N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by...
Transcript of N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by...
![Page 1: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/1.jpg)
1
N-acetyl-cysteine and celecoxib lessen cadmium cytotoxicity which is associated with
cyclooxygenase-2 up-regulation
Maria E. Figueiredo-Pereira*, Zongmin Li, Marlon Jansen and Patricia Rockwell
From the Department of Biological Sciences,
Hunter College of City University of New York, New York 10021
*To whom correspondence should be addressed:
Maria E. Figueiredo-Pereira, Dept. of Biological Sciences,
Hunter College of City University of New York, 695 Park Ave., New York, NY 10021.
Tel.: 212-650-3565; Fax: 212-772-5227; E-mail: [email protected]
Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on May 7, 2002 as Manuscript M109145200 by guest on D
ecember 8, 2020
http://ww
w.jbc.org/
Dow
nloaded from
![Page 2: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/2.jpg)
2
Running Title: cadmium, ubiquitin/proteasome pathway and cyclooxygenase-2
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 3: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/3.jpg)
3
SUMMARY
In many neurodegenerative disorders, aggregates of ubiquitinated proteins are detected in
neuronal inclusions but their role in neurodegeneration remains to be defined. To identify
intracellular mechanisms associated with the appearance of ubiquitin-protein aggregates, mouse
neuronal HT4 cells were treated with cadmium. This heavy metal is a potent cell poison that
mediates oxidative stress and disrupts the ubiquitin/proteasome pathway. In the current studies,
the following intracellular events were found to be also induced by cadmium: (i) a specific rise in
cyclooxygenase-2 (COX-2) gene expression but not cyclooxygenase-1, (ii) an increase in the
extracellular levels of the pro-inflammatory prostaglandin PGE2, a product of COX-2 and (iii)
production of 4-hydroxy-2-nonenal-protein adducts, which result from lipid peroxidation. In
addition, cadmium treatment led to the accumulation of high molecular weight ubiquitin-COX-2
conjugates and perturbed COX-2 glycosylation. The thiol reducing anti-oxidant N-acetyl-
cysteine, and, to a lesser extent, the COX-2 inhibitor Celecoxib attenuated the loss of cell
viability induced by cadmium demonstrating that oxidative stress and COX-2 activation
contribute to cadmium cytotoxicity. These findings establish that disruption of the
ubiquitin/proteasome pathway is not the only event triggered by cadmium. This oxidative
stressor also activates COX-2 function. Both events could be triggered by formation of 4-
hydroxy-2-nonenal as a result of cadmium-induced lipid peroxidation. Pro-inflammatory
responses stimulated by oxidative stressors that mimic the cadmium effects may, therefore, be
important initiators of the neurodegenerative process and exacerbate its progress.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 4: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/4.jpg)
4
INTRODUCTION
The ubiquitin/proteasome pathway plays a major role in the intracellular quality control
process by degrading mutated or abnormally folded proteins to prevent their accumulation as
aggregates [reviewed in (1)]. In many neurodegenerative disorders, however, aggregates of
ubiquitinated proteins are detected in neuronal inclusions [reviewed in (2)]. A correlation
between neuronal inclusions and cell death remains to be established (3;4). Nevertheless, recent
findings demonstrated that protein aggregates directly impair the function of the
ubiquitin/proteasome pathway, the latter known to be essential for cell survival (5).
It has become increasingly evident that functional changes in the ubiquitin/proteasome
pathway are critical to the neurodegenerative process. For example, a mutant form of ubiquitin,
known as Ub+1, was detected only in brains of Alzheimer’s disease (AD) patients and not in age
matched controls (6). Ub+1-capped polyubiquitin chains were shown to be refractory to
disassembly by de-ubiquitinating enzymes and to potently inhibit proteasome degradation of a
polyubiquitinated substrate (7). Moreover, particular areas of AD brains were found to exhibit
compromised proteasome activities when compared to age matched controls (8). In addition, a
decline in ubiquitination activity was shown to decrease cell viability in a cellular model of
Huntington's disease (9). In this model, transfected rat striatal neurons co-expressing a non-
functional ubiquitin-conjugating enzyme and a mutant huntingtin containing polyglutamine
expansions showed a greater loss of cell viability than transfectants expressing the huntingtin
mutant alone (9). Together, these results strongly support the view that disruption of the
ubiquitin/proteasome pathway plays an important role in neurodegeneration.
Oxidative stress is another mechanism found to be involved in neurodegeneration.
Increasing evidence supports its role in neuronal death in disorders such as AD and Parkinson’s
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 5: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/5.jpg)
5
disease (PD). Studies with autopsied brains of AD patients show a co-localization of high levels
of oxidative stress products with neurofibrillary tangles (NFT) and senile plaques (10).
Furthermore, signs of oxidative stress, such as lipid peroxidation and a decline in reduced
glutathione (GSH), were detected in the substantia nigra in brains of PD patients (11). The
production of free radicals by oxidative stress promotes partial unfolding of cellular proteins,
resulting in exposure of previously buried hydrophobic domains to proteolytic enzymes (12-14)
and to ubiquitin-conjugating enzymes (15). This sudden increase in protein substrates may
compromise the capacity of the ubiquitin/proteasome pathway to clear the abnormal proteins and
cause their aggregation and accumulation within the cell. However, the link between oxidative
stress and the accumulation of ubiquitinated proteins in neurodegeneration remains to be
established.
