Nature06263 Supplementary Info

Table of Contents:

Supplementary Results

Supplementary Discussion

Supplementary References

Supplementary Figures S1-S11

Supplementary Table 1-2.

Supplementary Results

Detailed analysis of PIWI-associated piRNA features

We obtained 19,048 candidate small RNA clones with at least one perfect match in the D.

melanogaster genome, which represent 13,299 unique PIWI-associated small RNAs. 1.9% of the

small RNA clones represent 31 miRNAs that were identified multiple times (Supplementary Fig.

S1B). This interaction might reflect the miRNA-related function of PIWI in germline

determination during early embryogenesis1. Another 6.8% small RNA clones correspond to

rRNAs, tRNAs, snRNAs, snoRNAs, or other known non-coding RNAs. The remaining 12,903

(91.3%) small RNAs are bona fide PIWI-associated piRNAs. Of these, 10,567 (81.9%) piRNAs

were cloned only for once (Supplementary Fig. S2A). Moreover, only 1,373 (10.6%) piRNAs

were previously published as PIWI-bound rasiRNAs2, 3, which indicates the complexity of the

PIWI-associated piRNA population (Supplementary Fig. S2B). With respect to their genomic

origins, 8,629 (66.8%) piRNAs have multiple matched sites in the D. melanogaster genome

(Supplementary Fig. S2C), suggesting these piRNAs might be transcribed from repetitive

sequences. 9,049 (70.1%) piRNAs can be mapped to the unassembled heterochromatic

sequences, which only represent about 22.5% of the sequenced D. melanogaster genome. On

SUPPLEMENTARY INFORMATION

doi: 10.1038/nature06263

www.nature.com/nature 1

average, the density of piRNA-matched sites in these heterochromatic sequences is 41.5 times of

that in the assembled chromosome arms.

Most PIWI-associated piRNAs are located within 369 clusters (Supplementary Table 1).

Within clusters, piRNAs are present in an overlapping fashion (piRNA contigs; Supplementary

Table 2), indicating the likeliness that each cluster represents a precursor transcript, which is then

cleaved at U-containing sites by a proposed AGO3/AUBERGINE-involved piRNA amplification

mechanism3, 4. We discovered that the average G/C content of piRNA sequences is significantly

higher than the average G/C contents of transposon sequences and the D. melanogaster genome

(Supplementary Fig. S2D), which implies the proposed piRNA amplification mechanism might

bear sequence preference toward high G/C content regions.

We also determined the distribution of unique mapped PIWI-associated piRNAs, which have

unambiguous genome origins (Supplementary Fig. S3A). These unique mapped piRNAs form

clusters at cytological bands 20A1-A3, 20A5-B6 (also known as flamenco region), 42A16-B2,

48C5, 57A5-A7 66D11-D12 and 99A1-A5. Some of these unique mapped piRNA clusters are

highly enriched of fragmented transposons. Detailed views of these clusters suggest piRNAs

might generate from long read-through precursors originated from legacy transposon promoters

or promoters of neighboring genes (Supplementary Fig. S3B). Interestingly, unique mapped

piRNA clusters at 66D11-D12 and 99A1-A5 are localized at gene-enriched regions that in

general lack of transposon and repetitive sequences. The genetic relationship between piwi and

these regions might imply a function of piwi beyond transposon silencing5.

Detailed views of piRNA clusters indicate PIWI-associated piRNAs are derived from both

strands (Supplementary Fig. S3B, S3C). No divergently transcribed “bidirectional” cluster was

found, in contrast to the mammalian piRNA clusters6-9. We then further determined the

doi: 10.1038/nature06263 SUPPLEMENTARY INFORMATION


distributions of piRNAs within LTR and LINE types of retrotransposons (Supplementary Fig.

S4). Within LTR type retrotransposons, the majority of PIWI-associated piRNAs are mapped to

the LTR regions on the antisense strands. In contrast, within LINE type retrotransposons,

piRNAs are evenly distributed along the protein coding regions and correspond to both sense and

antisense strands. This difference might reflect different biogenesis or function of piRNAs with

regard to those two types of retrotransposons.

Verification of direct binding of PIWI to piRNAs

We confirmed that 3R-TAS1 piRNA binds directly to PIWI by electrophoresis mobility shift

assays (Supplementary Fig. S6A). Increasing amounts of in vitro translated MYC-PIWI were

incubated with a 5’ 32P labeled 3R-TAS1 piRNA probe. We observed a proportional increase of a

distinct protein-RNA complex that is not detected with the template-free in vitro translation

reaction. This binding can be effectively competed by increasing amount of cold 3R-TAS1

piRNA (Supplementary Fig. S6B). Moreover, mutating the first ribonucleotide U to C

completely abolished this in vitro binding (Supplementary Fig. S6B). These results indicate that

PIWI directly binds to the 3R-TAS1 piRNA in vitro.

Overall epigenetic effect of piwi mutation to the D. melanogaster genome

We evaluated the overall effect of PIWI on the epigenetic states of the entire genome by

immunoblotting analysis of nuclear extracts from wild type and piwi mutant flies. Although the

total levels of H3Me2K4 and H3AcK9 remain unchanged in the piwi mutant, those of H3Me2K9,

H3Me3K9, and H4AcK12 are dramatically reduced in the piwi mutant (Supplementary Fig. S9).

The down-regulation of H3Me3K9 in piwi mutants has been observed previously10. These



observations are consistent with the known global function of PIWI in heterochromatic silencing.

Supplementary Discussion

We postulate a heterochromatin/euchromatin counter-balance model to explain the activating

effect of PIWI, together with the 3R-TAS1 piRNA (and possibly other piRNAs), on the TAS

region (Supplementary Fig. S11). We propose that the repetitive nature of the 3R-TAS region by

default is a substrate for heterochromatization. The heterochromatic state could be established

and maintained by the Polycomb group proteins11, 12, or an RNAi pathway mediated by

ARGONAUTE proteins, or yet another mechanisms. However, PIWI association with 3R-TAS

region via the 3R-TAS1 piRNA (and possibly other piRNAs) counteracts the

heterochromatization. In our model, TAS transcribes a piRNA precursor in wild type flies, which

is processed by PIWI subfamily proteins into the 3R-TAS1 piRNA, which is then loaded onto the

PIWI complex and guides the complex back to 3R-TAS. An unknown component in the complex

then prevents heterochromatization and promotes the transcription of the piRNA precursor. This

PIWI/TAS-piRNA-dependent self-enforcing loop, possibly together with a proposed activating

signal from telomeric HeT-A/TART tandem arrays13, 14, counteracts the silencing effect initiated

from the repetitive 3R-TAS, leading to the partially euchromatic state of the TAS region that

allows a low level of transcription. Loss of PIWI disrupts this loop. Consequently, 3R-TAS

heterochromatin invades and silences the 3R-TAS1 piRNA coding region. The insertion of a ~20

kb P{w+,ry+}A4-4 element in the 3R-TAS of wild type flies physically attenuates the

heterochromatin silencing effect on 3R-TAS1 piRNA coding region, leading to 3R-TAS1 piRNA

over-expression. Meanwhile, the inserted P{w+,ry+}A4-4 itself becomes under the influence of

the neighboring TAS heterochromatin, which causes the TPE variegation phenotype of the white



gene. In the piwi2 mutant, even though the PIWI-dependent activating effect is abolished, the

presence of P{w+,ry+}A4-4 acts as a buffering zone, so that the heterochromatin spreads to

P{w+,ry+}A4-4, silencing the expression of its white reporter gene, but not far enough to silence

the 3R-TAS1 piRNA transcription region. Consequently, the 3R-TAS1 piRNA precursor is

transcribed and 3R-TAS1 piRNA is generated by AGO3 and AUBERGINE.

