SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

NATURE PLANTS | www.nature.com/natureplants 1

Supplementary Information

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor

NRT1.1/NPF6.3

Bouguyon E1, Brun F1, Kubeš M3, Meynard D2, Pervent M1, Leran S1, Lacombe B1, Krouk G1,

Guiderdoni E2, Zažímalová E3, Hoyerová K3, Nacry P1 and Gojon A1

1Biochimie et Physiologie Moléculaire des Plantes, CNRS/INRA/SupAgro-M/UM, Montpellier 34060,

France, 2Amélioration Génétique et Adaptation des Plantes, CIRAD/INRA/SupAgro-M, Montpellier,

France. 3Institute of Experimental Botany, Academy of Sciences of the Czech Republic, v.v.i.,

Rozvojová 263, 16502 Prague 6 - Lysolaje, Czech Republic

Multiple mechanisms of nitrate sensing by Arabidopsis nitrate transceptor NRT1.1

2 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

Supplementary Figure 1

Gene expression

relative to EiF1 without estradiol

Gene expression relative to EiF1 with estradiol

Induction after estradiol supply

NRT1.1WT 0.00026 0.06708 258 x higher

NRT1.1T101A 0.00024 0.16445 685 x higher

NRT1.1T101D 0.00030 0.19984 666 x higher

NRT1.1p492L 0.00027 0.56712 2100 x higher

a

b

accu

mul

atio

n o

f 3 H-IA

A (p

mol

/10

6 cel

ls)

accu

mul

atio

n o

f 3 H-IA

A (p

mol

/10

6 cel

ls)

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

NATURE PLANTS | www.nature.com/natureplants 3

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

Supplementary Figure 2

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

0mM NO3- 1mM NO3

-

Col chl1-5 chl1-9 Col chl1-5 chl1-9

4 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

Supplementary Figure 3

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

C1 C2 C3 C4 C5

C6 C7 C8 C9 C10

C11 C12 C13 C14 C15

C16 C17 C18 C19 C20

C21

NATURE PLANTS | www.nature.com/natureplants 5

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

Supplementary Figure 4

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

- CELLULAR TRANSPORT, TRANSPORT FACILITATION AND TRANSPORT ROUTES (0.02) transported compounds (substrates) (0.000949) C-compound and carbohydrate transport (0.02) - nitrogen, sulfur and selenium metabolism (0.05)

Cluster 20

- extracellular / secretion proteins (0.00489) - extracellular matrix component (0.00489) - sulfate assimilation (0.02) - peroxidase reaction (0.04) - oxygen binding (0.04) - cell wall (0.04)

Cluster 17

- CELLULAR TRANSPORT, TRANSPORT FACILITATION AND TRANSPORT ROUTES (0.02) lipid/fatty acid transport (0.000668) phosphate transport (0.02 )

- INTERACTION WITH THE ENVIRONMENT (0.00426) chemoperception and response (0.00658) response to biotic stimulus (0.00426)

- SYSTEMIC INTERACTION WITH THE ENVIRONMENT (0.00822) plant / fungal specific systemic sensing and response (0.00544)

- CELL RESCUE, DEFENSE AND VIRULENCE (0.00578) oxidative stress response (0.01) cold shock response (0.02)

- storage facilitating proteins (0.02) -peptidoglycan layer or other prokaryotic cell wall (0.02) -extracellular matrix component (0.03) -chitin metabolism (0.00128) -lipid binding (0.000668) - sugar binding (0.02)

- CELLULAR TRANSPORT, TRANSPORT FACILITATION AND TRANSPORT ROUTES (0.00191) transported compounds (substrates) (0.00191) channel / pore class transport (0.0064) ion channels (0.02) electron transport (0.02) transport facilities (0.03) cellular import (0.05) - INTERACTION WITH THE ENVIRONMENT (0.00466) cellular sensing and response to external stimulus (0.00227) chemoperception and response (0.00946) homeostasis of metal ions (Na, K, Ca etc.) (0.05) homeostasis of cations (0.05) - SYSTEMIC INTERACTION WITH THE ENVIRONMENT (0.04) plant hormonal regulation (0.05) abscisic acid response (0.01) response to wounding (0.01) immune response (0.02) animal specific systemic sensing and response (0.02) - stress response (0.03) - cell aging (0.04)

Cluster 11

Cluster 16

6 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Table S1 : Overlap of five NRT1.1-regulated clusters (C11; C13; C16; C20; C17) in High N conditions with NO3

- and auxin-regulated gene lists.