To address the relationship between oxidative stress and disruption of the
ubiquitin/proteasome pathway in the neurodegenerative process, we chose to treat mouse
neuronal HT4 cells with cadmium (Cd2+). This heavy metal increases lipid peroxidation in
organs such as the brain, which is particularly sensitive to Cd2+-toxicity (16). Although Cd2+ is
not a Fenton metal and thus, by itself, is unable to generate reactive oxygen species (ROS), free
radical scavengers and anti-oxidants lessen Cd2+-toxicity, suggesting that the heavy metal elicits
an increase in free radical production [reviewed in (17)]. Earlier studies (18) suggested a close
link between Cd2+ cytotoxicity and the ubiquitin/proteasome pathway as yeast mutants deficient
in a specific ubiquitin-conjugating enzyme (UBC7) or a proteasome subunit (PRE1) were shown
to be hypersensitive to the heavy metal. Moreover, our previous studies with neuronal cells
(19;20) demonstrated that Cd2+ disrupts intracellular sulfhydryl homeostasis, leads to an
accumulation of ubiquitinated proteins and to a loss in cell viability. The ubiquitinated proteins
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 6: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/6.jpg)
6
that accumulate in cells upon Cd2+-treatment and the mechanisms mediating its toxicity in
neuronal cells remain poorly defined.
Herein we report that, in mouse neuronal HT4 cells, Cd2+ initiated a pro-inflammatory
response by inducing up-regulation of COX-2 at the mRNA and protein levels without affecting
COX-1. As a result of this response, there was an increase in the extracellular concentrations of
the pro-inflammatory prostaglandin PGE2, which is a COX-2 product. Moreover, treatments
with the heavy metal resulted in the stabilization of glycosylated and unglycosylated forms of
COX-2 as well as an accumulation of ubiquitin-COX-2 conjugates. Cd2+ also induced the
formation of HNE-protein adducts in the neuronal cells indicating that its cytotoxicity may be
mediated by HNE, a highly cytotoxic aldehyde product of lipid peroxidation. Based on the
observations that Cd2+-induced oxidative stress is closely associated with COX-2 up-regulation
and neuronal cell death, we evaluated the protective effect of two anti-oxidants [N-acetyl-
cysteine (NAC) and ascorbic acid] and a COX-2 specific inhibitor (Celecoxib) on Cd2+-
cytotoxicity. Of the three drugs tested, NAC, a thiol reducing anti-oxidant, was the most
effective in preventing the loss of cell viability caused by the heavy metal. Ascorbic acid, a free
radical scavenger, failed to prevent and even potentiated Cd2+-cytotoxicity in some instances.
Celecoxib, the COX-2 specific inhibitor, attenuated the loss of cell viability caused by the heavy
metal under certain conditions. These studies provide evidence that both the disruption of the
ubiquitin/proteasome pathway and the induction of a pro-inflammatory response are induced by
oxidative stressors such as cadmium. These two mechanisms may be associated in the
neurodegenerative process.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 7: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/7.jpg)
7
EXPERIMENTAL PROCEDURES
Materials - Cadmium sulfate, NAC, ascorbic acid, actinomycin D, puromycin and MTT
were from SIGMA (St. Louis, MO). Tunicamycin was from Calbiochem (La Jolla, CA).
Celecoxib was a generous gift from Pharmacia Corp. (Peapack, NJ). The goat polyclonal
antibodies anti-COX-2 (1:1,000) and anti-COX-1 (1:1,000) were obtained from Santa Cruz
Biotechnology (Santa Cruz, CA). Ubiquitin protein conjugates were detected with a rabbit
polyclonal antibody (1:1,500) from Dako Corp. (Carpinteria, CA). 4-hydroxy-2-nonenal (HNE)
protein adducts were identified with a rabbit polyclonal antibody (1:1,000) from Calbiochem
(San Diego, CA). The Super Signal West Pico detection system and the bicinchoninic acid
protein assay kit were from PIERCE (Rockford, IL). Other reagents were of the highest purity
available.
Cell Cultures—HT4 cells were derived from a mouse neuroblastoma cell line infected with
a retrovirus encoding the temperature-sensitive mutant of SV40 large T antigen. When grown at
39oC (non-permissive temperature), HT4 cells differentiate with neuronal morphology, express
neuronal antigens, synthesize and secrete nerve growth factor, and express receptors for nerve
growth factor (21). The cells were maintained at 33oC in Dulbecco's modified Eagle's medium
containing 5% fetal bovine serum, as previously described (19).
Cell Treatments—Cultures of HT4 cells were treated at 37oC with aqueous solutions of
cadmium sulfate added to serum-containing medium. When specified, anti-oxidants (1mM NAC
or 1mM ascorbic acid) or the COX-2 inhibitor Celecoxib (20µM) or inhibitors of transcription
(15µg/ml actinomycin D) or translation (25µg/ml puromycin) or an inhibitor of N-linked
glycosylation (10µg/ml tunicamycin), were added to the culture media 1h prior to Cd2+-
treatment. NAC, ascorbic acid and puromycin were dissolved in water and the remaining listed
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 8: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/8.jpg)
8
drugs were dissolved in DMSO. At the end of the indicated incubation times, the cultures were
washed twice with PBS and the cells were harvested as previously described (22). Cell washes
removed unattached cells, hence, subsequent assays, were performed on adherent cells only.
Preparation of Cell Extracts for Western Blotting— Cell extracts were prepared and
subjected to SDS-PAGE as previously described (19). Identification of COX-1, COX-2,
ubiquitinated proteins and HNE-protein adducts was by Western blotting on 8% polyacrylamide
gels. For detection of HNE-protein adducts the samples were run under non-reducing conditions
in the absence of β-mercaptoethanol. The antigens were visualized by a horseradish peroxidase
method utilizing the Super Signal West Pico detection system. Quantitative analysis of the
immunostaining was by image analysis with the ImagePC program from NIH as described
previously (23).
RT-PCR analysis - Total RNA was isolated with the RNAeasy Kit from QIAGEN
(Valencia, CA). To perform each RT-PCR 1µg of RNA/sample was reverse-transcribed in a 25µl
reaction (Omniscript RT Kit from Qiagen, Valencia, CA) and 2µl of the resultant cDNA was
amplified with gene specific primers using the Taq PCR core Kit from QIAGEN (Valencia, CA).
