Nature Medicine: doi:10.1038/nm · Amer2 8.90 9.04E04 Gzmf 4.95 1.19E02 Sprr2h 8.83 1.40E03...

Nature Medicine: doi:10.1038/nm.4123

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1:

(a) Representative IHC images depicting the specificity of monoclonal p-FAK1 (Tyr397) antibody (Thermo

Fisher, clone # 31H5L17). (b) Representative IHC images of different expression levels of p-FAK1 in human

PDAC; scale bar, 400 µm. (c) Representative 10× IHC images of low and high expression levels of CD8α in

human PDAC. (d) Kaplan-Meier survival analysis of PDAC patients stratified by both mean p-FAK1 and

CD8α+ CTL values. p-FAK1highCD8αlow group displayed vs. p-FAK1highCD8αhigh, p-FAK1lowCD8αlow and p-

FAK1lowCD8αhigh groups. (e) Quantification of collagen levels by collagen type IV and collagen type III

staining on human PDAC tumor tissues subdivided into p-FAK1 high or low by mean p-FAK1 expression (n =

50). Analysis shows mean collagen pixel intensity/tumor core. (f) Representative IHC images of total PYK2

and phosphorylated PYK2 (p-PYK2) in human adjacent normal pancreatic tissue and PDAC. (g) Representative

10× IHC images of total PYK2 and p-PYK2 in normal pancreatic tissue, early PANIN, and PDAC tumor from

KPC mice. Scale bars for f and g, 400 µm.


(a) Representative western blot for p-FAK1, total FAK1 and β-actin (loading control) in HPNE cells transiently

transfected with empty vector and vector carrying KrasG12V using either Lipofectamine (Lipo) or Fugene 6. (b)

Representative western blot for Kras, p-FAK1 and total FAK1 in KP cells transiently expressing shRNA

targeting Kras (shKras #1, #4) for 48 h. (c) Immunofluorescence analysis of p-FAK1 in KP cells cultured on

collagen I gel. KP cells were transiently infected with lentivirus expressing shLuc or shKras for 48 hours and

subsequently cultured on 1 mg/mL collagen I gel for 24 h. (d) Representative western blot for p-FAK1 and total

FAK1 in KP cells cultured on collagen I and basement membrane extract (BME) gels. Tumor cells were treated

with vehicle or 1 µM FAKi (VS-4718) for 24 h. (e) Immunofluorescence analysis of p-FAK1 in KP cells

cultured on collagen I gels of different concentrations. (f) Immunofluorescence analysis of p-FAK1 in KP cells

transiently expressing shLuc or shKras for 48 hours and subsequently cultured on 1 mg/mL or 3 mg/mL

collagen I gels for 24 h. (g) Representative immunofluorescence image of CD8α+ CTL and Pan-Keratin (PAN-

K) in PDAC tissue from KPC mice; scale bar, 200 µm. All graphs depict mean ± s.e.m., * indicates P < 0.05 by

Student’s t-test. All in vitro assays are representative of 3 independent and agreeing replicate experiments.


(a) Molecular structure diagram of FAK1/2 inhibitor (VS-4718/ PND-1186) and FAK1 inhibitor (VS-116). (b)

Tumor burden in mice bearing established (> 0.5 cm) orthotopic KP tumors treated with vehicle or FAKi for 12

days. Burden is displayed as mean tumor weight (in grams) normalized to the weight of normal pancreas (n = 8-

9/group). (c) Representative micrographs and quantification for Sirius red (left panel) and FAP staining (right


panel) in tumor tissues of KPPC mice treated with vehicle and FAKi for 10 days; scale bars, 400 µm (n = 6-9

/group). (d) Representative IHC image of α−SMA+ stroma in PDAC tumor from vehicle- and FAKi-treated

KPC mice; scale bar, 400 µm. (e) Quantification of FAP+ area in KP tumor tissues from vehicle- and FAKi-

treated mice. (f) Representative IHC image of stromal Ki67+ cells from vehicle- and FAKi-treated KPPC mice;

scale bar, 200 µm. Adjacent histograms quantify Ki67+ cells in stroma and tumor (n = 8-11 mice/group). (g)

Analysis of tumor grade/stage from KPC mice with 1.5-month treatment (“Rx”) of vehicle or FAKi. (h)

Analysis of tumor grade/stage from vehicle- and FAKi-treated KPPC mice. All graphs depict mean ± s.e.m., *

indicates P < 0.05 by Student’s t-test.