On a larger scale, the PIWI-mediated piRNA pathway might regulate long range chromatin

pairing and clustering, or global chromatin organization. This possibility is supported by the

findings that the RNAi pathway is involved in telomere clustering in the fission yeast15 and that

PIWI and other ARGONAUTE proteins are required for the pairing-sensitive activating16 and

long range interaction of multiple copies of reporter genes mediated by Polycomb group

proteins17.

Our study raises several important mechanistic questions. For example, what proteins are

responsible for the opposite effects of PIWI at different genomic loci? What are the precursor,

promoter, and polymerase for 3R-TAS1 piRNA precursor transcription? It also remains to be

resolved why, while PIWI is presumed to exert its epigenetic regulation at many sites in the

genome10, 3R-TAS plays an important role in germline stem cell maintenance. The sub-telomeric

regions of almost all eukaryotes contain tandem repetitive sequences, suggesting a conserved yet

elusive function of these repeats during evolution. Our finding that PIWI is required for the

epigenetic activation of sub-telomeric region in D. melanogaster might reveal a new mechanism

underlying epigenetic regulation and stem cell maintenance.



Supplementary References

1. Megosh, H. B., Cox, D. N., Campbell, C. & Lin, H. The role of PIWI and the miRNAmachinery in Drosophila germline determination. Curr Biol 16, 1884-94 (2006).

2. Saito, K. et al. Specific association of Piwi with rasiRNAs derived from retrotransposonand heterochromatic regions in the Drosophila genome. Genes Dev 20, 2214-22 (2006).

3. Brennecke, J. et al. Discrete small RNA-generating loci as master regulators oftransposon activity in Drosophila. Cell 128, 1089-103 (2007).

4. Gunawardane, L. S. et al. A slicer-mediated mechanism for repeat-associated siRNA 5'end formation in Drosophila. Science 315, 1587-90 (2007).

5. Smulders-Srinivasan, T. K. & Lin, H. Screens for piwi suppressors in Drosophila identifydosage-dependent regulators of germline stem cell division. Genetics 165, 1971-91(2003).

6. Aravin, A. et al. A novel class of small RNAs bind to MILI protein in mouse testes.Nature 442, 203-7 (2006).

7. Girard, A., Sachidanandam, R., Hannon, G. J. & Carmell, M. A. A germline-specificclass of small RNAs binds mammalian Piwi proteins. Nature 442, 199-202 (2006).

8. Grivna, S. T., Beyret, E., Wang, Z. & Lin, H. A novel class of small RNAs in mousespermatogenic cells. Genes Dev 20, 1709-14 (2006).

9. Lau, N. C. et al. Characterization of the piRNA Complex from Rat Testes. Science(2006).

10. Pal-Bhadra, M. et al. Heterochromatic silencing and HP1 localization in Drosophila aredependent on the RNAi machinery. Science 303, 669-72 (2004).

11. Boivin, A., Gally, C., Netter, S., Anxolabehere, D. & Ronsseray, S. Telomeric associatedsequences of Drosophila recruit polycomb-group proteins in vivo and can induce pairing-sensitive repression. Genetics 164, 195-208 (2003).

12. Cryderman, D. E., Morris, E. J., Biessmann, H., Elgin, S. C. & Wallrath, L. L. Silencingat Drosophila telomeres: nuclear organization and chromatin structure play critical roles.Embo J 18, 3724-35 (1999).

13. Mason, J. M., Konev, A. Y., Golubovsky, M. D. & Biessmann, H. Cis- and trans-actinginfluences on telomeric position effect in Drosophila melanogaster detected with asubterminal transgene. Genetics 163, 917-30 (2003).

14. Biessmann, H., Prasad, S., Walter, M. F. & Mason, J. M. Euchromatic andheterochromatic domains at Drosophila telomeres. Biochem Cell Biol 83, 477-85 (2005).

15. Hall, I. M., Noma, K. & Grewal, S. I. RNA interference machinery regulateschromosome dynamics during mitosis and meiosis in fission yeast. Proc Natl Acad Sci US A 100, 193-8 (2003).

16. Pal-Bhadra, M., Bhadra, U. & Birchler, J. A. Interrelationship of RNA interference andtranscriptional gene silencing in Drosophila. Cold Spring Harb Symp Quant Biol 69, 433-8 (2004).

17. Grimaud, C. et al. RNAi components are required for nuclear clustering of Polycombgroup response elements. Cell 124, 957-71 (2006).



Supplementary Figures



Supplementary Figure S1. PIWI-associated piRNAs in the Drosophila genome.

(A) Immunoprecipitation and immunoblotting for MYC-PIWI shows that MYC-PIWI can be

specifically and efficiently purified from adult ovarian lysate of myc-piwi transgenic flies, but not

from w1118, which is the non-tagged parental strain of the transgenic flies. (B) Statistical analysis

of cloned small RNAs that match to miRNAs, rRNAs, tRNAs, snRNAs, snoRNAs and other

known non-coding RNAs. (C) The distribution of PIWI-associated piRNAs in the D.

melanogaster genome. Large piRNA clusters (>100 piRNAs) in sub-telomeric regions,

pericentromeric regions, and chromosome 4 are labeled with red arrow heads. The vertical axis

indicates the numbers of piRNAs within each 20-kb window along the genome



Supplementary Figure S2. Statistical analysis of PIWI-associated piRNAs.

(A) Pie chart summarizing the count numbers of PIWI-associated piRNAs in pyrosequencing

data set. (B) The Venn diagram of PIWI-associated piRNA/rasiRNA sequence overlaps at a 95%

identity cutoff. Dataset A, 12,903 PIWI-associated piRNAs discussed here; Dataset B, 13,904

PIWI-associated rasiRNAs from Brennecke, J. et al.3; Dataset C, 330 PIWI-associated rasiRNAs

from Saito, K. et al.2. (C) Pie chart summarizing the numbers of genomic matched site of PIWI-

associated piRNAs. (D) The average G/C contents of D. melanogaster genome, transposon

sequences, piRNA sequences and piRNA contigs (Supplementary Table 2).