The mouse specific PCR primers were for cox-2 (forward: CAGCACTTCACCCATCAGTT;
reverse: CTGGTCAATGGAGGCCTTTG) and for ubA (forward:
CAACATCCAGAAAGAGTCCA; reverse: CCTCATCTTGTCACAGTTGT). Primers were
designed from cDNA sequences obtained from GenBank under the following Accession
numbers: M88242 for mouse cox-2 and M11690 for mouse ubA. PCR was performed as follows:
5 minutes at 94oC, then 35 cycles for ubA and 30 cycles for cox-2 of 1 minute at 94oC, 1 minute
at 60oC and 1.5 minutes at 72oC with a final extension at 72oC for 10-min.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 9: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/9.jpg)
9
PGE2 Concentrations – Levels of PGE2 released into the media of treated cells were
measured by an enzyme-linked immunoassay according to manufacturer's instructions (Cayman
Chemicals, Ann Arbor, MI). For all experiments, cells were seeded at a density of 1.5 X 105
cells/ml. Amounts of PGE2 are expressed as ng of PGE2 produced/ml of media.
Immunoprecipitation – Immunoprecipitation of COX-2 from total cell extracts, normalized
to protein concentration, was performed as previously described (24). The immunocomplexes
were resolved on 8% SDS gels, followed by Western blot analysis probed with the anti-COX-2
antibody, proceeded by stripping and reprobing with the anti-ubiquitin conjugates antibody.
Cell Viability Assay—Cell viability was assessed with a modification of the method
described in Mosmann (25) by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium
bromide (MTT) assay as previously described (19).
Glutathione Assay — Total GSH was quantified as described previously (26) by a
modification of the standard recycling assay based on the reduction of 5,5-dithiobis(2-
nitrobenzoic acid) with glutathione reductase and NADPH. This assay measures both GSH and
GSSG; normally GSSG measures less than 5% of the total GSH in control cell cultures.
Protein Determination—Protein levels were determined with a bicinchoninic acid assay kit.
Statistical Analysis—Statistical comparisons between two groups (Fig. 6) or among three or
more groups (Fig. 8) were performed with the unpaired “t” test or with the Tukey-Kramer
multiple comparison test (Instat 2.0, Graphpad Software, San Diego, CA), respectively.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 10: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/10.jpg)
10
RESULTS
Cadmium Induces a Time- and Dose-dependent Increase in COX-2 Protein Levels - To
determine the time and concentration dependence of the effect of Cd2+ on the intracellular levels
of COX-2, we treated confluent HT4 cells with a range of concentrations between 1.5 and 45 µM
of CdSO4. After incubations of 10-48 h, intracellular levels of COX-2 in total lysates prepared
from adherent cells were visualized by Western blot analysis as described under "Experimental
Procedures". Fig 1 shows the dose-dependent course of the changes in COX-2 levels after
treatment for 10h (A), 16h (B), 24h (C) and 48h (D) with CdSO4. Anti-COX-2 immunoreactivity
detected a light 72kDa band in control cells or cells treated with 1.5µM CdSO4. This band
corresponds to COX-2 that is N-glycosylated at three sites (27). In cells treated with higher Cd2+
concentrations, such as 3, 15, 30 and, in some cases, 45µM, two additional bands were identified
as corresponding to COX-2 forms that are N-glycosylated at four sites (74kDa) and non-
glycosylated (65kDa), respectively (27). The three COX-2 bands, corresponding to 74, 72 as
well as 65kDa, are clearly visible in Fig. 5 (below). COX-2 levels rose above control as early as
10h after treatment with 15µM CdSO4, which is the Cd2+ concentration that most effectively
increases COX-2 levels to a range between 3 and 38-fold above control (Fig. 1E). In addition, a
form of COX-2 (Ub-COX-2) that migrated at a high molecular weight, was clearly identified at
the top of blots corresponding to cells treated for 24 and 48h with 15µM Cd2+ (Fig.1C and D). At
higher Cd2+ concentrations (45µM) the levels of all COX-2 forms decrease. This effect is most
likely due to a dramatic loss in cell viability caused by high Cd2+ concentrations (see below).
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 11: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/11.jpg)
11
Cadmium Up-regulates COX-2 Gene Expression - The increase in COX-2 protein levels
observed in HT4 cells upon treatment with the heavy metal could result from either a reduction
in COX-2 degradation or to an increase in its expression. To establish if cadmium affects cox-2
gene expression we carried out RT-PCR analyses with gene-specific primers. These studies
revealed that CdSO4 concentrations ranging between 3 and 30µM caused a considerable
induction of cox-2 mRNA (Fig. 2A). The ubA mRNA levels did not change significantly with
these treatments. The levels of cox-2 and ubA mRNA were both decreased by 45µM CdSO4,
most likely due to the high level of cell death elicited by this concentration of the heavy metal.
Pre-treatment of HT4 cells with inhibitors of transcription (actinomycin D) or translation
(puromycin) prevented the Cd2+-induced rise in COX-2 protein levels [compare Fig. 2B (top
panel) with Fig. 2C]. Only the preexisting 72kDa form of COX-2 was identified in cells pre-
treated with actinomycin D or puromycin. This finding demonstrates that the other COX-2 forms
detected in cells treated solely with Cd2+, namely the 74 and 65kDa as well as Ub-COX-2, are
dependent on de novo protein synthesis.
The increase in cyclooxygenase levels induced by Cd2+ is specific for COX-2. Protein
levels of COX-1, which is constitutive in HT4 cells, was not raised by treatment with increasing
concentrations of the heavy metal (Fig. 2B, lower panel).
Cadmium Increases PGE2 levels - To evaluate the functional changes in COX-2 levels shown in
Fig. 1, culture media from HT4 cells incubated with different Cd2+-concentrations over time
were analyzed for production of the proinflammatory prostaglandin PGE2, a COX-2 product
(Fig. 3). In the absence of cadmium, HT4 cells maintained a basal level of approximately 0.25ng
of PGE2/ml media. After 24h incubations with increasing concentrations of cadmium, PGE2
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 12: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/12.jpg)
12
levels were elevated to a maximum of 90ng of PGE2/ml media, a 360-fold increase over basal
levels. After 48h of treatment, PGE2 production in cells treated with 30 and 45µM Cd2+ was at
least 3-fold lower than in those treated with 15µM of the heavy metal. This decline in PGE2
production most likely reflects the poor cell survival caused by higher Cd2+ concentrations.
