUROPROTECTIVE SIGNALING THROUGH METABOTROPIC GLUTAMATE
RECEPTOR 1
A Dissertation
submitted to the Faculty of the
Graduate School of Arts and Sciences
of Georgetown University
in partial fulfillment of the requirements for the
degree of
Doctor of Philosophy
in Neuroscience
By
Andrew Clayton Emery, M.A.
Washington, DC
April 12, 2011
ii
Copyright 2011 by Andrew Clayton Emery
All Rights Reserved
iii
NEUROPROTECTIVE SIGNALING THROUGH METABOTROPIC GLUTAMATE
RECEPTOR 1
Andrew C. Emery, M.A.
Thesis Advisor: Jarda T. Wroblewski, Ph.D.
ABSTRACT
Metabotropic glutamate receptor 1 (mGlu1) is a G protein-coupled receptor which enhances
the hydrolysis of membrane phosphoinositides (PI). Additionally, mGlu1 receptors have been
shown to stimulate cytoprotective signaling in the presence of the endogenous ligand glutamate.
This goal of the experiments in the following thesis was to (1) characterize the signal
transduction pathway through which mGlu1 receptors protect cells expressing these receptors
from toxicity. Instead of the classical G protein-mediated (PI) signaling, the following
experiments indicate that mGlu1a receptors cause a sustained phosphorylation of ERK that is -
arrestin-1 dependent. This G protein-independent signaling pathway was necessary for protective
signaling and was stimulated by glutamate, but not quisqualate, demonstrating ligand bias at this
receptor. (2) Therefore, pharmacological and mutational studies were carried out to investigate
the molecular basis of this ligand bias. Together, these studies indicate the existence of 3 classes
of mGlu1a receptor agonists: (a) unbiased agonists, such as glutamate, which stimulate both
signal transduction pathways, (b) biased agonists, such as quisqualate, which only stimulate PI
hydrolysis, and (c) agonists which are biased toward sustained ERK phosphorylation and
protective signaling. In these studies, glutaric and succinic acid were identified as protection-
biased mGlu1a receptor agonists. Further pharmacological studies indicate that quisqualate does
not inhibit glutamate-induced protection and glutaric acid fails to inhibit glutamate-induced PI
iv
hydrolysis, suggesting the existence of two distinct, non-overlapping agonist binding sites on
mGlu1a receptors.
v
I wish to extend my sincere gratitude to my family and colleagues who have been so helpful and
supportive throughout the process of this thesis. In particular I wish to thank my wife, Maria Jena
Emery, for all of her love and care, as well as my parents, Clay and Wendy Emery. My advisor,
Dr. Jarda Wroblewski, has served as a kindly and sage mentor throughout my entire tenure in his
laboratory and was instrumental through the entire process of this thesis. Many of the
experiments performed herein were successful due to the assistance of Dr. Sergey Pshenichkin,
Ewa Grajkowska, and Rodrigue Takoudjou, S.J. Furthermore, Drs. Barry Wolfe and Bob Yasuda
were extremely helpful in regular discussion of experimental methods and results. I remain
especially grateful to Dr. Jean Wrathall, who provided grant support to me from the Training
Program in Neural Injury and Recovery for the entirety of my thesis research.
Many thanks,
Andrew C. Emery
vi
TABLE OF CONTENTS
ABSTRACT .................................................................................................................... iii
ACKNOLEDGEMENTS ................................................................................................. v
TABLE OF CONTENTS ................................................................................................ vi
LIST OF FIGURES ....................................................................................................... vii
LIST OF TABLES ............................................................................................................ x
LIST OF ABBREVIATIONS .......................................................................................... xi
CHAPTER 1: Thesis Introduction .................................................................................... 1
MATERIALS AND METHODS ..................................................................................... 9
CHAPTER 2: The Protective Signaling of Metabotropic Glutamate Receptor 1 is Mediated by
Sustained β-Arrestin-1-dependent ERK Phosphorylation .............................................. 14
INTRODUCTION ......................................................................................................... 15
RESULTS ...................................................................................................................... 17
DISCUSSION ................................................................................................................. 47
CHAPTER 2: Metabotropic Glutamate Receptor 1 Possesses Two Glutamate Binding Sites
Coupled to Different Signal Transduction Systems........................................................ 50
INTRODUCTION .......................................................................................................... 51
RESULTS ....................................................................................................................... 54
DISCUSSION ................................................................................................................. 88
CHAPTER 4: Thesis Conclusion.................................................................................... 94
REFERENCES ............................................................................................................. 100
vii
LIST OF FIGURES
Figure 1. Time course of protection by glutamate in CHO cells expressing mGlu1a receptors
........................................................................................................................................ 18
Figure 2. Efficacy of glutamate to protect CHO cells .................................................... 19
Figure 3. Potency of glutamate to protect CHO cells expressing mGlu1a receptors ..... 21
Figure 4. Inhibition of the protective effect of glutamate by mGlu1-selective noncompetitive
antagonists....................................................................................................................... 22
Figure 5. Noncompetitive inhibition of protection by glutamate ................................... 23
Figure 6. Pharmacology of PI hydrolysis through mGlu1a receptors ............................ 25
Figure 7. Bioassay demonstrating the stability of glutamate and quisqualate ................ 27
Figure 8. Receptor reserve for mGlu1a receptor-mediated PI hydrolysis ...................... 28
Figure 9. Glutamate-induced protection is PLC-independent but MEK and dynamin-dependent
......................................................................................................................................... 30
Figure 10. Internalization of mGlu1a receptors is dynamin-dependent ......................... 32
Figure 11. Glutamate-induced protection is PLC-independent but MEK and dynamin-dependent
in neurons ........................................................................................................................ 33
Figure 12. ERK phosphorylation due to mGlu1 agonists .............................................. 35
Figure 13. ELISA-based quantification of phosphorylated ERK ................................... 36
Figure 14. Agonist profiles of ERK phosphorylation through mGlu1a receptors .......... 37
Figure 15. Silencing of -arrestin-1 with shRNA ........................................................... 40
Figure 16. Knockdown β-arrestin-1 of does not impair classical mGlu1a receptor signaling
......................................................................................................................................... 41
Figure 17. Protective signaling through mGlu1a is abolished by shRNA silencing of β-arrestin-1
......................................................................................................................................... 42
Figure 18. Endocytosis of mGlu1a receptors is β-arrestin-1-dependent......................... 44
viii
Figure 19. Sustained ERK phosphorylation through mGlu1a receptors is β-arrestin-1-dependent
......................................................................................................................................... 45
Figure 20. Schematic representation of signal transduction through mGlu1 receptors . 46
Figure 21. Agonist profile for mGlu1a-mediated PI hydrolysis .................................... 56
Figure 22. Agonist profile for mGlu1a-mediated transient ERK phosphorylation ....... 57
Figure 23. Agonist profile for mGlu1a-mediated sustained ERK phosphorylation
......................................................................................................................................... 58
Figure 24. Agonist profile for mGlu1a-mediated protective signaling.......................... 60
Figure 25. Competitive antagonism of glutamate-induced PI hydrolysis by LY367685
......................................................................................................................................... 62
Figure 26. Competitive antagonism of glutamate-induced PI hydrolysis by 3-MATIDA
......................................................................................................................................... 63
Figure 27. Competitive antagonism of glutamate-induced transient ERK phosphorylation
......................................................................................................................................... 64
Figure 28. Lack of competitive antagonism on glutamate-induced sustained ERK
phosphorylation.............................................................................................................. 66
Figure 29. Lack of competitive antagonism on glutamate-induced protective signaling
......................................................................................................................................... 67
Figure 30. Protein expression levels of mutant mGlu1a receptors ................................. 69
Figure 31. Lack of classical mGlu1a receptor signaling in T188A mutant receptors .... 70
Figure 32. Silencing of -arrestin-1 in CHO cells expressing T188A mutant mGlu1a receptors
......................................................................................................................................... 71
Figure 33. -arrestin-1 dependent sustained ERK phosphorylation in T188A mutant mGlu1a
receptors .......................................................................................................................... 72
Figure 34. Glutamate-induced protective signaling in T188A mutant mGlu1a receptors
......................................................................................................................................... 73
ix
Figure 35. Classical signaling in R323V and K409A mutant mGlu1a receptors .......... 75
Figure 36. ERK phosphorylation is G protein-dependent in R323V and K409A mutant mGlu1a
receptors .......................................................................................................................... 76
Figure 37. R323V and K409A mutant mGlu1a receptors do not stimulate long-term ERK
phosphorylation............................................................................................................... 77
Figure 38. R323V and K409A mutant mGlu1a receptors do not protect CHO cells ..... 78
Figure 39. Effects of glutaric and succinic acids on PI hydrolysis ................................. 80
Figure 40. Glutaric acid is an mGlu1a receptor agonist that causes ERK phosphorylation
......................................................................................................................................... 81
Figure 41. Glutaric acid protects CHO cells through activity at mGlu1a receptors ....... 82
Figure 42. Glutaric acid protects cerebellar granule neurons through mGlu1a receptors
......................................................................................................................................... 83
Figure 43. Succinic acid protects CHO cells through activity at mGlu1a receptors ...... 84
Figure 44. Quisqualate fails to inhibit glutamate-induced protection at mGlu1a receptors
......................................................................................................................................... 86
Figure 45. Glutaric acid fails to inhibit glutamate-induced PI hydrolysis at mGlu1a receptors
......................................................................................................................................... 87
x
LIST OF TABLES
Table 1. Summary of mGlu1a receptor pharmacology ................................................... 24
Table 2. Different responses induced by three classes of agonists acting at wild type and mutated
mGlu1a receptors ........................................................................................................... 90
Table 3.Sequences of PCR primers for creating mutant mGlu1 receptors ................... 99
xi
LIST OF ABBREVIATIONS
Asp, L-aspartate; CHO, Chinese hamster ovary; CPCCOEt, 7-hydroxyiminocyclopropan[b]
chromen-1a-carboxylic acid ethyl ester; DHPG, (S)-3,5-Dihydroxyphenylglycine; DTT,
dithiothreitol; ELISA, Enzyme-linked immunosorbent assay; ERK, extracellular signal-regulated
kinase; GA, L-glutaric acid; Glu, L-glutamate; GPCR, G protein-coupled receptor; IP, inositol
phosphate; JNJ16259685, (3,4-dihydro-2H-pyrano[2,3]b quinolin-7-yl) (cis-4-
methoxycyclohexyl) methanone; L-CA, L-cysteic acid; LY367385, (+)-2-Methyl-4-
carboxyphenyl glycine; MAPK, mitogen-activated protein kinase; MEK, ERK kinase; mGlu,
metabotropic glutamate; MTT, [3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium
Bromide]; PI, phosphatidylinositdes; PKC, Protein kinase C; PLC, Phospholipase C; Quis, L-
quisqualate; TPA, 12-O-tetradecanoylphorbol-13-acetate; YM 298198, 6-Amino-N-cyclohexyl-
N,3-dimethylthiazolo[3,2-a]benzimidazole-2-carboxamide hydrochloride.
1
CHAPTER 1
Thesis Introduction
2
INTRODUCTION
Properties of metabotropic glutamate receptors
Metabotropic glutamate (mGlu) receptors are a family of G protein-coupled receptors linked
to multiple second messenger systems (Conn and Pin, 1997). Eight mGlu receptors have been
cloned and have been categorized into three groups based on sequence homology and
pharmacology (Conn and Pin, 1997; Pin and Duvoisin, 1995). Group I includes mGlu1 and
mGlu5, group II mGlu2 and mGlu3, and group III mGlu4, mGlu6, mGlu7, and mGlu8. These
receptors form family C of G protein coupled receptors, which also includes the parathyroid
calcium-sensing receptor (Garrett et al., 1995), the GABAB receptor (Kaupmann et al., 1997),
and pheromone receptors (Matsunami and Buck, 1997). Structural features of this family of
receptors include a large extracellular domain containing an agonist binding site (Takahashi et
al., 1993), seven transmembrane spanning domains, and a variable-length intracellular C-
terminal domain (Bhave et al., 2003). The second intracellular loop and portions of the C-
terminus are responsible for binding of G proteins and therefore for the coupling of mGlu
receptors to the different second messenger systems (Gomeza et al., 1996a; Pin et al., 1994).
Initial evidence for the existence of mGlu1 receptors came from reports which described the
ability of glutamate to stimulate the accumulation of inositol phosphates in cultured striatal and
cerebellar granule neurons (Nicoletti et al., 1986; Sladeczek et al., 1985). Two laboratories later
cloned these receptors (Houamed et al., 1991; Masu et al., 1991) and further studies
demonstrated that group I mGlu receptors stimulate phospholipase C (PLC) via coupling to
Gq/11 (Aramori and Nakanishi, 1992; Pickering et al., 1993). Activated PLC cleaves
3
phosphatidylinositol-4,5-bisphosphate into inositol-1,4,5-trisphosphate and diacylglycerol.
Inositol phosphates then cause calcium release from intracellular stores, which happens due to
activation of both IP3 receptors and ryanodine receptors, both of which are located on the surface
of the endoplasmic reticulum (del Rio et al., 1999). Released calcium and diacylglycerol cause
the phosphorylation of protein kinase C (Nishizuka, 1995). Furthermore, agonist stimulation of
group I mGlu receptors has more recently been shown to cause a transient protein kinase C-
dependent phosphorylation of extracellular signal-regulated kinase (ERK) (Choe and Wang,
2001; Ferraguti et al., 1999; Karim et al., 2001).
Physiological roles of mGlu1 receptors
Metabotropic glutamate receptor 1 is highly expressed in the granule and Purkinje cells of the
cerebellum, in the substania nigra pars compacta, in the septal nuclei, in the relay nuclei of the
dorsal thalamus, and throughout the dorsal pallidum (Martin et al., 1992). Studies of the
localization of mGlu1 receptors have indicated that they are most highly-expressed on
postsynaptic membranes at excitatory synapses (Baude et al., 1993). Most physiological studies
on mGlu1 receptors have been conducted to investigate its roles in cerebellar long-term
depression at the parallel fiber-Purkinje cell synapse (Kano et al., 2008). Knockout mice lacking
the gene (GRM1) for mGlu1 receptors are ataxic and have impaired motor learning skills and
cerebellar LTD (Aiba et al., 1994). Reintroduction of mGlu1 receptors in these mice corrects
ataxia and aberrant cerebellar LTD (Ichise et al., 2000). Additionally, mGlu1 receptors seem to
play a role in the synaptogenesis of the cerebellar cortex since GRM1 knockout mice have
impaired synapse elimination at parallel fiber-Purkinje cell synapses (Kano et al., 1997). In
4
addition to its roles in synaptic plasticity, mGlu1 receptors have been shown to mediate slow
EPSPs at these synapses (Batchelor et al., 1997).
Pharmacology of Group I Metabotropic Glutamate Receptors
Pharmacologically, group I mGlu receptors can be distinguished from other groups of mGlu
receptors by the action of their most potent agonist quisqualate, and by the group I-selective
agonist 3,5-dihydroxyphenylglycine (DHPG) (Ito et al., 1992; Schoepp et al., 1994). The
nonselective agonist of mGlu receptors 1-Aminocyclopentane-trans-1,3-di
carboxylic acid (trans-ACPD) stimulates PI hydrolysis through mGlu1 receptors, however it is
less potent than the endogenous agonist glutamate (Thomsen et al., 1993). L-aspartate also acts
as an agonist at mGlu1 receptors, but it is also active at NMDA receptors (Chen et al., 2005),
which is probably responsible for limiting its use on mGlu1 receptors in the literature.
Additionally, sulfur-containing amino acids, such as L-cysteic acid and L-homocysteic acid have
been shown to possess the properties of agonists at mGlu1 receptors (Porter and Roberts, 1993;
Shi et al., 2003). Despite the relatively high number of available ligands for mGlu1 receptors, an
agonist which is selective for mGlu1 receptors and inactive at mGlu5 receptors has not yet been
identified.
Competitive antagonism of mGlu1 receptors was initially accomplished using several analogs
of phenylglycine, most notably MCPG (Eaton et al., 1993). None of these compounds are
selective for mGlu1 receptors (Hayashi et al., 1994), but further modifications led to the
development of LY367385, which is moderately potent and for mGlu1 receptors with little
action at mGlu5 receptors (Clark et al., 1997). Additionally, 3-MATIDA, a rigidified
5
phenylglycine analog, selectively competitively inhibits mGlu1 receptors (Moroni et al., 2002).
The most potent and selective antagonists at mGlu1 receptors are the noncompetitive
antagonists, which bind to an allosteric site situated on the seventh transmembrane domain of the
receptor (Litschig et al., 1999). A number of these compounds exist and are typified by the first
to be synthesized, CPCCOEt (Hermans et al., 1998). Subsequently, more selective and potent
noncompetitive antagonists which are systemically active have been discovered, and these
compounds include YM-298198 (Kohara et al., 2005), and JNJ 16259685 (Lavreysen et al.,
2004) .
Metabotropic Glutamate Receptors in Neuroprotection
Several studies indicate that activation of group I mGlu receptors promotes neuronal death.
Such results have been demonstrated in an in vivo model of rat traumatic brain injury and in an in
vitro model of traumatic injury of rat cortical neurons (Mukhin et al., 1996). The toxic effects of
group I mGlu receptors appear to be mediated through mechanisms including the activation of
protein kinase C (Bruno et al., 1995), potentiation of NMDA and AMPA currents (Aniksztejn et
al., 1992; Bleakman et al., 1992; Harvey and Collingridge, 1993; Meguro et al., 1992), and the
activation of voltage-gated calcium channels (Chavis et al., 1995). In contrast, multiple other
studies indicate that in the presence of glutamate, mGlu1 induces signaling that facilitates growth
and development as opposed to neurotoxicity. Activation of mGlu1 receptors has been shown to
increase tolerance to ischemia in the hippocampus, thus minimizing cellular damage due to
ischemia (Werner et al., 2007). When stimulated with glutamate, mGlu1 has been shown to
stimulate axon elongation in the developing central nervous system (Kreibich et al., 2004) and
6
outgrowth of dendritic spines in the developing hippocampus (Vanderklish and Edelman, 2002).