Supplementary Figure S3. Distribution of unique mapped PIWI-associated piRNAs and

piRNA overlaps in the D. melanogaster genome.

(A) Unique mapped PIWI-associated piRNAs form clusters along chromosome arms. Large

unique mapping piRNA clusters are labeled with cytological locations. (B) Detailed organization

of PIWI-associated piRNA clusters and various genomic features in cytological band 42AB

region. The genome coordinates are based on the D. melanogaster genome assembly version 5.1.

The Pld gene, localized at the proximal end of the cluster, is drawn in green. Sequenced ESTs,

which are products of read-through and cryptic transcription, are drawn in red. The conservation

is calculated based on Multiz alignment of 12 Drosophila species and is drawn with grey

gradient. The directions of transposon fragments and piRNAs are denoted by blue for Watson

strand and orange for Crick strand, respectively. The heights of bars denote the numbers of

piRNAs mapped in each 2 kb genomic window. (C) Distribution of piRNAs in large piRNA

clusters. Four piRNA clusters at 2L and 3L telomeres, 3L pericentromeric region and

chromosome 4 are shown.



Supplementary Figure S4. Distribution of PIWI-associated piRNAs within LTR type and

LINE type retrotransposons.

The position of a bar represents the relative location of a piRNA in the transposon sequence. The

height of a bar indicates the count number of the piRNA in pyrosequencing data set. The

minimal height of a bar denotes that the piRNA is cloned only once, with additional clones

indicated in incremental increase in 0.2 height unit. Blue bars denote piRNAs matching the sense

strands of transposons, whereas red bars denote piRNAs matching the antisense strands.



Supplementary Figure S5. Multiple alignment of TAS homologous sequences in the D.

melanogaster genome.

The coding sequence of the unique mapped 3R-TAS1 piRNA (red box) in 3R-TAS is within a

conserved, but not identical, region among 3R-TAS, 2R-TAS and XL-TAS. The coding

sequences of TAS2 piRNA (blue boxes) are within each 172 bp repeat and are identical between

3R-TAS, 2R-TAS and XL-TAS. 172 bp repeats are underlined by alternating dark and light green

bars. Phylogenetic analysis shows 3R-TAS shares high level of similarity with 2R-TAS.



Supplementary Figure S6. PIWI directly binds to the 3R-TAS1 piRNA in vitro.

(A) MYC-PIWI in vitro translation reaction specifically causes the electrophoresis mobility shift

of 3R-TAS1 piRNA probe (upper panel). The amounts of soluble MYC-PIWI used in different

lanes were determined by immunoblotting analysis (bottom panel). (B) The replacement of the

first ribonucleotide U with C abolishes the binding of 3R-TAS1 piRNA with MYC-PIWI.

Unlabeled 3R-TAS1 piRNA also effectively competes the binding of MYC-PIWI with labeled

3R-TAS1 piRNA.



Supplementary Figure S7. The expression levels of the 3R-TAS1 piRNA, the TAS2 piRNA,

the HeT-A1 piRNA and the 2R-42AB-B1 piRNA.

(A) Expression levels of the 3R-TAS1 piRNA in w 1118, Canton-S, Oregon-R, piwi2/piwi2,

P{w+,ry+}A4-4, piwi2/piwi2;P{w+,ry+}A4-4 and P{w+,ry+}A4-4 revertants. (B) Expression levels

of the TAS2 piRNA (arrow head) in w1118, P{w+,ry+}A4-4 and piwi2/piwi2 flies. (C) Expression

levels of the HeT-A1 piRNA (arrow head) in w1118, P{w+,ry+}A4-4 and piwi2/piwi2 flies. (D)

Expression levels of the 2R-42AB-B1 piRNA (arrow head) in w1118, P{GT1}BG01672 and

piwi2/piwi2 flies.



Supplementary Figure S8. The relative enrichment of MYC-PIWI at various genomic

regions.

The relative enrichment is normalized against Succinate Dehydrogenase B (left panel) or

Actin88F (right panel). TAS(D): 3R-TAS distal region; TAS(P): 3R-TAS proximal region;

piRNA Cluster#9N: piRNA cluster#9 neighboring region [X:21,402,184..21,402,264]; piRNA

Cluster#11N: piRNA cluster#11 neighboring region [X:21,427,084..21,427,889]; piRNA

Cluster#16N: piRNA cluster#16 neighboring region [X:21,630,603..21,630,730]; HeT-A*: HeT-

A homologous region on chromosome 4 [4:1,289,176..1,289,339]; TART*: TART homologous

region on chromosome 4 [4:1,330,260..1,330,388].



Supplementary Figure S9. Immunoblotting analysis of global histone modifications from

nuclear extract of wild type and piwi mutant flies.

Nuclear lamin was used as inner loading control. The numbers below each panel indicate the

relative quantitative ratios of histone bands to nuclear lamin bands in piwi-/- samples, which are

further normalized against those of wild type samples.



Supplementary Figure S10. Histone profiles of the 172 bp repeat in wild type, piwi mutant,

and P{w+,ry+}A4-4 flies.

The histone profiles of the 172 bp repeat indicate that this region is associated with decreased

levels of euchromatic histone modifications and increased level of HP1 in piwi mutants. The

P{w+,ry+}A4-4 insertion partially restores euchromatic features in this region.



Supplementary Figure S11. The heterochromatin/euchromatin counter-balance model.

Black represents complete heterochromatin, whereas dark gray and light grey indicate partial

heterochromatin with less and more euchromatic features, respectively. For details, see

Supplementary Discussion.