Cadmium Induces Accumulation of High Molecular Mass Ubiquitin-COX-2 conjugates and
Perturbs COX-2 Glycosylation - The COX-2 immunoreactive high molecular mass forms
detected by Western blot analysis of total cell lysates probed with anti-COX-2 were further
characterized for the presence of ubiquitin. Total lysates prepared from control and Cd2+ -treated
HT4 cells were subjected to imunoprecipitation with the anti-COX-2 antibody. Western blots of
the immunoprecipitated proteins probed with the anti-COX-2 antibody (Fig. 4B) revealed three
COX-2 forms (74/72 kDa doublet and 65kDa) as well as high molecular mass COX-2 (Ub-COX-
2), a pattern of reactivity similar to the one observed in Fig.1. Only the high molecular mass
COX-2 forms were detected when these blots were stripped and reprobed with the antibody that
recognizes ubiquitin-conjugates (Fig. 4A). These findings suggest that Cd2+ promotes
stabilization of COX-2 as high molecular mass ubiquitin conjugates.
Treatment with endo H reduced the apparent molecular mass of most of the 72/74 kDa
doublet to the 65 kDa band (data not shown). The latter was also the major band identified in
Cd2+-treated cells preincubated for one hour with 10µg/ml of tunicamycin, a glycosylation
inhibitor (Fig. 5B). The 65 kDa band corresponds, therefore, to unglycosylated COX-2. These
results indicate that the shift in COX-2 apparent molecular masses seen in Cd2+-treated cells is
due to changes in the extent of its glycosylation and not to its proteolytic degradation.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 13: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/13.jpg)
13
Evaluation of the Effect of Anti-Oxidants and a COX-2 Inhibitor on Cadmium Cytotoxicity - To
investigate which mechanisms mediate Cd2+-cytotoxicity we evaluated the effects of two anti-
oxidants, NAC and ascorbic acid, and a COX-2 inhibitor, Celecoxib, on HT4 cell viability. The
results obtained after treatments with 15, 30 and 45µM of the heavy metal for 7h or 24h are
shown in Fig. 6A and 6B, respectively. The lowest survival rate was observed as an approximate
90% decrease in cell viability after a 24h treatment with 45µM Cd2+. A 7h treatment with the
same Cd2+ concentration caused a 45% reduction in cell viability.
The thiol reducing agent NAC significantly (p<0.05) attenuated the loss in cell viability
caused by 7h [Fig.6A(a)] or 24h [Fig.6B(a)] treatments with the three Cd2+ concentrations tested.
Moreover, Celecoxib, a COX-2 specific inhibitor, significantly (p<0.05) lessened the cytotoxic
effect of 7h incubations with the same three Cd2+ concentrations [Fig.6A(b)]. The COX-2
inhibitor was less effective after 24h incubations with the heavy metal by only significantly
(p<0.05) preventing the loss of viability of cells treated with 15µM Cd2+ [Fig.6B(b)]. These
findings suggest that the induction of a pro-inflammatory response is one of the early
mechanisms activated by Cd2+ and plays an important role in its cytotoxicity. However, in longer
exposures to the heavy metal, other cytotoxic mechanisms may be sufficiently activated to
override the effect of the pro-inflammatory response alone. COX-2 activity may then contribute
to the acceleration of the cytotoxic process.
Remarkably, ascorbic acid failed to prevent the loss of cell viability caused by Cd2+-
treatment. In some instances, this free radical scavenger even intensified Cd2+-cytotoxicity [Fig.
6B(c)]. As discussed below, this effect could be due to a synergism between the anti-oxidant and
cadmium in causing lipid peroxidation (see Discussion).
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 14: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/14.jpg)
14
Inhibitors of transcription (actinomycin D) or translation (puromycin) did not
significantly alter the loss of cell viability caused by 24h treatments with Cd2+ [Fig. 6B(d) and
(e), respectively]. These results suggest that, under these conditions, de novo protein synthesis of
COX-2 is not the sole contributor to the cytotoxic process.
It should be noted that some of the drugs tested in these experiments, namely Celecoxib,
actinomycin D and puromycin, were slightly cytotoxic. Their effect on Cd2+-mediated loss in cell
viability, therefore, reflects a comparison to cells treated with the drugs alone.
Cadmium Induces the Production of HNE-protein Adducts in HT4 neuronal cells – One
of the effects of Cd2+-induced oxidative stress is lipid peroxidation. Since HNE is a product of
lipid peroxidation, we investigated if the heavy metal causes the formation of this highly
cytotoxic aldehyde. Fig. 7 shows that 15, 30 and 45µM Cd2+ induce the formation of HNE-
protein adducts. These protein conjugates, with molecular masses above 132 kDa, are indicated
at the top of the Western blot shown in Fig.7. Since HNE is known to be an extremely reactive
electrophile, it is possible that the cytotoxic effect of Cd2+ is potentiated by this aldehyde.
The Cd2+-induced HNE-protein adducts were not detected in HT4 cells pre-treated with
NAC (Fig. 7, right lanes). The latter is a sulfur-containing anti-oxidant, which reacts directly
with free radicals and may, therefore, prevent lipid peroxidation.
NAC, but not Ascorbic Acid, Prevents the Cadmium-induced Rise in COX-2 levels as well as the
Decline in GSH levels and Attenuates PGE2-production - To further test the hypothesis that
oxidation of protein thiols and ROS production are events that mediate Cd2+ toxicity we
attempted to block some of the heavy metal effects with the thiol reducing agent NAC. As seen
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 15: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/15.jpg)
15
in Fig. 8, 1mM NAC prevented the Cd2+-induced increase in COX-2 protein levels (Fig. 8A,
middle panel) and decline in glutathione (Fig. 8B), the latter measured after a 24h treatment with
45µM Cd2+. In addition, NAC attenuated the Cd2+-induced rise in PGE2 levels detected in HT4
cells incubated with the heavy metal for 7h (Fig. 8C). Ascorbic acid (1mM) did not block the
Cd2+-induced rise in COX-2 levels (Fig. 8A, right panel). More importantly, the decrease in GSH
and the increase in PGE2 levels caused by the heavy metal were potentiated by ascorbic acid by
a factor of 5-fold and 10 to 38-fold, respectively (Fig. 8B and D).