It has recently been described that mGlu1a produces dual neuroprotective and neurotoxic
signaling in cerebellar and cortical neurons (Pshenichkin et al., 2008). Thus, mGlu1a exhibits the
properties of a dependence receptor (Chao, 2003; Mehlen and Bredesen, 2004), inducing
apoptosis in the absence of glutamate, while promoting neuronal survival in its presence.
However, the molecular mechanisms of this neuroprotective signaling are unknown.
Regulation of mGlu1 Receptors by β-arrestin
Like other G protein-coupled receptors, desensitization and internalization of mGlu1 receptors
occurs both constitutively and in response to agonist stimulation. Initial studies on the
desensitization of mGlu1 receptors implicated protein kinase C (PKC), since phorbol esters
apparently increased desensitization of mGlu1 receptors and these increases were blocked by
inhibitors of PKC (Catania et al., 1991). Further studies on PKC regulation of mGlu1 receptors
indicate that PKC phosphorylates the receptor on the second intracellular loop (Alaluf et al.,
1995), which is where the G protein binds (Gomeza et al., 1996b), thus reducing G protein-
dependent activity through mGlu1 receptors. Along with PKC-mediated desensitization, in the
presence of an agonist, mGlu1 receptors undergo rapid homologous desensitization and are
endocytosed in a dynamin and β-arrestin-1-dependent manner (Mundell et al., 2001). During this
process, mGlu1 may be phosphorylated by several kinases. Homologous desensitization and
endocytosis likely require the activity of G-protein coupled receptor kinases (GRKs). Multiple
GRK isoforms, including GRK2, GRK4, GRK5, and GRK6 have been shown to have the
potential to phosphorylate mGlu1 (Dhami and Ferguson, 2006), however it remains unclear
7
which of these kinases phosphorylate native mGlu1 receptors. One study indicates that GRK2
regulates the desensitization of mGlu1 via a physical interaction with the second intracellular
loop (Dhami et al., 2004). However, phosphorylation of the C-terminus of mGlu1 receptors by
GRK4 appears to be necessary for β-arrestin1 binding (Iacovelli et al., 2003). Additionally, the
association of mGlu1 receptors with β-arrestin has been also shown to induce receptor-mediated
transient phosphorylation of ERK (Iacovelli et al., 2003).
Cellular Signaling through β-arrestin
ERK functions in the MAP kinase pathway downstream of MEK1/2 and the phosphorylation
of ERK is a critical step in signal transduction from the membrane to the nucleus and usually
causes protective or mitogenic cellular responses (Seger and Krebs, 1995). Although a relatively
recently described signal transduction pathway, numerous G protein-coupled receptors have been
shown to stimulate ERK phosphorylation in a β-arrestin-dependent manner (Kenakin, 2007).
Through numerous receptors, ERK can be activated by both β-arrestin dependent and G protein-
dependent signaling pathways (Wei et al., 2003). In several systems, including PAC1 and VPAC
receptors, these parallel pathways have been described where ERK phosphorylation due to G
protein activation is transient, whereas phosphorylation is sustained over time when ERK is
bound to β-arrestin (Broca et al., 2009). Transient, G protein-dependent ERK phosphorylation is
terminated by the action of β-arrestin, which is critical for the desensitization and internalization
of G protein-coupled receptors (Lohse et al., 1990).
Anti-apoptotic signaling through β-arrestin-dependent pathways has been demonstrated for
numerous G protein-coupled receptors. There is evidence that β-arrestin-mediated ERK
8
phosphorylation is independent from G protein signaling when β-arrestin is bound to a receptor.
Some receptors where this signaling mechanism has been characterized include the angiotensin
II type 1a receptor (Luttrell et al., 2001), the D3 dopamine receptor (Beom et al., 2004), the β2-
adrenergic receptor (Shenoy et al., 2006), and the mu opioid receptor (Macey et al., 2006). While
β-arrestin-mediated signaling has not previously been demonstrated due to mGlu1 receptor
activation, it is known that β-arrestin1 is involved in rapid agonist-induced internalization of
mGlu1 (Dale et al., 2001).
Ligand Bias
Through the same receptor, β-arrestin-mediated signaling may not follow an identical
pharmacological profile as classical G protein-mediated modes of signal transduction. This
phenomenon is known as ligand bias, which is a new and emerging concept in pharmacology
that has been shown to exist for multiple G protein-coupled receptors when various agonists
preferentially activate receptor conformations that are selectively conducive for different signal
transduction pathways (Violin and Lefkowitz, 2007). The earliest reported example of ligand
bias was in M1 muscarinic receptors, which activate both cAMP and PLC in response to their
endogenous agonist acetylcholine. However, several ligands were identified that selectively
activate PLC while blocking cAMP formation through these receptors (Fisher et al., 1993). Since
this initial report of ligand bias at different modes of G protein-mediated signaling through a
single receptor, ligands have been identified preferentially activate β-arrestin-mediated signaling
which is independent of G protein signaling (Rajagopal et al., 2010).
9
MATERIALS AND METHODS
Materials. Dulbecco's modified Eagle's media (DMEM) and Neurobasal media, B27
supplement, fetal bovine serum, and all other reagents used for cell cultures were purchased from
Invitrogen (Carlsbad, CA). All restriction enzymes used for molecular biology were purchased
from New England Biolabs (Ipswich, MA). Receptor agonists glutamate, aspartate, cysteic acid,
quisqualate, and DHPG, antagonists LY367385, 3-MATIDA, CPCCOEt, YM298198, JNJ
16259685, and inhibitors U73122, dynasore, U0126, and PD98059 were obtained from Tocris
Cookson (Ellisville, MO). Glutaric and succinic acids and all other chemicals were purchased
from Sigma (St. Louis, MO).
Cell cultures. CHO-K1 cells (American Type Culture Collection, Manassas, VA) were
stably transfected with mGlu1a receptor cDNA in pcDNA-3.1 vector (Invitrogen) using
Lipofectamine 2000 transfection reagent (Invitrogen). Cell lines were created from mass stable
transfections and selected with the antibiotic G-418 (Invitrogen). Cells were cultured in DMEM
supplemented with 10% fetal bovine serum, 2 mM glutamine, and 5% L-proline (Invitrogen).
Primary cultures of cerebellar granule neurons were prepared as described previously
(Wroblewski et al., 1985). Cerebella were dissected from 7-day old Sprague-Dawley rats and
granule cells were grown on poly-D-lysine coated 96-well plates (Nunc, Wiesbaden, Germany)
in Neurobasal medium containing B27 supplement, 2 mM glutamine, 100 g/ml gentamicin, and
either 5 mM KCl or 25 mM KCl. Cytosine arabinoside (10 µM) was added to granule cells the
day after plating to prevent growth of non-neural cells.
10
Transfection of cells with shRNA. SureSilencing shRNA plasmids against β-arrestin-1
(insert sequence: ATGGAGGAAGCTGATGATACT) and scrambled control were contained in
the pGeneClip Hygromycin vector (SABiosciences, Frederick, MD). CHO cells stably
expressing mGlu1a were transfected with plasmids containing shRNA using Effectene
transfection reagent (Quiagen, Valencia, CA) and selected in 0.8 mg/ml Hygromycin B.
Knockdown of β-arrestin-1 was confirmed by Western blotting. Rescue experiments were
performed by transfecting cells expressing shRNA with human β-arrestin-1, which was
subcloned in pcDNA-6.2 (Invitrogen).
Site directed mutagenesis. Introduction of point mutations in mGlu1a cDNA was made
using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Briefly, 20 ng
of plasmid containing mGlu1a cDNA was mixed with 125 ng of two mutagenic primers
(sequences in Table 3), dNTPs (50 μM) and 2.5 unit of Pfu DNA polymerase in a final volume
of 50 μl. Samples were denatured at 95°C for 30 sec and subjected to 20 cycles: denaturation
(95°C, 30 sec), annealing (55°C, 1 min), and elongation (72°C, 30 min), with a final 10 min
extension. Then 10 units of DpnI were added to digest the DNA template. After incubation at
37°C for 1 hour, samples were used for transformation of E. Coli XL1-Blue Supercompetent
cells. Positive clones were identified by restriction analysis and the authenticity of each mutation
was confirmed by DNA sequencing.
Western blots. Cells grown and treated in 35 mm dishes were collected in 25 mM Tris-
HCl buffer, pH 7.5 containing Halt protease and phosphatase inhibitor cocktails with 1 mM
EDTA (Pierce Biotechnology, Rockford, IL). Proteins were solubilized in Laemmli buffer
containing 50 mM DDT, and equal amounts of sample protein were resolved on 8%
11
polyacrylamide gels (Invitrogen). Proteins were transferred to Immobilon-P PVDF membranes
(Millipore, Billerica, MA) and were probed with antibodies against mGlu1a (BD Biosciences,
San Jose, CA), p44/42 MAPK (ERK1/2; Cell Signaling Technology, Danvers, MA), Phospho-
p44/42 MAPK (ERK1/2) (Thr202
/Tyr204
; Cell Signaling Technology), β-actin (Sigma), β-tubulin
(Sigma), and β-arrestin-1 (Abcam, Cambridge, MA). Proteins were visualized by incubation with
secondary antibodies coupled to horseradish peroxidase (Pierce) followed by exposure to
chemiluminescent HRP substrate SuperSignal West Femto (Pierce) and imaged with a CCD
camera. Blots were quantified using ImageJ software.
Receptor internalization assays. Receptor endocytosis was assayed as described
previously (Jeanneteau et al., 2006). Cells grown in 6 cm dishes were washed in PBS and labeled
for 30 minutes with cleavable Sulfo-NHS-SS-Biotin (Pierce), which was in a solution of PBS.
For 20 minutes, excess biotin was quenched with 100 mM glycine. Labeled cells were then
incubated for 30 minutes in the absence or presence of glutamate at 37oC. Stimulation was halted
by three washes with ice cold PBS. Extracellular biotin was then cleaved by 2 washes with 50
mM glutathione, 75 mM NaCl, 5 mM NaOH, 10% FBS in water for 15 minutes. Excess
glutathione was then quenched for 30 min in PBS containing 50 mM iodoacetamide and 1%
BSA. Cells were then lysed in RIPA buffer (0.5% Triton X-100, 10 mM Tris-HCl, pH 7.5, 120
mM NaCl, 25 mM KCl, and Halt protease inhibitor cocktails) and clarified, and biotinylated
proteins were precipitated with NeutrAvidin-agarose (Pierce). Proteins were rinsed 4 times with
RIPA buffer, solubilized in Laemmli buffer, and resolved by SDS-PAGE.
Measurement of ERK phosphorylation. Phosphorylated ERK was measured using cell-
based ELISA according to a protocol described previously (Versteeg et al., 2000). Cells were
12
grown and treated with agonists in 96 well plates. After incubation with agonist, cells were fixed
in 4% formaldehyde/PBS for 20 minutes at room temperature. After 3 washes in 0.1% Triton X-
100 (PBST) for membrane permeablization, endogenous peroxidase activity was quenched by 20
minutes incubation in PBS containing 0.5% H2O2 and 0.2% NaN3. After three more washes in
PBST, cells were blocked with 2% BSA for one hour and incubated overnight with primary
antibody against Phospho-p44/42 MAPK (ERK1/2) (Thr202
/Tyr204
) (Cell Signaling Technology).
Cells were then washed for five minutes three times in PBST and twice in PBS. A HRP-coupled
goat anti-rabbit secondary antibody (Pierce) was incubated for one hour at room temperature and
then cells were again washed five times. Cells were exposed to the colorimetric HRP substrate 1-
Step Ultra TMB (Pierce). After at least 10 minutes of developing, the reaction was stopped in 4
M H2SO4 and absorbance was read at 450 nm.
Assessment of cell viability. Viability of cells cultured on 96-well plates was measured by
incubation for 1 hour at 37oC with 0.2 mg/ml of 3-[4,5-dimethylthiazol-2-yl]-2,5-
diphenyltetrazolium bromide (MTT), which was purchased from Invitrogen. The formation of
the formazan product, proportional to the number of viable cells, was measured colorimetrically
at 570 nm after extraction with 70 µl DMSO (Mosmann, 1983).
Measurements of PI hydrolysis. Cells, cultured in 96-well plates, were incubated
overnight with 0.625 Ci/well myo-[3H]inositol (Perkin Elmer, Boston, MA) to label the cell
membrane phosphoinositides. After two washes with 0.1 ml of Locke’s buffer (156 mM NaCl,
5.6 mM KCl, 3.6 mM NaHCO3, 1 mM MgCl2, 1.3 mM CaCl2, 5.6 mM glucose and 20 mM
Hepes, pH 7.4), incubations with receptor ligands were carried out for 45 min at 37°C in Locke’s
buffer containing 20 mM LiCl to block inositol phosphate degradation. The reaction was
13
terminated by aspiration of media and inositol phosphates were extracted in 10 mM formic acid
for 30 min. Samples were transferred to opaque-welled plates and incubated with polylysine
coated yttrium scintillation proximity assay (SPA) beads (Perkin Elmer) and incubated at room
temperature for 1 hour with vigorous shaking. After 8 hours of incubation with SPA beads,
inositol phosphates were detected by scintillation counting.
Calculations and Statistics. For dose-response data, curves were fitted by nonlinear
regression to data points using the four-parameter logistic equation in Sigma Plot. Significance
testing was performed using Student’s t tests when comparing two groups or by Bonferroni-
corrected t tests when comparing multiple groups. Statistical significance was deemed by p <
0.01.
14
CHAPTER 2
The Protective Signaling of Metabotropic Glutamate Receptor 1 is Mediated by Sustained
β-Arrestin-1-Dependent ERK Phosphorylation
N.B. Many of the following results were previously published in the following manuscript:
Emery, A.C., Pshenichkin, S., Takoudjou, G.R., Grajkowska, E., Wolfe, B.B., Wroblewski, J.T.
(2010). The protective signaling of metabotropic glutamate receptor 1 is mediated by sustained,
beta-arrestin-1-dependent ERK phosphorylation. J Biol Chem, 285(34):26041-8.
15
INTRODUCTION
Metabotropic glutamate receptor 1 (mGlu1) is a G protein-coupled receptor that is linked to
various second messenger systems through its association with Gq. Numerous studies have
indicated a role of mGlu1 receptors in synaptic physiology, notably including systems of long-
term depression at the parallel fiber-Purkinje cell synapse in the cerebellum (Kano et al., 2008).
Additionally, several other studies indicate that mGlu1 receptors induce signaling that facilitates
cellular growth and development. In the presence of glutamate, mGlu1 receptors have been
shown to stimulate axon growth in the developing brain (Kreibich et al., 2004) and the outgrowth
of dendritic spines in the developing hippocampus (Vanderklish and Edelman, 2002).
Recent evidence has demonstrated that mGlu1 receptors stimulate signaling which protects
cultured cerebellar and cortical neurons from apoptosis (Pshenichkin et al., 2008). However, the
mechanisms of this neuroprotective signaling remained unknown. In these studies, the protective
effect of glutamate followed a different pharmacological profile than for PI hydrolysis, the
known signaling mechanism of the receptor. Therefore, the following studies were designed to
ascertain whether this signaling followed the known G protein-dependent signaling mechanism
or a novel G protein-independent mechanism.
The aim of these studies was to identify the signal transduction pathway through which
glutamate causes protective signaling in cells expressing mGlu1a receptors. The following data
determined that glutamate, but not quisqualate, stimulates a sustained phosphorylation of ERK
through mGlu1a receptors. This phenomenon was unique to mGlu1a receptors and required the
expression of β-arrestin-1. Moreover, inhibition of ERK phosphorylation and silencing of β-
16
arrestin-1 expression abolished the protective effects of glutamate. Therefore, the protective
signaling of mGlu1a receptors does not rely on the classical, G protein-mediated, mechanism of
signal transduction, but, instead involves a β-arrestin-dependent receptor internalization and
ERK phosphorylation.
17
RESULTS
Previous studies in primary cultures of cortical and cerebellar neurons have shown that
glutamate, acting selectively at mGlu1a receptors, rescued these neurons from apoptotic cell
death induced by conditions of trophic deprivation (Pshenichkin et al., 2008). This protective
effect of glutamate was revealed in the presence of antagonists of ionotropic glutamate receptors
which suppressed the excitotoxic actions of glutamate. Moreover, in these cells, the protective
effect was elicited by high concentrations of glutamate, about 10 times higher than those needed
to activate mGlu1-mediated PI hydrolysis.
In order to study the pharmacological and protective properties of mGlu1a without
interference from other glutamate receptors, CHO cells with stably expressed mGlu1a receptors
were used to assess the potency of mGlu1 agonists in producing the protective effect. Cells were
transferred to serum-free culture medium to induce apoptosis (Zhong et al., 1993) and their
viability was monitored by the MTT assay. Under these conditions, after 3 days, cells exhibited
approximately 35-50% viability relative to controls grown in serum-containing medium. Cells
exposed to 3 mM glutamate were fully protected from serum deprivation-induced apoptosis for
up to 6 days, having similar viability to control cells grown in serum-containing growth media
while lower concentrations of glutamate (0.3 mM) produced a partial protection from serum
deprivation (Figure 1). The protective effect of glutamate required the expression of mGlu1a
receptors since untransfected CHO cells were not protected from serum deprivation (Figure 2).