Cluster ID Chromosome Start End Length Number of Densityarm Coordinate Coordinate (bp) piRNA (piRNA/kb)

========================================================================Cluster #1 Arm_X 1252098 1261739 9641 216 22.4Cluster #2 Arm_X 5621700 5626015 4315 137 31.75Cluster #3 Arm_X 6287190 6291479 4289 134 31.24Cluster #4 Arm_X 6324128 6329329 5201 330 63.45Cluster #5 Arm_X 14310547 14314848 4301 194 45.11Cluster #6 Arm_X 14672285 14676593 4308 116 26.93Cluster #7 Arm_X 18954659 18958967 4308 118 27.39Cluster #8 Arm_X 19815669 19819481 3812 210 55.09Cluster #9 Arm_X 21403799 21407995 4196 103 24.55

Cluster #10 Arm_X 21413365 21415734 2369 104 43.9Cluster #11 Arm_X 21419866 21425407 5541 109 19.67Cluster #12 Arm_X 21525325 21532899 7574 132 17.43Cluster #13 Arm_X 21533509 21538212 4703 238 50.61Cluster #14 Arm_X 21542645 21550393 7748 131 16.91Cluster #15 Arm_X 21611039 21616510 5471 131 23.94Cluster #16 Arm_X 21620535 21629318 8783 104 11.84Cluster #17 Arm_X 21764065 21771065 7000 143 20.43Cluster #18 Arm_X 21771699 21775582 3883 113 29.1Cluster #19 Arm_X 21789757 21794180 4423 133 30.07Cluster #20 Arm_X 21795053 21801012 5959 173 29.03Cluster #21 Arm_X 22214134 22218430 4296 245 57.03Cluster #22 Arm_2L 0 5132 5132 301 58.65Cluster #23 Arm_2L 1570900 1573390 2490 147 59.04Cluster #24 Arm_2L 8019087 8023402 4315 138 31.98Cluster #25 Arm_2L 9218186 9222494 4308 117 27.16Cluster #26 Arm_2L 10138266 10143348 5082 325 63.95Cluster #27 Arm_2L 10862956 10864409 1453 111 76.39Cluster #28 Arm_2L 11897169 11899781 2612 101 38.67Cluster #29 Arm_2L 12731354 12735656 4302 224 52.07Cluster #30 Arm_2L 12739381 12743689 4308 117 27.16Cluster #31 Arm_2L 12791804 12795225 3421 147 42.97Cluster #32 Arm_2L 13405936 13410251 4315 138 31.98Cluster #33 Arm_2L 13560743 13565045 4302 241 56.02Cluster #34 Arm_2L 16958397 16962712 4315 132 30.59Cluster #35 Arm_2L 17273406 17277707 4301 197 45.8Cluster #36 Arm_2L 17687782 17692084 4302 241 56.02

Supplementary Table 1. PIWI-associated piRNA clusters



Cluster #37 Arm_2L 18408309 18412624 4315 131 30.36Cluster #38 Arm_2L 18633824 18638132 4308 118 27.39Cluster #39 Arm_2L 19345301 19349189 3888 152 39.09Cluster #40 Arm_2L 19668699 19673014 4315 131 30.36Cluster #41 Arm_2L 20107176 20112453 5277 111 21.03Cluster #42 Arm_2L 20215288 20218218 2930 119 40.61Cluster #43 Arm_2L 20976802 20981195 4393 152 34.6Cluster #44 Arm_2L 21546320 21550252 3932 145 36.88Cluster #45 Arm_2L 22370947 22373965 3018 109 36.12Cluster #46 Arm_2L 22377257 22383442 6185 198 32.01Cluster #47 Arm_2L 22384032 22388611 4579 126 27.52Cluster #48 Arm_2L 22414789 22420161 5372 132 24.57Cluster #49 Arm_2L 22508047 22511223 3176 147 46.28Cluster #50 Arm_2L 22516277 22520872 4595 211 45.92Cluster #51 Arm_2L 22572820 22577123 4303 236 54.85Cluster #52 Arm_2L 22659598 22666270 6672 244 36.57Cluster #53 Arm_2L 22786621 22802141 15520 260 16.75Cluster #54 Arm_2R 112704 118375 5671 104 18.34Cluster #55 Arm_2R 218538 223528 4990 253 50.7Cluster #56 Arm_2R 302155 312320 10165 160 15.74Cluster #57 Arm_2R 371028 375343 4315 134 31.05Cluster #58 Arm_2R 415137 419269 4132 222 53.73Cluster #59 Arm_2R 459389 463208 3819 236 61.8Cluster #60 Arm_2R 750412 756058 5646 382 67.66Cluster #61 Arm_2R 768846 773239 4393 154 35.06Cluster #62 Arm_2R 812458 816591 4133 105 25.41Cluster #63 Arm_2R 875058 882230 7172 315 43.92Cluster #64 Arm_2R 2149723 2153997 4274 140 32.76Cluster #65 Arm_2R 2160681 2173100 12419 368 29.63Cluster #66 Arm_2R 2177210 2182386 5176 131 25.31Cluster #67 Arm_2R 2200217 2204519 4302 244 56.72Cluster #68 Arm_2R 2207305 2212630 5325 150 28.17Cluster #69 Arm_2R 2260568 2278714 18146 332 18.3Cluster #70 Arm_2R 2317782 2337210 19428 305 15.7Cluster #71 Arm_2R 2338240 2348301 10061 542 53.87Cluster #72 Arm_2R 2382233 2386534 4301 186 43.25Cluster #73 Arm_2R 3084277 3088578 4301 192 44.64Cluster #74 Arm_2R 3756900 3761209 4309 113 26.22Cluster #75 Arm_2R 4286004 4290319 4315 133 30.82

Supplementary Table 1. (2/10 pages)



Cluster #76 Arm_2R 4378175 4379740 1565 119 76.04Cluster #77 Arm_2R 8389257 8391258 2001 136 67.97Cluster #78 Arm_2R 9024560 9028868 4308 115 26.69Cluster #79 Arm_2R 10281943 10286254 4311 118 27.37Cluster #80 Arm_2R 10776929 10783743 6814 226 33.17Cluster #81 Arm_2R 13373711 13378013 4302 242 56.25Cluster #82 Arm_2R 13999262 14002882 3620 195 53.87Cluster #83 Arm_2R 16627239 16631541 4302 245 56.95Cluster #84 Arm_2R 16671001 16675302 4301 196 45.57Cluster #85 Arm_3L 0 19748 19748 1038 52.56Cluster #86 Arm_3L 1425040 1429769 4729 221 46.73Cluster #87 Arm_3L 2751573 2755549 3976 216 54.33Cluster #88 Arm_3L 4452065 4456458 4393 154 35.06Cluster #89 Arm_3L 5045741 5050056 4315 135 31.29Cluster #90 Arm_3L 5104576 5115041 10465 116 11.08Cluster #91 Arm_3L 5452759 5459575 6816 243 35.65Cluster #92 Arm_3L 6849310 6853625 4315 133 30.82Cluster #93 Arm_3L 7492153 7496455 4302 241 56.02Cluster #94 Arm_3L 8226932 8231661 4729 207 43.77Cluster #95 Arm_3L 11716480 11720795 4315 138 31.98Cluster #96 Arm_3L 12912488 12917690 5202 325 62.48Cluster #97 Arm_3L 13567902 13573103 5201 351 67.49Cluster #98 Arm_3L 14260556 14264730 4174 238 57.02Cluster #99 Arm_3L 14305419 14309814 4395 154 35.04Cluster #100 Arm_3L 14517710 14522012 4302 241 56.02Cluster #101 Arm_3L 14714484 14716050 1566 120 76.63Cluster #102 Arm_3L 16177501 16181896 4395 150 34.13Cluster #103 Arm_3L 17857165 17861480 4315 138 31.98Cluster #104 Arm_3L 18499293 18502521 3228 172 53.28Cluster #105 Arm_3L 19392195 19396496 4301 194 45.11Cluster #106 Arm_3L 19701776 19706084 4308 110 25.53Cluster #107 Arm_3L 19733192 19737500 4308 110 25.53Cluster #108 Arm_3L 19764606 19768914 4308 118 27.39Cluster #109 Arm_3L 21742775 21747473 4698 140 29.8Cluster #110 Arm_3L 22571004 22575319 4315 128 29.66Cluster #111 Arm_3L 23106010 23110959 4949 419 84.66Cluster #112 Arm_3L 23283637 23288162 4525 151 33.37Cluster #113 Arm_3L 23293227 23300521 7294 166 22.76Cluster #114 Arm_3L 23347887 23352341 4454 156 35.02