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 16: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/16.jpg)
16
DISCUSSION
The aim of this study was to identify mechanisms activated by disruption of the
intracellular oxidation-reduction homeostasis and accumulation of ubiquitinated proteins, which
could contribute to neuronal cell death. For this purpose, we treated mouse HT4 neuronal cells
with cadmium, since the heavy metal is an oxidative stressor that depletes GSH, increases the
levels of protein-mixed disulfides and leads to the accumulation of ubiquitinated proteins and
neuronal cell death (19).
The present investigations reveal that Cd2+ specifically enhances COX-2 gene expression,
at the mRNA and protein levels, without affecting COX-1 expression in the HT4 neuronal cells.
In addition, the heavy metal induces a rise in the production of PGE2, a pro-inflammatory
prostaglandin that is a product of COX-2. This result demonstrates that the de novo synthesized
COX-2, resulting from Cd2+ induction, is enzymatically active. Moreover, the increases in COX-
2 expression were detected as early as a 10h treatment with 15µM Cd2+ suggesting that the
induction of a pro-inflammatory response is an early event in the cellular reaction to the heavy
metal.
Whether the accumulation of ubiquitinated proteins and/or COX-2 up-regulation are a
cause or a consequence of Cd2+ cytotoxicity in our system remains unclear. Nevertheless, the
cellular events brought about by the heavy metal in HT4 neuronal cells (19 and herein) mimic
those we reported for proteasome inhibitors (22). Like oxidative stress induced by cadmium,
proteasome inhibition leads to the accumulation of ubiquitinated proteins, to the induction of a
pro-inflammatory response and to a loss in cell viability. Therefore, the data presented herein
together with our previous findings from studies with cadmium or proteasome inhibitors (19;22)
suggest that disruption of the ubiquitin/proteasome pathway cooperates with COX-2 function in
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 17: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/17.jpg)
17
a neurodegenerative pathway. The fact that COX-2 plays a role in neurodegeneration is
supported by several studies. For example, up-regulation of COX-2 precedes the appearance of
NFT-containing neurons and neurodegeneration in patients with Fukuyama-type congenital
muscular dystrophy, a neurodegenerative disorder transmitted through autosomal recessive
inheritance (28). Similarly, both NFT-containing and damaged neurons in Down's syndrome and
AD were found to exhibit high expression of COX-2 (29). ROS produced by COX-2 could be
responsible for its role in the neurodegenerative process. It is well established that ROS are by-
products of prostaglandin biosynthesis by cyclooxygenases and these ROS are regarded as
important contributors to tissue damage resulting from, for example, brain injury and ischemia
(28;30).
Interestingly, ROS are currently being considered to act not only as toxic metabolites but
also as signaling molecules that may regulate cellular processes such as apoptosis (31;32). ROS
derived from Cd2+treatment may cause lipid peroxidation (33). One of the products of lipid
peroxidation, HNE, is a highly reactive aldehyde recognized as one of the most important
mediators of the cytopathological effects of oxidative stress (34). Our observation that Cd2+
caused formation of HNE-protein adducts, indicates that HNE may, in fact, be one of the
molecules triggering some of the intracellular responses to Cd2+. In support of this hypothesis, a
study involving a screen of 15 different oxidized fatty acid metabolite products of lipid
peroxidation, revealed that HNE was the only specific inducer of COX-2 in rat liver epithelial
RL34 cells (35). Moreover, HNE-modified proteins were shown to become ubiquitinated (36)
and act as non-competitive inhibitors of the proteasome (37). Other studies demonstrated that
HNE can directly modify the proteasome and inhibit its trypsin-like and caspase-like activities
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 18: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/18.jpg)
18
(36). Consequently, under the conditions tested in our studies, HNE may be one of the molecules
contributing to COX-2 up-regulation as well as to the accumulation of ubiquitinated proteins.
To confirm that ROS production mediates some of the Cd2+effects we treated HT4 cells
with two anti-oxidants, namely NAC and ascorbic acid. NAC is a thiol-reducing agent known to
increase GSH pools and to react with ROS in cells (38;39). The present studies demonstrate that
NAC attenuates the Cd2+ effects on cytotoxicity, formation of HNE-protein adducts, COX-2
induction and PGE2 production as well as the decline in GSH, confirming that oxidative stress is
an important mechanism mediating cadmium toxicity. The demonstration that NAC decreases
the HT4 neuronal cell loss in viability induced by 45µM Cd2+ underscores the capability of the
thiol reducing agent to protect cells from oxidative stress. Due to their anti-oxidant properties,
thiol reducing agents such as NAC are emerging as potential therapeutic drugs to manage
neurodegenerative disorders such as PD (38;39).
Ascorbic acid is an anti-oxidant and free radical scavenger effective against peroxyl- and
hydroxyl-radicals, superoxide, singlet oxygen and peroxynitrite [reviewed in (40)]. In our
studies, however, ascorbic acid failed to prevent Cd2+ cytotoxicity. It acted instead as a pro-
oxidant in the presence of the heavy metal potentiating its decrease in GSH. This free radical
scavenger also increased the levels of cytotoxicity and PGE2 production induced by Cd2+. A
recent report demonstrated that ascorbic acid in the presence of transition metals stimulates the
decomposition of products of lipid peroxidation to fatty acid metabolites such as HNE (41). Cd2+
is a transition metal and a synergism between ascorbic acid and the heavy metal may, therefore,
be responsible for enhancing its cytotoxicity.