Also, among PLC-coupled mGlu receptors only mGlu1, but not mGlu5, was effective in
protecting from toxicity induced by serum deprivation (Figure 2).
18
Figure 1. Time course of protection by glutamate in CHO cells expressing mGlu1a
receptors. CHO cells stably expressing mGlu1a receptors were placed in serum-free media to
induce toxicity. In the presence of glutamate (Glu), these cells were protected from toxicity. Data
points represent means and error bars are S.E.M. from three independent time-course series of
MTT assays performed in triplicate.
Days Post-treatment
1 2 3 4 5 6
Via
bili
ty (
% o
f S
eru
m c
on
tro
l a
t d
ay 1
)
40
60
80
100
Serum
Serum-freeSerum-free + 0.3 mM Glu
Serum-free + 3 mM Glu
19
Figure 2. Efficacy of glutamate to protect CHO cells. CHO cells were stably transfected with
mGlu1a receptors or mGlu5a receptors cells and were subjected to serum deprivation for three
days in the presence or absence of 1 mM glutamate (Glu). Glutamate protected only CHO cells
expressing mGlu1a receptors. Values represent means and error bars represent S.E.M. from three
independent series of MTT assays performed in triplicate. **p<0.001 as compared to untreated
controls using Student's t-test.
CHO mGlu1a mGlu5a
Via
bili
ty (
% o
f S
eru
m c
on
tro
l)
0
20
40
60
80
100
**
Serum-free
Serum-free + 1 mM Glu
20
The addition of glutamate to the serum-free culture medium produced a dose-dependent increase
in viability with an EC50 of 153 + 31 μM; however, quisqualate, the most potent mGlu1 agonist,
was not effective in concentrations up to 3 mM (Figure 3). In order to further ascertain that the
protective effect is in fact due to the activation of mGlu1a receptors, and not to a nonspecific
effect involving glutamate transporters or another mechanism, glutamate-induced protection was
tested in the presence of three distinct noncompetitive mGlu1-selective antagonists. Application
of 100 μM CPCCOEt, 10 μM YM-298198, or 30 μM JNJ16259685 completely inhibited the
activity of 1 mM glutamate (Figure 4). Effective concentrations of these antagonists were
derived from pilot experiments evaluating their effects on mGlu1 receptor-mediated PI
hydrolysis (data not shown). A more detailed analysis showed that YM-298198 inhibited
glutamate-induced protection in a noncompetitive manner with increasing concentrations of the
antagonist decreasing glutamate efficacy but having no effect on its potency as shown by similar
glutamate EC50 values in the presence of different concentrations of antagonist (Figure 5, Table
1).
The observed pharmacological properties of mGlu1a in inducing the protective effect were
inconsistent with its known properties in stimulating G protein-mediated phosphoinositide (PI)
hydrolysis (Aramori and Nakanishi, 1992). To study this discrepancy, the potency of the agonists
to stimulate PI hydrolysis in CHO cells expressing mGlu1a that were used in these experiments
was determined. As shown in Figure 6, both glutamate and quisqualate stimulated PI hydrolysis
in a dose-dependent manner with quisqualate being more potent (EC50 = 0.63 ± 0.13 μM) than
glutamate (EC50 = 16 ± 1.2 μM). Hence, the potency of glutamate to induce protection was
approximately 10 times lower than its potency to stimulate PI hydrolysis.
21
[Agonist], M
10-5 10-4 10-3 10-2
Via
bility (
% o
f u
ntr
eate
d c
ontr
ol)
0
20
40
60
80 Glu
Quis
Figure 3. Potency of glutamate to protect CHO cells expressing mGlu1a receptors. CHO
cells stably expressing mGlu1a receptors were subjected to serum withdrawal for three days in
the absence or presence of receptor agonists. Glutamate (Glu) was effective, EC50 = 154 ± 31
μM, whereas quisqualate (Quis) failed to protect cells at concentrations as high as 3 mM. Data
points are means and error bars are S.E.M. from three independent MTT assays performed in
triplicate.
22
Figure 4. Inhibition of the protective effect of glutamate by mGlu1-selective noncompetitive
antagonists. CHO cells stably expressing mGlu1a receptors were subjected to serum withdrawal
for three days in the absence or presence of 1 mM glutamate (Glu). CP –CPCCOEt (100 μM),
YM – YM-298198 (10 μM), and JN – JNJ16259685 (30 μM). Values are means from at least
three independent experiments performed in triplicate with error bars representing S.E.M.
**p<0.001 as compared to untreated controls using Student's t-test.
Control CP YM JNJ
Via
bili
ty (
% o
f se
rum
co
ntr
ol)
0
50
100
Serum-free
Serum-free+Glu
**
23
Figure 5. Noncompetitive inhibition of protection by glutamate. Dose-response curves of
glutamate-mediated protection in the presence of varying concentrations of YM-298198 (YM).
Cell viability was measured by MTT assay after 72 hours of incubation with the ligands in
serum-free conditions and is expressed as a percent of cells viable in parallel cultures grown in
the presence of serum. All data points are means from at least three independent experiments
performed in triplicate with error bars representing S.E.M.
[Glutamate], M
10-4 10-3 10-2
Via
bili
ty (
% o
f u
ntr
ea
ted
con
trol)
40
60
80
100YM = 0
YM = 0.03 M
YM = 0.3 M
YM = 3 M
24
Protection from toxicity PI hydrolysis
YM-298198 EC50 (μM) Emax (% Control) EC50 (μM) Emax (% Basal)
(μM) Avg ± SEM Avg ± SEM Avg ± SEM Avg ± SEM
0 191 ± 27 93 ± 1.7 28 ± 3.1
259 ± 5.0
0.03 180 ± 11 74 ± 3.6* 42 ± 4.8* 233 ± 16
0.3 160 ± 56 63 ± 2.4* 94 ± 6.0* 198 ± 14*
3 153 ± 20 53 ± 0.9* 171 ± 11* 157 ± 12*
Table 1. Summary of mGlu1a receptor pharmacology. Comparison of potency and efficacy of
glutamate to induce protection and stimulate PI hydrolysis in the absence and presence of a non-
competitive antagonist YM-289198 in CHO cells expressing mGlu1a receptors. Potency (EC50)
refers to the concentration of glutamate producing a half-maximal effect. Efficacy (Emax)
represents the maximal effect of glutamate expressed as a percent of control cell viability in the
presence of serum for toxicity experiments and as a percent of basal activity for measurements of
PI hydrolysis. Data are averages ± SEM calculated from dose-response curves obtained in 3-6
experiments. *p<0.05 compared to values obtained in the absence of antagonist using
Bonferroni-adjusted t-test.
25
Figure 6. Pharmacology of PI hydrolysis through mGlu1a receptors. In CHO cells stably
expressing mGlu1a receptors, PI hydrolysis is activated in a dose-dependent manner by
glutamate (Glu; EC50 = 11 ± 1.2 μM) and quisqualate (Quis; EC50 = 0.63 ± 0.13 μM). Glutamate-
induced PI hydrolysis is noncompetitively inhibited by 10 M YM298198 (YM). Data points
represent means from three independent experiments performed in triplicate with error bars
corresponding to S.E.M.
[Agonist], M
10-8 10-7 10-6 10-5 10-4 10-3 10-2
PI
hyd
roly
sis
(%
of
ba
sa
l)
100
200
300
400
Glu
Quis
Glu + YM
26
One possible explanation for these differences would be that the potencies observed in
protection reflect an artefactual decrease of agonist concentrations occurring during the 3 day
incubation that would not appear in the 45 minute incubation used when measuring PI
hydrolysis. In control experiments testing agonist stability, glutamate and quisqualate were
incubated with CHO cells for 3 days and then used to stimulate PI hydrolysis. As shown in
Figure 7, both conditioned and freshly prepared agonists stimulated PI hydrolysis with the same
potency, demonstrating that these compounds remain intact for the entire 3 day incubation and
that the observed discrepancies do not result from a decrease in agonist concentration.
As expected, glutamate-stimulated PI hydrolysis was abolished by the selective
noncompetitive mGlu1 antagonist YM-298198 and the antagonism appeared noncompetitive as
seen by the decrease of the maximal effect of glutamate with increasing concentrations of the
antagonist (Figure 8). However, in contrast with the data obtained for glutamate protective
signaling, the calculated potency of glutamate in PI hydrolysis experiments decreased with
increasing antagonist concentrations (Table 1). Usually, such right-shifts of agonist potency in
the presence of a noncompetitive antagonist indicate the existence of receptor reserve (also
known as spare receptors) and are frequently seen in heterologous expression systems. This leads
to the conclusion that the apparent difference in potency of glutamate to produce both effects
results from the presence of a high receptor reserve for PI hydrolysis but no receptor reserve for
protective signaling. The use of the highest concentration of YM-298198 in PI hydrolysis
experiments increases the EC50 of glutamate to the levels observed in protection experiments.
Hence, once this receptor reserve is abolished by the use of a noncompetitive antagonist the
potency of glutamate to produce both effects is the same.
27
Figure 7. Bioassay demonstrating the stability of glutamate and quisqualate. Stimulation of
PI hydrolysis in CHO cells expressing mGlu1a receptors by fresh agonists and agonists
conditioned in the presence of CHO cells for 3 days. EC50 for fresh and conditioned agonists was
as follows: glutamate (19 ± 3.2 μM and 12 ± 2.6 μM) and quisqualate (0.23 ± 0.11 μM and 0.24
± 0.13 μM). All data points are means from three independent experiments performed in
triplicate with error bars representing S.E.M.
28
[Glutamate], M
10-6 10-5 10-4 10-3
PI h
yd
roly
sis
(%
of b
asa
l)
100
150
200
250YM = 0
YM = 3 nM
YM = 30 nM
YM = 300 nM
Figure 8. Receptor reserve for mGlu1a receptor-mediated PI hydrolysis. Dose-response
curves of glutamate-induced PI hydrolysis in the presence of varying concentrations of mGlu1-
selective noncompetitive antagonist YM-298198 (YM). With increasing concentrations of YM,
the EC50 for glutamate increases (see Table 1), indicating the presence of receptor reserve. All
data points are means from three independent experiments performed in triplicate with error bars
representing S.E.M.
29
While these pharmacological results confirm that the protective signaling and PI hydrolysis are
mediated by the same receptor, they also indicate the existence of ligand bias in producing the
two effects. Ligand bias is defined as the ability of some agonists, such as quisqualate, to activate
only selected signal transduction mechanisms while other agonists, such as glutamate, may
activate all signaling associated with this receptor (Kenakin, 2007).
Signal transduction of protective signaling through mGlu1.
To identify the mechanism through which mGlu1a elicits protective signaling, a selective
inhibitor of signaling which occurs downstream of G protein activation was used. Since mGlu1
typically couples to phospholipase C (PLC) through Gq/11 (Aramori and Nakanishi, 1992),
transfected CHO cells were treated with the PLC inhibitor U73122 (Bleasdale et al., 1990). In
conditions of serum deprivation for 3 days U73122 (30 μM) failed to block the protective effect
of glutamate (Figure 9A). In control experiments, 30 μM culture-conditioned U73122 effectively
blocked glutamate-induced PI hydrolysis (Figure 9B), indicating that this compound is stable in
these culture conditions and is effective in blocking PI hydrolysis in this model. These data,
therefore, indicate that the protective effect is not mediated by the coupling of mGlu1a receptors
to PLC. These data suggest that the protective effect mediated by mGlu1a receptor is not related
to its ability to stimulate PI hydrolysis but, rather, is mediated by a different signal transduction
mechanism.
30
A B
Figure 9. Glutamate-induced protection is PLC-independent but MEK and dynamin-
dependent. (A) CHO cells expressing mGlu1a were subjected to serum deprivation for 72 hours
in the presence of glutamate (Glu) and inhibitors U73122 (30 μM), PD98059 (10 μM), U0126
(10 μM), or dynasore (100 μM). Phospholipase C inhibitor U73122 fails to block protection by
glutamate, whereas protection is blocked by MEK1 inhibitor PD98059, MEK 1/2 inhibitor
U0126, and dynamin inhibitor, dynasore. ** p < 0.001 as compared with serum-deprived
controls using Bonferroni-adjusted t test. (B) Inhibition of glutamate-induced PI hydrolysis in
mGlu1a-expressing CHO cells by U73122 (30 μM) that is freshly prepared (U73) or
preconditioned (U73-C) by exposure to CHO cells for 3 days, indicating U73122 is stable for the
entire 3 day incubation period. Values are means from at least three independent experiments
performed in triplicate with error bars representing S.E.M.
Control U73122 PD98059 U0126 Dynasore
Via
bili
ty (
% o
f S
eru
m c
on
tro
l)
0
20
40
60
80
100
Serum Serum-free + 0.3 mM Glu + 3 mM Glu
****
** **
PI
hyd
roly
sis
(%
of
ba
sa
l)
0
100
200
300
Con U73 U73-C
31
Since mGlu1 has also been reported to activate the MAP kinase pathway (Sheffler and Conn,
2008), the involvement of this pathway in the protective effect of glutamate was investigated.
Indeed, treatment of mGlu1a-expressing CHO cells with MEK1 inhibitor PD98059 (Rosen et al.,
1994) or with the MEK1/2 inhibitor U0126 (Favata et al., 1998) abolished the efficacy of
glutamate to cause protective signaling (Figure 9A).
Furthermore dynasore, an inhibitor of dynamin, a protein in the endocytotic pathway for
mGlu1 (Mundell et al., 2001), also abolished glutamate-induced protection. In control
experiments, monitoring receptor trafficking, dynasore (100 μM) blocked glutamate-induced
internalization of mGlu1 receptors (Figure 10A, 10B). These data suggest that the protective
effect of glutamate is not mediated by the classical G protein-mediated mechanism, but instead, a
G protein-independent activation of MAP kinase pathway, most probably involving receptor
internalization and the phosphorylation of ERK. Additionally, these studies were replicated in
cultured cerebellar granule cells, which natively express mGlu1 receptors (Pshenichkin et al.,
2008). Cerebellar granule cells require 25 mM extracellular potassium (K25) to survive in
culture. Reducing the potassium concentration to 5 mM (K5) caused granule cells to exhibit an
approximately 50% reduction in viability compared to K25 controls (Figure 11). Glutamate
protected these cells from low potassium-induced apoptosis, and protection was inhibited by
both MEK inhibitors, 30 M U0126 and 30 M PD98059, as well as dynasore (100 M). As
with transfected CHO cells, the PLC inhibitor U73122 (30 M) failed to attenuate the protective
effect of glutamate (Figure 11).
32
A B . Control Dynasore 100 μM
Glu (1 mM) + + - - + + - -
Fraction P S P S P S P S
Figure 10. Internalization of mGlu1a receptors is dynamin-dependent. (A) Inhibition of
glutamate-induced internalization of mGlu1a receptors by the dynamin inhibitor dynasore (100
μM). Cells were labeled with cleavable biotin and stimulated with 1 mM glutamate for 1 hour.
Extracellular biotin was removed and internalized mGlu1a receptors were pulled down in
NeutrAvidin. P, pellet (internalized during incubation); S, supernatant (remaining receptors). (B)
Densitometric quantification of Western blot from Fig. 10A.
% o
f to
tal m
Glu
1 a
mou
nt
0
20
40
60
80
100
% Internalized
% Remaining
Glu GluBasal Basal
Control Dynasore (100 M)
33
Control U73122 PD98059 U0126 Dynasore
Via
bili
ty (
% o
f K
25 C
ontr
ol)
0
20
40
60
80
100
K25
K5
0.1 mM Glu
1 mM Glu
Figure 11. Glutamate-induced protection is PLC-independent but MEK and Dynamin-
dependent in neurons. Cerebellar granule cells were subjected to low potassium (K5) for 12
hours to induce apoptosis in the presence of glutamate (Glu) and inhibitors U73122 (30 μM),
PD98059 (30 μM), U0126 (30 μM), or dynasore (100 μM). Phospholipase C inhibitor U73122
fails to block protection by glutamate, whereas protection is blocked by MEK1 inhibitor
PD98059, MEK 1/2 inhibitor U0126, and dynamin inhibitor, dynasore.
34
Time-course and pharmacology of mGlu1- mediated ERK phosphorylation.
Previous reports have demonstrated that the stimulation of group I mGlu receptors causes
transient ERK phosphorylation that occurs due to G protein activation and subsides within 30
minutes of agonist application (Karim et al., 2001). As shown by Western blot (Fig. 12A, 12B),
in CHO cells expressing mGlu1, glutamate and quisqualate increased ERK phosphorylation at 5
minutes after agonist application. In addition, when agonists were added for 24 hours, glutamate,
but not quisqualate, produced a sustained ERK phosphorylation. As shown in Fig. 12A, both
isoforms of ERK were equally phosphorylated.
These effects were further quantified using an ELISA-based assay to compare the levels of
ERK phosphorylation in CHO cells expressing either mGlu1a or mGlu5a receptors. In cells
expressing mGlu5a both glutamate and quisqualate elicited a transient ERK phosphorylation
which was elevated at 5 minutes after the addition of agonists, and subsided after 30 minutes
(Figure 13B). However, in cells expressing mGlu1a, while both agonists induced a transient
increase in ERK phosphorylation, after the addition of glutamate ERK phosphorylation was
elevated up to 24 hours (Figure 13A).
A closer look at the pharmacology of ERK phosphorylation revealed that the transient, 5 minute,
phosphorylation was induced by both glutamate and quisqualate (Figure 14A), with a
pharmacological profile and agonist potencies similar to those observed for PI hydrolysis (Figure
6). Also like PI hydrolysis, agonist-induced ERK phosphorylation was abolished by the mGlu1-
selective noncompetitive antagonist YM-298198 (Figure 14A). In contrast, the sustained 24 hour
ERK phosphorylation was only induced by glutamate, but not by quisqualate, and was blocked
by YM-298198 (Figure 14B).