Cluster #115 Arm_3L 23353691 23362499 8808 214 24.3Cluster #116 Arm_3L 23453386 23458672 5286 153 28.94Cluster #117 Arm_3L 23508154 23514732 6578 110 16.72Cluster #118 Arm_3L 23613764 23618300 4536 124 27.34Cluster #119 Arm_3L 23753189 23757505 4316 134 31.05Cluster #120 Arm_3L 23973071 23977187 4116 197 47.86Cluster #121 Arm_3L 23984448 23988750 4302 225 52.3Cluster #122 Arm_3L 24014495 24020302 5807 252 43.4Cluster #123 Arm_3L 24089215 24100255 11040 254 23.01Cluster #124 Arm_3L 24125776 24130920 5144 211 41.02Cluster #125 Arm_3L 24362452 24366809 4357 117 26.85Cluster #126 Arm_3L 24414822 24417695 2873 165 57.43Cluster #127 Arm_3L 24476487 24479364 2877 142 49.36Cluster #128 Arm_3R 579252 583092 3840 209 54.43Cluster #129 Arm_3R 1164250 1169210 4960 320 64.52Cluster #130 Arm_3R 2242539 2244684 2145 148 69Cluster #131 Arm_3R 3384516 3388831 4315 138 31.98Cluster #132 Arm_3R 3927690 3930506 2816 114 40.48Cluster #133 Arm_3R 5104778 5109507 4729 208 43.98Cluster #134 Arm_3R 6783699 6788901 5202 352 67.67Cluster #135 Arm_3R 8294247 8299602 5355 101 18.86Cluster #136 Arm_3R 9140027 9144344 4317 112 25.94Cluster #137 Arm_3R 9804517 9806548 2031 137 67.45Cluster #138 Arm_3R 10006811 10011113 4302 246 57.18Cluster #139 Arm_3R 10988474 10992775 4301 198 46.04Cluster #140 Arm_3R 11561122 11565423 4301 199 46.27Cluster #141 Arm_3R 14432452 14436426 3974 173 43.53Cluster #142 Arm_3R 15018804 15022832 4028 219 54.37Cluster #143 Arm_3R 15570232 15574961 4729 226 47.79Cluster #144 Arm_3R 16071200 16074544 3344 145 43.36Cluster #145 Arm_3R 16680498 16684813 4315 138 31.98Cluster #146 Arm_3R 18707209 18710414 3205 100 31.2Cluster #147 Arm_3R 20753140 20757455 4315 133 30.82Cluster #148 Arm_3R 21150294 21154611 4317 101 23.4Cluster #149 Arm_3R 23617459 23620427 2968 241 81.2Cluster #150 Arm_3R 27517527 27521842 4315 138 31.98Cluster #151 Arm_4 612315 616615 4300 347 80.7Cluster #152 Arm_XHet 175890 179042 3152 119 37.75Cluster #153 Arm_XHet 196280 198884 2604 225 86.41




Cluster #154 Arm_2LHet 40656 43963 3307 103 31.15Cluster #155 Arm_2LHet 144667 148975 4308 117 27.16Cluster #156 Arm_2LHet 208909 213211 4302 192 44.63Cluster #157 Arm_2LHet 322192 328333 6141 136 22.15Cluster #158 Arm_2LHet 351464 356392 4928 122 24.76Cluster #159 Arm_2LHet 361583 365812 4229 151 35.71Cluster #160 Arm_2RHet 0 6468 6468 216 33.4Cluster #161 Arm_2RHet 109558 114444 4886 111 22.72Cluster #162 Arm_2RHet 144371 148066 3695 157 42.49Cluster #163 Arm_2RHet 209348 213663 4315 137 31.75Cluster #164 Arm_2RHet 224462 228426 3964 147 37.08Cluster #165 Arm_2RHet 380984 387446 6462 119 18.42Cluster #166 Arm_2RHet 540727 543942 3215 102 31.73Cluster #167 Arm_2RHet 649625 654861 5236 222 42.4Cluster #168 Arm_2RHet 840779 845087 4308 109 25.3Cluster #169 Arm_2RHet 871398 881025 9627 307 31.89Cluster #170 Arm_2RHet 890944 899512 8568 210 24.51Cluster #171 Arm_2RHet 901967 908340 6373 172 26.99Cluster #172 Arm_2RHet 1091489 1095415 3926 133 33.88Cluster #173 Arm_2RHet 1600456 1604734 4278 227 53.06Cluster #174 Arm_2RHet 1633841 1637657 3816 151 39.57Cluster #175 Arm_2RHet 1684311 1688983 4672 159 34.03Cluster #176 Arm_2RHet 1806262 1810655 4393 151 34.37Cluster #177 Arm_2RHet 1816340 1819579 3239 114 35.2Cluster #178 Arm_2RHet 2047897 2052793 4896 127 25.94Cluster #179 Arm_2RHet 2146249 2151128 4879 106 21.73Cluster #180 Arm_2RHet 2276585 2284230 7645 120 15.7Cluster #181 Arm_2RHet 2319066 2321395 2329 136 58.39Cluster #182 Arm_2RHet 2335630 2340911 5281 187 35.41Cluster #183 Arm_2RHet 2416349 2420352 4003 142 35.47Cluster #184 Arm_2RHet 2789688 2794461 4773 103 21.58Cluster #185 Arm_2RHet 2803128 2807436 4308 114 26.46Cluster #186 Arm_2RHet 3087181 3092074 4893 201 41.08Cluster #187 Arm_2RHet 3107784 3111737 3953 127 32.13Cluster #188 Arm_2RHet 3219946 3224249 4303 199 46.25Cluster #189 Arm_3LHet 172470 178013 5543 156 28.14Cluster #190 Arm_3LHet 260310 265584 5274 191 36.22Cluster #191 Arm_3LHet 275509 280130 4621 134 29Cluster #192 Arm_3LHet 305063 311249 6186 208 33.62