(a) Representative flow cytometry gating strategies for Myeloid cell, cytotoxic T lymphocyte (CTL) and

regulatory T cell (Treg)/ effector T cell (Teff) panel. (b) Flow cytometric analyses of monocytes, granulocytes,

total TAMs, CD206Hi MHCIILow TAMs and CD8α+ T cells in PDAC tissue from mice bearing orthotopic KP

tumors treated for 15 days with vehicle or FAKi (n = 5-6 mice/group). All graphs depict mean ± s.e.m., *

indicates P < 0.05 by Student’s t-test or Mann Whitney U-test.


(a) Flow cytometric analysis of bone marrow macrophages, inflammatory monocytes, resident macrophages,

pre-neutrophils, granulocytic-myeloid derived suppressor cells (G-MDSCs) and myeloid and dendritic

progenitor (MDP) from bone marrow of KP tumor-bearing mice treated for 7 days with vehicle or FAKi (n = 7

mice/group). (b) Flow cytometric analysis of common DC progenitors (CDPs), BATF3 Pre-DCs, BATF3 DCs,

SIRPα Pre-DCs and SIRPα DCs from bone marrow of KP tumor-bearing mice treated for 7 days with vehicle

or FAKi (n = 7 mice/group). (c) Flow cytometric analysis of peripheral blood granulocytes and inflammatory

monocytes from KP tumor-bearing mice treated for 7 days with vehicle or FAKi (n = 7 mice/group). All graphs

depict mean ± s.e.m.


(a) Representative western blot (left) for total FAK1 protein expression in both KP and KC cells stably

expressing shLuc or shFAK1 constructs and MTT proliferation assay (right) using KP cells stably expressing

shLuc or shFAK1 constructs (shFAK#1,4,5), treated with DMSO or FAK1/PYK2 dual inhibitor VS-4718

(“FAK1/2i”). (b) Representative western blot for total FAK1 and total FAK2/PYK2 protein expression in KC

cells stably expressing shLuc or shFAK1 constructs. (c) In vivo subcutaneous growth curve of KP cells stably

transfected with shLuc or shFAK1. ShLuc tumor-bearing mice were treated with vehicle or FAKi from the day

tumor cells were implanted. Tumor burden was assessed by caliper measurements (n = 8 mice/group). (d)


Analysis of collagen levels in orthotopic PDAC tumors derived from KP cells expressing shLuc or shFAK1 (n

= 5-7 mice/group). (e) Representative immunofluorescence staining for FAP (red) and Ki67 (green) in PDAC

tumor tissue derived from KP cells expressing shLuc or shFAK1; scale bar, 400 µm (inset, 50 µm). (f) ELISA

for CXCL12 protein expression in CM from KP cells stably expressing shLuc or shFAK1 constructs. (g)

Representative Flow cytometry plots of CD163 and CD206 expression on CD14+ human

monocytes/macrophages co-cultured for 3 days with human PDAC cells (HPAC, Capan-2, MIA PaCa-2,

Hs766T, SW1990) pretreated with vehicle (red) or 1 µM FAKi (blue) for 24 h. (h) Representative Flow

cytometry plots of CD163 expression on CD14+ human monocytes/macrophages treated for 3 days with CM

from human PDAC cells (Capan-1, Capan-2, MIA PaCa-2, HPAC, Hs766T, SW1990). PDAC cells were

pretreated with vehicle (red) or 1µM FAKi (blue) for 24 h prior to collection of medium. (i) Representative