35
A B
Figure 12. ERK phosphorylation due to mGlu1 agonists. (A) Representative Western blot of
phosphorylated ERK (pERK) and total ERK (ERK) at 5 minutes and 24 hours after the
application of glutamate or quisqualate to CHO cells expressing mGlu1a receptors. (B)
Densitometric quantification of Western blot from A, expressed as the ratio of measured
intensities for the sum of pERK bands divided by total ERK. 12-O-tetradecanoylphorbol-13-
acetate (TPA), which activates PKC, was used as positive control.
24 h 5 min 24 h 5 min 24 h 5 min 24 h 5 min
Ra
tio
pE
rk/t
ota
l E
rk
0
1
2
3
Glu Quis TPABasal
36
A mGlu1 B mGlu5
Figure 13. ELISA-based quantification of phosphorylated ERK. CHO cells expressing
mGlu1a receptors (A) or mGlu5a receptors (B) were treated with agonists glutamate (Glu) or
quisqualate (Quis) for varying times. Values are means from at least three experiments
performed in triplicate with error bars representing S.E.M. and are expressed as the percent of
ERK phosphorylation measured in cells not treated with agonists. *, p < 0.01 and **, p < 0.001
as compared with untreated controls using Bonferroni-adjusted t test.
Time
5 min 30 min 24 h
ph
osp
ho
ER
K (
% o
f b
asa
l)
100
150
200
250
Glu 1 mM
Glu 10 mM
Quis 1 M
**** **
**
**
**
**
*
Time
5 min 30 min 24 h
phosphoE
RK
(%
of
basal)
100
150
200
250Glu 1 mM
Glu 10 mM
Quis 1 M
**
** **
*
37
A 5 minutes B 24 hours
Figure 14. Agonist profiles of ERK phosphorylation through mGlu1a receptors. CHO cells
expressing mGlu1a receptors were stimulated with agonists glutamate (Glu) or quisqualate
(Quis) for 5 minutes (A) or 24 hours (B). Glutamate caused an increase in phosphorylated ERK
at both times, while quisqualate was only active at the 5 minute time point. All effects were
inhibited by 10 M YM298198 (YM). All data points are means from at least three experiments
performed in triplicate with error bars representing S.E.M. and are expressed as the percent of
ERK phosphorylation measured in cells not treated with agonists.
[Agonist], M
10-7 10-6 10-5 10-4 10-3 10-2
Ph
osp
ho
ER
K (
% o
f b
asa
l)
100
200
300
Glu
Quis
Glu+YM
Quis+YM
[Agonist], M
10-5 10-4 10-3 10-2
Pho
sph
oE
RK
(%
of
ba
sal)
100
150
200
250Glu
Quis
Glu+YM
38
The observed agonist potencies were lower than those for PI hydrolysis and transient ERK
phosphorylation, but approximated agonist potencies observed for the protective signaling
through mGlu1a (Figure 3).
Together, these data indicate that transient (5 minute) ERK phosphorylation is activated by
both mGlu1a and mGlu5a receptors and has a pharmacological profile similar to the activation of
PI hydrolysis, hence is mediated by a G protein-mediated mechanism. In contrast, the sustained
ERK phosphorylation, lasting up to 24 hours, is only activated by mGlu1a, and only glutamate is
able to produce the protective mGlu1a signaling. These results further support the existence of a
ligand bias which extends to ERK phosphorylation and reveals the existence of two distinct
signal transduction mechanisms. The classical mechanism, activated by both glutamate and
quisqualate, mGlu1 agonists with an apparent high potency, involves a G protein-mediated PI
hydrolysis and transient ERK phosphorylation. The second mechanism, which correlates well
with protective mGlu1a signaling, is activated with an apparent lower potency by glutamate and
is mediated by a G protein-independent mechanism which leads to prolonged activation of
MAPK pathway and sustained ERK phosphorylation.
39
The role of β-arrestin-1 in sustained ERK phosphorylation and the protective signaling of
mGlu1a.
Based on similarities with other GPCRs (Brauner-Osborne et al., 2007) we hypothesized that
the mGlu1a-induced phosphorylation of ERK may involve a β-arrestin-1-dependent
internalization of mGlu1a receptors and formation of a signaling complex mediating this
protective signaling. To investigate this hypothesis the expression of β-arrestin-1 in mGlu1a-
expressing CHO cells was silenced using a plasmid encoding shRNA targeted against rat β-
arrestin-1. Transfection with this plasmid encoding shRNA caused a substantial decrease in
protein expression levels of β-arrestin-1 as monitored by Western blots, while a scrambled
shRNA used in control experiments had no effect (Figure 15A, 15B). In rescue experiments,
cells expressing targeted shRNA were transfected with cDNA for human β-arrestin-1, which is
refractory to the silencing effects of rat shRNA due to having mismatches of several bases.
Expression of human β-arrestin-1 caused an approximate 3-fold increase of β-arrestin-1 protein
levels relative to untransfected controls (Figure 15A, 15B). Additional control experiments
showed that shRNA silencing of β-arrestin-1 failed to decrease agonist-induced PI hydrolysis in
CHO cells expressing mGlu1a receptors (Figure 16), suggesting that this shRNA did not
significantly affect classical mGlu1 receptor function. In contrast, β-arrestin-1 shRNA effectively
abolished the protective effect of glutamate against serum deprivation (Figure 16). Protection by
glutamate was restored after transfection of human β-arrestin-1 (Figure 17).
40
Figure 15. Silencing of -arrestin-1 with shRNA. (A) Protein levels of β-arrestin-1 in mGlu1a-
expressing CHO cells. Samples in lane 3 were transfected with plasmids encoding shRNA
targeted against rat β-arrestin-1, which reduces expression to 24% of untransfected controls (lane
1). Scrambled control shRNA does not affect protein levels of β-arrestin-1 (lane 2). Knockdown
due to shRNA is reversed by transfection of human β-arrestin-1 (lane 4). Knockdown due to
shRNA is reversed by transfection of human β-arrestin-1 (lane 4). Transfection with human β-
arrestin-1 causes expression levels of 314% relative to untransfected controls. (B) Densitometric
quantification of the Western blot expressed as a ratio of band densities measured for β-arrestin-1
and β-actin.
41
Figure 16. Knockdown of β-arrestin-1 of does not impair classical mGlu1a receptor
signaling. PI hydrolysis was measured in CHO cells expressing mGlu1a and scrambled shRNA;
or mGlu1a and shRNA targeted against β-arrestin-1, which were stimulated with agonists
glutamate (Glu) or quisqualate (Quis). All data points are means from two experiments
performed in quadruplicate with error bars representing S.E.M.
2D Graph 1
[Agonist], M
10-8 10-7 10-6 10-5 10-4 10-3
PI
hydro
lysis
(%
of
basal)
100
200
300
400
Glu
Quis
shRNA+Glu
shRNA+Quis
42
Figure 17. Protective signaling through mGlu1a is abolished by shRNA silencing of β-
arrestin-1. In shRNA-expressing cells, transfection of human β-arrestin-1 restores protective
signaling by glutamate. All CHO cells expressed mGlu1a receptors and were treated with serum
deprivation for three days to induce toxicity, which was measured by MTT assays. Data points
reflect experiments performed at least four times in triplicate with data points representing means
and error bars as S.E.M.
9110
[Glutamate], M
10-6 10-5 10-4 10-3 10-2
Via
bility (
% o
f S
eru
m)
40
60
80
100
Scrambled shRNA
shRNA
shRNA +Ar-1
43
Internalization assays showed that a 30 minute pulse of 1 mM glutamate caused 50% of
mGlu1a receptors to become internalized in contrast to control cells, where approximately 18%
of mGlu1a receptors were internalized during the 30 minute control incubation (Figure 17A,
17B). Transfection with shRNA targeted toward β-arrestin-1 caused internalization in the
presence of 1 mM glutamate to be equivalent with the constitutive internalization seen in cells
not exposed to glutamate (Figure 18A, 18B).
Further experiments showed that β-arrestin-1 silencing differentially affected the transient and
sustained ERK phosphorylation mediated by mGlu1a receptors. The transient ERK
phosphorylation induced by glutamate and quisqualate was reduced by the PLC inhibitor
U73122 but not by β-arrestin-1 silencing (Figure 19A). In contrast, the sustained ERK
phosphorylation, measured 24 hours after the application of agonist, was activated only by
glutamate and was abolished by β-arrestin-1 silencing, but not by the PLC inhibitor U73122
(Figure 19B).
These results show that the classical mGlu1a receptor signaling through PI hydrolysis, which
also includes transient ERK phosphorylation, does not depend on the presence of β-arrestin-1. In
fact, Figure 16 suggests that PI hydrolysis after silencing of β-arrestin-1 was slightly elevated,
which corresponds well to the reported ability of β-arrestin to inhibit G protein-mediated signal
transduction (Diviani et al., 1996). In contrast, these results indicate that the presence of β-
arrestin-1 is required for both the sustained ERK phosphorylation and the protective mGlu1a
signaling.
44
A. B.
Figure 18. Endocytosis of mGlu1a receptors is β-arrestin-1-dependent. (A) Representative
Western blot showing that glutamate (Glu)-induced internalization of mGlu1a is attenuated by
shRNA silencing of β-arrestin-1. CHO cells expressing mGlu1a receptors were labeled with
cleavable biotin and stimulated with 1 mM glutamate for 1 hour. Extracellular biotin was
removed and internalized mGlu1a receptors were pulled down in NeutrAvidin. P, pellet
(internalized during incubation); S, supernatant (remaining receptors). (B) Densitometric
quantification of three independent internalization assays.
% o
f to
tal m
Glu
1 a
moun
t
0
20
40
60
80
100
% Internalized
% Remaining
Glu GluBasal Basal
Scrambled shRNA Arrestin-1 shRNA
45
A. B.
Figure 19. Sustained ERK phosphorylation through mGlu1a receptors is β-arrestin-1-
dependent. Effect of shRNA silencing of β-arrestin1 on ERK phosphorylation induced by
agonists glutamate (Glu) and quisqualate (Quis) after 5 minutes (A) and 24 hours (B). Transient
ERK phosphorylation is sensitive to the inhibition of PLC by U73122 (30 μM) (A). Sustained
ERK phosphorylation is blocked by shRNA silencing of β-arrestin-1 but is not affected by the
inhibition of PLC (B). ERK phosphorylation was measured using ELISA, and the data are
expressed as a percent of ERK phosphorylated in the absence of agonists. All values are means
from at least three experiments performed in triplicate with error bars representing S.E.M. **p <
0.001) as compared with untreated controls using Bonferroni-adjusted t test.
46
Figure 20. Schematic representation of signal transduction through mGlu1 receptors.
During short-term treatment with glutamate, mGlu1 receptors stimulate PI hydrolysis via
coupling to Gq. After long-term treatment, the receptor is hypothesized to be phosphorylated by
a GRK and is internalized in by dynamin and -arrestin-1 (arr-1). Once internalized, mGlu1
receptors cause a long-term phosphorylation (P) of MEK and ERK, which leads to cellular
survival.
47
DISCUSSION
Previously it has been shown that glutamate, acting selectively at mGlu1 receptors, protects
neurons from apoptotic death induced by trophic deprivation (Pshenichkin et al., 2008). This
study demonstrates the existence of a novel signal transduction mechanism that allows mGlu1
receptors to mediate this protective signaling. This mechanism is distinct from the well described
classical G protein-mediated signal transduction of group I mGlu receptors (Aramori and
Nakanishi, 1992; Pickering et al., 1993) and is not shared by mGlu5 receptors, likely due to
differences in the two receptors respective C-termini. Shown here is that in CHO cells expressing
mGlu1a receptors, glutamate caused protection from toxicity due to serum deprivation, and this
protection was blocked not only by noncompetitive antagonists of mGlu1, but also by the
inhibition of receptor internalization by silencing β-arrestin-1 expression and inhibition of
dynamin. Furthermore, protective signaling was blocked by inhibitors of MEK1/2. The pathway
through which mGlu1 acts appears to be unrelated to classical G protein signaling, as protection
was not attenuated by inhibition of phospholipase C. Instead, these data reveal the existence of a
previously unreported signaling mechanism associated with mGlu1a receptors, namely a G
protein-independent protective signaling pathway that requires β-arrestin-1 and activation of
MEK, followed by ERK phosphorylation.
Anti-apoptotic signaling through β-arrestin has been demonstrated for numerous GPCRs
(DeWire et al., 2007). As signaling molecules, β-arrestins have been shown to mediate the
stimulation of phosphorylation of several protein kinases, including ERK (Daaka et al., 1998).
Additionally, β-arrestin-mediated signaling has been shown to be independent of G protein
signaling for multiple receptors including the angiotensin II type 1a receptor (Luttrell et al.,
48
2001), the D3 dopamine receptor (Beom et al., 2004), the β2-adrenergic receptor (Shenoy et al.,
2006), and the mu opioid receptor (Macey et al., 2006). Consistent with previous reports that β-
arrestin-1 is required for agonist-induced internalization of mGlu1 (Dale et al., 2001), these
findings suggest that the protective signaling of mGlu1a may be initiated by agonist-dependent
receptor internalization, followed by a non-classical, G protein-independent mechanism of signal
transduction. The current results also indicate that, similarly to several other GPCRs (Kenakin,
2007), mGlu1a receptors show a ligand bias towards the different signaling mechanisms,
manifested by the ability of glutamate to activate both signaling pathways, while quisqualate
activates only G protein-mediated PI hydrolysis.
The protective mGlu1a signaling appears to be mediated by a different mechanism of ERK
phosphorylation than that described previously. Several reports show that agonists acting at
mGlu1 receptors induce a transient increase of ERK phosphorylation which peaks at 5 minutes
and subsides within 30 minutes (Mundell et al., 2001). Consistent with these reports, in CHO
cells expressing mGlu1, at 5 minutes, agonists induced a transient ERK phosphorylation which
had a pharmacological profile similar to that observed for PI hydrolysis, was blocked by the
inhibition of PLC activity, and was not dependent on β-arrestin expression. At higher glutamate
concentrations, β-arrestin silencing slightly reduced ERK phosphorylation also at 5 minutes,
which is consistent with a previous report showing that a portion of mGlu1-mediated transient
MAP kinase phosphorylation is β-arrestin-dependent (Iacovelli et al., 2003). Together, these data
suggest that transient ERK phosphorylation is mediated by the classical mechanism of G protein-
mediated PI hydrolysis.
49
In addition, these data show that glutamate, acting at mGlu1 receptors, activates also a long
lasting phase of ERK phosphorylation, which was maintained in the presence of glutamate for 24
hours. This is the first report of a sustained phosphorylation of ERK due to stimulation of a
metabotropic glutamate receptor. Similar to the protective effect of glutamate, the sustained
phase of ERK phosphorylation was insensitive to PLC inhibition and was completely abolished
by shRNA silencing of β-arrestin-1 expression. In contrast to transient ERK phosphorylation, the
sustained phase was induced by much higher glutamate concentrations and was not elicited by
quisqualate. As demonstrated in these studies, this difference in glutamate potency reflected the
presence in transfected CHO cells of receptor reserve for PI hydrolysis. The pharmacological
profile of the sustained ERK phosphorylation resembled that of the protective mGlu1a signaling,
but not that of PI hydrolysis and transient ERK phosphorylation. These data strongly suggest that
the protective mGlu1a signaling is mediated by glutamate-induced sustained ERK
phosphorylation. While the specific downstream targets of phosphorylated ERK have not been
identified, phosphorylated ERK, acting at the cell nucleus, was shown to cause protective
cellular responses (Seger and Krebs, 1995).
50
CHAPTER 3
Metabotropic Glutamate Receptor 1 Possesses Two Glutamate Binding Sites Coupled to
Different Signal Transduction Systems
51
INTRODUCTION
The previous chapter demonstrated that in CHO cells transfected with mGlu1a receptors,
stimulation of mGlu1a receptors with glutamate protected cells from serum withdrawal-induced
apoptosis. These results were published in Emery et al., 2010. In this manuscript we showed that,
protective signaling through mGlu1a receptors was accomplished by a β-arrestin-1-dependent
sustained phosphorylation of ERK. Moreover, this study on signal transduction of mGlu1a
receptors indicates that classical, G protein-mediated signal transduction and transient ERK
phosphorylation differ in their pharmacological profiles from sustained ERK phosphorylation
and protective signaling. In these studies, the classical mGlu1a-mediated PI hydrolysis and
transient ERK phosphorylation was induced by both quisqualate and glutamate with quisqualate
as the most potent agonist.
Our data are consistent with several previous reports on the pharmacology of mGlu1-
mediated PI hydrolysis (Aramori and Nakanishi, 1992) and ERK phosphorylation (Thandi et al.,
2002). In contrast, sustained ERK phosphorylation and protection followed a unique
pharmacological profile. Only glutamate produced these effects, demonstrating an apparent
ligand bias at mGlu1a receptors. Ligand bias is a new and emerging concept in pharmacology
that has been shown to exist for other GPCRs when various agonists preferentially activate
receptor conformations that are selectively conducive for different signal transduction pathways
(Rajagopal et al., 2010). The earliest reported example of ligand bias was in M1 muscarinic
receptors, which activate both cAMP and PLC in response to their endogenous agonist
acetylcholine. However, several ligands were identified that selectively activate PLC while
blocking cAMP formation through these receptors (Fisher et al., 1993). Ligand bias, also referred
52
to as “biased agonism”, has since been reported in numerous GPCRs, and has been recently
reviewed by Rajagopal et al. (2010). In addition to selective activation of different G protein-
dependent pathways, ligands have been identified which preferentially activate β-arrestin-
mediated signaling which is independent of G protein signaling for several receptor systems
(Wei et al., 2003).