IAA (783) NR-null Nitrate resp. (393) WT Nitrate resp. (439)

C_11 (28) 0.055 (5) <0.001 (11) <0.001 (10)

C_16 (85) 0.005 (8) <0.001 (8) 0.001 (8)

C_20 (158) <0.001 (15) <0.001 (15) <0.001 (23)

C_13 (9) 0.285 (1) 0.148 (1) 0.153 (1)

C_17 (55) 0.044 (5) 1 (0) 0.64 (1)

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary figures legends:

Supplementary Figure 1. (A) Transcript levels of the various NRT1.1 variants in BY-2 cells with or

without induction by estradiol. (B) Auxin (3H-IAA) uptake in tobacco BY-2 cells expressing either

NRT1.1WT or NRT1.1P492L under the control of an estradiol inducible promoter and supplied with 2 nM

3H IAA. (see supplemental Material and Methods).

Supplementary Figure 2. The chl1-5 KO mutation and P492L mutation of NRT1.1 alter the nitrate

regulation of DR5::GUS expression in lateral root primordia.

GUS expression pattern in lateral root primordia of transgenic lines expressing DR5::GUS (1) in Col-0, chl1-

5 or chl1-9 (P492L mutation) genetic background in absence or in presence of NO3- (1 mM) in the

external medium. The plants were cultivated for 8 days either on a N-free medium or in presence of

1 mM NO3-. Histochemical β-glucuronidase (GUS) staining was adaptated from Friml et al.,(2003) (2). The

staining was performed for 4h at 37°C in a solution containing 0.1% (w/v) X-Gluc (5-bromo-4-chloro-3-

indolyl-β-D glucuronid Acid), 0.5mM K3Fe(CN)6 and 0.5mM K4Fe(CN)6. Microscopic observations were

performed on a Olympus BH2 microscope. The same settings were used for all observations. White bar

represents 100 µm.

Supplementary Figure 3. Gene expression pattern for the 21 clusters identified. Raw data were

normalized with the MAS v5.0 method. An ANOVA1 analysis was then performed (threshold : p<0.001)

NATURE PLANTS | www.nature.com/natureplants 7

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary figures legends:

Supplementary Figure 1. (A) Transcript levels of the various NRT1.1 variants in BY-2 cells with or

without induction by estradiol. (B) Auxin (3H-IAA) uptake in tobacco BY-2 cells expressing either

NRT1.1WT or NRT1.1P492L under the control of an estradiol inducible promoter and supplied with 2 nM

3H IAA. (see supplemental Material and Methods).

Supplementary Figure 2. The chl1-5 KO mutation and P492L mutation of NRT1.1 alter the nitrate

regulation of DR5::GUS expression in lateral root primordia.

GUS expression pattern in lateral root primordia of transgenic lines expressing DR5::GUS (1) in Col-0, chl1-

5 or chl1-9 (P492L mutation) genetic background in absence or in presence of NO3- (1 mM) in the

external medium. The plants were cultivated for 8 days either on a N-free medium or in presence of

1 mM NO3-. Histochemical β-glucuronidase (GUS) staining was adaptated from Friml et al.,(2003) (2). The

staining was performed for 4h at 37°C in a solution containing 0.1% (w/v) X-Gluc (5-bromo-4-chloro-3-

indolyl-β-D glucuronid Acid), 0.5mM K3Fe(CN)6 and 0.5mM K4Fe(CN)6. Microscopic observations were

performed on a Olympus BH2 microscope. The same settings were used for all observations. White bar

represents 100 µm.

