Mutations in BBS2 Cause Apparent Nonsyndromic Retinitis ...2020/06/03 · Retinitis pigmentosa (RP)...

1

Mutations in BBS2 Cause Apparent Nonsyndromic Retinitis Pigmentosa

Meghan DeBenedictis2, Joseph Fogerty1, Gayle Pauer1, John Chiang3, Stephanie A.

Hagstrom1, Elias I. Traboulsi1,2 and Brian D. Perkins1

1Department of Ophthalmic Research, and the 2Center for Genetic Eye Diseases, Cole

Eye Institute, Cleveland Clinic, Cleveland, OH, 44195; 3Molecular Vision Laboratory,

Hillsboro, OR

Corresponding author:

Brian D. Perkins, Ph.D.

Department of Ophthalmic Research

Cleveland Clinic

Cleveland, OH 44195, USA

[email protected]

.CC-BY-NC-ND 4.0 International licenseavailable under awas not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made

The copyright holder for this preprint (whichthis version posted June 3, 2020. ; https://doi.org/10.1101/2020.06.03.130518doi: bioRxiv preprint

https://doi.org/10.1101/2020.06.03.130518

http://creativecommons.org/licenses/by-nc-nd/4.0/

2

Abstract

Purpose: To identify and functionally test the causative mutations in the BBS2 gene in

a family presenting with retinitis pigmentosa and infertility and to generate a bbs2-/-

mutant zebrafish.

Methods: A female proband and her male sibling were clinically evaluated and genetic

testing with targeted next-generation sequencing was performed. Mutations were

verified by Sanger sequencing. Protein localization was examined by transient

expression and immunocytochemistry in cultured HEK-293T cells. Mutations in the

zebrafish bbs2 gene were generated by CRISPR/Cas9 and retinal phenotypes were

examined by immunohistochemistry.

Results: The proband and her brother exhibited reduced visual fields, retinal

degeneration, and bone spicule deposits, consistent with retinitis pigmentosa. The

brother also reported symptoms consistent with infertility. Compound heterozygous

mutations in the BBS2 gene; namely NM_031885.4 (BBS2):c.823C>T (p.R275X) and

NM_031885.4 (BBS2):c.401C>G (p.P134R), were identified in the proband and her

brother. Both mutations interfered with ciliary localization of Bbs2 in cell culture.

Mutation of the zebrafish bbs2 gene resulted in progressive cone degeneration and

rhodopsin mislocalization.

Conclusion: Missense mutations of BBS2 leads to non-syndromic retinitis pigmentosa,

but not Bardet-Biedl Syndrome, even though Bbs2 fails to localize to cilia. In zebrafish,

the complete loss of bbs2 results in cone degeneration and ciliopathy phenotypes,

indicating a requirement for Bbs2 in photoreceptor survival.



https://doi.org/10.1101/2020.06.03.130518


3

Introduction

Bardet-Biedl Syndrome (BBS) is a rare, autosomal recessive group of disorders

that exhibits significant phenotypic and genetic heterogeneity. BBS results from

dysfunction of the cilia and is referred to as a ciliopathy. The clinical features of

different ciliopathies often overlap, making the diagnosis of BBS challenging in some

cases. BBS is characterized by the primary features of postaxial polydactyly, truncal

obesity, retinal degeneration, cognitive impairment, renal anomalies, and

hypogonadism. Secondary features include among others hypertension, diabetes

mellitus, hepatic fibrosis, hearing loss, dental abnormalities (hypodontia and dental

crowding), congenital heart defects, brachydactyly, speech disorder, ataxia, and

polydipsia-polyuria. A clinical diagnosis of BBS requires the presence of four of the

primary features or three primary and two secondary features [1]. The prevalence of

BBS differs between populations, with an incidence of approximately 1/160,000 in

European populations [2] to as high at 1/13,000 among Bedouins in Kuwait [3].

Mutations in at least 21 different genes cause BBS and many of these genes

encode proteins that regulate ciliary protein trafficking [4]. BBS2 (OMIM 606151) is one

of eight highly conserved BBS proteins (BBS1, 2, 4, 5, 7, 8, 9, and 18) that form the

BBSome, a protein complex that functions as a “ciliary gatekeeper” and regulates the

entry and removal of specific membrane proteins from the cilium [5, 6]. The

pathological features of BBS are thought to be linked to mislocalization and/or defects in

ciliary trafficking of various proteins, including several G-protein coupled receptors

(GPCRs), the leptin receptor, and the insulin receptor [7-12]. Nonsense, frameshift, and

missense mutations in BBS2 can result in BBS [13, 14].

The most penetrant feature of BBS is retinal dystrophy, with almost 97% of

patients exhibiting some form of retinopathy [15]. Patients typically develop night

blindness in the first decade of life and subsequently lose peripheral vision and visual

acuity, all symptoms consistent with retinitis pigmentosa [4, 16]. Retinitis pigmentosa

(RP) is a genetically heterogeneous condition with multiple inheritance patterns,

including autosomal recessive (30-40% of cases), autosomal dominant (50-60%), and

X-linked (5-15%) and is the most common hereditary retinal degenerative disease [17].

While the majority of RP cases remain isolated to the eye, up to 30% of patients can



https://doi.org/10.1101/2020.06.03.130518


4

also exhibit extra-ocular manifestations indicating a syndromic association of the retinal

dystrophy; this group of conditions includes BBS that accounts for up to 5% of all RP

cases [17]. Here we describe a proband with compound heterozygous missense and

nonsense variants in BBS2 who presented with apparent nonsyndromic RP and her

brother, who was affected by RP and infertility. These mutations disrupted ciliary

localization of BBS2 protein in cultured cells. The generation of zebrafish with truncating

mutations in bbs2 resulted in progressive retinal degeneration and phenotypes

consistent with cilia defects.



https://doi.org/10.1101/2020.06.03.130518


5

Methods

Clinical Evaluation

Retinal examinations, DNA sample acquisition, and molecular analysis were approved

by the Cleveland Clinic Institutional Review Board (IRB). Written informed consent was

obtained from the patients and was in accordance with HIPAA regulations and the

tenets of the Declaration of Helsinki. The proband was evaluated in a specialized retinal

dystrophy clinic. Family and medical histories were obtained and reviewed. Fundus

photography, Goldmann visual field testing, and optical coherence tomography were

performed.