We also investigated if COX-2 inhibition would prevent the loss of cell viability induced
by Cd2+. Our studies revealed that Celecoxib, a COX-2 specific inhibitor, increased the survival
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 19: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/19.jpg)
19
rate of HT4 cells treated with 15, 30 and 45 µM Cd2+ for 7h and 15µM Cd2+ for 24h. This effect
may be due to Celecoxib blocking a cyclooxygenase-mediated toxic pathway that is independent
of eicosanoid biosynthesis. In this pathway lipid hydroperoxides, which are the precursors of
fatty acid metabolites such as HNE, are produced enzymatically by cyclooxygenases (41). COX-
2 was found to be more efficient in producing this enzymatic reaction than COX-1 (41). Our
studies demonstrated that Celecoxib, however, failed to significantly promote cell survival of
HT4 cells treated for 24h with 30 and 45µM Cd2+. The Celecoxib effect on Cd2+ cytotoxicity,
therefore, becomes concentration-dependent after longer treatments with the heavy metal. These
results suggest that COX-2 activation plays an important role in the early phase of the cytotoxic
process initiated by Cd2+. COX-2 inhibition, therefore, could be an important target for
therapeutic intervention in the initial stages of neurodegeneration associated with oxidative
stress. Accordingly, other studies demonstrated that treatment of AD patients with non-steroidal
anti-inflammatory drugs (NSAIDs), which inhibit cyclooxygenases, slows the progression of the
disease proportionally to the duration of the treatment (42).
Our studies indicate that Cd2+ may prevent COX-2 turnover, since treatment with the
heavy metal promotes the accumulation of ubiquitin-COX-2 conjugates. These findings are
consistent with our previous demonstration that ubiquitin-COX-2 conjugates appear in HT4 cells
treated with proteasome inhibitors (22), suggesting that COX-2 may be turned over by the
ubiquitin/proteasome pathway. In addition, Cd2+ most likely perturbs COX-2 glycosylation.
Accordingly, an unglycosylated 65 kDa form of COX-2 was consistently detected in Cd2+ -
treated but not in control cells. The heavy metal also increases the protein levels of the 72 and 74
kDa COX-2 forms, which are N-glycosylated at three and four sites, respectively (27). N-
Glycosylation of cyclooxygensases at three sites is required for them to achieve a native
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 20: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/20.jpg)
20
conformation and for activity, but the role of N-glycosylation at the fourth site remains unknown
(27).
In summary, these studies demonstrate that disruption of the intracellular sulfhydryl
homeostasis and formation of HNE-protein adducts mediate Cd2+ cytotoxicity. The heavy metal
induces the accumulation of ubiquitinated proteins, cell death (19) and a pro-inflammatory
response manifested by up-regulation of COX-2 (shown in this report). It is possible that
neurodegenerative factors, such as genetic make-up, age or environmental toxins that mimic the
cadmium effects, contribute to the development of initial cellular lesions containing
ubiquitinated proteins. These neuronal inclusions, which are hallmarks of neurodegeneration,
may, themselves, lead to neuronal cell death. The neurodegenerative process, however, could be
exacerbated by stimulation of a pro-inflammatory response that would contribute to a more rapid
decline in neuronal survival. Inhibition of COX-2 activation in the initial phases of the
neurodegenerative process may, therefore, be an important target for preventive therapy.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 21: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/21.jpg)
21
REFERENCES
1. Chung, K. K., Zhang, Y., Lim, K. L., Tanaka, Y., Huang, H., Gao, J., Ross, C. A., Dawson, V. L., and Dawson, T. M. (2001) Nat.Med. 7, 1144-1150
2. Figueiredo-Pereira ME and Rockwell, P. (2001) The ubiquitin/proteasome pathway in neurological disorders. In Banik, N. L., Lajtha, A., and Smith, M., editors. Proteolysis in the pathophysiology of neurodegenerative disease, Kluwer Academic/Plenum Publishers, New York, N.Y. pp. 137-153.
3. Sisodia, S. S. (1998) Cell 95, 1-4
4. Andersen, J. K. (2000) Mech.Ageing Dev. 118, 15-22
5. Bence, N. F., Sampat, R. M., and Kopito, R. R. (2001) Science 292, 1552-1555
6. van Leeuwen, F. W., de Kleijn, D. P., van den Hurk, H. H., Neubauer, A., Sonnemans, M. A., Sluijs, J. A., Koycu, S., Ramdjielal, R. D. J., Salehi, A., Martens, G. J. M., Grosveld, F. G., Peter, J., Burbach, H., and Hol, E. M. (1998) Science 279, 242-247
7. Lam, Y. A., Pickart, C. M., Alban, A., Landon, M., Jamieson, C., Ramage, R., Mayer, R. J., and Layfield, R. (2000) Proc.Natl.Acad.Sci.U.S.A 97, 9902-9906
8. Keller, J. N., Hanni, K. B., and Markesbery, W. R. (2000) J Neurochem 75, 436-439
9. Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M. E. (1998) Cell 95, 55-66
10. Markesbery, W. R. and Carney, J. M. (1999) Brain Pathol 9, 133-146
11. Fahn, S. and Cohen, G. (1992) Ann Neurol 32, 804-812
12. Grune, T., Reinheckel, T., and Davies, K. J. (1997) FASEB J 11, 526-534
13. Berlett, B. S. and Stadtman, E. R. (1997) J.Biol.Chem. 272, 20313-20316
14. Chao, C. C., Ma, Y. S., and Stadtman, E. R. (1997) Proc Natl Acad Sci U S A 94, 2969-2974
15. Sadis, S., Atienza, C. J., and Finley, D. (1995) Mol Cell Biol 15, 4086-4094
16. Acan, N. L. and Tezcan, E. F. (1995) Biochem Mol Med 54, 33-37
17. Stohs, S. J. and Bagchi, D. (1995) Free Radic Biol Med 18, 321-336
18. Jungmann, J., Reins, H. A., Schobert, C., and Jentsch, S. (1993) Nature 361, 369-371
19. Figueiredo-Pereira, M. E., Yakushin, S., and Cohen, G. (1998) J Biol Chem 273, 12703-12709