Supplementary Figure 3. Gene expression pattern for the 21 clusters identified. Raw data were

normalized with the MAS v5.0 method. An ANOVA1 analysis was then performed (threshold : p<0.001)

8 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

followed by a Tukey test (threshold : p<0.01). Cluster and Gene Ontology analysis were done using MeV

4.8 (http://www.tm4.org/mev.html) and VirtualPlant 1.3 (http://virtualplant.bio.nyu.edu) respectively.

Supplementary Figure 4. Gene ontology analysis of the four major clusters. The Biomaps tool of the

Virtual Plant plateform was used (3) to define biomodules as described in Nero et al. (2009) (4). P-values

are indicated in paranthesis.

Table S1. Overlap between five main NRT1.1-regulated gene clusters (C11; C16; C20; C13 and C17) in

high N conditions with nitrate or auxin regulated gene lists. Overlap was determined using the

Genesect tool available through the VirtualPlant plateform (3). P-values are indicated in the table with the

number of genes involved in paranthesis. Red numbers indicate statistically significant values (pval

<0.05).

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary Material and methods:

Plant material

Transgenic Arabidopsis lines expressing the various NRT1.1 forms fused with mCherry under control of a

estradiol inducible promoter in chl1-5 mutant background were obtained as described below. The pER8

binary vector (5) was used as backbone. The 1768 bp fragment containing the NOS promoter, NPTII gene

and Nos terminator from pGWB4 (from Tsuyoshi Nakagawa (Research Institute of Molecular Genetics,

Shimane University, Matsue, Japan) were amplified using HpaI restriction site containing primers (P5:

agttaacgacaatctgatcatgagcgg and P6:tgttaacggcccgatctagtaacatag) and cloned by restriction in the PvuII

restriction site of pER8 to create the pER8_KanR. The mCherry coding sequence (771bp) has been

amplified using SpeI-MfeI and SpeI restriction site containing primers (P7:

gaactagtcaattgatggtgagcaagggcgagg and : P8: ccactagtttacttgtacagctcgtcc) and cloned by restriction in

the SpeI restriction site of pER8_KanR to create the pER8_KanR_mCherry vector. The NRT1.1 coding

sequence (1773 bp) and T101A, T101D and P492L mutated forms have been amplified using AscI and

MfeI restriction site containing primers (P9: tatggcgcgccatgtctcttcctgaaactaaatc and P10:

tatcaattgtccatgacccattggaatact) and cloned in frame by restriction in the AscI and MfeI restriction sites of

pER8_KanR_mCherry. The binary vector was sequenced and introduced into Agrobacterium tumefaciens

strain GC3101. A. thaliana chl1-5 mutant plants were transformed by dipping the flowers in the presence

of Silwet L77 (6). Transgenic seedlings were selected on a medium containing 50 mg.L-1 of kanamycin.

For further analyses, T1 segregation ratios were analyzed to select transformants with one T-DNA

insertion and to isolate T3-homozygous plants. Functionality of the construct was tested by restoring

NATURE PLANTS | www.nature.com/natureplants 9

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

followed by a Tukey test (threshold : p<0.01). Cluster and Gene Ontology analysis were done using MeV

4.8 (http://www.tm4.org/mev.html) and VirtualPlant 1.3 (http://virtualplant.bio.nyu.edu) respectively.

Supplementary Figure 4. Gene ontology analysis of the four major clusters. The Biomaps tool of the

Virtual Plant plateform was used (3) to define biomodules as described in Nero et al. (2009) (4). P-values

are indicated in paranthesis.

Table S1. Overlap between five main NRT1.1-regulated gene clusters (C11; C16; C20; C13 and C17) in

high N conditions with nitrate or auxin regulated gene lists. Overlap was determined using the

Genesect tool available through the VirtualPlant plateform (3). P-values are indicated in the table with the

number of genes involved in paranthesis. Red numbers indicate statistically significant values (pval

<0.05).