Molecular analysis

The proband’s DNA was sequenced for mutations in the retinal dystrophy genes via

next generation sequencing (NGS) in a Clinical Laboratory Improvement Amendments

(CLIA)-certified laboratory. Her brother’s and parent’s samples underwent targeted

variant analysis in the Hagstrom laboratory. Genomic DNA was isolated from leukocyte

nuclei prepared from blood samples as recommended by the manufacturer

(QuickGene-610L; autogen). Saliva was collected in OG-250 Oragen DNA collection

kits (DNA Genotek, Ottawa, ON, Canada) and processed using the PrepIT*L2P protocol

(DNA Genotek, Ottawa, ON, Canada). Genetic analysis was performed with NGS via

analysis of an inherited retinal dystrophy gene panel to identify the underlying cause of

disease. 131 RP genes were known and screened at the respective time of analysis.

Following the identification of the mutation in the proband, targeted analysis was

performed in the family’s samples. The DNA was amplified for exons 3 and 8 of the

BBS2 gene (AF342736). Primer pairs were designed for both exons. (Exon 3 forward:

CTGTTTTACTCAAAATCTGCTCAG and reverse:

AAAGTAAAAATGCTTAAGGGTACC; Exon 8 forward:

AGAATACTCTTGAAAACTGCTAGA and reverse: CTTTTTAAGGATTTTTCTCATCCC)

Amplification was performed at an annealing temperature of 54 ºC using Choice TM Taq

Mastermix DNA Polymerase (Denville Scientific, Inc, Metuchen, NJ). PCR products

were analyzed by direct sequencing using an automated sequencer. (3130XL, Life



https://doi.org/10.1101/2020.06.03.130518


6

Technologies Corporation Grand Island, NY). In silico analysis of the identified

missense variants was conducted using the Polyphen-2, pMut, and SIFT algorithms.

Disease gene collections and targeted capture probes design

283 genes for 146 monogenic eye diseases were collected by systematic database

(GeneReviews, OMIM, and RetNet) and literature searches, and expert reviews.

Customized oligonucleotide probes were designed to capture the exons and 30 base

pairs of adjacent sequences using NimbleGen (Roche) online oligonucleotide probe

design system.

Targeted sequencing library preparation and sequencing

Targeted sequencing libraries were prepared as following: 1 μg genomic DNA was

sonicated to 200~300 bp sized fragments. This was followed by end-repair, A-tailing,

Illumina adaptors ligation, and 4 cycles of pre-capture PCR amplification and sample

indexing. The indexed PCR product of 20-30 samples were pooled, targeted capture

was performed by hybridizing with capture probes, followed by 15 cycles of PCR

amplification and validation of library products for sequencing. DNA sequencing was

performed on Illumina HiSeq2000 sequencers to generate paired-end reads including

90 bps at each end and 8 bps of the index tag.

Data filtering and analysis

Image analysis and base calling were performed using the Illumina Pipeline. Indexed

primers were used for the data fidelity surveillance. Only reads that matched theoretical

adapter indexed sequences and theoretical primer indexed sequences with no more

than three mismatches were considered as valid reads. The human reference genome

was obtained from the NCBI database, version hg19. Sequence alignment was

performed using BWA (Burrows Wheeler Aligner) Multi-Vision software package (Li and

Durbin, 2009). SNPs were called using SOAPsnp (Li et al., 2009) and Indels were

identified using the GATK IndelGenotyper

(http://www.broadinstitute.org/gsa/wiki/index.php/, The Genome Analysis Toolkit).



https://doi.org/10.1101/2020.06.03.130518


7

Animal Maintenance

Wild-type zebrafish of an AB/Ekkwill hybrid strain were maintained and housed at

approximately 28 °C on a 14/10 light/dark cycle using standard procedures [18] and with

approval by the Institutional Animal Care and Use Committee (IACUC) at the Cleveland

Clinic.

CRISPR/Cas9 gene editing

Potential CRISPR target sites were identified in exon 4 of the zebrafish bbs2 gene using

ZiFiT (http://zifit.partners.org/ZiFiT/) [19] and gRNA synthesis was performed according

to the protocol by Talbot and Amacher [20]. Briefly, oligonucleotides for gRNA

synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’

AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274

(Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New

England BioLabs, Beverly, MA) and used for in vitro transcription reaction to generate

gRNA. Zebrafish embryos were injected at the 1-cell stage with a 1 nL solution of bbs2

gRNA (200 ng/µL) and Cas9 protein (10 µM; New England BioLabs, Beverly, MA).

Mutagenesis was confirmed by High Resolution Melt Analysis (HRMA) in injected F0

animals at 3 days post fertilization (dpf). Remaining F0 injected animals were raised to

adulthood and outcrossed to wild-type fish and HRMA was performed on DNA from F1

progeny to screen for mutations. F0 founders producing a high degree of mutant F1

progeny were kept and individual bbs2 alleles identified by sequencing.

Preparation of wild-type and mutant BBS2 constructs

The full-length human BBS2 clone in the pCMV6-entry vector was obtained

commercially (Origene; Clone ID: RC204337). Using this as a template, the human

BBS2 ORF was PCR amplified with gene specific primers and sub-cloned into the

pCDNA3.1V5/His TOPO TA vector (Invitrogen, Carlsbad, CA). The GeneArt Site-

Directed Mutagenesis system (Invitrogen, Carlsbad, CA) was used to engineer two

human BBS2 mutant alleles (P134R and R275X). The BBS2P134R mutant allele was

engineered using mutant primer pairs 5’-

ACATTGGGAGACATTTCTTCCCgTCTTGCGATTATTGGTGGCAAT and 5’



https://doi.org/10.1101/2020.06.03.130518


8

ATTGCCACCAATAATCGCAAGAcGGGAAGAAATGTCTCCCAATGT-3; while the

BBS2R275X mutant allele was engineered using mutant primer pairs 5’-

GAAGGTTGATGCTCGAAGTGACtGAACTGGGGAGGTCATCTTTAA and 5’-

TTAAAGATGACCTCCCCAGTTCaGTCACTTCGAGCATCAACCTTC-3’.

Cell line authentication

HEK-293T cells were authenticated by American Type Tissue Collection (ATCC;

Manassas, VA) using short tandem repeat (STR) analysis. Briefly, seventeen STR loci

and a gender determining locus were amplified using PowerPlex 18D Kit (Promega;

Madison, WI) and analyzed using GeneMapper ID-X v1.2 software (Applied

Biosystems; Foster City, CA). Samples were a 100% match to a reference of human

HEK-293T cells.