Our previous results demonstrate that sustained ERK phosphorylation and protective
signaling are β-arrestin-1-dependent, and this may suggest that agonists that do not cause these
effects, such as quisqualate, are biased toward PI hydrolysis through mGlu1 receptors, whereas
an agonist such as glutamate is less biased owing to the observations that glutamate activated
both signal transduction pathways. While the structural properties responsible for the observed
ligand bias are unknown, the X-ray crystallographic studies of the ligand binding domain of
mGlu1 (Kunishima et al., 2000), have led to the suggestions that glutamate, the apparently
unbiased ligand, interacts with 14 amino acid residues while quisqualate, the apparently biased
ligand, interacts with only nine of these residues (Sato et al., 2003). The interaction of glutamate
with additional residues in the binding domain may represent a mechanism by which glutamate,
but not quisqualate, can activate the two separate signal transduction pathways. This raises an
interesting possibility that it may be possible to identify compounds which activate mGlu1
receptors but are biased toward sustained ERK phosphorylation and cellular survival. The aim of
the following studies is to identify the mechanism of ligand bias by which glutamate, but not
quisqualate causes protective signaling in cells expressing mGlu1a receptors. In these studies,
glutaric and succinic acids are identified as compounds which act as ligands at mGlu1a receptors
that are completely biased toward sustained ERK phosphorylation and protective signaling and
53
are inactive in stimulating PI hydrolysis. These dicarboxylic acids may serve as lead compounds
for drug discovery.
54
RESULTS
Previous studies in primary cultures of cortical neurons and cerebellar granule neurons
have demonstrated that glutamate, acting selectively at mGlu1 receptors, enhanced PI hydrolysis,
but also rescued these neurons from apoptotic cell death induced by conditions of trophic
deprivation (Pshenichkin et al., 2008). This protective effect of glutamate was revealed in the
presence of antagonists of ionotropic glutamate receptors which suppressed the excitotoxic
actions of glutamate. Studies in CHO cells stably transfected with mGlu1a receptors have shown
that protective signaling of mGlu1a is not mediated by its coupling with G proteins, but instead,
it is due to β-arrestin-1-mediated sustained ERK phosphorylation (Emery et al., 2010). This
sustained ERK phosphorylation is distinct from the transient, G protein–mediated and PLC-
dependent phosphorylation of ERK also seen after activation of mGlu1a receptors. In both
cerebellar granule cells, which express native mGlu1a receptors, and in CHO cells transfected
with mGlu1a receptors, protective signaling through mGlu1a receptors was induced only by
glutamate, the native ligand for the receptor, but not by quisqualate (Emery et al., 2010;
Pshenichkin et al., 2008), the most potent agonist in inducing PI hydrolysis through mGlu1a
receptors (Aramori and Nakanishi, 1992; Emery et al., 2010). These data suggest the existence of
ligand bias at mGlu1a receptors, where some agonists, such as quisqualate, can only stimulate
the G protein-mediated signaling, while others, such as glutamate, can induce both PI hydrolysis
and sustained ERK phosphorylation.
55
In order to further study the pharmacological properties of mGlu1a receptors without
interference from ionotropic or other metabotropic glutamate receptors, CHO cells stably
expressing mGlu1a receptors were used. As shown in Figure 21, all tested agonists stimulated PI
hydrolysis with quisqualate being the most potent agonist (EC50 ~ 1 μM), followed by glutamate
and DHPG (EC50 ~ 10 μM), and by aspartate and L-cysteic acid (EC50 ~ 100 μM). In addition to
the stimulation of PI hydrolysis, these agonists caused an increase in transient ERK
phosphorylation measured after five minutes of incubation with the agonist (Figure 22) which, as
shown previously, is PLC-dependent (Emery et al., 2010). The current data also indicate that the
transient ERK phosphorylation was induced by all mGlu1 agonists tested (Figure 22), with a
pharmacological profile and agonist potencies similar to those observed for PI hydrolysis (Figure
21). As expected, the mGlu1-selective noncompetitive antagonist YM-298198 (Kohara et al.,
2005) completely abolished both glutamate and quisqualate-induced ERK phosphorylation
(Figure 22).
The previous studies indicated that in addition to transient ERK phosphorylation, mGlu1a
receptors also cause a long-lasting β-arrestin1-dependent phosphorylation of ERK, which is
required for the mGlu1a-mediated protection from apoptosis (Emery et al., 2010). The sustained
ERK phosphorylation, measured after 24 hours, had a different pharmacological profile from
transient ERK phosphorylation (Figure 23), and was only induced by glutamate, aspartate and L-
cysteic acid, but not by quisqualate and DHPG (Figure 23). Glutamate-induced sustained ERK
phosphorylation was completely blocked by 10 μM YM-298198 (Figure 23).
56
Figure 21. Agonist profile for mGlu1a-mediated PI hydrolysis. Dose response curves of
agonist induced PI hydrolysis in CHO cells stably expressing mGlu1a receptors. Quisqualate
(Quis) was the most potent agonist followed by glutamate (Glu), DHPG, aspartate (Asp), and L-
cysteic acid (L-CA). Glutamate-induced PI hydrolysis was blocked by 10 M YM-298198
(YM). All data points are means from three independent experiments performed in triplicate with
error bars corresponding to S.E.M.
[Agonist], M
10-8 10-7 10-6 10-5 10-4 10-3
PI h
yd
roly
sis
(%
of
ba
sa
l)
100
200
300
400Glu
Quis
DHPG
Asp
L-CA
Glu+YM
57
[Agonist], M
10-6 10-5 10-4 10-3 10-2
Ph
osp
ho
ER
K (
% o
f b
asa
l)
100
200
300
400 GluQuisAspL-CADHPG
Glu+YMQuis+YM
Figure 22. Agonist profile for mGlu1a-mediated transient ERK phosphorylation. Dose
response curves of agonist induced ERK phosphorylation measured after 5 minutes of incubation
with ligands in CHO cells stably expressing mGlu1a receptors. Quisqualate (Quis) was the most
potent agonist followed by glutamate (Glu), aspartate (Asp), L-cysteic acid (L-CA), and DHPG.
Quisqualate and glutamate-induced ERK phosphorylation was blocked by 10 M YM-298198
(YM). All data points are means from three independent experiments performed in quadruplicate
with error bars corresponding to S.E.M.
58
[Agonist], M
10-5 10-4 10-3 10-2
Ph
osp
ho
ER
K (
% o
f b
asa
l)
100
150
200
250 GluQuisAspL-CADHPGGlu+YM
Figure 23. Agonist profile for mGlu1a-mediated sustained ERK phosphorylation. Dose
response curves of agonist induced ERK phosphorylation measured after 24 hours of incubation
with ligands in CHO cells stably expressing mGlu1a receptors. Glutamate (Glu) was the most
agonist, followed by aspartate (Asp), and L-cysteic acid (L-CA). Neither quisqualate nor DHPG
stimulated sustained ERK phosphorylation. Glutamate-induced ERK phosphorylation was
blocked by 10 M YM-298198 (YM). All data points are means from three independent
experiments performed in quadruplicate with error bars corresponding to S.E.M.
59
In addition, the potency and efficacy of the various mGlu1 agonists to elicit the protective
effect were tested. To this end, cells were transferred to serum-free culture medium to induce
apoptosis (Zhong et al., 1993) and their viability was assessed by MTT assays. Under these
conditions, after 3 days, cells exhibited approximately 30-40% of viability relative to controls
grown in serum-containing medium. The addition of glutamate, aspartate or L-cysteic acid to the
serum-free culture medium produced a substantial increase in viability, however in contrast to
the pharmacology of PI hydrolysis, quisqualate and DHPG were not effective in concentrations
up to 10 mM (Figure 24). The observed agonist potencies were similar to those observed for the
sustained phosphorylation of ERK through mGlu1a (Figures 23 and 24). The lack of effect by
quisqualate and DHPG is not likely due to agonist degradation or uptake since control
experiments were performed to test drug stability under cell culture conditions for the 3-day
incubation used in viability assays. Agonists were culture-conditioned with mGlu1a-expressing
CHO cells for 3 days, and then the collected media were used to stimulate PI hydrolysis in naïve
cells. As shown previously, both quisqualate and glutamate were equally potent at stimulating PI
hydrolysis before and after culture conditioning (Figure 7). Additionally, a similar bioassay of
DHPG showed no significant breakdown: EC50 = 30.6 + 4.7 μM for freshly-diluted DHPG, EC50
= 32.4 + 5.3 μM for preconditioned DHPG. These data indicate that the agonists tested are not
subject to degradation or uptake during the extended periods of incubation used.
60
[Agonist], M
10-5 10-4 10-3 10-2
Via
bility (
% o
f u
ntr
eate
d c
ontr
ol)
0
25
50
75
Glu
Quis
DHPG
Asp
L-CA
Figure 24. Agonist profile for mGlu1a-mediated protective signaling. Dose response curves
of agonist induced protection from serum deprivation in CHO cells stably expressing mGlu1a
receptors as measured by MTT assays. Glutamate (Glu) was the most agonist, followed by
aspartate (Asp), and L-cysteic acid (L-CA). Neither quisqualate (Quis) nor DHPG protected
cells. All data points are means from three independent experiments performed in triplicate with
error bars corresponding to S.E.M.
61
Taken together, these results confirm that PI hydrolysis, ERK phosphorylation, and the
protective signal transduction pathway are activated by the same receptors, but different mGlu1
receptor agonists appear to activate either one or both signal transduction pathways. Glutamate,
aspartate, and L-cysteic acid activate PI hydrolysis, transient and sustained ERK
phosphorylation, and protection; while quisqualate and DHPG only activate PI hydrolysis and a
transient phosphorylation of ERK. Such results can be explained by a phenomenon known as
ligand bias, which is the ability of some agonists, such as quisqualate, to activate only selected
signal transduction mechanisms while other agonists, such as glutamate, may activate all
signaling associated with the same receptor (Violin and Lefkowitz, 2007).
To further investigate mGlu1a receptor-mediated pharmacology and signal transduction, all
effects were measured in the presence of mGlu1-selective antagonists. To this end, both LY
367385 and 3-MATIDA, selective and competitive antagonists of mGlu1 receptors, (Clark et al.,
1997; Moroni et al., 2002) were used. As seen in Figures 25 and 26, LY 367385 and 3-MATIDA
both competitively inhibited glutamate-induced PI hydrolysis, causing the EC50 for glutamate to
shift from 17 + 2.2 μM to 101 + 15 μM in presence of LY 367385 (10 μM) and from 9.2 + 0.3
μM to 76 + 18 μM in the presence of 3-MATIDA (30 μM). Additionally, both competitive
antagonists were bioassayed after 3 days of culture conditioning and both were stable (Figures
25, 26). Competitive inhibition of glutamate-induced transient ERK phosphorylation was also
observed (Figure 27), causing the EC50 for glutamate to shift from 50 μM to 810 μM in presence
of LY 367385 (30 μM) and to 880 μM in presence of 3-MATIDA (30 μM).
62
[Glutamate], M
10-6 10-5 10-4 10-3
PI
Hyd
roly
sis
(%
of
ba
sa
l)
100
150
200
250 Control
10 M LY (Fresh)
10 M LY (CC)
Figure 25. Competitive antagonism of glutamate-induced PI hydrolysis by LY367685. Dose
response curves of glutamate-induced PI hydrolysis with competitive inhibition by freshly-
prepared (Fresh) and cultured-conditioned (CC) 10 μM LY367385 (LY). For glutamate, EC50 =
17 + 2.2 μM and 101 + 15 μM in the presence of either freshly-prepared or culture-conditioned
LY367385, demonstrating stability of this antagonist. Control refers to cells treated only with
indicated concentrations of glutamate and the solvent used to dilute LY367385. All data points
are means from three independent experiments performed in triplicate with error bars
corresponding to S.E.M.
63
Figure 26. Competitive antagonism of glutamate-induced PI hydrolysis by 3-MATIDA.
Dose response curves of glutamate-induced PI hydrolysis with competitive inhibition by freshly-
prepared (Fresh) and cultured-conditioned (CC) 30 μM 3-MATIDA. For glutamate, EC50 = 9.2 +
0.3 μM, and 76 + 18 μM in the presence of either freshly-prepared or culture-conditioned 3-
MATIDA, demonstrating stability of this antagonist. Control refers to cells treated only with
indicated concentrations of glutamate and the solvent used to dilute 3-MATIDA. All data points
are means from three independent experiments performed in triplicate with error bars
corresponding to S.E.M.
[Glutamate], M
10-6 10-5 10-4 10-3
PI
Hyd
roly
sis
(%
of
ba
sa
l)
100
150
200
250
Control
30 M 3-MATIDA (Fresh)
30 M 3-MATIDA (CC)
64
[Glutamate], M
10-5 10-4 10-3 10-2
Ph
osp
hoE
RK
(%
of ba
sal)
100
150
200
250
Contol
LY367385 (30 M)
3-MATIDA (30 M)
Figure 27. Competitive antagonism of glutamate-induced transient ERK phosphorylation.
Dose response curves of glutamate-induced transient ERK phosphorylation with competitive
inhibition by 30 μM LY367385 or 30 μM 3-MATIDA. For glutamate, EC50 = 50 μM, shifting to
810 μM in presence of LY 367385 (30 μM) and to 880 μM in presence of 3-MATIDA (30 μM).
All data points are means from three independent experiments performed in triplicate with error
bars corresponding to S.E.M.
65
In contrast, even high concentrations (1 mM) of either LY 367385 or 3-MATIDA failed to
inhibit glutamate-induced sustained (24 hour) ERK phosphorylation (Figure 28), where the EC50
for glutamate did not vary significantly from 301 μM in the presence or absence of either
competitive antagonist. However, glutamate-induced sustained ERK phosphorylation was
completely inhibited by 30 μM YM-298198, an mGlu1-selective noncompetitive antagonist
(Kohara et al., 2005). As in the case of glutamate-induced sustained ERK phosphorylation, the
addition of either LY 367385 (1 mM) or 3-MATIDA (1 mM) had no effect on glutamate-induced
protection (Figure 29). Instead, the protective signaling was noncompetitively inhibited by YM-
298198 (3 μM), confirming that this effect is mediated by mGlu1 receptors.
Because sustained ERK phosphorylation and protective signaling were inhibited by
noncompetitive antagonists, but not by the competitive antagonists LY 367285 and 3-MATIDA,
we hypothesized that glutamate may bind to different sites to stimulate PI hydrolysis and to
induce protective signaling. Previously, the X-ray crystallography of the mGlu1 binding site with
bound glutamate has been resolved (Kunishima et al., 2000). These studies, as well as mutational
analyses of the mGlu1 binding site (Sato et al., 2003), indicate that several amino acid residues,
including Thr188
, Asp208
, Tyr236
, and Asp318
, interact with the amino group of the glutamate and
these interactions are necessary for receptor activation as measured by PI hydrolysis and the
binding of quisqualate (Sato et al., 2003). In contrast, there are additional residues in the binding
site, including Arg323
and Lys409
, which are postulated to bind the omega-carboxyl group of
glutamate, but mutation of these residues does not attenuate glutamate-induced PI hydrolysis or
the binding of quisqualate (Sato et al., 2003).
66
Figure 28. Lack of competitive antagonism on glutamate-induced sustained ERK
phosphorylation. Dose response curves of glutamate-induced sustained (24 hour) ERK
phosphorylation in the presence of competitive antagonists by LY367385 (1 mM) or 3-MATIDA
(1 mM). For glutamate, EC50 = 300 μM, neither competitive antagonist changed the potency of
glutamate. Glutamate-induced sustained ERK phosphorylation was effectively blocked by the
noncompetitive antagonist YM-298198 (30 μM). All data points are means from three
independent experiments performed in triplicate with error bars corresponding to S.E.M.
[Glutamate], M
10-4 10-3 10-2
Ph
osp
ho
ER
K (
% o
f b
asa
l)
100
150
200
Control
LY367385 (1 mM)
3-MATIDA (1 mM)
YM298198 (30 M)
67
[Glutamate], M
10-5 10-4 10-3
Via
bili
ty
(% o
f untr
eate
d c
ontr
ol)
40
60
80
Control
LY367385 (1 mM)
3-MATIDA (1 mM)
YM298198 (3 M)
Figure 29. Lack of competitive antagonism on glutamate-induced protective signaling. Dose
response curves of glutamate-induced protective signaling in the presence of competitive
antagonists by LY367385 (1 mM) or 3-MATIDA (1 mM). Neither competitive antagonist changed
the potency of glutamate, however glutamate-induced protection was noncompetitively inhibited
by the noncompetitive antagonist YM-298198 (3 μM). All data points are means from four
independent experiments performed in triplicate with error bars corresponding to S.E.M.
68
In order to ascertain the mechanism by which different ligands can activate different signal
transduction pathways through the same receptor, we have mutated Thr188
, Arg323
and Lys409
residues of the mGlu1a ligand binding site, selected based on X-ray crystallographic studies of
the mGlu1 ligand binding domain (Kunishima et al., 2000).