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary Material and methods:

Plant material

Transgenic Arabidopsis lines expressing the various NRT1.1 forms fused with mCherry under control of a

estradiol inducible promoter in chl1-5 mutant background were obtained as described below. The pER8

binary vector (5) was used as backbone. The 1768 bp fragment containing the NOS promoter, NPTII gene

and Nos terminator from pGWB4 (from Tsuyoshi Nakagawa (Research Institute of Molecular Genetics,

Shimane University, Matsue, Japan) were amplified using HpaI restriction site containing primers (P5:

agttaacgacaatctgatcatgagcgg and P6:tgttaacggcccgatctagtaacatag) and cloned by restriction in the PvuII

restriction site of pER8 to create the pER8_KanR. The mCherry coding sequence (771bp) has been

amplified using SpeI-MfeI and SpeI restriction site containing primers (P7:

gaactagtcaattgatggtgagcaagggcgagg and : P8: ccactagtttacttgtacagctcgtcc) and cloned by restriction in

the SpeI restriction site of pER8_KanR to create the pER8_KanR_mCherry vector. The NRT1.1 coding

sequence (1773 bp) and T101A, T101D and P492L mutated forms have been amplified using AscI and

MfeI restriction site containing primers (P9: tatggcgcgccatgtctcttcctgaaactaaatc and P10:

tatcaattgtccatgacccattggaatact) and cloned in frame by restriction in the AscI and MfeI restriction sites of

pER8_KanR_mCherry. The binary vector was sequenced and introduced into Agrobacterium tumefaciens

strain GC3101. A. thaliana chl1-5 mutant plants were transformed by dipping the flowers in the presence

of Silwet L77 (6). Transgenic seedlings were selected on a medium containing 50 mg.L-1 of kanamycin.

For further analyses, T1 segregation ratios were analyzed to select transformants with one T-DNA

insertion and to isolate T3-homozygous plants. Functionality of the construct was tested by restoring

10 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

chlorate sensitivity (data not shown), wild-type lateral root growth of transgenic seedlings and

expressing mCherry.

Tobacco BY-2 cells Nicotiana tabacum L. cv. Bright Yellow 2 (7) were transformed accordingly to the

modified transformation protocol by An et al. (1985) (8) using Agrobacterium tumefaciens GV2260 strain

carrying pER8 plant binary vector coding for estradiol inducible NRT1.1T101A or NRT1.1T101D in fusion with

mCherry and cultured in darkness at 27°C on the orbital incubator (Sanyo Gallenkamp PLC; 150 rpm, 32-

mm orbit) in liquid medium (3% (w/v) sucrose, 4.3 g l−1 Murashige and Skoog salts, 100 mg l−1 inositol, 1

mg l−1 thiamin, 0.2 mg l−1 2,4-D, 200 mg l−1 KH2PO4, 50 µg ml-1 hygromycin and 100 µg ml-1 cefotaxim, pH

5.8), and subcultured weekly. Stock BY-2 calli were maintained on media solidified with 0.6% (w/v) agar

and subcultured monthly. Sigma-Aldrich, Inc. and Duchefa supplied all commonly used chemicals.

RNA analysis

BY-2 cells were filter collected, frozen in liquid nitrogen and disrupted for 3 min at 30 s-1 in homogenizer

(Retsch mixer mill MM301). Total RNA was extracted and purified using RNeasy Plant Mini Kit (Qiagen)

and DNA-freeTM Kit (Ambion Life Technologies). Reverse transcription was achieved with 3 µg of RNA in

the presence of M-MLV Reverse Transcriptase (Promega) after annealing with an anchored poly-dT

primer. Quantitative real-time PCR (Light Cycler 480 II; Roche) was done by using combination of these

qRT-PCR primers: NRT1.1 qFor ATCGGCGAAGCGTTAATCTA and NRT1.1 qRev AATGCCAATGTGCTCAACAA.

Microscopy

BY-2 cells Microscopy was performed using Zeiss LSM 5 Duo Confocal Microscope (LSM 510 Meta, LSM 5

Live, Zeiss). Fluorescence signals for mCherry (excitation 587nm, emission peak 610 nm) were detected

with a 40x (water immersion) Plan Apochromat objective. Obtained results were analyzed with Zeiss LSM

5 (microscopy.zeiss.com/microscopy/en_us/downloads/lsm-5-series.html).