Cell culture, transient transfection and immunofluorescence

HEK-293T cells were cultured in DMEM medium containing 10% FBS. For localization

studies, cells were seeded in 6-well dishes with glass cover slips. At 60% confluence,

cells were transfected with 3 μg of either wild-type (BBS2-WT-V5) or mutant BBS2

constructs (BBS2P134R-V5 and BBS2R275X-V5) using FuGENE HD (Roche, Branford, CT)

according to the manufacturer's instructions. Ciliogenesis was induced 24 h post-

transfection by serum starvation using 0.5% FBS. After 24h, cell medium was removed

from cells and washed twice with cold 1X PBS. Cells were fixed with a 4% PFA solution

prepared in 1X PBS and subjected to indirect immunofluorescence. Cilia were detected

using an anti α-acetylated tubulin antibody (Sigma, clone 6-11B-1), while the BBS2-V5

fusion proteins were detected using anti V5 antibody (Abcam, Cambridge, MA). Nuclei

were stained using DAPI in the mounting medium. All mages were obtained using an

epi-florescent microscope (Olympus BX60) equipped with a U-M61002 Tri-pass cube

for DAPI/FITC/Texas Red. All images were obtained under a 100X oil immersion lens.

Experiments were carried out in duplicate and approximately 100 cells, from 10-15

fields, were counted and scored per transfection.

Immunohistochemistry



https://doi.org/10.1101/2020.06.03.130518


9

Immunohistochemistry was performed as previously described [21]. Briefly, zebrafish

larvae were fixed in 4% paraformaldehyde, equilibrated in PBS + 30% sucrose, and

embedded in Tissue Freezing Medium (Electron Microscopy Sciences, Hatfield, PA),

prior to cryosectioning. Adult eyes were likewise fixed 2 hours in PBS + 4%

paraformaldehyde and equilibrated as described [22]. Transverse sections including or

adjacent to the optic nerve were incubating in blocking solution (PBS + 2% BSA, 5%

goat serum, 0.1% Tween-20, 0.1% DMSO) for 1 hr. For cone inner segment analysis,

the length of five Zpr-1+ cells were measured near the synapse at regular intervals

across the retina. Rod outer segment length was measured similarly with zpr3 imaging.

Cone outer segments and PCNA+ nuclei were counted across the entire retina. All

experiments used between 3 and 6 animals per genotype.



https://doi.org/10.1101/2020.06.03.130518


10

Results

Two siblings from a non-consanguineous Caucasian family display features of RP and

no other common signs of ciliopathies

A 40 year-old female presented for evaluation after an initial diagnosis of RP.

Her medical history was significant for recurrent vocal cord carcinoma but otherwise

non-contributory. She reported that her brother, three children, and parents were all

healthy with no complaints of vision loss. A dilated fundus exam showed characteristic

findings of RP, including optic nerve pallor, attenuated vessels, and the presence of

bone spicule pigment deposits in the periphery (Fig. 1A). Her best-corrected visual

acuity was 20/25 OU, but visual fields were significantly restricted (Fig. 1B).

Subjectively, the patient did not appear overweight. The subject reported having no

cardiac, renal, or neurological problems. A full panel analysis of 13 recessive retinitis

pigmentosa genes available at the time was obtained and included BEST1, CNGA1,

CNGB1, CRB1, EYS, LRAT, NR2E3, NRL, PDE6A, PDE6B, RHO, RPE65, and USH2A;

genetic testing did not detect any variants. Later, genetic testing via next generation

sequencing of additional retinal dystrophy genes detected 2 variants in BBS2, a

pathogenic nonsense variant, c.823C>T leading to p.R275X, and a likely pathogenic

missense variation, c.401C>G leading to p.P134R, which was previously identified in an

Indian family with non-syndromic RP [23]. In silico analysis performed on the missense

variant suggested it to be likely pathogenic (Polyphen score 0.957; PMut – pathological;

SIFT score 0.08; potentially tolerated). Cosegregation analysis determined the variants

to be in trans, but also determined the proband’s reportedly unaffected brother was also

positive for both variants (Fig. 2)

These results prompted us to revisit the family and perform a clinical evaluation

on the brother, a 39-year old male. Although he did not report any complaints in visual

function, dilated fundus examinations showed optic disc pallor, bone spicule pigment

deposition, evidence of retinal degeneration, and mild peripheral visual field constriction

(Fig. 3). During this examination he also disclosed fertility problems. His visual acuity

was 20/20 OU. His confrontation visual fields were full and he had no color

discrimination problems on Ishihara testing.



https://doi.org/10.1101/2020.06.03.130518


11

Additional testing was obtained following the molecular diagnosis of BBS to

determine if the female patient had any systemic findings. Her free T4, TSH, and lipid

panel were normal. Her complete metabolic panel and renal function panel were

considered normal, although below the average reference range. Specifically, her

fasting blood glucose was 62 mg/dL (reference range: 65 - 100 mg/dL) and her

creatinine level was 0.58 mg/dL (reference range: 0.70 - 1.40 mg/dL). Prior imaging of

her heart and reproductive organs did not reveal any abnormalities. Her most recent

eye exam at the age of 48 years continued to show evidence of RP. Her best corrected

visual acuity was 20/40 in both eyes and she was noted to have posterior subcapsular

cataracts. Repeat metabolic testing was still normal.

The proband’s brother also had normal LH, FSH, Estradiol 17B, TSH and lipid

panel levels. His blood pressure was normal. He had no history of recurrent pneumonia,

bronchitis, or sinusitis. His complete metabolic panel was within normal limits.

However, his testosterone levels were slightly below normal (173 ng/dL, reference

range: 220 - 1000 ng/dL). Nigrosin-eosin staining of his sperm detected low amounts of

viable sperm (40%, reference range: >75%). Complete semen analysis showed a

decrease in motile sperm (30%, reference range: >40%) and a decrease in normal

sperm heads (2%, reference range: 14-100%). The morphology of his sperm was also

abnormal. Height was unavailable, but he weighed 270 pounds, placing him in the

obese range. This patient was lost to subsequent follow up visits.