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 22: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/22.jpg)
22
20. Figueiredo-Pereira, M. E. and Cohen, G. (1999) Mol Biol Rep 26, 65-69
21. Whittemore, S. R., Holets, V. R., Keane, R. W., Levy, D. J., and McKay, R. D. (1991) J Neurosci Res 28, 156-170
22. Rockwell, P., Yuan, H., Magnusson, R., and Figueiredo-Pereira, M. E. (2000) Arch Biochem Biophys 374, 325-333
23. Pereira, M. E., Yu, B., and Wilk, S. (1992) Arch Biochem Biophys 294, 1-8
24. Figueiredo-Pereira, M. E., Efthimiopoulos, S., Tezapsidis, N., Buku, A., Ghiso, J., Mehta, P., and Robakis, N. K. (1999) J Neurochem 72, 1417-1422
25. Mosmann, T. (1983) J Immunol Methods 65, 55-63
26. Mytilineou, C., Han, S. K., and Cohen, G. (1993) J Neurochem 61, 1470-1478
27. Otto, J. C., DeWitt, D. L., and Smith, W. L. (1993) J Biol Chem 268, 18234-18242
28. Oka, A., Itoh, M., and Takashima, S. (1999) Neuropediatrics 30, 34-37
29. Oka, A. and Takashima, S. (1997) Neuroreport 8, 1161-1164
30. Sairanen, T., Ristimaki, A., Karjalainen-Lindsberg, M. L., Paetau, A., Kaste, M., and Lindsberg, P. J. (1998) Ann Neurol 43, 738-747
31. Sen, C. K. (2000) Curr.Top.Cell Regul. 36, 1-30
32. Carmody, R. J. and Cotter, T. G. (2001) Redox.Rep. 6, 77-90
33. Stohs, S. J., Bagchi, D., Hassoun, E., and Bagchi, M. (2001) J.Environ.Pathol.Toxicol.Oncol. 20, 77-88
34. Minekura, H., Kumagai, T., Kawamoto, Y., Nara, F., and Uchida, K. (2001) Biochem.Biophys.Res.Commun. 282, 557-561
35. Kumagai, T., Kawamoto, Y., Nakamura, Y., Hatayama, I., Satoh, K., Osawa, T., and Uchida, K. (2000) Biochem.Biophys.Res.Commun. 273, 437-441
36. Okada, K., Wangpoengtrakul, C., Osawa, T., Toyokuni, S., Tanaka, K., and Uchida, K. (1999) J Biol Chem 274, 23787-23793
37. Friguet, B. and Szweda, L. I. (1997) FEBS Lett 405, 21-25
38. Martinez, M., Martinez, N., Hernandez, A. I., and Ferrandiz, M. L. (1999) Life Sci. 64, 1253-1257
39. Martinez, M., Hernandez, A. I., and Martinez, N. (2000) Brain Res. 855, 100-106
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 23: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/23.jpg)
23
40. Rice, M. E. (2000) Trends Neurosci 23, 209-216
41. Lee, S. H., Oe, T., and Blair, I. A. (2001) Science 292, 2083-2086
42. Stewart, W. F., Kawas, C., Corrada, M., and Metter, E. J. (1997) Neurology 48, 626-632
FOOTNOTES
Abbreviations: AD, Alzheimer's disease; Cd2+, cadmium; COX-1 and COX-2, cyclooxygenase-
1 and 2, respectively; DMSO, dymethyl sulfoxide; GSH, glutathione; HNE, 4-hydroxy-2-
nonenal; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; NAC, N-acetyl-
L-cysteine; NFT, neurofibrillary tangles; PD, Parkinson's disease; PBS, phosphate buffered
saline; PGs, prostaglandins; ROS, reactive oxygen species.
Acknowledgments: We would like to dedicate this article to the memory of Dr. Gerald Cohen,
from the Department of Neurology, Mount Sinai School of Medicine, New York, NY. We are
grateful to Ms. Natasa Kesler and Ms. Faith Harrow for technical assistance and to Pharmacia
Corporation (Peapack, N.J.) for providing Celecoxib. This work was supported by grants from
the National Institutes of Health (NIH) (NS34018 to M.E.F.-P. and SO660654 a MBRS SCORE
to Hunter College of CUNY) and a core facility grant from the Research Centers in Minority
Institutions-NIH.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 24: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/24.jpg)
24
FIGURE LEGENDS
Figure 1 - Cadmium increases intracellular COX-2 protein levels – The immunoblots show
COX-2 in HT4 cell lysates (20 µg protein/lane) prepared as described under "Experimental
Procedures". Cells were incubated at 37oC for 10h (A), 16h (B), 24h (C) and 48h (D) with
aqueous solutions of CdSO4 at the concentrations shown above panel A. (E) represents the semi-
quantitative analysis of the immunoblots shown in A-D and indicates the changes in COX-2
levels after 10h (!), 16h ("), 24h (#) and 48h ($) of treatment. The combined quantification
of the 65, 72 and 74kDa COX-2 immunostained forms was by image analysis as described under
"Experimental Procedures". The values (y axis) are displayed as pixels, the units obtained from
the densitometry scans. The blots shown are representative of one of at least three identical
experiments for each condition tested. Molecular mass markers in kDa are shown on the left. Ub-
COX-2, ubiquitinated COX-2.
Figure 2 - Cadmium increases COX-2 gene expression (A) – Semi-quantitative RT-PCR
detection of cox-2 (top panel) and ubA (bottom panel) gene expression as described under
"Experimental Procedures". HT4 cells were incubated at 37oC for 24h with the Cd2+
concentrations shown in the figure. The results presented are representative of at least two
independent experiments. The plot on the bottom of (A) represents the semi-quantification of the
respective bands by densitometry [(!) for cox-2 and ($) for ubA]. (B) and (C) - Immunoblots
of HT4 cell lysates (20 µg protein/lane) showing COX-2 [B (upper panel) and C] and COX-1 [B
(lower panel)] . Cells were incubated at 37oC for 24h without or with the Cd2+ concentrations
listed above the Western blot panels. In (C) cells were treated with 15µg/ml of the
transcriptional inhibitor actinomycin D (Act.) or with 25µg/ml of the translational inhibitor
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 25: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/25.jpg)
25
puromycin (Pur.) for one hour prior to the addition of Cd2+. The blots shown are representative
of one of at least three identical experiments for each condition tested. Molecular mass markers
in kDa are shown on the left. Ub-COX-2, ubiquitinated COX-2.