Microarray analysis

Affimetrix micro array data analysis was performed using custom made [R] (http://www.r-project.org/)

functions as previously described in (9, 10). In more details, aov() function has been used over the

dataset where the signal of a probe-set i is modeled as follow: Pi ~ G + . G represents the effect of the

genotype (6 levels: WT, chl1-5, chl1-12, chl1-9, T101A, T101D); is the coefficient of the ANOVA and is

the unexplained variance. Analysis of Variance (ANOVA) has been followed by a Tuckey test and a

clustering analysis. This stringent procedure (ANOVA pval<0.001 and Tukey test pval<0.01, FDR is

estimated to be lower than 5% across the whole experiment) retrieved 490 regulated probes

corresponding to 468 unambiguous genes. Clustering analysis has been performed on MeV software to

retrieve dominant mode of regulation among the regulated genes. The number of clusters has been

determined according to the Figure of Merit (FOM) method. The clusters have been generated using a K-

mean method using Pearson correlation as a distance metric between genes.

NATURE PLANTS | www.nature.com/natureplants 11

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

chlorate sensitivity (data not shown), wild-type lateral root growth of transgenic seedlings and

expressing mCherry.

Tobacco BY-2 cells Nicotiana tabacum L. cv. Bright Yellow 2 (7) were transformed accordingly to the

modified transformation protocol by An et al. (1985) (8) using Agrobacterium tumefaciens GV2260 strain

carrying pER8 plant binary vector coding for estradiol inducible NRT1.1T101A or NRT1.1T101D in fusion with

mCherry and cultured in darkness at 27°C on the orbital incubator (Sanyo Gallenkamp PLC; 150 rpm, 32-

mm orbit) in liquid medium (3% (w/v) sucrose, 4.3 g l−1 Murashige and Skoog salts, 100 mg l−1 inositol, 1

mg l−1 thiamin, 0.2 mg l−1 2,4-D, 200 mg l−1 KH2PO4, 50 µg ml-1 hygromycin and 100 µg ml-1 cefotaxim, pH

5.8), and subcultured weekly. Stock BY-2 calli were maintained on media solidified with 0.6% (w/v) agar

and subcultured monthly. Sigma-Aldrich, Inc. and Duchefa supplied all commonly used chemicals.

RNA analysis

BY-2 cells were filter collected, frozen in liquid nitrogen and disrupted for 3 min at 30 s-1 in homogenizer

(Retsch mixer mill MM301). Total RNA was extracted and purified using RNeasy Plant Mini Kit (Qiagen)

and DNA-freeTM Kit (Ambion Life Technologies). Reverse transcription was achieved with 3 µg of RNA in

the presence of M-MLV Reverse Transcriptase (Promega) after annealing with an anchored poly-dT

primer. Quantitative real-time PCR (Light Cycler 480 II; Roche) was done by using combination of these

qRT-PCR primers: NRT1.1 qFor ATCGGCGAAGCGTTAATCTA and NRT1.1 qRev AATGCCAATGTGCTCAACAA.

Microscopy

BY-2 cells Microscopy was performed using Zeiss LSM 5 Duo Confocal Microscope (LSM 510 Meta, LSM 5

Live, Zeiss). Fluorescence signals for mCherry (excitation 587nm, emission peak 610 nm) were detected

with a 40x (water immersion) Plan Apochromat objective. Obtained results were analyzed with Zeiss LSM

5 (microscopy.zeiss.com/microscopy/en_us/downloads/lsm-5-series.html).

Microarray analysis

Affimetrix micro array data analysis was performed using custom made [R] (http://www.r-project.org/)

functions as previously described in (9, 10). In more details, aov() function has been used over the

dataset where the signal of a probe-set i is modeled as follow: Pi ~ G + . G represents the effect of the

genotype (6 levels: WT, chl1-5, chl1-12, chl1-9, T101A, T101D); is the coefficient of the ANOVA and is

the unexplained variance. Analysis of Variance (ANOVA) has been followed by a Tuckey test and a

clustering analysis. This stringent procedure (ANOVA pval<0.001 and Tukey test pval<0.01, FDR is

estimated to be lower than 5% across the whole experiment) retrieved 490 regulated probes

corresponding to 468 unambiguous genes. Clustering analysis has been performed on MeV software to

retrieve dominant mode of regulation among the regulated genes. The number of clusters has been

determined according to the Figure of Merit (FOM) method. The clusters have been generated using a K-

mean method using Pearson correlation as a distance metric between genes.