The P134R and R275X mutations disrupts ciliary location BBS2 in HEK-293T cells

To investigate the functional consequences of the BBS2P134R and BBS2R275X

alleles, plasmids encoding V5-tagged BBS2 proteins were introduced into HEK-293T

cells (Fig. 4). The wild-type BBS2 protein was consistently seen localizing along the

length of the cilium, as assessed by immunocytochemistry with antibodies against

acetylated alpha tubulin and V5 (Fig. 4A). In contrast, the BBS2P134R mutant failed to

localize to the cilia, was retained within the cytoplasm, and occasionally aggregated

away from the cilium (Fig. 4B). The BBS2R275X mutant also failed to localize to the cilia

and additionally showed punctate staining near the cell surface (Fig. 4C). Taken

together, these data suggested that these mutations interfered with proper targeting or



https://doi.org/10.1101/2020.06.03.130518


12

localization of BBS2 to the cilium. Lack of ciliary localization may be responsible for the

retinal phenotypes associated with mutated BBS2 alleles.

Mutation of zebrafish bbs2 results in progressive cone degeneration

To assess the role of BBS2 in photoreceptor function, we utilized the

CRISPR/Cas9 gene editing system to target exon 4 of the zebrafish bbs2 gene. One

mutant line (lri82) was recovered that resulted in the insertion of a 15-base pair

fragment combined a 4-bp deletion, thereby yielding an 11-bp insertion and a frameshift

with a premature stop codon (Fig. 5A). The truncated protein is predicted to contain the

first 30% of the WD40 domain and then terminate after an additional frameshifted 58

amino acids (Fig. 5B). Founder (F0) animals were outcrossed to wild-type animals to

generate bbs2 heterozygote (bbs2+/-) zebrafish. Genotyping of clutches from bbs2+/-

intercrosses revealed that homozygous offspring (bbs2-/-) appeared normal and were

present in Mendelian ratios at 5 days post-fertilization (dpf) (Fig 5C). bbs2-/- mutants

survived to at least 1 year of age, but developed spinal curvatures and were smaller

than bbs2+/- and wild-type siblings (Fig 5D). These phenotypes resemble those of other

zebrafish ciliopathy mutants [22].

The bbs2-/- zebrafish have normal retinal patterning at 5 dpf, but show early signs

of photoreceptor dysfunction and long-term photoreceptor degeneration in adults. At

larval stages (5 dpf), the inner segments of the red-green double cone photoreceptors

were stained with the zpr-1 antibody, which recognizes arrestin 3-like [24], and with

peanut agglutinin (PNA), which labels the extracellular matrix surrounding cone outer

segments [25]. Although the number of cones and the size of the inner segments was

no different between bbs2-/- mutants and wild-type siblings, the cone outer segments of

bbs2-/- mutants were 20% shorter (5.43 ± 0.03 µm vs. 6.83 ± 0.18 µm, p=0.0015; Figs.

6A and 6B). Both juvenile bbs2-/- mutants (2.5 mpf) and adult bbs2-/- mutants showed

signs of cone disorganization, with both cone inner segments and outer segments being

significantly shorter than wild-type siblings (Figs. 6A, 6C, 6D) and reduced cone

numbers in 6 mpf adults (Fig. 6D). In 6 mpf bbs2-/- mutants, rhodopsin was mislocalized

to the rod inner segments, although the size of the rod outer segments was unchanged

(Figs. 6E and 6F). This phenotype resembled that of the zebrafish cep290-/- mutant,



https://doi.org/10.1101/2020.06.03.130518


13

which also showed signs of degeneration [22]. As retinal injury and cell death is known

to stimulate regeneration of lost retinal neurons through the reprogramming and

proliferation of Müller glia [26], retinal sections were stained with PCNA to identify

proliferating cells. In wild-type retinas, only 1-2 PCNA+ cells were found in either the

inner nuclear layer (INL), where the Müller glia reside, and 4-5 PCNA+ cells in the ONL

that represent rod precursors [27]. In contrast, bbs2-/- zebrafish had a 4-fold increase in

PCNA+ cells in the INL (10.8 ± 3.0 vs 2.5 ± 0.4) and a nearly 7-fold increase in PCNA+

cells in the ONL (35.8 ± 7.7 vs 4.8 ± 0.6; Figs. 6G and 6H). Increased proliferation of

unipotent rod precursors in the ONL indicates regeneration of dying rod photoreceptors.

The limited proliferation of Müller glia in the INL suggest that the slow degeneration in

bbs2-/- mutants was not sufficient to trigger a robust regeneration response.



https://doi.org/10.1101/2020.06.03.130518


14

Discussion

Herein, we report two siblings with compound heterozygous mutations in BBS2

that result in apparently nonsyndromic retinitis pigmentosa, which on detailed

investigation revealed associated male infertility and mild obesity in the male but no

other syndromic signs of BBS in the proband or her brother. The two mutations

detected in the present patients appear more likely to cause retinal dystrophy with little

or no systemic findings. The P134R mutant allele was previously described in a non-

consanguineous family with non-syndromic RP [23]. Although biallelic inheritance of the

R275X allele was clinically diagnosed as BBS [14], the clinical manifestations were

restricted to one or two systems and did not include obesity and polydactyly, two classic

symptoms associated with BBS. The variability in expression of the genetic defect was

not only in the systems involved, but also in the severity of the retinal degeneration.

The female patient in the present report exhibited earlier onset of RP symptoms and

more rapid progression compared to the male sibling.

Clinical and functional data from this study provides further evidence that

pathogenic variants of the BBS2 gene can present with apparent nonsyndromic RP or

male infertility. It is likely that with advancing age the male patient would have shown

symptoms of his retinal dystrophy. Nonsyndromic RP or RP with minimal systemic

features has been described in patients with mutations in six of the BBS genes (BBS1,

BBS3/RP55/ARL6, BBS8/RP51/TTC8, BBS9, BBS12, and BBS14/CEP290) [28-31].

The first report of this association came in 2008 when Cannon et al. reported brothers

who were homozygous for the most common missense mutation in BBS1, p.M390R

[31]. Brother 1 had RP, polydactyly, and some mild learning difficulties but he did not

meet clinical diagnostic criteria for BBS [1]. Similarly, brother 2 had only RP and

polydactyly. A second study that investigated the phenotypic spectrum of the common

p.M390R BBS1 variant found biallelic inheritance in two siblings with nonsyndromic RP

[28]; one patient who was compound heterozygous for the p.M390R variant and a

second missense pathogenic variant, p.L388P with nonsyndromic RP; three patients (3

homozygous and 1 compound heterozygous) were labeled as possibly nonsyndromic

RP; and six patients (5 homozygous and 1 compound heterozygous) with mild BBS.

