n.neurology.orgn.neurology.org/.../Supplemental_data.docx · Web viewsubcloned into pFLAG-CMV-5a...
Transcript of n.neurology.orgn.neurology.org/.../Supplemental_data.docx · Web viewsubcloned into pFLAG-CMV-5a...
A novel TFG mutation causes Charcot-Marie-Tooth disease type 2 and impairs
TFG function
Supplemental materials
Appendix e-1
e-Methods for linakage analysis
The 22 individuals indicated by dots in Figure 1A were recruited for linkage analysis.
The genotyping of them with ~300,000 markers was performed by the Illumina
Infinium assay using the HumanCytoSNP-12 BeadChip (Illumina, San Diego, CA).1,2
The average call rate per SNP was 98.3%. PedCheck was used to assess the
Mendelian consistency.3 Incompatibilities at 112 (0.04%) markers were detected and
therefore removed from the data. Since presence of linkage disequilibrium (LD) may
inflate multipoint linkage statistics,4,5 SNPs within a 50-SNP window that had
variance inflation factor (VIF) greater than 2 (corresponding to r2 > 0.5) were pruned
out using PLink.6,7 After the quality control and the LD-based pruning, the number of
remaining markers was 3,355. Merlin (version 1.1.2) was then used to assess
information content of these markers and to perform multipoint parametric linkage
analysis.8 The disease allele frequency was set to 0.00001. The penetrance for
homozygous normal, heterozygous, and homozygous affected were set to 0.0001,
1.000, and 1.000 respectively.
e-Methods for in vitro functional studies
Expression plasmids. A fragment containing full-length coding region of TFG was
subcloned into the pcDNA3.1(-) vector (Invitrogen, Grand Island, NY ) to generate
TFG expression plasmids (table e-2). In some experiments, full length TFG was also
subcloned into pFLAG-CMV-5a (Sigma, St. Louis, MO) or pcDNA 3.1/Myc-His
vector for expression of FLAG-tagged or Myc-tagged TFG. The mutations c.806G>T
(p.Gly269Val) and c.854C>T (p.Pro285Leu) were introduced into the expression
plasmids, separately, by using QuikChange Site-Directed Mutagenesis method
(Stratagene, Santa Clara, CA) (table e-2).
Cell culture and transfection. HEK293 and HeLa cells were maintained in DMEM
medium supplemented with 10% fetal bovine serum in a humidified incubator at 37°C
under 5% CO2. Transient transfection was performed using the calcium phosphate
precipitation method.9,10 For endogenous TFG depletion, siRNA specifically targeting
the 3’UTR of TFG was transfected by using Lipofectamine 2000 (Invitrogen) (table e-
2).
Western blot analysis and protein solubility studies. Forty-eight hours post-
transfection, cells were lysed with RIPA buffer. The lysates were used for blotting of
total proteins and the amount of the protein was quantified using a Bradford-based
assay kit (Bio-Rad, Hercules, CA). To determine the protein solubility profile,
sequential extractions were performed. Transfected cells were lysed in RIPA buffer
and the cell lysates were centrifuged generating the soluble fraction. The pellet was
further solubilized using urea buffer (7M urea, 2M thiourea, 1% ASB-14, 40mM Tris,
pH 8.5) to recover insoluble fraction. Sixty microgram of protein extract was
separated by 10% SDS-PAGE and transferred to PVDF membranes. After the
blocking step with 5% nonfat dry milk, the membrane was incubated with primary
antibodies followed by HRP–conjugated secondary antibodies (table e-3). Detection
was performed with a standard enhanced chemiluminescence method. Quantification
analysis was performed by using NIH Image J software.
Real-time quantitative PCR (RT-qPCR) and ER stress detection. To measure the
TFG mRNA levels in the transfected HEK293 cells, total RNA from the harvested
cells was prepared using TRIzol method (Invitrogen). Reverse transcription (RT) was
carried out using the QuantiTect Reverse Transcription kit (Qiagen, Valencia, CA).
The RT-qPCR assays were performed using a 7500 Fast Real-Time PCR System (Life
Technologies, Grand Island, NY) in a 96-well format using the Fast SYBR® Green
Master Mix (Life Technologies). The relative gene expression was normalized against
GAPDH expression.