Flow cytometry plots of CD206 expression in bone marrow derived macrophages (BM-MACs) either cultured

alone (left) or in KP cell co-culture (right), when treated with vehicle (red) or 1 µM FAKi (blue) for 24 h. (j)

mRNA expression analysis for CCL2, ARG1 and YM1 in BM-MACs either cultured alone or with KP cells,

following 24-hours treatment with vehicle or 1 µM FAKi. Mean fold change over vehicle treatment shown. (k)

Cell proliferation analysis of normal pancreatic fibroblasts by cell counting over 7 days. Low passage normal

pancreas fibroblasts from C57BL/6 mice were treated with DMSO, 1µM FAKi, or CM from KP cells treated

with DMSO and 1 µM FAKi. (l) Assessment of normal pancreatic fibroblast proliferation by

immunofluorescence staining of Ki67 following treatment with CM from KP cells expressing shLuc or shFAK1

as well as DMSO or FAKi. (m) Representative western blots for p-FAK1, total FAK1 and β-actin (loading

control) in flow-sorted cancer-associated fibroblasts (CAFs) from KPPC mice following treatment with 100 nM

siRNAs targeting FAK1 for 48 hours. (n) MTT proliferation assay using flow-sorted CAFs from KPPC mice

following treatment with 100nM siRNAs targeting FAK1 (left panel), and following treatment with DMSO, 1

µM FAK1/2i or 1 µM FAK1-specific inhibitor (right panel). All graphs depict mean ± s.e.m., * indicates P <

0.05 by one-way ANOVA with Tukey’s method for multiple comparisons. All in vitro assays are representative

of 3 independent and agreeing replicate experiments.


(a) Quantification of Sirius Red+ fibrotic area in tumors from vehicle +/- GEM75 and FAKi (VS-4718) +/-

GEM75 treated KPPC mice (n = 6-8/group). (b) Flow cytometric analysis of adoptively transferred CD45.1+

CD8α+ OT-I cells in peripheral blood from CD45.2+ KP-OVA tumor-bearing mice 3 days and 7 days after ACT.

(c) Tumor growth curve of KP tumor-bearing mice treated with vehicle, GEM25, αPD1, FAKi, GEM25 + αPD1,

GEM25 + FAKi, αPD1+ FAKi and GEM25 + αPD1 + FAKi. Arrows indicate start of treatments. (d) Tumor

growth curve of KP tumor-bearing mice treated with GEM25, GEM25 + αPD1, GEM25 + αCTLA4, GEM25 +

αPD1/αCTLA4, GEM25 + FAKi, GEM25 + αPD1+ FAKi, GEM25 + αCTLA4+ FAKi and GEM25 +


αPD1/αCTLA4 + FAKi. Arrows indicate start of treatments. (e) Tumor weight of tumors (in grams) for

orthotopic KP tumor-bearing mice treated with GEM25, GEM25 + αPD1/αCTLA4, GEM25 + FAKi, and GEM25

+ αPD1/αCTLA4 + FAKi. (f) Quantification of CD4+ FOXP3+ Treg, CD4+ FOXP3- Teff, CD8α+ CTLs, and

‘Teff / Treg’ ratio in tumors from vehicle + GEM25 + αPD-1/αCTLA4 (“Immuno”) and FAKi + GEM25 + αPD-

1/αCTLA4 (“FAKi + Immuno”) treatment groups. All graphs depict mean ±_s.e.m., * indicates P < 0.05 by

unpaired two-sided Student’s t-tests or one-way ANOVA with Tukey’s method for multiple comparisons, n.s.

indicates not significant.