Cluster #193 Arm_3LHet 314442 317538 3096 133 42.96Cluster #194 Arm_3LHet 497580 505187 7607 267 35.1Cluster #195 Arm_3LHet 535245 542162 6917 260 37.59Cluster #196 Arm_3LHet 586464 590755 4291 134 31.23Cluster #197 Arm_3LHet 615227 620158 4931 356 72.2Cluster #198 Arm_3LHet 641455 645580 4125 193 46.79Cluster #199 Arm_3LHet 662691 666553 3862 143 37.03Cluster #200 Arm_3LHet 798197 802421 4224 203 48.06Cluster #201 Arm_3LHet 812490 816300 3810 132 34.65Cluster #202 Arm_3LHet 845456 851919 6463 112 17.33Cluster #203 Arm_3LHet 860300 866480 6180 103 16.67Cluster #204 Arm_3LHet 878076 882391 4315 133 30.82Cluster #205 Arm_3LHet 951301 955931 4630 221 47.73Cluster #206 Arm_3LHet 994119 1001725 7606 175 23.01Cluster #207 Arm_3LHet 1011493 1015794 4301 246 57.2Cluster #208 Arm_3LHet 1020726 1024740 4014 229 57.05Cluster #209 Arm_3LHet 1041214 1045454 4240 182 42.92Cluster #210 Arm_3LHet 1168151 1172452 4301 197 45.8Cluster #211 Arm_3LHet 1445562 1452231 6669 262 39.29Cluster #212 Arm_3LHet 1482497 1489583 7086 256 36.13Cluster #213 Arm_3LHet 1506991 1511290 4299 173 40.24Cluster #214 Arm_3LHet 1513920 1517803 3883 130 33.48Cluster #215 Arm_3LHet 1523195 1526753 3558 137 38.5Cluster #216 Arm_3LHet 1762997 1767274 4277 152 35.54Cluster #217 Arm_3LHet 1768500 1772400 3900 121 31.03Cluster #218 Arm_3LHet 1876190 1888019 11829 704 59.51Cluster #219 Arm_3LHet 2057304 2063250 5946 129 21.7Cluster #220 Arm_3LHet 2068084 2072479 4395 146 33.22Cluster #221 Arm_3LHet 2093044 2096668 3624 142 39.18Cluster #222 Arm_3LHet 2289730 2293505 3775 154 40.79Cluster #223 Arm_3RHet 46463 51068 4605 246 53.42Cluster #224 Arm_3RHet 72343 76879 4536 130 28.66Cluster #225 Arm_3RHet 127482 132247 4765 121 25.39Cluster #226 Arm_3RHet 648143 651984 3841 109 28.38Cluster #227 Arm_3RHet 768140 772455 4315 132 30.59Cluster #228 Arm_3RHet 805746 810341 4595 169 36.78Cluster #229 Arm_3RHet 853992 858704 4712 201 42.66Cluster #230 Arm_3RHet 1050038 1055313 5275 144 27.3Cluster #231 Arm_3RHet 1056015 1060967 4952 146 29.48




Cluster #232 Arm_3RHet 1196215 1200517 4302 246 57.18Cluster #233 Arm_3RHet 1210574 1214059 3485 112 32.14Cluster #234 Arm_3RHet 1416812 1422069 5257 111 21.11Cluster #235 Arm_3RHet 1430747 1436181 5434 111 20.43Cluster #236 Arm_3RHet 1492495 1497031 4536 116 25.57Cluster #237 Arm_3RHet 1585991 1588236 2245 158 70.38Cluster #238 Arm_3RHet 1720625 1724941 4316 134 31.05Cluster #239 Arm_3RHet 1749438 1753740 4302 199 46.26Cluster #240 Arm_3RHet 1779141 1783730 4589 175 38.13Cluster #241 Arm_3RHet 1787291 1792208 4917 223 45.35Cluster #242 Arm_3RHet 1848051 1852354 4303 107 24.87Cluster #243 Arm_3RHet 2076611 2081130 4519 105 23.24Cluster #244 Arm_3RHet 2087962 2091286 3324 132 39.71Cluster #245 Arm_3RHet 2312682 2317754 5072 222 43.77Cluster #246 Arm_3RHet 2368245 2371899 3654 111 30.38Cluster #247 ArmU 47176 50134 2958 148 50.03Cluster #248 ArmU 90945 99671 8726 294 33.69Cluster #249 ArmU 106660 113478 6818 224 32.85Cluster #250 ArmU 182492 187794 5302 181 34.14Cluster #251 ArmU 286179 293811 7632 169 22.14Cluster #252 ArmU 298458 304219 5761 207 35.93Cluster #253 ArmU 477929 480404 2475 141 56.97Cluster #254 ArmU 662024 666635 4611 346 75.04Cluster #255 ArmU 819753 825985 6232 191 30.65Cluster #256 ArmU 863466 868513 5047 110 21.8Cluster #257 ArmU 934489 938888 4399 161 36.6Cluster #258 ArmU 947167 950519 3352 127 37.89Cluster #259 ArmU 1041873 1044051 2178 112 51.42Cluster #260 ArmU 1150821 1156339 5518 205 37.15Cluster #261 ArmU 1265675 1275339 9664 294 30.42Cluster #262 ArmU 1383515 1392700 9185 321 34.95Cluster #263 ArmU 1408463 1412978 4515 177 39.2Cluster #264 ArmU 1414504 1420482 5978 205 34.29Cluster #265 ArmU 1571778 1581483 9705 144 14.84Cluster #266 ArmU 1646281 1650511 4230 139 32.86Cluster #267 ArmU 1757955 1762348 4393 151 34.37Cluster #268 ArmU 1768033 1771272 3239 114 35.2Cluster #269 ArmU 1925396 1928765 3369 101 29.98Cluster #270 ArmU 2059750 2063910 4160 121 29.09