To investigate the effect of Gly269Val mutant on the unfolded protein response,
biomarkers of ER stress, such as expression of BiP11 and CHOP12 and alternative
splicing of XBP-1,13 were examined in the transfected HEK293 cells. For RT-qPCR
analysis of XBP-1 splicing, RT product was used as a template with primers specific
to spliced XBP-1 and GAPDH.13 For analyzing expression of BiP and CHOP, a RT-
qPCR was performed using primers specific for BiP and CHOP with GAPDH as a
reference. The sequences of the primers used in this study are shown in table e-2.
Immunofluorescence studies. Forty-eight hours post-transfection, cells were fixed in
4% paraformaldehyde, permeablized with 0.2% Tween-20 and blocked with 1% BSA
before incubation in primary antibody overnight at 4°C (table e-3). Bound primary
antibodies were detected using Alexa-conjugated secondary antibodies. Images were
captured with an Olympus FluoView FV10i confocal laser scanning fluorescence
microscopy system with a 60X oil immersion objective (Olympus, Tokyo, Japan).
Cell viability assay. MTT colorimetric assay was used to assess the cell viability of
transfected HEK293 cells. Forty-eight or 72 hours post-transfection, MTT solution (5
mg/ml) was added to growing cultures and incubated at 37˚C for 4 h. The formed
formazan dye from metabolically active viable cells was dissolved in DMSO and the
absorbance of dissolved formazan at 570 nm was measured using a Tecan Infinite-
M1000 plate reader (Tecan, San Jose, CA).
Investigating protein secretory pathway by the secreted Gaussia luciferase assay.
The Gaussia luciferase (Gluc) is a secreted reporter and has been utilized to monitor
protein secretory pathway.14,15 The secreted Gluc activities in the culture medium from
transfected cells expressing both Gluc and Firefly luciferase (Fluc) can be
quantitatively measured and normalized by the corresponding internal Fluc activities
in the cell lysates to assess the protein secretory efficiency. Thus, we co-transfected
HEK293 cells with a plasmid expressing Gluc (pCMV-Gaussia Luc; Thermo
Scientific), a plasmid encoding Fluc (pCMV-Red Firefly Luc; Thermo Scientific) and
along with TFG wild-type or mutant vector constructs. Forty-eight hours post-
transfection, for each set of readings, cell-free conditioned medium was assayed for
Gluc activity, which was then normalized to their corresponding Fluc activity of the
cell lysate.
siRNA-mediated TFG depletion studies. For depleting endogenous TFG, the siRNA
specifically targeting the 3’UTR of TFG (table e-2) was transfected into HEK293
cells and the efficiency of TFG depletion was evaluated by western blot analysis. For
investigating the effect of TFG depletion on cell viability, HEK293 cells transfected
with wild-type TFG or mutant TFG constructs or empty vectors were simultaneously
treated with 75 nM siRNA in a 96-well plate. Forty-eight or 72 hours post-
transfection, cell viability was measured by MTT assay. For evaluating the effect of
TFG depletion on protein secretory pathway, HEK293 cells in a 96-well plate were
co-transfected with siRNA (75 nM), Gluc and Fluc reporter plasmids (60 ng of each),
and along with empty vector, wild-type TFG, or mutant TFG constructs (60 ng). The
normalized secreted Gluc activities were analyzed at 48 hours after transfection.
Appendix e-2
e-Results
Clinical features of the patient IV-2
The clinical features of the proband (IV-2) are used to examplify the disease in this
family. IV-2 is a 36-year-old man who had manifested slowly progressive weakness
of distal lower limbs since the age of 28 years. He started to walk at a normal age.
Physical examination at age 36 revealed high-arched feet, hammer toes, generalized
areflexia, atrophy and weakness of the intrinsic muscles of the hands (score 4/5 in
Medical Research Council Scale), feet (2/5) and also the muscles in the legs, resulting
in impaired dorsiflexion and plantar flexion of the feet (4 and 4+/5). Despite a lack of
sensory complaints, mildly diminished sensation for all modalities in regions distal to
the ankles was observed. Nerve conduction studies demonstrated the presence of an
axonal sensorimotor polyneuropathy with normal NCVs but reduced amplitudes.