Supplementary Table 1: ARRAY TOP REGULATED GENES

TOP 50 DOWN-‐REGULATED GENES TOP 50 UP-‐REGULATED GENES

GeneSymbol Fold Change (FAKi vs Veh) P.Value GeneSymbol Fold Change

(FAKi vs Veh) P.Value

Zic3 -‐25.25 5.58E-‐05 Ugt2b5 12.39 3.01E-‐02Flrt1 -‐16.86 6.83E-‐03 Alb 11.66 2.64E-‐02Bche -‐15.31 5.48E-‐04 Esx1 9.81 4.74E-‐03Zic2 -‐14.18 1.99E-‐02 Cpn1 6.72 8.38E-‐04Npr3 -‐14.17 5.99E-‐05 Lrrc2 6.64 5.94E-‐04Gjb2 -‐12.95 7.75E-‐03 1700012B09Rik 6.36 1.31E-‐02Hunk -‐12.16 5.38E-‐03 Gm30692 6.23 1.98E-‐02Dlx4 -‐12.04 1.44E-‐04 Sbk3 6.13 3.50E-‐02Hmgcll1 -‐11.64 5.89E-‐03 Ugt2b36 5.63 1.78E-‐02Fam13a -‐11.63 3.19E-‐04 Alb 5.60 1.24E-‐02Ankrd29 -‐10.95 5.13E-‐04 Grip1 5.36 4.20E-‐02Zic3 -‐10.81 2.12E-‐03 Gm9804 5.23 1.96E-‐02Lama3 -‐9.43 2.00E-‐03 9930014A18Rik 5.20 8.16E-‐03Wnt9a -‐9.04 1.53E-‐02 Scrn1 5.11 1.64E-‐02Amer2 -‐8.90 9.04E-‐04 Gzmf 4.95 1.19E-‐02Sprr2h -‐8.83 1.40E-‐03 1700012B09Rik 4.91 2.97E-‐02Gcsam -‐8.80 5.52E-‐03 Tprg 4.90 2.53E-‐04Slc2a5 -‐8.73 6.13E-‐04 Fam183b 4.85 1.68E-‐02Lrrc75b -‐8.59 6.56E-‐03 Pvt1 4.84 4.04E-‐03Kcnk1 -‐8.46 2.17E-‐03 Peg3 4.82 2.18E-‐03Cfap45 -‐8.40 5.65E-‐05 Snrpn 4.77 8.59E-‐03Pitx1 -‐8.10 2.85E-‐02 Itih4 4.68 7.36E-‐03Nefh -‐7.99 8.90E-‐03 Hal 4.68 4.96E-‐02Mfsd2a -‐7.62 3.59E-‐03 5031415H12Rik 4.64 4.16E-‐02Sprr2h -‐7.57 1.08E-‐02 Zfp735 4.49 5.30E-‐03Nudt7 -‐7.54 2.92E-‐03 Sltm 4.43 4.54E-‐02Il7 -‐7.43 6.09E-‐04 BC100530 4.41 3.76E-‐02Degs2 -‐7.34 2.46E-‐02 Fras1 4.39 2.39E-‐02Prkg2 -‐7.32 1.50E-‐03 Satb1 4.39 2.54E-‐02Zic3 -‐7.28 1.29E-‐03 LOC102640035 4.39 8.88E-‐03Marveld3 -‐7.01 1.84E-‐02 Abcg5 4.36 2.08E-‐02Dact2 -‐7.01 4.33E-‐03 Gprin1 4.24 4.42E-‐02Amy1 -‐6.80 2.55E-‐02 LOC101056219 4.11 4.10E-‐03Kirrel3 -‐6.79 6.56E-‐04 Klf12 4.09 4.44E-‐03Otop2 -‐6.79 4.86E-‐02 8030451A03Rik 4.08 8.79E-‐03Sgsm1 -‐6.75 2.06E-‐02 Peg3os 3.96 1.14E-‐02Gm3604 -‐6.71 6.66E-‐03 Ffar4 3.95 3.62E-‐03Ramp1 -‐6.64 1.37E-‐03 Ptgds 3.94 4.45E-‐03Has2 -‐6.44 1.93E-‐03 Scaf4 3.93 5.29E-‐03Ret -‐6.33 6.96E-‐04 Pvt1 3.82 2.80E-‐02Acsm3 -‐6.31 2.56E-‐02 Ncoa6 3.81 2.18E-‐02Stac -‐6.28 1.41E-‐03 1700003M07Rik 3.80 7.82E-‐04Col10a1 -‐6.27 3.95E-‐02 Grip1 3.80 1.80E-‐02Anxa10 -‐6.11 6.22E-‐03 Pla2g1b 3.75 2.36E-‐02Rai2 -‐6.02 2.36E-‐02 2310007L24Rik 3.74 1.45E-‐02Ptger3 -‐5.99 1.08E-‐02 Satb1 3.73 1.70E-‐02Hecw2 -‐5.93 5.89E-‐03 Acsl6 3.71 2.20E-‐023010001F23Rik -‐5.92 5.33E-‐03 Enpp3 3.69 2.89E-‐02Ankrd54 -‐5.91 1.91E-‐02 Nkain1 3.69 2.31E-‐02