There was only 1 patient with classic BBS in that study. A study of Saudi patients with



https://doi.org/10.1101/2020.06.03.130518


15

RP found 4 patients in 1 family to be homozygous for the missense mutation, p.A89V in

the BBS3 gene [30]. All had RP without systemic findings. Four members of a family

with a homozygous splice site mutation in BBS8, namely IVS1-2A>G had nonsyndromic

RP [29]. Recently, Shevach et al. reported an association between missense

pathogenic variants in the BBS2 gene and nonsyndromic RP [23]. One of the missense

variants they found is the same missense variant we detected in the present family,

p.P134R. Unlike the patient in that report, the second pathogenic variant we report is a

nonsense variant. This observation further broadens both the phenotypic and genetic

spectrum of BBS alleles.

While BBS is largely an autosomal recessive disease, a number of reports have

attributed phenotypic variability to triallelism [14]. In one study aimed at testing the

hypothesis that triallelism causes clinical variability, a homozygous deletion of exon 6 in

the BBS9 gene was detected in three sisters [32]. One of these patients had all the

primary features of BBS, while her two sisters had RP but none of the other BBS

features. No other variants were found in any of the other BBS genes in this family. One

study found a novel BBS12 variant, p.S701X, in three affected individuals of a

consanguineous family. All three had postaxial polydactyly and retinal degeneration.

There were no renal or genital anomalies, obesity, or other symptoms consistent with a

clinical diagnosis of BBS [33, 34]. Much has been published on the phenotypic

heterogeneity in patients with BBS14/CEP290 gene. This gene has also been reported

to cause Leber Congenital Amaurosis [35], Senior Loken Syndrome [36], Joubert

syndrome [36, 37], and McKusick-Kaufman syndrome [38]. Modifier alleles have been

proposed to influence phenotypic severity of CEP290-associated disease [39], but

mechanisms such as nonsense-mediated exon skipping may prove more predictive

[40].

This also represents the first report of a loss-of-function phenotype for any bbs

gene in zebrafish. Several prior studies utilized morpholinos to knock-down bbs gene

function in bbs1-14 and bbs18 and reported defects in early embryogenesis [34, 41-48].

Unfortunately, interpretations of morpholino phenotypes, particularly those related to

bbs function, have recently come under increased scrutiny due to potential off-target

effects [49]. The phenotypes of the bbs2-/- mutant reported herein are consistent with



https://doi.org/10.1101/2020.06.03.130518


16

other genetic mutants in zebrafish that affect cilia genes [22, 50, 51]. Importantly, the

zebrafish bbs2-/- mutant undergoes progressive photoreceptor degeneration, consistent

with mouse models [11] and humans. As zebrafish are capable of regenerating

damaged photoreceptors following acute injury [52, 53], the bbs2-/- mutant may serve as

a useful model for studies of regeneration in inherited retinal dystrophies.

In conclusion, we demonstrate that mutations in BBS2 cause non-syndromic RP

and infertility, that these mutations prevent ciliary localization of Bbs2 protein, and that

zebrafish lacking bbs2 function exhibit progressive photoreceptor degeneration.

Although the phenotypes reported do not meet the diagnostic criteria for BBS, patients

with RP and difficulties conceiving children from sperm problems should still be

suspected of having BBS mutations. Advances in genetic testing technology, such as

next generation sequencing, and broader diagnostic genetic testing panels have

increased our ability to molecularly diagnose patients. Using more unbiased approaches

for genetic diagnosis may lead to detection of variants in genes otherwise not

considered as causative for a patient’s disease.



https://doi.org/10.1101/2020.06.03.130518


17

References

1. Beales PL, Elcioglu N, Woolf AS, Parker D, Flinter FA. New criteria for improved diagnosis of Bardet-Biedl syndrome: results of a population survey. J Med Genet 1999; 36(6):437-46. 2. Beales PL, Warner AM, Hitman GA, Thakker R, Flinter FA. Bardet-Biedl syndrome: a molecular and phenotypic study of 18 families. J Med Genet 1997; 34(2):92-8. 3. Farag TI, Teebi AS. High incidence of Bardet Biedl syndrome among the Bedouin. Clin Genet 1989; 36(6):463-4. 4. Weihbrecht K, Goar WA, Pak T, Garrison JE, DeLuca AP, Stone EM, Scheetz TE, Sheffield VC. Keeping an Eye on Bardet-Biedl Syndrome: A Comprehensive Review of the Role of Bardet-Biedl Syndrome Genes in the Eye. Med Res Arch 2017; 5(9). 5. Datta P, Allamargot C, Hudson JS, Andersen EK, Bhattarai S, Drack AV, Sheffield VC, Seo S. Accumulation of non-outer segment proteins in the outer segment underlies photoreceptor degeneration in Bardet-Biedl syndrome. Proc Natl Acad Sci U S A 2015; 112(32):E4400-9. 6. Ye F, Nager AR, Nachury MV. BBSome trains remove activated GPCRs from cilia by enabling passage through the transition zone. J Cell Biol 2018; 217(5):1847-68. 7. Seo S, Guo DF, Bugge K, Morgan DA, Rahmouni K, Sheffield VC. Requirement of Bardet-Biedl syndrome proteins for leptin receptor signaling. Hum Mol Genet 2009; 18(7):1323-31. 8. Starks RD, Beyer AM, Guo DF, Boland L, Zhang Q, Sheffield VC, Rahmouni K. Regulation of Insulin Receptor Trafficking by Bardet Biedl Syndrome Proteins. PLoS Genet 2015; 11(6):e1005311. 9. Seo S, Zhang Q, Bugge K, Breslow DK, Searby CC, Nachury MV, Sheffield VC. A novel protein LZTFL1 regulates ciliary trafficking of the BBSome and Smoothened. PLoS Genet 2011; 7(11):e1002358. 10. Davis RE, Swiderski RE, Rahmouni K, Nishimura DY, Mullins RF, Agassandian K, Philp AR, Searby CC, Andrews MP, Thompson S, Berry CJ, Thedens DR, Yang B, Weiss RM, Cassell MD, Stone EM, Sheffield VC. A knockin mouse model of the Bardet-Biedl syndrome 1 M390R mutation has cilia defects, ventriculomegaly, retinopathy, and obesity. Proc Natl Acad Sci U S A 2007; 104(49):19422-7. 11. Nishimura DY, Fath M, Mullins RF, Searby C, Andrews M, Davis R, Andorf JL, Mykytyn K, Swiderski RE, Yang B, Carmi R, Stone EM, Sheffield VC. Bbs2-null mice have neurosensory deficits, a defect in social dominance, and retinopathy associated with mislocalization of rhodopsin. Proc Natl Acad Sci U S A 2004; 101(47):16588-93. 12. Abd-El-Barr MM, Sykoudis K, Andrabi S, Eichers ER, Pennesi ME, Tan PL, Wilson JH, Katsanis N, Lupski JR, Wu SM. Impaired photoreceptor protein transport and synaptic transmission in a mouse model of Bardet-Biedl syndrome. Vision Res 2007; 47(27):3394-407. 13. Nishimura DY, Searby CC, Carmi R, Elbedour K, Van Maldergem L, Fulton AB, Lam BL, Powell BR, Swiderski RE, Bugge KE, Haider NB, Kwitek-Black AE, Ying L, Duhl DM, Gorman SW, Heon E, Iannaccone A, Bonneau D, Biesecker LG, Jacobson SG, Stone EM, Sheffield VC. Positional cloning of a novel gene on chromosome 16q causing Bardet-Biedl syndrome (BBS2). Hum Mol Genet 2001; 10(8):865-74. 14. Katsanis N, Ansley SJ, Badano JL, Eichers ER, Lewis RA, Hoskins BE, Scambler PJ, Davidson WS, Beales PL, Lupski JR. Triallelic inheritance in Bardet-Biedl syndrome, a Mendelian recessive disorder. Science 2001; 293(5538):2256-9.