12 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.15

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary references

1) Ulmasov T, et al. (1997) Aux/IAA proteins repress expression of reporter genes containing

natural and highly active synthetic auxin response elements. The Plant Cell 9(11):1963-1971.

2) Friml J, et al. (2003) Efflux-dependent auxin gradients establish the apical–basal axis of

Arabidopsis. Nature (426):147-153.

3) Katari MS, et al. (2010). VirtualPlant: A software platform to support Systems Biology research.

Plant Physiol. 152(2):500-515.

4) Nero D, et al. (2009) A system biology approach highlights a hormonal enhancer effect on

regulation of genes in a nitrate responsive "biomodule". BMC Syst Biol.3:59.

5) Zuo J, et al. (2000) Technical advance: An estrogen receptor-based transactivator XVE mediates

highly inducible gene expression in transgenic plants. Plant J 24 :265-273.

6) Clough SJ and Bent AF (1998). Floral dip: a simplified method for Agrobacterium-mediated

transformation of Arabidopsis thaliana. Plant J. 16, 735–743.

7) Nagata T, Nemoto Y and Hasezava S (1992) Tobacco BY-2 cell line as the ‘Hela’ cell in the cell

biology of higher plants. International Review of Cytology 132, 1–30.

8) An G. (1985) High efficiency transformation of cultured tobacco cells. Plant Physiology 79, 568-

570.

9) Krouk G, et al. (2009) A systems approach uncovers restrictions for signal interactions regulating

genome-wide responses to nutritional cues in Arabidopsis. PLoS Comput Biol. 5(3):e1000326

10) Obertello M, et al. (2010) Modeling the global effect of the basic-leucine zipper transcription

factor 1 (bZIP1) on nitrogen and light regulation in Arabidopsis. BMC Syst Biol. 4:111

NATURE PLANTS | www.nature.com/natureplants 13

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.15

Multiple mechanisms of nitrate sensing by Arabidopsis transceptor NRT1.1/NPF6.3

Supplementary references

1) Ulmasov T, et al. (1997) Aux/IAA proteins repress expression of reporter genes containing

natural and highly active synthetic auxin response elements. The Plant Cell 9(11):1963-1971.

2) Friml J, et al. (2003) Efflux-dependent auxin gradients establish the apical–basal axis of

Arabidopsis. Nature (426):147-153.

3) Katari MS, et al. (2010). VirtualPlant: A software platform to support Systems Biology research.

Plant Physiol. 152(2):500-515.

4) Nero D, et al. (2009) A system biology approach highlights a hormonal enhancer effect on

regulation of genes in a nitrate responsive "biomodule". BMC Syst Biol.3:59.

5) Zuo J, et al. (2000) Technical advance: An estrogen receptor-based transactivator XVE mediates

highly inducible gene expression in transgenic plants. Plant J 24 :265-273.

6) Clough SJ and Bent AF (1998). Floral dip: a simplified method for Agrobacterium-mediated

transformation of Arabidopsis thaliana. Plant J. 16, 735–743.

7) Nagata T, Nemoto Y and Hasezava S (1992) Tobacco BY-2 cell line as the ‘Hela’ cell in the cell

biology of higher plants. International Review of Cytology 132, 1–30.

8) An G. (1985) High efficiency transformation of cultured tobacco cells. Plant Physiology 79, 568-

570.

9) Krouk G, et al. (2009) A systems approach uncovers restrictions for signal interactions regulating

genome-wide responses to nutritional cues in Arabidopsis. PLoS Comput Biol. 5(3):e1000326

10) Obertello M, et al. (2010) Modeling the global effect of the basic-leucine zipper transcription

factor 1 (bZIP1) on nitrogen and light regulation in Arabidopsis. BMC Syst Biol. 4:111