Gly269Val TFG mutants do not provoke ER stress or increase cellular toxicity.
The accumulated cytoplasmic protein aggregates might provoke ER stress or lead to
cellular toxicity. Thus, we examined whether the Gly269Val TFG mutants undermine
cell viability. MTT assay was used to assess the cell viability of HEK293 cells
transfected with vectors expressing wild-type TFG, Gly269Val TFG, or empty vector.
Compared with empty vector control, overexpression of neither wild-type TFG nor
the Gly269Val mutant had any significant effect on cell viability (figure e-6A),
suggesting that Gly269Val TFG did not have a significant cellular toxicity.
To investigate whether mutant TFG induces ER stress, the biomarkers of ER
stress, including expression of Bip and CHOP and alternative splicing of XBP-1, were
examined in the transfected HEK293 cells. Cells exposed to a stress stimulator
dithiothreitol (DTT) or transfected to express Arg89Cys myelin protein zero, a
previously identified ER stress-inducing mutant protein,16 were used as the positive
controls. As shown in figure e-6B, cells expressing Gly269Val TFG did not have a
significantly higher level of Bip or spliced XBP-1 compared with the cells expressing
wild-type TFG, suggesting that the Gly269Val TFG did not induce ER stress. To
investigate whether the Gly269Val TFG mutant increases the susceptibility of cells to
external ER stress, transfected cells were exposed to 1mM DTT and the expression of
ER markers were examined. Similarly, DTT treatment did not significantly alter the
levels of BiP, CHOP, or spliced XBP-1 in the cells expressing Gly269Val TFG when
compared with the cells expressing wild-type TFG (figure e-6C), indicating that the
Gly269Val TFG did not increase the cellular susceptibility to ER stress.
figure e-1. Photographs of the patient III-23 with the TFG p.Gly269Val mutation
and advanced CMT
Pronounced atrophy of intrinsic muscles of the hands (A-C) and muscles of the legs
(D) of the patient III-23 at age 57 years.
figure e-2. Linkage analysis
(A) The results of parametric multipoint linkage analysis on chromosome 3 of the
family with CMT2. (B) The only locus with a LOD score greater than 3 is on
chromosome 3, between rs17021771 (chr3:84796650) and rs6789667
(chr3:103526835), where TFG gene resides.
figure e-3. Time-course of TFG degradation
HEK293 cells were transfected with plasmids encoding either wild-type TFG or
Gly269Val TFG. At 48 hours post-transfection, the cells were treated with 100 g/ml
cyclohexamide (CHX) for 0, 1, 2, 4, or 8 hours and then harvested. Forty microgram
of total-protein cell extracts for each cell lysate were analyzed by immunoblotting
using TFG-specific antibody. Actin was used as an internal loading control. A
representative blot of three independent experiments is shown.
figure e-4. Intracellular localization of the wild-type and mutant Gly269Val TFG
proteins
(A) Representative confocal images of HEK293 cells co-transfected with plasmids
encoding TFG (either wild-type or p.Gly269Val mutant) and DesRed-ER (an ER
marker; Clontech). 48 hours post-transfection, the cells were stained with anti-TFG
antibody and green fluorophore-labeled secondary antibodies. Mutant Gly269Val did
not substantially change its subcellular localization and stayed mostly in the ER. (B)
Representative images of HEK293 cells co-transfected with plasmids encoding wild-
type or p.Gly269Val TFG and plasmids encoding Sec16B. Cells were immunostained
against TFG (Green) and Sec16B (Red). Similar Sec16B co-localization patterns were
seen in both wild-type and Gly269Val TFG. (C) Representative images of HEK293
cells co-transfected with plasmids encoding FLAG-tagged wild-type TFG (Green)
and Myc-tagged Gly269Val TFG (Red). The presence of both wild-type and
Gly269Val mutant TFG in the same punctate structures suggests that the Gly269Val
mutant did not lose their ability to assemble in an oligomeric complex with wild-type
TFG. Scale bars, 10 mm.
figure e-5. Overexpression of Gly269Val TFG in HEK293 cells does not have a
significant effect on protein secretion efficiency.