Cluster #271 ArmU 2075105 2080332 5227 122 23.34Cluster #272 ArmU 2171987 2174215 2228 107 48.03Cluster #273 ArmU 2185688 2189961 4273 100 23.4Cluster #274 ArmU 2245357 2247679 2322 107 46.08Cluster #275 ArmU 3002186 3006140 3954 273 69.04Cluster #276 ArmU 3089093 3091260 2167 115 53.07Cluster #277 ArmU 3099711 3103534 3823 163 42.64Cluster #278 ArmU 3107669 3110867 3198 252 78.8Cluster #279 ArmU 3645321 3647985 2664 199 74.7Cluster #280 ArmU 3759856 3764895 5039 158 31.36Cluster #281 ArmU 3891413 3895232 3819 107 28.02Cluster #282 ArmU 4195557 4198415 2858 170 59.48Cluster #283 ArmU 4238138 4241995 3857 248 64.3Cluster #284 ArmU 4248178 4251428 3250 176 54.15Cluster #285 ArmU 4434881 4436508 1627 133 81.75Cluster #286 ArmU 4457690 4460549 2859 128 44.77Cluster #287 ArmU 4560048 4562000 1952 101 51.74Cluster #288 ArmU 5447474 5456766 9292 667 71.78Cluster #289 ArmU 5514729 5521247 6518 376 57.69Cluster #290 ArmU 5715164 5720962 5798 413 71.23Cluster #291 ArmU 5743515 5749785 6270 370 59.01Cluster #292 ArmU 5788957 5794105 5148 146 28.36Cluster #293 ArmU 5821453 5827307 5854 107 18.28Cluster #294 ArmU 5852665 5857649 4984 348 69.82Cluster #295 ArmU 6019385 6023004 3619 265 73.22Cluster #296 ArmU 6033275 6037390 4115 108 26.25Cluster #297 ArmU 6055766 6060080 4314 285 66.06Cluster #298 ArmU 6199847 6203381 3534 108 30.56Cluster #299 ArmU 6203996 6208030 4034 274 67.92Cluster #300 ArmU 6216517 6221344 4827 206 42.68Cluster #301 ArmU 6233112 6241490 8378 574 68.51Cluster #302 ArmU 6253801 6258132 4331 234 54.03Cluster #303 ArmU 6286274 6289901 3627 217 59.83Cluster #304 ArmU 6357500 6362618 5118 300 58.62Cluster #305 ArmU 6369075 6372775 3700 322 87.03Cluster #306 ArmU 6377247 6387002 9755 241 24.71Cluster #307 ArmU 6444741 6448249 3508 203 57.87Cluster #308 ArmU 6488389 6492213 3824 220 57.53Cluster #309 ArmU 6506939 6510402 3463 241 69.59




Cluster #310 ArmU 6527701 6539210 11509 392 34.06Cluster #311 ArmU 6542968 6549922 6954 507 72.91Cluster #312 ArmU 6605957 6609429 3472 197 56.74Cluster #313 ArmU 6613197 6616504 3307 215 65.01Cluster #314 ArmU 6644025 6647818 3793 223 58.79Cluster #315 ArmU 6655012 6657394 2382 153 64.23Cluster #316 ArmU 6746681 6751096 4415 277 62.74Cluster #317 ArmU 6805803 6809324 3521 268 76.11Cluster #318 ArmU 6825679 6827903 2224 171 76.89Cluster #319 ArmU 6834447 6842130 7683 451 58.7Cluster #320 ArmU 6908990 6914950 5960 365 61.24Cluster #321 ArmU 6954500 6957256 2756 235 85.27Cluster #322 ArmU 6993579 7001858 8279 107 12.92Cluster #323 ArmU 7028837 7037491 8654 374 43.22Cluster #324 ArmU 7046519 7048791 2272 166 73.06Cluster #325 ArmU 7049436 7055061 5625 266 47.29Cluster #326 ArmU 7062226 7067689 5463 108 19.77Cluster #327 ArmU 7075798 7077422 1624 110 67.73Cluster #328 ArmU 7084520 7089244 4724 208 44.03Cluster #329 ArmU 7184451 7187671 3220 118 36.65Cluster #330 ArmU 7209966 7212565 2599 127 48.86Cluster #331 ArmU 7254004 7256520 2516 168 66.77Cluster #332 ArmU 7366886 7369236 2350 170 72.34Cluster #333 ArmU 7426433 7431483 5050 232 45.94Cluster #334 ArmU 7500406 7502759 2353 159 67.57Cluster #335 ArmU 7515429 7519367 3938 103 26.16Cluster #336 ArmU 7555140 7558345 3205 125 39Cluster #337 ArmU 7562548 7567302 4754 162 34.08Cluster #338 ArmU 7570922 7574627 3705 157 42.38Cluster #339 ArmU 7577313 7582882 5569 323 58Cluster #340 ArmU 7616434 7623397 6963 318 45.67Cluster #341 ArmU 7647604 7661625 14021 355 25.32Cluster #342 ArmU 7706480 7708649 2169 207 95.44Cluster #343 ArmU 7786600 7788645 2045 134 65.53Cluster #344 ArmU 8095601 8099025 3424 124 36.21Cluster #345 ArmU 8355389 8358964 3575 126 35.24Cluster #346 ArmU 8384941 8386857 1916 128 66.81Cluster #347 ArmU 8413255 8416420 3165 118 37.28Cluster #348 ArmU 8601937 8605164 3227 166 51.44




Cluster #349 ArmU 8764205 8769475 5270 207 39.28Cluster #350 ArmU 8778211 8781555 3344 129 38.58Cluster #351 ArmU 8833486 8834651 1165 105 90.13Cluster #352 ArmU 8844540 8845769 1229 112 91.13Cluster #353 ArmU 9041203 9044340 3137 120 38.25Cluster #354 ArmU 9058060 9062741 4681 182 38.88Cluster #355 ArmU 9107903 9110366 2463 123 49.94Cluster #356 ArmU 9167396 9169808 2412 110 45.61Cluster #357 ArmU 9179106 9181339 2233 100 44.78Cluster #358 ArmU 9184099 9186497 2398 208 86.74Cluster #359 ArmU 9212243 9214651 2408 128 53.16Cluster #360 ArmU 9221221 9224103 2882 108 37.47Cluster #361 ArmU 9284419 9286686 2267 115 50.73Cluster #362 ArmU 9314572 9315670 1098 109 99.27Cluster #363 ArmU 9457064 9460496 3432 112 32.63Cluster #364 ArmU 9517915 9520176 2261 133 58.82Cluster #365 ArmU 9575700 9580485 4785 221 46.19Cluster #366 ArmU 9639847 9642354 2507 104 41.48Cluster #367 ArmU 9705686 9708267 2581 161 62.38Cluster #368 ArmU 9787155 9791072 3917 169 43.15Cluster #369 ArmU 10014929 10016319 1390 110 79.14