Figure 3 - Cadmium enhances production of the proinflammatory prostaglandin PGE2.
The levels of PGE2 produced by HT4 cells were assessed by ELISA as described under
"Experimental Procedures". Untreated HT4 cells produce approximately 0.25ng of PGE2/ml
media. Each curve represents changes in PGE2 levels following incubations with increasing
Cd2+-concentrations for 10h ($), 16h (!), 24h (") and 48h (#). Data represent mean ng of
PGE2 produced per ml of media from two determinations within a representative experiment.
Figure 4 - Cadmium causes the accumulation of ubiquitin-COX-2 conjugates -
Electrophoretic mobilities of COX-2 forms immunoprecipitated with the anti-COX-2 antibody
from HT4 cells incubated at 37oC for 24h with the Cd2+ concentrations listed in the figure.
Immunoblots of the precipitated proteins were probed with anti-COX-2 antibody (B) and then
stripped and reprobed with the anti-ubiquitin protein conjugates antibody (A). Electrophoretic
mobilities of the goat anti-COX IgG heavy (HC) and light (LC) chains are identified in (C) by
open arrows on the right. Molecular mass markers in kDa are also shown on the right. The blots
shown are representative of one of at least two identical experiments for each condition tested.
IgG, goat anti-COX IgG; Ub-COX-2, ubiquitinated COX-2.
Figure 5 - Cadmium perturbs COX-2 glycosylation - Electrophoretic mobilities of native (A)
and unglycosylated (B) COX-2 forms from HT4 cell lysates (20 µg protein/lane) incubated at
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 26: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/26.jpg)
26
37oC for 24h with the Cd2+ concentrations listed in the figure. Unglycosylated COX-2 was
obtained by treating the cells with tunicamycin (10 µg/ml) 1h prior to the addition of cadmium.
The blots shown are representative of one of at least two identical experiments for each condition
tested. Molecular mass markers in kDa are shown on the left. Tun., tunicamycin.
Figure 6 - Identification of drugs that attenuate cadmium cytotoxicity. HT4 cells were
treated with the drugs listed below for 1h prior to a 7h (A) or 24h (B) incubation with increasing
concentrations of CdSO4. ! - Vehicle; (a) 1mM NAC; (b) 20µM Celecoxib; (c) 1mM Ascorbic
Acid; (d) 15µg/ml actinomycin D and (e) 25µg/ml Puromycin. Cell viability was assessed by the
MTT assay as described under "Experimental Procedures". Data represent the mean and S.E.
from at least three determinations and are shown as percentage of cell viability measured for
each drug treatment without Cd2+ (control, 100%). The (*) identifies the values that are
significantly different (at least p<0.05) from the respective treatments with cadmium only ( ! ).
Figure 7 - Cadmium causes the formation of HNE-protein adducts - Immunoblot showing
HNE-protein adducts in HT4 cell lysates (20 µg protein/lane) prepared as described under
"Experimental Procedures". Cells were incubated at 37oC for 24h with aqueous solution of
CdSO4 at the concentrations listed on the figure. Where indicated (6 lanes on the right), cells
were treated with 1mM N-acetyl-cysteine (NAC) for one hour prior to the addition of cadmium.
The immunoblot shown is representative of one of two identical experiments for each condition
tested. Molecular mass markers in kDa are shown on the right. HNE, 4-hydroxy-2-nonenal.
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 27: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/27.jpg)
27
Figure 8 - NAC and ascorbic acid effects on HT4 cells treated with cadmium- The effect of
NAC or ascorbic acid (Asc.) was assessed on the levels of COX-2 (A), glutathione (B) and PGE2
(C and D) in HT4 cells treated with increasing concentrations of Cd2+. Cells were incubated with
1mM NAC or 1mM Asc. 1h prior to a 24h treatment with Cd2+ when assayed for COX-2 (A) and
GSH levels (B) or 7h treatment with Cd2+ for PGE2 levels (C and D). After the indicated
treatments, the cells were harvested and prepared for COX-2 immunoblotting (A) or
measurements of glutathione (B). PGE2 levels in the media (C and D) were carried out as
indicated under "Experimental Procedures". The plot on the bottom of (A) represents the semi-
quantification, by densitometry, of the changes in COX-2 levels in HT4 cells treated with Cd2+
only (!), or Cd2+ in combination with NAC (") or Asc. ($). The values (y axis) are displayed
as fold-increases in COX-2 levels compared to no cadmium treatment, which was given an
arbitrary value of one. The blots shown are representative of one of at least two identical
experiments for each condition tested. (B), (C) and (D) represent the mean and S.E. of at least
three determinations. " - cadmium only; ! - NAC and Cd2+; ▤- ascorbic acid and Cd2+. The
(*) in B identifies the values that are significantly different (at least p<0.05) from the respective
controls treated without cadmium ( " ).
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from
![Page 36: N-acetyl-cysteine and celecoxib lessen cadmium ... · 5/7/2002 · production of free radicals by oxidative stress promotes partial unfolding of cellular proteins, resulting in exposure](https://reader035.fdocuments.us/reader035/viewer/2022071016/5fcf7e4870b51b57846109a9/html5/thumbnails/36.jpg)
Maria E. Figueiredo-Pereira, Zongmin Li, Marlon Jansen and Patricia Rockwellcyclooxygenase-2 up-regulation
N-acetyl-cysteine and celecoxib lessen cadmium cytotoxicity which is associated with
published online May 7, 2002J. Biol. Chem.
10.1074/jbc.M109145200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on Decem
ber 8, 2020http://w
ww
.jbc.org/D
ownloaded from