Supplementary Table 2: Sequence of siRNAs, shRNAs targeting FAK1 and Kras

Clone Name Target Gene ID Gene Symbol Sequence

NM_007982.1-2864s1c1/shFAK #1 14083 FAK1/Ptk2 CGGTCCAATGACAAGGTATAT

NM_007982.1-1523s1c1/shFAK #2 14083 FAK1/Ptk2 GCCTTAACAATGCGTCAGTTT

NM_007982.1-804s1c1/shFAK #3 14083 FAK1/Ptk2 CCAACCTTAATAGAGAAGAAA

NM_007982.1-212s1c1/shFAK #4 14083 FAK1/Ptk2 CGAGTATTAAAGGTCTTTCAT

NM_007982.1-1666s1c1/shFAK #5 14083 FAK1/Ptk2 CCTGGCATCTTTGATATTATA

NM_021284.2-234s1c1/shKras #1 16653 Kras GCCTTGACGATACAGCTAATT

NM_021284.2-650s1c1/shKras #2 16653 Kras CTATACATTAGTCCGAGAAAT

NM_021284.2-298s1c1/shKras #3 16653 Kras CCTACAGGAAACAAGTAGTAA

NM_021284.2-571s1c1/shKras #4 16653 Kras CTCAGGAGTTAGCAAGGAGTT

NM_021284.2-689s1c1/shKras #5 16653 Kras GATGAGCAAAGATGGGAAGAA

shLuc Control Luciferase GTTGTGTTTGTGGACGAAGTA

siFAK #1 14083 FAK1/Ptk2

GCAAUGGAACGAGUAUUAAAGG

UCT

siFAK #2 14083 FAK1/Ptk2

AGAAAUAGCUGAUCAAGUAGACC

AA

siNC

DS NC1 universal

negative control

(IDT). N/A N/A


Supplementary Table 3: Antibody list for flow cytometryName Host Clone# Company DilutionCD45 Rat 30-‐F11 eBioscience 1/400CD3e Armenian Hamster 145-‐2C11 eBioscience 1/200CD4 Rat GK1.5 eBioscience 1/200CD8α Rat 53-‐6.7 eBioscience 1/400FoxP3 Rat FJK-‐16s eBioscience 1/25CD19 Mouse MB19-‐1 eBioscience 1/200CD11b Rat M1/70 eBioscience 1/400CD11c Armenian Hamster N418 eBioscience 1/100Ly6C Rat HK1.4 eBioscience 1/400Ly6G Rat 1A8 BioLegend 1/400F4/80 Rat BM8 eBioscience 1/400CD206 Rat C068C2 BioLegend 1/200MHCII Rat M5/114.15.2 eBioscience 1/800RelMα Rabbit N/A PeproTech 1/50CD24 Rat M1/69 eBioscience 1/200CD44 Rat IM7 eBioscience 1/400

CD16/CD32 Rat 93 eBioscience 1/200anti-‐Human CD163 Mouse GHI/61 eBioscience 1/20anti-‐Human CD14 Mouse 61D3 eBioscience 1/20anti-‐Human CD206 Mouse 19.2 eBioscience 1/20