All mutated constructs of mGlu1a were stably expressed in CHO cells, and in the case of
all mutants protein expression levels were comparable to wild-type mGlu1a receptors (Figure
30). The mGlu1a construct with the T188A, mutation which has been shown to be critical for the
binding of quisqualate and activation of PI hydrolysis (Sato et al., 2003) was, as expected, unable
to enhance PI hydrolysis, as the observed response was not different from that obtained with
CHO cells transfected with the control empty vector (Figure 31). These data confirm that the
Thr188
residue is required for classical PI-linked signaling through mGlu1a receptors. In contrast,
the T188A mutation failed to block the ability of mGlu1 to induce the β-arrestin1-mediated
sustained ERK phosphorylation and protective signaling (Figures 33, 34). For additional controls
to ascertain the role of β-arrestin-1, the expression of β-arrestin-1 was silenced by shRNA in
CHO cells stably transfected with mGlu1a T188A mutant. As seen in Figure 32, shRNA targeted
to β-arrestin-1 caused an approximately 70% reduction in β-arrestin-1 expression. Cells
expressing shRNA against β-arrestin-1 were then transfected with human β-arrestin-1, which is
refractory to shRNA due to several mismatched bases. Expression of human β-arrestin-1 caused
a substantial increase in protein expression of β-arrestin-1 (Figure 32). While glutamate
stimulated both sustained ERK phosphorylation (Figure 33) and protective signaling (Figure 34),
the silencing of β-arrestin-1 with shRNA resulted in the blockade of both responses.
69
Figure 30. Protein expression levels of mutant mGlu1a receptors. Representative Western
blot depicting protein expression levels of mutated mGlu1a receptors stably transfected in CHO
cells. All receptors were expressed at equivalent levels to wild-type (W/T) control mGlu1a
receptors.
70
10-6 10-5 10-4
PI H
yd
roly
sis
(%
of b
asa
l)
100
150
200
250
mGlu1
Vector
T188A
[Glutamate], M
Figure 31. Lack of classical mGlu1a receptor signaling in T188A mutant receptors.
Glutamate-induced PI hydrolysis occurs to a similar extent in CHO cells transfected with vector
(pcDNA 3.1) and CHO cells stably expressing the T188A mutant mGlu1a receptor. Data points
are means from three independent experiments performed in quadruplicate with error bars
representing S.E.M.
71
Figure 32. Silencing of -arrestin-1 in CHO cells expressing T188A mutant mGlu1a
receptors. Representative Western blot depicting efficient silencing of -arrestin-1 by shRNA.
Protein expression levels were restored by transfection with human β-arrestin-1.
72
[Glutamate], M
10-5 10-4 10-3 10-2
ph
osph
oE
RK
(%
of ba
sa
l)
50
100
150
200
250
300
350T188A + Scrambled shRNA
T188A + shRNA
T188A + shRNA + Arr1
Figure 33. -arrestin-1 dependent sustained ERK phosphorylation in T188A mutant
mGlu1a receptors. In T188A mutant mGlu1a receptors stably expressed in CHO cells,
glutamate-induced ERK phosphorylation measured after 24 hours of agonist stimulation is
blocked by shRNA silencing of β-arrestin-1 and is restored by overexpression of human β-
arrestin-1. All data points are means from three experiments performed in quadruplicate with
error bars representing S.E.M.
73
Figure 34. Glutamate-induced protective signaling in T188A mutant mGlu1a receptors.
Glutamate-induced protective signaling through T188A mutant mGlu1a receptors expressed in
CHO cells is inhibited by shRNA silencing of β-arrestin-1. Glutamate-induced protection is
restored upon overexpression of human β-arrestin-1. All values are means from at least three
independent experiments performed in triplicate with error bars representing S.E.M.
[Glutamate], M
10-5 10-4 10-3 10-2
Via
bili
ty
(% o
f U
ntr
ea
ted
Con
tro
l)
40
50
60
70
80
90
100T188A + Scrambled shRNA
T188A + shRNA
T188A + shRNA + Arr1
74
However, these responses were restored when the β-arrestin-1-depleted cells were rescued by
transfection with human β-arrestin-1 (Figures 33, 34). Taken together, these data indicate that the
interaction of glutamate with the Thr188
residue is required for the coupling with PI hydrolysis,
but is not necessary for the coupling with sustained ERK phosphorylation and protective
signaling.
Because Thr188
has been shown to interact with the alpha amino group of mGlu1 agonists
(Sato et al., 2003), the next hypothesis was that sustained ERK phosphorylation and protective
signaling require ligand interactions with different residues of the binding site. Therefore,
mutations were performed on residues Arg323
and Lys409
, which are postulated to interact with
the omega carboxyl group of glutamate, but do not functionally interact with quisqualate (Sato et
al., 2003). In CHO cells stably transfected with either R323V or K409A mutant of mGlu1a,
agonist-induced PI hydrolysis was equivalent to cells expressing wild-type mGlu1a receptors
(Figure 35). These data are consistent with a previous report indicating that these residues are not
needed for quisqualate binding or PI hydrolysis (Sato et al., 2003). As expected, glutamate
stimulation of both mutated mGlu1a receptors also caused an increase in PLC-dependent,
transient ERK phosphorylation (Figure 36), which was abolished by the PLC inhibitor U73122
(Figure 36). In contrast, both R323V and K409A mGlu1a mutants, expressed in CHO cells,
failed to stimulate the sustained ERK phosphorylation (Figure 37), and failed to protect against
serum withdrawal-induced apoptosis (Figure 38).
75
[Glutamate], M
10-6 10-5 10-4 10-3
PI
Hyd
roly
sis
(%
ba
sa
l)
100
150
200
250
300
350mGlu1
R323V
K409A
Figure 35. Classical signaling in R323V and K409A mutant mGlu1a receptors. In both
R323V and K409A mutant mGlu1a receptors expressed in CHO cells, glutamate-induced PI
hydrolysis occurs to a similar extent as in CHO cells expressing the wild-type mGlu1a receptors
(EC50 = 18 μM, 16 μM , and 13 μM, respectively). All data points are means from three
independent experiments performed in triplicate with error bars representing S.E.M.
76
Figure 36. ERK phosphorylation is G protein-dependent in R323V and K409A mutant
mGlu1a receptors. Glutamate-induced ERK phosphorylation measured after 5 minutes of
agonist stimulation was completely inhibited by PLC inhibitor U73122 (U73), suggesting ERK
phosphorylation through R323V and K409A mutant mGlu1a receptors is completely G protein-
dependent. All data points are means from two experiments performed with six replications and
error bars represent S.E.M.
[Glutamate], M
10-6 10-5 10-4 10-3
Ph
osp
hoE
RK
(%
of b
asa
l)
100
150
200
250
300
R323V
R323V + U73 (30 M)
K409A
K409A + U73 (30 M)
77
Figure 37. R323V and K409A mutant mGlu1a receptors do not stimulate long-term ERK
phosphorylation. Glutamate-induced ERK phosphorylation measured after 24 hours of agonist
stimulation was not significantly elevated over basal in R323V or K409A mutant mGlu1a
receptors expressed in CHO cells. All data points are means from two experiments performed
with six replications and error bars represent S.E.M.
W/T mGlu1a R323V K409A
Ph
osp
ho
ER
K (
% b
asa
l)
100
150
200
250 10 mM Glutamate
78
Figure 38. R323V and K409A mutant mGlu1a receptors do not protect CHO cells.
Glutamate-induced protection from serum deprivation-induced toxicity was measured after three
days agonist stimulation by MTT assays. Glutamate failed to increase the viability of CHO cells
stably expressing R323V or K409A mutant mGlu1a receptors. All data points are means from
three experiments performed with six replications and error bars represent S.E.M.
[Glutamate], M
10-5 10-4 10-3 10-2
Via
bili
ty
(% o
f u
ntr
ea
ted
co
ntr
ol)
40
60
80
mGlu1
R323V
K409A
79
Based on the data suggesting that interaction with residues Arg323
and Lys409
, which are
thought to bind the omega carboxyl group of glutamate, are not necessary for agonist-induced PI
hydrolysis but, instead, are required for receptor-mediated protective signaling, we reasoned that
a ligand able to interact with Arg323
and Lys409
, but not with Thr188
should induce protection, but
not PI hydrolysis when applied to wild-type mGlu1a receptors. Such a ligand, glutaric acid, is an
analog of glutamate that lacks the alpha amino group, which interacts with Thr188
, therefore it
would not be expected to stimulate PI hydrolysis. Similarly, succinic acid is an analog of
aspartate which also lacks an alpha amino group. In fact, in CHO cells stably expressing mGlu1a
receptors, glutaric and succinic acids both failed to enhance PI hydrolysis, even at very high
concentrations (Figure 39), suggesting that they are not classical mGlu1a agonists. In contrast,
glutaric acid stimulated, in a dose-dependent manner, both the sustained ERK phosphorylation
(Figure 40) and the protective signaling of mGlu1 receptors (Figure 41). Moreover, glutaric acid
protected cerebellar granule cells, which express native mGlu1a receptors, from low potassium-
induced apoptosis in a dose-dependent manner (Figure 42). Succinic acid protected cells from
apoptosis to a similar extent (Figure 43). The effects of glutaric and succinic acid were blocked
by the noncompetitive mGlu1 antagonist YM-298198, confirming their site of action at this
receptor (Figures 41-43).
80
Figure 39. Effects of glutaric and succinic acids on PI hydrolysis. Neither glutaric nor
succinic acid caused an elevation in PI hydrolysis in CHO cells stably expressing mGlu1a
receptors. Glutamate (1 mM) served as a positive control in these experiments. Values are means
from three experiments performed in quadruplicate and error bars represent S.E.M.
PI H
yd
roly
sis
(%
of b
asa
l)
100
150
200
250
300
350
Glutaric Acid
Glutamate
Succinic Acid
1 mM 3 mM 10 mM
81
[Glutaric Acid], M
10-5 10-4 10-3 10-2
Pho
sp
ho
ER
K (
% o
f b
asa
l)
100
150
200
250
5 min
5 min + YM (10 M)
24 h.
24 h. + YM (10 M)
Figure 40. Glutaric acid is an mGlu1a receptor agonist that causes ERK phosphorylation.
ERK phosphorylation in CHO cells expressing mGlu1a receptors was measured after 5 minutes
and 24 hours of incubation with glutaric acid increased in a dose-dependent manner. All effects
of glutaric acid were noncompetitively inhibited by YM-298198 (YM). All data points are means
from three experiments performed in triplicate with error bars representing S.E.M.
82
Figure 41. Glutaric acid protects CHO cells through activity at mGlu1a receptors. Dose-
dependent effect of glutaric acid on protecting CHO cells expressing mGlu1a receptors from
serum deprivation-induced toxicity. Glutaric acid was noncompetitively inhibited by YM-
298198 (YM). All data points are means from four experiments performed in triplicate with error
bars representing S.E.M.
[Glutaric Acid], M
10-5 10-4 10-3 10-2
Via
bili
ty
(% o
f u
ntr
ea
ted
co
ntr
ol)
50
75
100
YM (10 M)
83
Figure 42. Glutaric acid protects cerebellar granule neurons through mGlu1a receptors.
Dose-dependent effect of glutaric acid (GA) on viability of cerebellar granule neurons subjected
to 5 mM potassium (K5) overnight to induce apoptosis. The effect of glutaric acid was
noncompetitively inhibited by 10 M YM-298198 (YM). Viability was measured by MTT assay.
All data points were normalized to controls grown in 25 mM potassium (K25) and are means
from four experiments performed in triplicate with error bars representing S.E.M.
Glutaric Acid, [M]
10-6 10-5 10-4 10-3 10-2
Via
bility (
% o
f K
25
Co
ntr
ol)
40
50
60
70
80
90
GA
GA + YM298198
84
Figure 43. Succinic acid protects CHO cells through activity at mGlu1a receptors. Dose-
dependent effect of succinic acid on protecting CHO cells expressing mGlu1a receptors from
serum deprivation-induced toxicity. Succinic acid was noncompetitively inhibited by YM-
298198 (YM). All data points are means from four experiments performed in triplicate with error
bars representing S.E.M.
[Succinic Acid], M
10-5 10-4 10-3 10-2
Via
bili
ty
(% o
f untr
eate
d c
ontr
ol)
50
75
100
YM (10 M)
85
The ability of the competitive antagonists LY 367385 and 3-MATIDA to inhibit only PI
hydrolysis and transient ERK phosphorylation, but not the sustained ERK phosphorylation or
protective signaling, suggests that glutamate may bind to two distinct sites to stimulate the two
different signaling cascades. If these sites were truly separate, then ligands binding to one site
(site A) should not interfere with the potency of agonists binding to the second site (site B). This
possibility was investigated by testing for interactions between the biased ligands.
First, the ability of quisqualate (biased ligand for site A) to interfere with the potency of
glutamate to induce protective signaling was tested, and no effect was found, even at extreme
(300 μM) concentrations of quisqualate (Figure 44). Second, we tested the ability of glutaric acid
(biased ligand at site B) to interfere with glutamate-induced PI hydrolysis, and found it equally
inactive at concentrations up to 10 mM (Figure 45). These data strongly suggest that mGlu1a
receptors possess two distinct, non-interacting glutamate binding sites, and the binding of
agonists to each site allows for the stimulation of a different signal transduction cascade.
86
Figure 44. Quisqualate fails to inhibit glutamate-induced protection at mGlu1a receptors.
Glutamate-induced protection from serum deprivation-induced toxicity in CHO cells expressing
mGlu1a receptors in the presence of varying concentrations of quisqualate. In the presence of
quisqualate, the EC50 for glutamate to protect did not vary significantly from 320 μM. All data
points are means from five experiments performed in triplicate with error bars representing
S.E.M.
[Glutamate], M
10-5 10-4 10-3 10-2
Via
bili
ty
(% o
f u
ntr
ea
ted
co
ntr
ol)
40
60
80
100
Quis = 0 M
Quis = 30 M
Quis = 300 M
87
Figure 45. Glutaric acid fails to inhibit glutamate-induced PI hydrolysis at mGlu1a
receptors. Glutamate-induced PI hydrolysis in CHO cells expressing mGlu1a receptors in the
presence of varying concentrations of glutaric acid. In the presence of glutaric acid, the EC50 for
glutamate to protect did not vary significantly from 13 μM. All data points are means from three
experiments performed in triplicate with error bars representing S.E.M.
[Glutamate], M
10-6 10-5 10-4 10-3
PI H
yd
roly
sis
(%
ba
sa
l)
100
150
200
250
300
350GA = 0
GA = 1 mM
GA = 3 mM
GA = 10 mM
88
DISCUSSION
Previous studies with mGlu1a receptors have revealed some unusual properties of these
receptors. As shown in primary cultures of cerebellar and cortical neurons, increased mGlu1a
receptor expression led to apoptotic cell death (Pshenichkin et al., 2008). This toxic effect was
not blocked by mGlu1 antagonists but by silencing receptor expression. Unexpectedly, mGlu1a
toxicity was also blocked by its agonist glutamate. These properties allow us to categorize
mGlu1a as a dependence receptor, defined as a receptor which, when expressed, promotes
apoptosis in the absence of its ligand, but stimulates survival in its presence (Mehlen and
Bredesen, 2004). Hence, mGlu1a receptors would make the survival of neuronal cells
“dependent” on the presence of the endogenous agonist glutamate. While the negative signaling
of mGlu1a which leads to apoptosis still remains to be elucidated, the positive signaling has been
described in our previous studies (Emery et al., 2010; Pshenichkin et al., 2008). This positive,
protective signaling is not mediated by the classical G protein- mediated coupling of mGlu1a
receptors, but, instead, involves a β-arrestin-1-dependent internalization of mGlu1a, followed by
the stimulation of the MEK/ERK pathway (Emery et al., 2010). However, the protective
signaling of mGlu1a showed a different agonist profile than the G protein-mediated stimulation
of PLC.
In this study, those different pharmacological profiles of the two mGlu1a responses were
investigated and revealed the existence of a ligand bias at these receptors. These studies indicate
the existence of three classes of agonists at mGlu1a receptors: (1) unbiased ligands, such as
glutamate, aspartate, and cysteic acid, which activate both G protein-dependent signaling and β-
arrestin-dependent protective signaling, (2) ligands biased towards G protein signaling, such as
89
quisqualate and DHPG, and (3) previously unknown ligands biased towards β-arrestin-dependent
signaling, such as glutaric or succinic acid (Table 2). This is the first report of ligand bias at a
metabotropic glutamate receptor, but these findings should come as no surprise, as ligand bias
has been described at numerous other GPCRs, as reviewed in (Violin and Lefkowitz, 2007).
The initial clue as to the mechanism responsible for ligand bias at mGlu1a receptors came
from results indicating that, in contrast to PI hydrolysis, the protective signaling was not
inhibited by competitive mGlu1 antagonists, while both responses were blocked by
noncompetitive mGlu1 antagonists. This would be explained if glutamate induced protective
signaling by binding to a site distinct from that occupied by competitive antagonists. Instead,
noncompetitive antagonists would still inhibit both responses, possibly by modifying receptor
conformation. In fact the mGlu1-selective competitive antagonists LY 367385 and 3-MATIDA,
which both inhibit glutamate-induced PI hydrolysis and transient ERK phosphorylation, had no
effect on glutamate-induced sustained ERK phosphorylation or protective signaling at
concentrations as high as 1 mM. In contrast, all mGlu1a signaling was inhibited by the mGlu1-
selective noncompetitive antagonist YM 298198, which binds to an allosteric site situated on the
7th
transmembrane domain of the receptor (Kohara et al., 2005). Previously, similar results were
obtained using other mGlu1-selective noncompetitive antagonists, including CPCCOEt and
JNJ16259685 (Emery et al., 2010), indicating that all effects are selectively mediated by
mGlu1a, but not necessarily due to interactions with the same orthosteric binding site which also
binds competitive antagonists (Clark et al., 1997).