The secreted Gaussia luciferase (Gluc) activities in the culture medium of HEK293
cells co-transfected with plasmids expressing Gluc and Firefly luciferase (Fluc) were
measured and normalized with the control Fluc activities in the cell lysates to assess
the protein secretory efficiency. The normalized secreted Gluc activities were similar
in HEK293 cells transfected with wild-type (WT) or Gly269Val TFG constructs or
empty vectors. The value obtained for the empty vector-transfected cells was set as
100%. Results are presented as mean ± SEM from 12 independent transfections. The
“N.S.” means no statistically significant difference.
figure e-6. Cell viability and the unfold protein response (UPR)
(A) Cell viability was assessed using the MTT colorimetric assay in HEK293 cells
transfected with wild-type or Gly269Val TFG constructs. Empty vector-transfected
cells were used as controls. Values are shown as means ± SEM of eight independent
experiments. The expression of Gly269Val TFG did not have any significant effect on
cell viability at 48 or 72 hours after transfection. (B) The activation of UPR was
evaluated by quantitative real-time PCR (qRT-PCR), measuring the XBP-1 mRNA
splicing and the expression levels of BiP mRNA. Cells exposed to DTT or transfected
with plasmid expressing Arg98Cys myelin protein zero (MPZ) represented the
positive controls. All values (mean ± SEM, n = 6) were first normalized to GAPDH
levels. (C) Susceptibility to external ER stress of HEK293 cells transfected with
plasmids expressing wild-type or Gly269Val TFG was evaluated by measuring XBP-1
splicing and the mRNA levels of BiP and CHOP using qRT-PCR at 5 hours after
treating with 1 mM DTT. Values are shown as means ± SEM of three independent
experiments. None of these UPR parameters was significantly up-regulated in cells
expressing the Gly269Val mutation with or without DTT treatment. *p< 0.05, **p<
0.01.
table e-1. Bioinformatic analysis of exome sequencing in the two affected individuals of the pedigree with axonal CMT
III-8 IV-3
Total bases sequenced 30,658,115.6 Kb 30,862,079.4 Kb
Raw heterozygous variants (number) 15,869 15,238
Common heterozygous variants 6,388
Variants not in dbSNP or 1000 genomes database 163
Variants not found in other 24 non-CMT patients’ exome databases 97
Variants resulting in amino acid sequence changes 57
Variants completely segregating with CMT phenotype in the pedigree 1
table e-2. Primer or oligonucleotide sequences used in this study
Primer sequences used for cloning of TFG
TFG-HindIII-F 5’- ACTAAGCTTACCATGAACGGACAGTTGG -3’
TFG-BamHI-R 5’- ACTGGATCCCTATCGATAACCAGGTCC -3’
Primer sequences used for site-directed mutagenesis
TFG-G269V-F 5’- CAGCCTCAACAGTATGTTATTCAGTATTCAGC -3’
TFG-G269V-R 5’- GCTGAATACTGAATAACATACTGTTGAGGCTG -3’
TFG-P285L-F 5’- CTGGACCTCAACAACTTCAGCAGTTCCAGG -3’
TFG-P285L-R 5’- CCTGGAACTGCTGAAGTTGTTGAGGTCCAG-3’
Primer sequences used for TFG mRNA expression by using real-time quantitative PCR
TFG-F 5’- GTTTCAGGGCCACCCAGTGCT -3’
TFG-R 5’ - GCCGGCCTGTTGCTGGTACTG -3’
GAPDH-F 5’ - GCAGCCTCCCGCTTCGCTC -3’
GAPDH-R 5’ - GCGCCCAATACGACCAAATCCGTT -3’
Primers sequences used for analysis of UPR by using real-time quantitative PCR
XBP1-F 5’- GGTCTGCTGAGTCCGCAGCAGG -3’
XBP1-R 5’- GGGCTTGGTATATATGTGG -3’
BiP-F 5’- TGCAGCAGGACATCAAGTTC -3’
BiP-R 5’- GGCTGGTACAGTAACAACTGC -3’
CHOP-F 5’- GCTCAGGAGGAAGAGGAGGA -3’
CHOP-R 5’ – TCCTGCTTGAGCCGTTCATT -3’