Human Trustain FcXTM Human N/A BioLegend 1/100Pan-‐Keratin-‐488 conjugate Mouse C11 Cell Signaling 1/200

CD140α (PDGFRα) Rat APA5 eBioscience 1/50Ki67 Rat SolA15 Ebioscience 1/200

SA-‐605 N/A N/A eBioscience 1/200CD45R/B220 Rat RA3-‐6B2 Biolegend 1/100CD117 (c-‐Kit) Rat 2B8 Biolegend 1/200

CD135 Rat A2F10.1 BD 1/20CD172alpha (Sirpalpha) Rat P84 Biolegend 1/100

CD115 (CSF-‐1R) Rat AFS98 Biolegend 1/200CD19 Rat eBio1D3 eBioscience 1/200

CD115 (c-‐fms) Rat AFS98 eBioscience 1/50CD45.1 Rat A20 eBioscience 1/400


Supplementary Table 4: Antibody list for IHC, IF & WBName Host Clone# Company Dilution

p-FAK (Y397) Rabbit 31H5L17 (monoclonal) Thermo Fisher 1:500 (IHC,IF,WB)FAK Rabbit N/A (Polyclonal) Cell Signaling 1:500 (IHC,IF,WB)p-PYK2 (Y402) Rabbit N/A (Polyclonal) Abcam 1:500 (IHC,IF,WB)PYK2 Rabbit N/A (Polyclonal) Millipore 1:500 (IHC,IF,WB)CD8⍺ Mouse C8/144B (monoclonal) Thermo Fisher 1:100 (IHC)CD15 Mouse BY87 (monoclonal) Leica Biosysems 1:200 (IHC)Neu Elastase (NE) Mouse NP57 (Polyclonal) Santa Cruz 1:200 (IHC)F4/80 biotin Rat BM8 (monoclonal) eBioscience 1:2000 (IF)Ly6G-biotin Rat RB6-8C5 (monoclonal) Abcam 1:2000 (IF)CD8⍺-biotin Rat 53-6.7 (monoclonal) eBioscience 1:2000 (IF)CD4-biotin Rat GK1.5 (monoclonal) eBioscience 1:2000 (IF)FOXP3-biotin Rat FJK-16S eBioscience 1:2000 (IF)Pan-Keratin-488 conjugate Mouse C11 (monoclonal) Cell Signaling 1:100 (IF)Pan-Keratin-647 conjugate Mouse C11 (monoclonal) Cell Signaling 1:100 (IF)Cytokeratin 19 (CK19) Rat SP2/0 (monoclonal) DSHB TROMA III-C 1:100 (IF)⍺-FAP Rabbit ABT11 (Polyclonal) Millipore 1:100 (IF)⍺-SMA Rabbit 1A4 (Polyclonal) Abcam 1:100 (IF)Ki67 Rabbit N/A (Polyclonal) Abcam 1:400 (IHC)Ki67 Rat SolA15 (Monoclonal) eBioscience 1:200 (IF)CD206 Rat MR5D3 (Monoclonal) AbDSerotec 1:200 (IF)Cleaved Caspase-3 (CC3) Rabbit D3E9 (Monoclonal) Cell Signaling 1:200 (IF)p-STAT3 (Y705) Rabbit D3A7 (Polyclonal) Cell Signaling 1:200 (IHC)beta-Actin Rabbit 13E5 (monoclonal) Cell Signaling 1:2000 (WB)

All Antibodies were validated by respective Manufacturers


Nature Medicine: doi:10.1038/nm · Amer2 8.90 9.04E04 Gzmf 4.95 1.19E02 Sprr2h 8.83 1.40E03...

Documents

Transcript of Nature Medicine: doi:10.1038/nm · Amer2 8.90 9.04E04 Gzmf 4.95 1.19E02 Sprr2h 8.83 1.40E03...