90
Agonist Type of agonism Wild type mGlu1a
T188A mutant
R323V & K409A mutants
Glutamate, Aspartate, Cysteate
Unbiased PI / PR -- / PR PI / --
Quisqualate, DHPG G protein-biased PI / -- -- / -- PI / --
Glutarate, Succinate β-arrestin-biased -- / PR -- / PR -- / --
Table 2. Different responses induced by three classes of agonists acting at wild type and
mutated mGlu1a receptors. PI: PI hydrolysis, PR: protection from apoptosis
91
The hypothesis for the existence of a second glutamate binding site on mGlu1a receptors is
further supported by the current mutational studies the T188A mutation on mGlu1a receptors
results in a complete block of signaling through G protein-dependent pathways, however
signaling which results in sustained ERK phosphorylation and protection from apoptosis through
the β-arrestin-1-dependent mechanism remains active. This indicates that the Thr188
residue is
required for classical signaling through mGlu1a receptors, but an interaction with this residue is
not necessary for β-arrestin-1-dependent signaling. Conversely, R323V and K409A mutants of
mGlu1a receptors do not induce β-arrestin-1-dependent, sustained, ERK phosphorylation or
protective signaling, but still enhance PI hydrolysis in the presence of glutamate to a similar
extent as wild-type mGlu1a receptors. This indicates that glutamate interaction with Arg323
and
Lys409
is needed for β-arrestin-1-dependent signaling. These mutational data are consistent with a
previous mutational analysis of the ligand binding domain of mGlu1a receptors, however β-
arrestin-dependent signaling was not tested in these studies (Sato et al., 2003).
Strong evidence for the existence of two distinct glutamate binding sites comes from the
study of interactions between the biased and unbiased mGlu1 ligands. Quisqualate, the most
potent ligand of mGlu1 receptors, biased towards G protein-mediated signaling, failed to inhibit
glutamate-induced protective signaling, even at very high concentrations. Similarly, glutaric
acid, an agonist biased towards protective signaling, failed to change the potency of glutamate to
stimulate PI hydrolysis. This lack of interactions indicates that biased ligands likely bind to two
distinct, non-interacting sites. While novel, these data suggesting the presence of two separate
glutamate binding sites on mGlu1a receptors are in keeping with some recent studies on mGlu
receptors. In a study of mGlu receptor homology, an allosteric ion binding site was located
92
adjacent to the orthosteric glutamate binding site (Ogawa et al., 2010). Interestingly, a ligand has
since been discovered which simultaneously interacts with the orthosteric glutamate site and
newly discovered allosteric site in mGlu4 receptors (Acher et al., 2011), suggesting the
possibility of multiple agonist binding motifs in other mGlu receptors. In case of mGlu1, our
mutational data indicate that the two binding sites, while separate, are still located in the same
general region of the receptor N-terminal domain. If confirmed, this would require some
revisions to the conformational model of the receptor N-terminal domain. The current model
assumes that Thr188
, as well as Arg323
and Lys409
residues interact with a single molecule of
glutamate. Such a conformation would not sterically allow for a simultaneous non-interacting
binding of two glutamate molecules within the proposed binding pocket. An alternative
possibility is the location of the two binding sites on separate subunits of the mGlu1a receptor
homodimer, however, we are not aware of any data supporting such a hypothesis.
In the present study, new ligands for mGlu1a receptors which are biased towards the
protective signaling were identified. They are glutaric and succinic acids, analogues of glutamate
and aspartate, respectively, with a deleted alpha-amino group. Other homologues of these
dicarboxylic acids, with shorter (oxalic acid and malonic acid) or longer (adipic acid, and pimelic
acid) carbon chains were inactive (data not shown). Consistent with the current findings of
cytoprotective properties, succinate has previously been shown to ameliorate cognitive defects in
a rat model of Alzheimer’s disease (Storozheva et al., 2008). While both glutarate and succinate
are endogenous to the brain, they are common metabolites, and it is unclear whether they could
serve a physiological role, acting at native mGlu1 receptors. However, these compounds may
now be used as lead structures in the design of new biased agonists, and especially antagonists,
93
with ability to affect mGlu1 receptor-mediated protective signaling, without disturbing the
classical G protein-mediated signal transduction.
94
CHAPTER 4
Thesis Conclusion
95
Major findings of this thesis
The existence of a new signal transduction mechanism of mGlu1a receptors is
demonstrated in Chapter 2. In contrast to the classical G protein-mediated PI hydrolysis, this
mechanism appears to involve agonist-mediated, β-arrestin-1-dependent receptor internalization,
followed by the activation of MEK cascade and a long-lasting, sustained phase of ERK
phosphorylation. This mechanism appears to be responsible for the protective action of
glutamate mediated by mGlu1a receptors. These experiments were described in the first
published report of this signal transduction pathway though a metabotropic glutamate receptor
(Emery et al., 2010). While novel, these findings should come as no surprise, since β-arrestin-1-
dependent sustained ERK phosphorylation has previously been demonstrated through numerous
other G protein-coupled receptors (Broca et al., 2009; Quan et al., 2008; Zheng et al., 2008).
Previously, it was proposed that mGlu1a functions as a dependence receptor causing
apoptosis in the absence of glutamate, possibly due to the cleavage of its C-terminal domain
(Pshenichkin et al., 2008). Now we propose that the protective, positive signaling of mGlu1,
which occurs in the presence of glutamate, is mediated by this new, G protein-independent,
mechanism of signal transduction. This hypothesis needs now to be more extensively validated
in systems expressing native mGlu1a receptors and in vivo. Further studies are also needed to
address the mechanism and establish the conditions in which glutamate, classically viewed as an
excitotoxin (Bruno et al., 1995; Siliprandi et al., 1992), may also produce a protective effect
when acting at mGlu1 receptors. Acting as a dependence receptor, mGlu1a may serve as a sensor
of extracellular glutamate, promoting neuronal survival in the presence of glutamate and
inducing apoptosis in its absence. Such a mechanism could play an important role in brain
96
physiology by allowing glutamate to act as a trophic factor contributing to neuronal development
and neuronal selection during synaptogenesis and, possibly, by participating in the restructuring
of damaged brain tissue.
In Chapter 3, the molecular mechanism for ligand bias at mGlu1 receptors was
investigated. Multiple experiments indicated that some agonists, such as glutamate, aspartate,
and L-cysteic acid, stimulate both PI hydrolysis and protective signaling through mGlu1a
receptors while other agonists, such as quisqualate and DHPG, only stimulate PI hydrolysis.
Mutations of selected residues of the ligand binding domain of the receptor revealed that Thr188
is necessary for PI hydrolysis while Arg323
and Lys409
are necessary for protective signaling but
not PI hydrolysis. These data suggest that the interaction of the -amino group of a ligand and
the receptor is required for PI hydrolysis while interaction between the omega-carboxyl group of
the ligand and the receptor is necessary for protective signaling. This hypothesis was supported
by the fact that glutaric and succinic acids, analogs of glutamate and aspartate lacking the -
amino group, stimulated sustained ERK phosphorylation and protective signaling selectively
through mGlu1a receptors. This is the first report of these two compounds as agonists at any
mGlu receptor. Finally, glutamate-induced protection was not inhibited by quisqualate, even at
very high concentrations. Likewise, glutaric acid did not inhibit glutamate-induced PI hydrolysis.
Taken together, these data suggest the existence of two distinct non-overlapping glutamate
binding sites on mGlu1a receptors, with agonist action at one site (Site A) being responsible for
G protein-dependent signaling and agonist action at the second site (Site B) being responsible for
sustained ERK phosphorylation and protective signaling.
97
Future directions
Many elements of the protective signaling cascade initiated by mGlu1a receptors remain
unknown. Future studies should investigate the hypothesis that the C-terminus of mGlu1a
receptors is phosphorylated with GRK4 prior to the binding of -arrestin-1. The protective
substrates of phosphorylated ERK remain unknown. Since phosphorylated ERK that is linked to
-arrestin generally acts upon cytosolic substrates, the phosphoproteins should be investigated
using antibodies. Moreover, the changes in gene regulation that result from this signaling
cascade could be investigated through the use of microarrays and further investigated using
pharmacological approaches. Such studies could be useful in identifying other potential methods
to protect cells from toxicity. Additionally, these studies should be more comprehensively
confirmed in primary cultures of neurons and ultimately in vivo. Such studies could be very
useful in identifying a role for glutamate to act as a trophic factor in the developing brain, and
possibly as a neuroprotective mechanism. Additionally, emerging evidence suggest that
activation of mGlu1 receptors plays a role in the proliferation of melanoma cells (Marin and
Chen, 2004). Further studies should test the hypothesis that -arrestin-dependent signaling
through mGlu1 receptors is responsible for this increase in proliferation. If confirmed, these
results would yield multiple additional molecular targets for the treatment of melanoma.
The studies in Chapter 3 represent interesting possibilities for further studies. Taken
together, these results suggest the existence of two glutamate binding sites at mGlu1a receptors.
A more thorough mutational analysis of the ligand binding domain of the receptor paired with
computer modeling may lead greater insight into the second binding site. Pharmacological
studies indicate that glutamate, aspartate, and L-cysteic acid act at Site B, and glutaric and
98
succinic acids were identified as biased agonists for this site on mGlu1a receptor. Neither of
these newly-identified compounds is very potent, but they may serve as lead compounds for
further rational drug design, as ligands which do not stimulate PI hydrolysis but do stimulate
protective signaling could be quite useful for possible use in neurodegeneration. Moreover, since
mGlu1 receptor activation increases the proliferation of melanoma cells (Marin and Chen, 2004),
identification of a compound that selectively antagonizes Site B could be extremely useful, since
it could potentially be used to inhibit the proliferation of melanoma cells while not affecting G
protein-dependent mGlu1 receptor signaling, which occurs due to agonist activity at Site A.
99
Construct Sequence
T188A Forward
5’CAGATCGCCTATTCTGCCGCTAGCA
Reverse 5’GTCACTCAGGTCTATGCTAGCGGGA
R323V Forward 5’GAAGTGATGGATGGGCAGACGTCGACGAAGTCATCGAAGGC
Reverse 5’GCCTTCGATTTCGTCGACGTCTGCCCATCCATCACTTC
K409A Forward 5’GAAAACTATGTCCAGGACAGCGCCATGGGATTTGTCATCAATGCC
Reverse 5’GGCATTGATGACAAATCCCATCGGGCTGTCCTGGACATAGTTTTC
Table 3. Sequences of PCR primers for creating mutant mGlu1 receptors
100
REFERENCES
Acher FC, Selvam C, Pin JP, Goudet C, Bertrand HO. 2011. A critical pocket close to the
glutamate binding site of mGlu receptors opens new possibilities for agonist design.
Neuropharmacology 60(1):102-7.
Aiba A, Kano M, Chen C, Stanton ME, Fox GD, Herrup K, Zwingman TA, Tonegawa S. 1994.
Deficient cerebellar long-term depression and impaired motor learning in mGluR1
mutant mice. Cell 79(2):377-88.
Alaluf S, Mulvihill ER, McIlhinney RA. 1995. Rapid agonist mediated phosphorylation of the
metabotropic glutamate receptor 1 alpha by protein kinase C in permanently transfected
BHK cells. FEBS Lett 367(3):301-5.
Aniksztejn L, Otani S, Ben-Ari Y. 1992. Quisqualate Metabotropic Receptors Modulate NMDA
Currents and Facilitate Induction of Long-Term Potentiation Through Protein Kinase C.
Eur J Neurosci 4(6):500-505.
Aramori I, Nakanishi S. 1992. Signal transduction and pharmacological characteristics of a
metabotropic glutamate receptor, mGluR1, in transfected CHO cells. Neuron 8(4):757-
65.
Batchelor AM, Knopfel T, Gasparini F, Garthwaite J. 1997. Pharmacological characterization of
synaptic transmission through mGluRs in rat cerebellar slices. Neuropharmacology
36(3):401-3.
101
Baude A, Nusser Z, Roberts JD, Mulvihill E, McIlhinney RA, Somogyi P. 1993. The
metabotropic glutamate receptor (mGluR1 alpha) is concentrated at perisynaptic
membrane of neuronal subpopulations as detected by immunogold reaction. Neuron
11(4):771-87.
Beom S, Cheong D, Torres G, Caron MG, Kim KM. 2004. Comparative studies of molecular
mechanisms of dopamine D2 and D3 receptors for the activation of extracellular signal-
regulated kinase. J Biol Chem 279(27):28304-14.
Bhave G, Nadin BM, Brasier DJ, Glauner KS, Shah RD, Heinemann SF, Karim F, Gereau RWt.
2003. Membrane topology of a metabotropic glutamate receptor. J Biol Chem
278(32):30294-301.
Bleakman D, Rusin KI, Chard PS, Glaum SR, Miller RJ. 1992. Metabotropic glutamate receptors
potentiate ionotropic glutamate responses in the rat dorsal horn. Mol Pharmacol
42(2):192-6.
Bleasdale JE, Thakur NR, Gremban RS, Bundy GL, Fitzpatrick FA, Smith RJ, Bunting S. 1990.
Selective inhibition of receptor-coupled phospholipase C-dependent processes in human
platelets and polymorphonuclear neutrophils. J Pharmacol Exp Ther 255(2):756-68.
Brauner-Osborne H, Wellendorph P, Jensen AA. 2007. Structure, pharmacology and therapeutic
prospects of family C G-protein coupled receptors. Curr Drug Targets 8(1):169-84.
Broca C, Quoyer J, Costes S, Linck N, Varrault A, Deffayet PM, Bockaert J, Dalle S, Bertrand
G. 2009. beta-Arrestin 1 is required for PAC1 receptor-mediated potentiation of long-
lasting ERK1/2 activation by glucose in pancreatic beta-cells. J Biol Chem 284(7):4332-
42.
102
Bruno V, Copani A, Knopfel T, Kuhn R, Casabona G, Dell'Albani P, Condorelli DF, Nicoletti F.
1995. Activation of metabotropic glutamate receptors coupled to inositol phospholipid
hydrolysis amplifies NMDA-induced neuronal degeneration in cultured cortical cells.
Neuropharmacology 34(8):1089-98.
Catania MV, Aronica E, Sortino MA, Canonico PL, Nicoletti F. 1991. Desensitization of
metabotropic glutamate receptors in neuronal cultures. J Neurochem 56(4):1329-35.
Chao MV. 2003. Dependence receptors: what is the mechanism? Sci STKE 2003(200):PE38.
Chavis P, Nooney JM, Bockaert J, Fagni L, Feltz A, Bossu JL. 1995. Facilitatory coupling
between a glutamate metabotropic receptor and dihydropyridine-sensitive calcium
channels in cultured cerebellar granule cells. J Neurosci 15(1 Pt 1):135-43.
Chen PE, Geballe MT, Stansfeld PJ, Johnston AR, Yuan H, Jacob AL, Snyder JP, Traynelis SF,
Wyllie DJ. 2005. Structural features of the glutamate binding site in recombinant
NR1/NR2A N-methyl-D-aspartate receptors determined by site-directed mutagenesis and
molecular modeling. Mol Pharmacol 67(5):1470-84.
Choe ES, Wang JQ. 2001. Group I metabotropic glutamate receptor activation increases
phosphorylation of cAMP response element-binding protein, Elk-1, and extracellular
signal-regulated kinases in rat dorsal striatum. Brain Res Mol Brain Res 94(1-2):75-84.
Clark BP, Baker SR, Goldsworthy J, Harris JR, Kingston AE. 1997. (+)-2-methyl-4-
carboxyphenylglycine (LY367385) selectively antagonises metabotropic glutamate
mGluR1 receptors. Bioorg Med Chem Lett 7(21):2777-2780.
Conn PJ, Pin JP. 1997. Pharmacology and functions of metabotropic glutamate receptors. Annu
Rev Pharmacol Toxicol 37:205-37.
103
Daaka Y, Luttrell LM, Ahn S, Della Rocca GJ, Ferguson SS, Caron MG, Lefkowitz RJ. 1998.
Essential role for G protein-coupled receptor endocytosis in the activation of mitogen-
activated protein kinase. J Biol Chem 273(2):685-8.
Dale LB, Bhattacharya M, Seachrist JL, Anborgh PH, Ferguson SS. 2001. Agonist-stimulated
and tonic internalization of metabotropic glutamate receptor 1a in human embryonic
kidney 293 cells: agonist-stimulated endocytosis is beta-arrestin1 isoform-specific. Mol
Pharmacol 60(6):1243-53.
del Rio E, McLaughlin M, Downes CP, Nicholls DG. 1999. Differential coupling of G-protein-
linked receptors to Ca2+ mobilization through inositol(1,4,5)trisphosphate or ryanodine
receptors in cerebellar granule cells in primary culture. Eur J Neurosci 11(9):3015-22.
DeWire SM, Ahn S, Lefkowitz RJ, Shenoy SK. 2007. Beta-arrestins and cell signaling. Annu
Rev Physiol 69:483-510.
Dhami GK, Dale LB, Anborgh PH, O'Connor-Halligan KE, Sterne-Marr R, Ferguson SS. 2004.
G Protein-coupled receptor kinase 2 regulator of G protein signaling homology domain
binds to both metabotropic glutamate receptor 1a and Galphaq to attenuate signaling. J
Biol Chem 279(16):16614-20.
Dhami GK, Ferguson SS. 2006. Regulation of metabotropic glutamate receptor signaling,
desensitization and endocytosis. Pharmacol Ther 111(1):260-71.
Diviani D, Lattion AL, Larbi N, Kunapuli P, Pronin A, Benovic JL, Cotecchia S. 1996. Effect of
different G protein-coupled receptor kinases on phosphorylation and desensitization of
the alpha1B-adrenergic receptor. J Biol Chem 271(9):5049-58.
104
Eaton SA, Jane DE, Jones PL, Porter RH, Pook PC, Sunter DC, Udvarhelyi PM, Roberts PJ, Salt
TE, Watkins JC. 1993. Competitive antagonism at metabotropic glutamate receptors by
(S)-4-carboxyphenylglycine and (RS)-alpha-methyl-4-carboxyphenylglycine. Eur J
Pharmacol 244(2):195-7.