GAPDH-F 5’ - GCAGCCTCCCGCTTCGCTC -3’
GAPDH-R 5’ - GCGCCCAATACGACCAAATCCGTT -3’
TFG siRNA targeting the 3’UTR of TFG
TFG siRNA 5’-ACCAAUUAAUGUAGCUGCUAGCUAU-3’
table e-3. Antibodies used for analysis
Western blotting
Antibody Company and product code Dilution
TFG (rabbit polyclonal) abcam 86606 1:2000
actin (mouse monoclonal) Millipore mab1501 1:5000
Goat polyclonal Secondary Antibody to Rabbit
IgG - H&L (HRP)abcam 6721 1:5000
Rabbit polyclonal Secondary Antibody to Mouse
IgG - H&L (HRP) abcam 6728 1:5000
Immunofluorescence
Antibody Company and product code Dilution
TFG (mouse monoclonal) Novus NBP2-01438 1:200
sec16B (rabbit polyclonal) abcam 106645 1:200
Alexa Flour 488 Goat anti-mouse IgG(H+L) Invitrogen a11001 1:500
Alexa Flour 555 Goat anti-rabbit IgG(H+L) Invitrogen a21428 1:500
e-References
e1. Gunderson KL, Steemers FJ, Lee G, Mendoza LG, Chee MS. A genome-wide
scalable SNP genotyping assay using microarray technology. Nat Genet 2005;37:549-
554.
e2. Steemers FJ, Chang W, Lee G, Barker DL, Shen R, Gunderson KL. Whole-
genome genotyping with the single-base extension assay. Nat Methods 2006;3:31-33.
e3. O'Connell JR, Weeks DE. PedCheck: a program for identification of genotype
incompatibilities in linkage analysis. Am J Hum Genet 1998;63:259-266.
e4. Boyles AL, Scott WK, Martin ER, et al. Linkage disequilibrium inflates type I
error rates in multipoint linkage analysis when parental genotypes are missing. Hum
Hered 2005;59:220-227.
e5. Goode EL, Badzioch MD, Jarvik GP. Bias of allele-sharing linkage statistics in the
presence of intermarker linkage disequilibrium. BMC Genet 2005;6 Suppl 1:S82.
e6. Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome
association and population-based linkage analyses. Am J Hum Genet 2007;81:559-
575.
e7. Howrigan DP, Simonson MA, Keller MC. Detecting autozygosity through runs of
homozygosity: a comparison of three autozygosity detection algorithms. BMC
Genomics 2011;12:460.
e8. Abecasis GR, Cherny SS, Cookson WO, Cardon LR. Merlin--rapid analysis of
dense genetic maps using sparse gene flow trees. Nat Genet 2002;30:97-101.
e9. Graham FL, van der Eb AJ. A new technique for the assay of infectivity of human
adenovirus 5 DNA. Virology 1973;52:456-467.
e10. Wigler M, Silverstein S, Lee LS, Pellicer A, Cheng Y, Axel R. Transfer of
purified herpes virus thymidine kinase gene to cultured mouse cells. Cell
1977;11:223-232.
e11. Zhang K, Kaufman RJ. Signaling the unfolded protein response from the
endoplasmic reticulum. J Biol Chem 2004;279:25935-25938.
e12. Li F, Hayashi T, Jin G, et al. The protective effect of dantrolene on ischemic
neuronal cell death is associated with reduced expression of endoplasmic reticulum
stress markers. Brain Res 2005;1048:59-68.
e13. Hirota M, Kitagaki M, Itagaki H, Aiba S. Quantitative measurement of spliced
XBP1 mRNA as an indicator of endoplasmic reticulum stress. J Toxicol Sci
2006;31:149-156.
e14. Badr CE, Hewett JW, Breakefield XO, Tannous BA. A highly sensitive assay for
monitoring the secretory pathway and ER stress. PLoS One 2007;2:e571.
e15. Hewett JW, Tannous B, Niland BP, et al. Mutant torsinA interferes with protein
processing through the secretory pathway in DYT1 dystonia cells. Proc Natl Acad Sci
U S A 2007;104:7271-7276.
e16. Saporta MA, Shy BR, Patzko A, et al. MpzR98C arrests Schwann cell
development in a mouse model of early-onset Charcot-Marie-Tooth disease type 1B.
Brain 2012;135:2032-2047.