Supplementary Table 2. Examples of piRNAs contigs

Chromosome Strand Start End Genomic sequence and overlapping piRNAs

arm Coordinate Coordinate

X + 21633451 21633583 TGCTTCTCCCAGCGTTGGCTGGTCCCTCTGTACCTCGGGTTGCGCCTCGGTCAATTGTGGCTCGTCTGCCATCAATTGCCGCTTGTGTCTGTGTGTTTTGTGTGTTTTTGTGCGTTTGGTGCTTGCTGATCGT21633451 21633477 TGCTTCTCCCAGCGTTGGCTGGTCCCT----------------------------------------------------------------------------------------------------------21633465 21633489 --------------TTGGCTGGTCCCTCTGTACCTCGGG----------------------------------------------------------------------------------------------21633466 21633493 ---------------TGGCTGGTCCCTCTGTACCTCGGGTTGC------------------------------------------------------------------------------------------21633467 21633488 ----------------GGCTGGTCCCTCTGTACCTCGG-----------------------------------------------------------------------------------------------21633470 21633496 -------------------TGGTCCCTCTGTACCTCGGGTTGCGCC---------------------------------------------------------------------------------------21633473 21633496 ----------------------TCCCTCTGTACCTCGGGTTGCGCC---------------------------------------------------------------------------------------21633477 21633501 --------------------------TCTGTACCTCGGGTTGCGCCTCGGT----------------------------------------------------------------------------------21633479 21633500 ----------------------------TGTACCTCGGGTTGCGCCTCGG-----------------------------------------------------------------------------------21633481 21633508 ------------------------------TACCTCGGGTTGCGCCTCGGTCAATTGT---------------------------------------------------------------------------21633497 21633518 ----------------------------------------------TCGGTCAATTGTGGCTCGTCTG-----------------------------------------------------------------21633506 21633532 -------------------------------------------------------TGTGGCTCGTCTGCCATCAATTGCCGC---------------------------------------------------21633515 21633541 ----------------------------------------------------------------TCTGCCATCAATTGCCGCTTGTGTCTG------------------------------------------21633520 21633548 ---------------------------------------------------------------------CATCAATTGCCGCTTGTGTCTGTGTGTTT-----------------------------------21633544 21633568 ---------------------------------------------------------------------------------------------TGTTTTGTGTGTTTTTGTGCGTTTG---------------21633551 21633576 ----------------------------------------------------------------------------------------------------TGTGTTTTTGTGCGTTTGGTGCTTGC-------

21633559 21633583 ------------------------------------------------------------------------------------------------------------TGTGCGTTTGGTGCTTGCTGATCGT

Chromosome Strand Start End Genomic sequence and overlapping piRNAs

arm Coordinate Coordinate

2R + 2343894 2344065 TCACCTAATAGCCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGTAGCACCGAACGAG2343894 2343919 TCACCTAATAGCCACTCGTGTGCCTC--------------------------------------------------------------------------------------------------------------------------------------------------2343899 2343924 -----TAATAGCCACTCGTGTGCCTCTTGCC---------------------------------------------------------------------------------------------------------------------------------------------2343902 2343927 --------TAGCCACTCGTGTGCCTCTTGCCTGG------------------------------------------------------------------------------------------------------------------------------------------2343914 2343936 --------------------TGCCTCTTGCCTGGAAGCGCCAC---------------------------------------------------------------------------------------------------------------------------------2343920 2343942 --------------------------TTGCCTGGAAGCGCCACTCCGCA---------------------------------------------------------------------------------------------------------------------------2343937 2343962 -------------------------------------------TCCGCATAAGGCTGAGAGCCTTGATC-------------------------------------------------------------------------------------------------------2343958 2343983 ----------------------------------------------------------------TGATCTCCAGATCAATCGGCAGGCCT----------------------------------------------------------------------------------2343981 2344008 ---------------------------------------------------------------------------------------CCTGCCAGCGCTAGCGCCGCGTCTTCGG---------------------------------------------------------2343992 2344016 --------------------------------------------------------------------------------------------------TAGCGCCGCGTCTTCGGATATGGTC-------------------------------------------------2343993 2344018 ---------------------------------------------------------------------------------------------------AGCGCCGCGTCTTCGGATATGGTCCT-----------------------------------------------2343996 2344021 ------------------------------------------------------------------------------------------------------GCCGCGTCTTCGGATATGGTCCTGAA--------------------------------------------2343997 2344024 -------------------------------------------------------------------------------------------------------CCGCGTCTTCGGATATGGTCCTGAATCC-----------------------------------------2344015 2344043 -------------------------------------------------------------------------------------------------------------------------TCCTGAATCCTCTAATGAGCCTGAGGGCC----------------------

2344043 2344065 -----------------------------------------------------------------------------------------------------------------------------------------------------CATTGACCGTAGCACCGAACGAG

Chromosome Strand Start End Genomic sequence and overlapping piRNAs Number of piRNA Number of Average length

arm Coordinate Coordinate in contig contigs of contigs (nt)

3R - 5130925 5131032 GGCTGGTCCCTCTGTACCTCGGGTTGCGCCTCGGTCAATTGTGGCTCGTCTGCCATCAATTGCCGCTTGTGTCTGTGTGTTTTTGTGCGTTTGGTGCTTGCTGATCGT 2 15527 31.45130925 5130949 -----------------------------------------------------------------------------------TGTGCGTTTGGTGCTTGCTGATCGT 3 6291 37.45130932 5130957 ---------------------------------------------------------------------------TGTGTTTTTGTGCGTTTGGTGCTTGC------- 4 3650 44.25130951 5130979 -----------------------------------------------------CATCAATTGCCGCTTGTGTCTGTGTGTTT-------------------------- 5 1913 45.85130958 5130979 -----------------------------------------------------CATCAATTGCCGCTTGTGTCTG--------------------------------- 6 1205 50.65130967 5130993 ---------------------------------------TGTGGCTCGTCTGCCATCAATTGCCGC------------------------------------------ 7 903 60.45130977 5131002 ------------------------------TCGGTCAATTGTGGCTCGTCTGCCAT---------------------------------------------------- 8 577 58.25130981 5131002 ------------------------------TCGGTCAATTGTGGCTCGTCTG-------------------------------------------------------- 9 533 645130991 5131018 --------------TACCTCGGGTTGCGCCTCGGTCAATTGT------------------------------------------------------------------ 10 331 74.25130998 5131022 ----------TCTGTACCTCGGGTTGCGCCTCGGT------------------------------------------------------------------------- 11 186 63.75130999 5131020 ------------TGTACCTCGGGTTGCGCCTCGG-------------------------------------------------------------------------- 12 66 675131003 5131026 ------TCCCTCTGTACCTCGGGTTGCGCC------------------------------------------------------------------------------ 13 196 88.35131006 5131033 TGGCTGGTCCCTCTGTACCTCGGGTTGC-------------------------------------------------------------------------------- 14 126 80.65131007 5131033 TGGCTGGTCCCTCTGTACCTCGGGTTG--------------------------------------------------------------------------------- 15 52 94.95131010 5131034 TTGGCTGGTCCCTCTGTACCTCGGG----------------------------------------------------------------------------------- 16 16 87.4

5131011 5131032 GGCTGGTCCCTCTGTACCTCGG-------------------------------------------------------------------------------------- 17 107 102

18 3 8919 5 98.820 8 11621 2 12922 0 N/A23 6 11624 2 12925 0 N/A26 0 N/A27 0 N/A

28 1 146



Nature06263 Supplementary Info

Documents

Transcript of Nature06263 Supplementary Info