Emery AC, Pshenichkin S, Takoudjou GR, Grajkowska E, Wolfe BB, Wroblewski JT. 2010. The
protective signaling of metabotropic glutamate receptor 1 Is mediated by sustained, beta-
arrestin-1-dependent ERK phosphorylation. J Biol Chem 285(34):26041-8.
Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE, Pitts
WJ, Earl RA, Hobbs F and others. 1998. Identification of a novel inhibitor of mitogen-
activated protein kinase kinase. J Biol Chem 273(29):18623-32.
Ferraguti F, Baldani-Guerra B, Corsi M, Nakanishi S, Corti C. 1999. Activation of the
extracellular signal-regulated kinase 2 by metabotropic glutamate receptors. Eur J
Neurosci 11(6):2073-2082.
Fisher A, Heldman E, Gurwitz D, Haring R, Barak D, Meshulam H, Marciano D, Brandeis R,
Pittel Z, Segal M and others. 1993. Selective signaling via unique M1 muscarinic
agonists. Ann N Y Acad Sci 695:300-3.
Garrett JE, Capuano IV, Hammerland LG, Hung BC, Brown EM, Hebert SC, Nemeth EF, Fuller
F. 1995. Molecular cloning and functional expression of human parathyroid calcium
receptor cDNAs. J Biol Chem 270(21):12919-25.
Gomeza J, Joly C, Kuhn R, Knopfel T, Bockaert J, Pin JP. 1996a. The second intracellular loop
of metabotropic glutamate receptor 1 cooperates with the other intracellular domains to
control coupling to G-proteins. J Biol Chem 271(4):2199-205.
105
Gomeza J, Mary S, Brabet I, Parmentier ML, Restituito S, Bockaert J, Pin JP. 1996b. Coupling
of metabotropic glutamate receptors 2 and 4 to G alpha 15, G alpha 16, and chimeric G
alpha q/i proteins: characterization of new antagonists. Mol Pharmacol 50(4):923-30.
Harvey J, Collingridge GL. 1993. Signal transduction pathways involved in the acute
potentiation of NMDA responses by 1S,3R-ACPD in rat hippocampal slices. Br J
Pharmacol 109(4):1085-90.
Hayashi Y, Sekiyama N, Nakanishi S, Jane DE, Sunter DC, Birse EF, Udvarhelyi PM, Watkins
JC. 1994. Analysis of agonist and antagonist activities of phenylglycine derivatives for
different cloned metabotropic glutamate receptor subtypes. J Neurosci 14(5 Pt 2):3370-7.
Hermans E, Nahorski SR, Challiss RA. 1998. Reversible and non-competitive antagonist profile
of CPCCOEt at the human type 1alpha metabotropic glutamate receptor.
Neuropharmacology 37(12):1645-7.
Houamed KM, Kuijper JL, Gilbert TL, Haldeman BA, O'Hara PJ, Mulvihill ER, Almers W,
Hagen FS. 1991. Cloning, expression, and gene structure of a G protein-coupled
glutamate receptor from rat brain. Science 252(5010):1318-21.
Iacovelli L, Salvatore L, Capobianco L, Picascia A, Barletta E, Storto M, Mariggio S, Sallese M,
Porcellini A, Nicoletti F and others. 2003. Role of G protein-coupled receptor kinase 4
and beta-arrestin 1 in agonist-stimulated metabotropic glutamate receptor 1
internalization and activation of mitogen-activated protein kinases. J Biol Chem
278(14):12433-42.
106
Ichise T, Kano M, Hashimoto K, Yanagihara D, Nakao K, Shigemoto R, Katsuki M, Aiba A.
2000. mGluR1 in cerebellar Purkinje cells essential for long-term depression, synapse
elimination, and motor coordination. Science 288(5472):1832-5.
Ito I, Kohda A, Tanabe S, Hirose E, Hayashi M, Mitsunaga S, Sugiyama H. 1992. 3,5-
Dihydroxyphenyl-glycine: a potent agonist of metabotropic glutamate receptors.
Neuroreport 3(11):1013-6.
Jeanneteau F, Funalot B, Jankovic J, Deng H, Lagarde JP, Lucotte G, Sokoloff P. 2006. A
functional variant of the dopamine D3 receptor is associated with risk and age-at-onset of
essential tremor. Proc Natl Acad Sci U S A 103(28):10753-8.
Kano M, Hashimoto K, Kurihara H, Watanabe M, Inoue Y, Aiba A, Tonegawa S. 1997.
Persistent multiple climbing fiber innervation of cerebellar Purkinje cells in mice lacking
mGluR1. Neuron 18(1):71-9.
Kano M, Hashimoto K, Tabata T. 2008. Type-1 metabotropic glutamate receptor in cerebellar
Purkinje cells: a key molecule responsible for long-term depression, endocannabinoid
signalling and synapse elimination. Philos Trans R Soc Lond B Biol Sci 363(1500):2173-
86.
Karim F, Wang CC, Gereau RWt. 2001. Metabotropic glutamate receptor subtypes 1 and 5 are
activators of extracellular signal-regulated kinase signaling required for inflammatory
pain in mice. J Neurosci 21(11):3771-9.
Kaupmann K, Huggel K, Heid J, Flor PJ, Bischoff S, Mickel SJ, McMaster G, Angst C, Bittiger
H, Froestl W and others. 1997. Expression cloning of GABA(B) receptors uncovers
similarity to metabotropic glutamate receptors. Nature 386(6622):239-46.
107
Kenakin T. 2007. Functional selectivity through protean and biased agonism: who steers the
ship? Mol Pharmacol 72(6):1393-401.
Kohara A, Toya T, Tamura S, Watabiki T, Nagakura Y, Shitaka Y, Hayashibe S, Kawabata S,
Okada M. 2005. Radioligand binding properties and pharmacological characterization of
YM-298198, a high-affinity, selective and noncompetitive antagonist of metabotropic
glutamate receptor type 1. J Pharmacol Exp Ther.
Kreibich TA, Chalasani SH, Raper JA. 2004. The Neurotransmitter glutamate reduces axonal
responsiveness to multiple repellents through the activation of metabotropic glutamate
receptor 1. J Neurosci 24(32):7085-95.
Kunishima N, Shimada Y, Tsuji Y, Sato T, Yamamoto M, Kumasaka T, Nakanishi S, Jingami H,
Morikawa K. 2000. Structural basis of glutamate recognition by a dimeric metabotropic
glutamate receptor. Nature 407(6807):971-7.
Lavreysen H, Wouters R, Bischoff F, Nobrega Pereira S, Langlois X, Blokland S, Somers M,
Dillen L, Lesage AS. 2004. JNJ16259685, a highly potent, selective and systemically
active mGlu1 receptor antagonist. Neuropharmacology 47(7):961-72.
Litschig S, Gasparini F, Rueegg D, Stoehr N, Flor PJ, Vranesic I, Prezeau L, Pin JP, Thomsen C,
Kuhn R. 1999. CPCCOEt, a noncompetitive metabotropic glutamate receptor 1
antagonist, inhibits receptor signaling without affecting glutamate binding. Mol
Pharmacol 55(3):453-61.
Lohse MJ, Benovic JL, Codina J, Caron MG, Lefkowitz RJ. 1990. beta-Arrestin: a protein that
regulates beta-adrenergic receptor function. Science 248(4962):1547-50.
108
Luttrell LM, Roudabush FL, Choy EW, Miller WE, Field ME, Pierce KL, Lefkowitz RJ. 2001.
Activation and targeting of extracellular signal-regulated kinases by beta-arrestin
scaffolds. Proc Natl Acad Sci U S A 98(5):2449-54.
Macey TA, Lowe JD, Chavkin C. 2006. Mu opioid receptor activation of ERK1/2 is GRK3 and
arrestin dependent in striatal neurons. J Biol Chem 281(45):34515-24.
Marin YE, Chen S. 2004. Involvement of metabotropic glutamate receptor 1, a G protein coupled
receptor, in melanoma development. J Mol Med 82(11):735-49.
Martin LJ, Blackstone CD, Huganir RL, Price DL. 1992. Cellular localization of a metabotropic
glutamate receptor in rat brain. Neuron 9(2):259-70.
Masu M, Tanabe Y, Tsuchida K, Shigemoto R, Nakanishi S. 1991. Sequence and expression of a
metabotropic glutamate receptor. Nature 349(6312):760-5.
Matsunami H, Buck LB. 1997. A multigene family encoding a diverse array of putative
pheromone receptors in mammals. Cell 90(4):775-84.
Meguro H, Mori H, Araki K, Kushiya E, Kutsuwada T, Yamazaki M, Kumanishi T, Arakawa M,
Sakimura K, Mishina M. 1992. Functional characterization of a heteromeric NMDA
receptor channel expressed from cloned cDNAs. Nature 357(6373):70-4.
Mehlen P, Bredesen DE. 2004. The dependence receptor hypothesis. Apoptosis 9(1):37-49.
Moroni F, Attucci S, Cozzi A, Meli E, Picca R, Scheideler MA, Pellicciari R, Noe C, Sarichelou
I, Pellegrini-Giampietro DE. 2002. The novel and systemically active metabotropic
glutamate 1 (mGlu1) receptor antagonist 3-MATIDA reduces post-ischemic neuronal
death. Neuropharmacology 42(6):741-51.
109
Mosmann T. 1983. Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays. J Immunol Methods 65(1-2):55-63.
Mukhin A, Fan L, Faden AI. 1996. Activation of metabotropic glutamate receptor subtype
mGluR1 contributes to post-traumatic neuronal injury. J Neurosci 16(19):6012-20.
Mundell SJ, Matharu AL, Pula G, Roberts PJ, Kelly E. 2001. Agonist-induced internalization of
the metabotropic glutamate receptor 1a is arrestin- and dynamin-dependent. J Neurochem
78(3):546-51.
Nicoletti F, Wroblewski JT, Novelli A, Alho H, Guidotti A, Costa E. 1986. The activation of
inositol phospholipid metabolism as a signal- transducing system for excitatory amino
acids in primary cultures of cerebellar granule cells. J Neurosci 6(7):1905-11.
Nishizuka Y. 1995. Protein kinase C and lipid signaling for sustained cellular responses. FASEB
J 9(7):484-96.
Ogawa H, Qiu Y, Philo JS, Arakawa T, Ogata CM, Misono KS. 2010. Reversibly bound chloride
in the atrial natriuretic peptide receptor hormone-binding domain: possible allosteric
regulation and a conserved structural motif for the chloride-binding site. Protein Sci
19(3):544-57.
Pickering DS, Thomsen C, Suzdak PD, Fletcher EJ, Robitaille R, Salter MW, MacDonald JF,
Huang XP, Hampson DR. 1993. A comparison of two alternatively spliced forms of a
metabotropic glutamate receptor coupled to phosphoinositide turnover. J Neurochem
61(1):85-92.
Pin JP, Duvoisin R. 1995. The metabotropic glutamate receptors: structure and functions.
Neuropharmacology 34(1):1-26.
110
Pin JP, Joly C, Heinemann SF, Bockaert J. 1994. Domains involved in the specificity of G
protein activation in phospholipase C-coupled metabotropic glutamate receptors. EMBO
J 13(2):342-8.
Porter RH, Roberts PJ. 1993. Glutamate metabotropic receptor activation in neonatal rat cerebral
cortex by sulphur-containing excitatory amino acids. Neurosci Lett 154(1-2):78-80.
Pshenichkin S, Dolinska M, Klauzinska M, Luchenko V, Grajkowska E, Wroblewski JT. 2008.
Dual neurotoxic and neuroprotective role of metabotropic glutamate receptor 1 in
conditions of trophic deprivation - possible role as a dependence receptor.
Neuropharmacology 55(4):500-8.
Quan W, Kim JH, Albert PR, Choi H, Kim KM. 2008. Roles of G protein and beta-arrestin in
dopamine D2 receptor-mediated ERK activation. Biochem Biophys Res Commun
377(2):705-9.
Rajagopal S, Rajagopal K, Lefkowitz RJ. 2010. Teaching old receptors new tricks: biasing
seven-transmembrane receptors. Nat Rev Drug Discov 9(5):373-86.
Rosen LB, Ginty DD, Weber MJ, Greenberg ME. 1994. Membrane depolarization and calcium
influx stimulate MEK and MAP kinase via activation of Ras. Neuron 12(6):1207-21.
Sato T, Shimada Y, Nagasawa N, Nakanishi S, Jingami H. 2003. Amino acid mutagenesis of the
ligand binding site and the dimer interface of the metabotropic glutamate receptor 1.
Identification of crucial residues for setting the activated state. J Biol Chem 278(6):4314-
21.
111
Schoepp DD, Goldsworthy J, Johnson BG, Salhoff CR, Baker SR. 1994. 3,5-
dihydroxyphenylglycine is a highly selective agonist for phosphoinositide-linked
metabotropic glutamate receptors in the rat hippocampus. J Neurochem 63(2):769-72.
Seger R, Krebs EG. 1995. The MAPK signaling cascade. FASEB J 9(9):726-35.
Sheffler DJ, Conn PJ. 2008. Allosteric potentiators of metabotropic glutamate receptor subtype
1a differentially modulate independent signaling pathways in baby hamster kidney cells.
Neuropharmacology 55(4):419-27.
Shenoy SK, Drake MT, Nelson CD, Houtz DA, Xiao K, Madabushi S, Reiter E, Premont RT,
Lichtarge O, Lefkowitz RJ. 2006. beta-arrestin-dependent, G protein-independent
ERK1/2 activation by the beta2 adrenergic receptor. J Biol Chem 281(2):1261-73.
Shi Q, Savage JE, Hufeisen SJ, Rauser L, Grajkowska E, Ernsberger P, Wroblewski JT, Nadeau
JH, Roth BL. 2003. L-homocysteine sulfinic acid and other acidic homocysteine
derivatives are potent and selective metabotropic glutamate receptor agonists. J
Pharmacol Exp Ther 305(1):131-42.
Siliprandi R, Lipartiti M, Fadda E, Sautter J, Manev H. 1992. Activation of the glutamate
metabotropic receptor protects retina against N-methyl-D-aspartate toxicity. Eur J
Pharmacol 219(1):173-4.
Sladeczek F, Pin JP, Recasens M, Bockaert J, Weiss S. 1985. Glutamate stimulates inositol
phosphate formation in striatal neurones. Nature 317(6039):717-9.
112
Storozheva ZI, Proshin AT, Sherstnev VV, Storozhevykh TP, Senilova YE, Persiyantseva NA,
Pinelis VG, Semenova NA, Zakharova EI, Pomytkin IA. 2008. Dicholine salt of succinic
acid, a neuronal insulin sensitizer, ameliorates cognitive deficits in rodent models of
normal aging, chronic cerebral hypoperfusion, and beta-amyloid peptide-(25-35)-induced
amnesia. BMC Pharmacol 8:1.
Takahashi K, Tsuchida K, Tanabe Y, Masu M, Nakanishi S. 1993. Role of the large extracellular
domain of metabotropic glutamate receptors in agonist selectivity determination. J Biol
Chem 268(26):19341-5.
Thandi S, Blank JL, Challiss RA. 2002. Group-I metabotropic glutamate receptors, mGlu1a and
mGlu5a, couple to extracellular signal-regulated kinase (ERK) activation via distinct, but
overlapping, signalling pathways. J Neurochem 83(5):1139-53.
Thomsen C, Mulvihill ER, Haldeman B, Pickering DS, Hampson DR, Suzdak PD. 1993. A
pharmacological characterization of the mGluR1 alpha subtype of the metabotropic
glutamate receptor expressed in a cloned baby hamster kidney cell line. Brain Res 619(1-
2):22-8.
Vanderklish PW, Edelman GM. 2002. Dendritic spines elongate after stimulation of group 1
metabotropic glutamate receptors in cultured hippocampal neurons. Proc Natl Acad Sci U
S A 99(3):1639-44.
Versteeg HH, Nijhuis E, van den Brink GR, Evertzen M, Pynaert GN, van Deventer SJ, Coffer
PJ, Peppelenbosch MP. 2000. A new phosphospecific cell-based ELISA for p42/p44
mitogen-activated protein kinase (MAPK), p38 MAPK, protein kinase B and cAMP-
response-element-binding protein. Biochem J 350 Pt 3:717-22.
113
Violin JD, Lefkowitz RJ. 2007. Beta-arrestin-biased ligands at seven-transmembrane receptors.
Trends Pharmacol Sci 28(8):416-22.
Wei H, Ahn S, Shenoy SK, Karnik SS, Hunyady L, Luttrell LM, Lefkowitz RJ. 2003.
Independent beta-arrestin 2 and G protein-mediated pathways for angiotensin II
activation of extracellular signal-regulated kinases 1 and 2. Proc Natl Acad Sci U S A
100(19):10782-7.
Werner CG, Scartabelli T, Pancani T, Landucci E, Moroni F, Pellegrini-Giampietro DE. 2007.
Differential role of mGlu1 and mGlu5 receptors in rat hippocampal slice models of
ischemic tolerance. Eur J Neurosci 25(12):3597-604.
Wroblewski JT, Nicoletti F, Costa E. 1985. Different coupling of excitatory amino acid receptors
with Ca2+ channels in primary cultures of cerebellar granule cells. Neuropharmacology
24(9):919-21.
Zheng H, Loh HH, Law PY. 2008. Beta-arrestin-dependent mu-opioid receptor-activated
extracellular signal-regulated kinases (ERKs) Translocate to Nucleus in Contrast to G
protein-dependent ERK activation. Mol Pharmacol 73(1):178-90.
Zhong LT, Sarafian T, Kane DJ, Charles AC, Mah SP, Edwards RH, Bredesen DE. 1993. bcl-2
inhibits death of central neural cells induced by multiple agents. Proc Natl Acad Sci U S
A 90(10):4533-7.