https://doi.org/10.1101/2020.06.03.130518


18

15. Denniston AK, Beales PL, Tomlins PJ, Good P, Langford M, Foggensteiner L, Williams D, Tsaloumas MD. Evaluation of visual function and needs in adult patients with bardet-biedl syndrome. Retina 2014; 34(11):2282-9. 16. Fulton AB, Hansen RM, Glynn RJ. Natural course of visual functions in the Bardet-Biedl syndrome. Archives of ophthalmology 1993; 111(11):1500-6. 17. Hartong DT, Berson EL, Dryja TP. Retinitis pigmentosa. Lancet 2006; 368(9549):1795-809. 18. Westerfield M. The Zebrafish Book. 3 ed. Eugene, OR: University of Oregon Press; 1995. 19. Sander JD, Maeder ML, Reyon D, Voytas DF, Joung JK, Dobbs D. ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool. Nucleic acids research 2010; 38(Web Server issue):W462-8. 20. Talbot JC, Amacher SL. A streamlined CRISPR pipeline to reliably generate zebrafish frameshifting alleles. Zebrafish 2014; 11(6):583-5. 21. Fogerty J, Stepanyan R, Cianciolo LT, Tooke BP, Perkins BD. Genomic non-redundancy of the mir-183/96/182 cluster and its requirement for hair cell maintenance. Sci Rep 2019; 9(1):10302. 22. Lessieur EM, Song P, Nivar GC, Piccillo EM, Fogerty J, Rozic R, Perkins BD. Ciliary genes arl13b, ahi1 and cc2d2a differentially modify expression of visual acuity phenotypes but do not enhance retinal degeneration due to mutation of cep290 in zebrafish. PloS one 2019; 14(4):e0213960. 23. Shevach E, Ali M, Mizrahi-Meissonnier L, McKibbin M, El-Asrag M, Watson CM, Inglehearn CF, Ben-Yosef T, Blumenfeld A, Jalas C, Banin E, Sharon D. Association Between Missense Mutations in the BBS2 Gene and Nonsyndromic Retinitis Pigmentosa. JAMA ophthalmology 2015; 133(3):312-8. 24. Ile KE, Kassen S, Cao C, Vihtehlic T, Shah SD, Mousley CJ, Alb JG, Jr., Huijbregts RP, Stearns GW, Brockerhoff SE, Hyde DR, Bankaitis VA. Zebrafish class 1 phosphatidylinositol transfer proteins: PITPbeta and double cone cell outer segment integrity in retina. Traffic 2010; 11(9):1151-67. 25. Blanks JC, Johnson LV. Specific binding of peanut lectin to a class of retinal photoreceptor cells. A species comparison. Invest Ophthalmol Vis Sci 1984; 25(5):546-57. 26. Wan J, Goldman D. Retina regeneration in zebrafish. Curr Opin Genet Dev 2016; 40:41-7. 27. Stenkamp DL. The rod photoreceptor lineage of teleost fish. Prog Retin Eye Res 2011; 30(6):395-404. 28. Estrada-Cuzcano A, Koenekoop RK, Senechal A, De Baere EB, de Ravel T, Banfi S, Kohl S, Ayuso C, Sharon D, Hoyng CB, Hamel CP, Leroy BP, Ziviello C, Lopez I, Bazinet A, Wissinger B, Sliesoraityte I, Avila-Fernandez A, Littink KW, Vingolo EM, Signorini S, Banin E, Mizrahi-Meissonnier L, Zrenner E, Kellner U, Collin RW, den Hollander AI, Cremers FP, Klevering BJ. BBS1 mutations in a wide spectrum of phenotypes ranging from nonsyndromic retinitis pigmentosa to Bardet-Biedl syndrome. Archives of ophthalmology 2012; 130(11):1425-32. 29. Riazuddin SA, Iqbal M, Wang Y, Masuda T, Chen Y, Bowne S, Sullivan LS, Waseem NH, Bhattacharya S, Daiger SP, Zhang K, Khan SN, Riazuddin S, Hejtmancik JF, Sieving PA, Zack DJ, Katsanis N. A splice-site mutation in a retina-specific exon of BBS8 causes nonsyndromic retinitis pigmentosa. Am J Hum Genet 2010; 86(5):805-12.



https://doi.org/10.1101/2020.06.03.130518


19

30. Aldahmesh MA, Safieh LA, Alkuraya H, Al-Rajhi A, Shamseldin H, Hashem M, Alzahrani F, Khan AO, Alqahtani F, Rahbeeni Z, Alowain M, Khalak H, Al-Hazzaa S, Meyer BF, Alkuraya FS. Molecular characterization of retinitis pigmentosa in Saudi Arabia. Mol Vis 2009; 15:2464-9. 31. Cannon PS, Clayton-Smith J, Beales PL, Lloyd IC. Bardet-biedl syndrome: an atypical phenotype in brothers with a proven BBS1 mutation. Ophthalmic Genet 2008; 29(3):128-32. 32. Abu-Safieh L, Al-Anazi S, Al-Abdi L, Hashem M, Alkuraya H, Alamr M, Sirelkhatim MO, Al-Hassnan Z, Alkuraya B, Mohamed JY, Al-Salem A, Alrashed M, Faqeih E, Softah A, Al-Hashem A, Wali S, Rahbeeni Z, Alsayed M, Khan AO, Al-Gazali L, Taschner PE, Al-Hazzaa S, Alkuraya FS. In search of triallelism in Bardet-Biedl syndrome. European journal of human genetics : EJHG 2012; 20(4):420-7. 33. Pawlik B, Mir A, Iqbal H, Li Y, Nurnberg G, Becker C, Qamar R, Nurnberg P, Wollnik B. A Novel Familial BBS12 Mutation Associated with a Mild Phenotype: Implications for Clinical and Molecular Diagnostic Strategies. Mol Syndromol 2010; 1(1):27-34. 34. Stoetzel C, Muller J, Laurier V, Davis EE, Zaghloul NA, Vicaire S, Jacquelin C, Plewniak F, Leitch CC, Sarda P, Hamel C, de Ravel TJ, Lewis RA, Friederich E, Thibault C, Danse JM, Verloes A, Bonneau D, Katsanis N, Poch O, Mandel JL, Dollfus H. Identification of a novel BBS gene (BBS12) highlights the major role of a vertebrate-specific branch of chaperonin-related proteins in Bardet-Biedl syndrome. Am J Hum Genet 2007; 80(1):1-11. 35. den Hollander AI, Koenekoop RK, Yzer S, Lopez I, Arends ML, Voesenek KE, Zonneveld MN, Strom TM, Meitinger T, Brunner HG, Hoyng CB, van den Born LI, Rohrschneider K, Cremers FP. Mutations in the CEP290 (NPHP6) gene are a frequent cause of Leber congenital amaurosis. Am J Hum Genet 2006; 79(3):556-61. 36. Sayer JA, Otto EA, O'Toole JF, Nurnberg G, Kennedy MA, Becker C, Hennies HC, Helou J, Attanasio M, Fausett BV, Utsch B, Khanna H, Liu Y, Drummond I, Kawakami I, Kusakabe T, Tsuda M, Ma L, Lee H, Larson RG, Allen SJ, Wilkinson CJ, Nigg EA, Shou C, Lillo C, Williams DS, Hoppe B, Kemper MJ, Neuhaus T, Parisi MA, Glass IA, Petry M, Kispert A, Gloy J, Ganner A, Walz G, Zhu X, Goldman D, Nurnberg P, Swaroop A, Leroux MR, Hildebrandt F. The centrosomal protein nephrocystin-6 is mutated in Joubert syndrome and activates transcription factor ATF4. Nat Genet 2006; 38(6):674-81. 37. Valente EM, Silhavy JL, Brancati F, Barrano G, Krishnaswami SR, Castori M, Lancaster MA, Boltshauser E, Boccone L, Al-Gazali L, Fazzi E, Signorini S, Louie CM, Bellacchio E, International Joubert Syndrome Related Disorders Study G, Bertini E, Dallapiccola B, Gleeson JG. Mutations in CEP290, which encodes a centrosomal protein, cause pleiotropic forms of Joubert syndrome. Nat Genet 2006; 38(6):623-5. 38. Baala L, Audollent S, Martinovic J, Ozilou C, Babron MC, Sivanandamoorthy S, Saunier S, Salomon R, Gonzales M, Rattenberry E, Esculpavit C, Toutain A, Moraine C, Parent P, Marcorelles P, Dauge MC, Roume J, Le Merrer M, Meiner V, Meir K, Menez F, Beaufrere AM, Francannet C, Tantau J, Sinico M, Dumez Y, MacDonald F, Munnich A, Lyonnet S, Gubler MC, Genin E, Johnson CA, Vekemans M, Encha-Razavi F, Attie-Bitach T. Pleiotropic effects of CEP290 (NPHP6) mutations extend to Meckel syndrome. Am J Hum Genet 2007; 81(1):170-9. 39. Coppieters F, Casteels I, Meire F, De Jaegere S, Hooghe S, van Regemorter N, Van Esch H, Matuleviciene A, Nunes L, Meersschaut V, Walraedt S, Standaert L, Coucke P, Hoeben H, Kroes HY, Vande Walle J, de Ravel T, Leroy BP, De Baere E. Genetic screening of LCA in Belgium: predominance of CEP290 and identification of potential modifier alleles in AHI1 of CEP290-related phenotypes. Hum Mutat 2010.



https://doi.org/10.1101/2020.06.03.130518


20

40. Drivas TG, Wojno AP, Tucker BA, Stone EM, Bennett J. Basal exon skipping and genetic pleiotropy: A predictive model of disease pathogenesis. Sci Transl Med 2015; 7(291):291ra97. 41. Zaghloul NA, Liu Y, Gerdes JM, Gascue C, Oh EC, Leitch CC, Bromberg Y, Binkley J, Leibel RL, Sidow A, Badano JL, Katsanis N. Functional analyses of variants reveal a significant role for dominant negative and common alleles in oligogenic Bardet-Biedl syndrome. Proc Natl Acad Sci U S A 2010; 107(23):10602-7. 42. Stoetzel C, Laurier V, Davis EE, Muller J, Rix S, Badano JL, Leitch CC, Salem N, Chouery E, Corbani S, Jalk N, Vicaire S, Sarda P, Hamel C, Lacombe D, Holder M, Odent S, Holder S, Brooks AS, Elcioglu NH, Silva ED, Rossillion B, Sigaudy S, de Ravel TJ, Lewis RA, Leheup B, Verloes A, Amati-Bonneau P, Megarbane A, Poch O, Bonneau D, Beales PL, Mandel JL, Katsanis N, Dollfus H. BBS10 encodes a vertebrate-specific chaperonin-like protein and is a major BBS locus. Nat Genet 2006; 38(5):521-4. 43. Leitch CC, Zaghloul NA, Davis EE, Stoetzel C, Diaz-Font A, Rix S, Alfadhel M, Lewis RA, Eyaid W, Banin E, Dollfus H, Beales PL, Badano JL, Katsanis N. Hypomorphic mutations in syndromic encephalocele genes are associated with Bardet-Biedl syndrome. Nat Genet 2008; 40(4):443-8. 44. Ross AJ, May-Simera H, Eichers ER, Kai M, Hill J, Jagger DJ, Leitch CC, Chapple JP, Munro PM, Fisher S, Tan PL, Phillips HM, Leroux MR, Henderson DJ, Murdoch JN, Copp AJ, Eliot MM, Lupski JR, Kemp DT, Dollfus H, Tada M, Katsanis N, Forge A, Beales PL. Disruption of Bardet-Biedl syndrome ciliary proteins perturbs planar cell polarity in vertebrates. Nat Genet 2005; 37(10):1135-40. 45. Gerdes JM, Liu Y, Zaghloul NA, Leitch CC, Lawson SS, Kato M, Beachy PA, Beales PL, DeMartino GN, Fisher S, Badano JL, Katsanis N. Disruption of the basal body compromises proteasomal function and perturbs intracellular Wnt response. Nat Genet 2007; 39(11):1350-60. 46. Badano JL, Kim JC, Hoskins BE, Lewis RA, Ansley SJ, Cutler DJ, Castellan C, Beales PL, Leroux MR, Katsanis N. Heterozygous mutations in BBS1, BBS2 and BBS6 have a potential epistatic effect on Bardet-Biedl patients with two mutations at a second BBS locus. Hum Mol Genet 2003; 12(14):1651-9. 47. Yen HJ, Tayeh MK, Mullins RF, Stone EM, Sheffield VC, Slusarski DC. Bardet-Biedl syndrome genes are important in retrograde intracellular trafficking and Kupffer's vesicle cilia function. Hum Mol Genet 2006; 15(5):667-77. 48. Loktev AV, Zhang Q, Beck JS, Searby CC, Scheetz TE, Bazan JF, Slusarski DC, Sheffield VC, Jackson PK, Nachury MV. A BBSome subunit links ciliogenesis, microtubule stability, and acetylation. Dev Cell 2008; 15(6):854-65. 49. Borovina A, Ciruna B. IFT88 plays a cilia- and PCP-independent role in controlling oriented cell divisions during vertebrate embryonic development. Cell reports 2013; 5(1):37-43. 50. Lessieur EM, Fogerty J, Gaivin RJ, Song P, Perkins BD. The Ciliopathy Gene ahi1 Is Required for Zebrafish Cone Photoreceptor Outer Segment Morphogenesis and Survival. Invest Ophthalmol Vis Sci 2017; 58(1):448-60. 51. Grimes DT, Boswell CW, Morante NF, Henkelman RM, Burdine RD, Ciruna B. Zebrafish models of idiopathic scoliosis link cerebrospinal fluid flow defects to spine curvature. Science 2016; 352(6291):1341-4. 52. Goldman D. Muller glial cell reprogramming and retina regeneration. Nature reviews Neuroscience 2014; 15(7):431-42.



https://doi.org/10.1101/2020.06.03.130518


21

53. Hyde DR, Reh TA. The past, present, and future of retinal regeneration. Exp Eye Res 2014; 123:105-6.



https://doi.org/10.1101/2020.06.03.130518


22

Figure Legends

Figure 1. Evidence of retinitis pigmentosa and reduced visual fields in the

proband (40 year old female). (A) Fundus photography showed optic disc pallor,

vascular constriction and bone spicule deposits. (B) Goldmann visual field

measurements of both eyes illustrate severely constricted visual fields.

Figure 2. Pedigree of the proband, her brother and their parents. (A) Targeted

variant analysis demonstrates the proband and her brother are both compound

heterozygous for the p.P134R and p.R275X variants. (B) Parental testing confirms the

variants are in trans with the mother and father carrying the p.P134R and p.R275X

variants, respectively.

Figure 3. Evidence of retinitis pigmentosa and reduced visual fields in the

proband’s brother, a 38 year old male. (A) Fundus photographs show a normal

appearing optic nerve and posterior pole; however, pigmentary changes with bony

spicules are seen in the inferior quadrants peripherally. (B) Goldmann visual field

measurements of both eyes found only mildly reduced visual fields.

Figure 4. The P134R and R275X mutations disrupt ciliary location BBS2 in HEK-

293T cells. Immunocytochemistry of HEK293-T cells expressing (A) wild-type BBS-V5

(B) BBSP134R-V5, or (C) BBSR275X-V5 mutant constructs using a monoclonal antibody

again acetylated tubulin (AcTub - green) to label the ciliary axoneme and polyclonal

antibodies against V5 (red) to label BBS-V5 fusion proteins. Nuclei are stained with

DAPI (blue). Arrows note the location of the primary cilium.

Figure 5. Mutation in bbs2 exon 4 causes a frame shift and premature truncation.

(A) Coding sequence alignment of the wild-type and bbs2lri82 alleles. A 15bp fragment

replaces “CTCT” from the wild-type allele, yielding a net 11-bp insertion and a frame

shift. Numbering is relative to the start codon. (B) Predicted structure the of the wild-

type and bbs2lri82 peptides. The bbs2lri82 mutant terminates after 58 frame-shifted



https://doi.org/10.1101/2020.06.03.130518


23

codons (red). (C) Lateral view of 5 dpf wild-type (top), bbs2+/lri82 heterozygotes (middle)

and bbs2lri82/lri82 homozygotes (bottom) that were verified by genotyping. No differences

could be observed. (D) Lateral view of a 10 month old wild-type (top) and bbs2-/-

homozygous mutant (bottom). Mutants are smaller and exhibit spinal curvature as

adults.

Figure 6. bbs2-/- zebrafish exhibit progressive cone degeneration. (A) Retinal

sections were immunostained at the indicated time points with the monoclonal antibody

zpr1 (green) to label cone inner segments (CIS), and with PNA (red) to label cone outer

segments (COS). (B) Quantification of cone inner segment length and cone outer

segment lengths at 5dpf, (C-D) Quantification of cone numbers and CIS and COS

lengths in 2.5 mpf and 6 mpf adults. (E) Retinas from 6 mpf animals immunostained for

zpr3 to label rod outer segments (ROS). (F) Quantified ROS length at 6 mpf. (G)

Retinal cryosections from 6 mpf animals were immunostained for PCNA to label

proliferating cells. (H) Quantification of PCNA+ cell counts at 6 mpf in the inner nuclear

layer (INL) and outer nuclear layer (ONL). Asterisks indicate statistically significant

differences, as determined by an unpaired t-test. *p<0.05; **p<0.01; ***p<0.001.



https://doi.org/10.1101/2020.06.03.130518




https://doi.org/10.1101/2020.06.03.130518


Mutations in BBS2 Cause Apparent Nonsyndromic Retinitis ...2020/06/03 · Retinitis pigmentosa (RP)...

Documents

Transcript of Mutations in BBS2 Cause Apparent Nonsyndromic Retinitis ...2020/06/03 · Retinitis pigmentosa (RP)...