Supplemental Information

EXTENDED EXPERIMENTAL PROCEDURES

Cell Lines and Cell CultureNIH 3T3 and AML12 cells were obtained from ATCC. Fld and their respective control mouse embryonic fibroblasts (MEFs) were

generated from fld/+ mice obtained from Jackson Laboratories. TSC2�/�; p53�/� MEFs were kindly provided by David Kwiatkowski

(Harvard Medical School). HEK293T, HepG2, and all fibroblast cell lines were cultured in DMEM with 10% IFS unless otherwise

stated. AML12 were cultured in 50%/50%DMEM/Ham’s F-12 with 10% FBS supplemented with 5 mg/ml insulin, 5 mg/ml transferrin,

40 ng/ml dexamethasone, 5 ng/ml selenium. 3T3-L1 preadipocytes were maintained in Dulbecco’s Modified Eagle Medium (DMEM)

with 10% newborn bovine serum. Differentiation of 3T3-L1 preadipocytes was initiated with a mix of insulin (0.25 U/ml), 3-isobutyl-1-

methylxanthine (0.5 mM), and dexamethasone (0.25 mM) in DMEM + 10% fetal bovine serum (FBS). On day 4 and every other day

thereafter the differentiation medium was replaced with DMEM containing 10% FBS. See Kim et al. (2010) for further reference.

cDNA Manipulations and MutagenesisThe cDNA for lipin 1b used was cloned by Huffman TA et al. (Huffman et al., 2002) and has the NCBI identifier: AAL07798. The cDNAs

for full-length SREBP-1 and SREBP-2 were cloned from a NIH 3T3 fibroblast cDNA library. The cDNA for mLST8/GbL was generated

as previously described (Kim et al., 2003). The cDNAs for the control genes, metap2 and rap2a, were previously described and vali-

dated (Peterson et al., 2009). For expression studies, lipin 1, SREBP-1, and SREBP-2 cDNAs were amplified by PCR and the prod-

ucts were subcloned into the Sal1 and Not1 sites of pRK5, pLKO.1, or pMSCV. All constructs were verified by DNA sequencing. For

the catalytic site mutant analysis, the lipin 1 cDNA was mutagenized using a QuikChange mutagenesis XLII kit (Stratagene) with olio-

gonucleotides obtained from Integrated DNA Technologies. To generate the catalytically inactive lipin 1mutant, the catalytic site resi-

dues were mutated as follows: 712 D/ E, 714 D/ E. The 17xS/T/ A mutant encompasses the following residues: S106, S150,

(S281, T282), S285, S287, S293, T298, S328, (S353, S356), S392, S468, S472, S483, S634, S635, (S647, S648), S921, S923. Resi-

dues in parentheses were both mutated to alanine because the singly phosphorylated site in each case could not be unambiguously

determined by mass spectrometry (Harris et al., 2007).

Cell Lysis, Immunoprecipitations, and Kinase AssaysFor protein studies, all cells unless otherwise stated, were rinsed twice with ice-cold PBS and lysed with Triton X-100 containing lysis

buffer (40mMHEPES [pH 7.4], 2mMEDTA, 10mMsodium pyrophosphate, 10mMsodium glycerophosphate, 150mMNaCl, 50mM

NaF, 1% Triton X-100, and one tablet of EDTA-free protease inhibitors [Roche] per 25 ml). The soluble fractions of cell lysates were

isolated by centrifugation at 13,000 rpm for 10 min in a microcentrifuge, lysate protein concentrations were normalized by Bradford

assay (Bio-Rad). Proteins were then denatured by the addition of sample buffer and by boiling for 5 min, resolved using 4%–12%

SDS-PAGE (Invitrogen), and analyzed by immunoblotting as described (Kim et al., 2002).

For mTOR in vitro kinase assays, cells were lysed in ice-cold CHAPS-containing lysis buffer lacking added NaCl and NaF (40 mM

HEPES [pH 7.4], 2 mMEDTA, 10mMpyrophosphate, 10mMglycerophosphate, 0.3%CHAPS, and one tablet of EDTA-free protease

inhibitors [Roche] per 25ml). mTOR antibody or FLAGM2 resins were incubated with precleared cell lysates and incubated with rota-

tion for 1.5 hr at 4�C. For mTOR immunoprecipitation, a 50%/50% slurry of protein G Sepharose/lysis buffer was then added, and the

incubation continued for an additional 1 hr. mTOR or FLAG-mLST8/GbL immunoprecipitates were then washed three times with

CHAPS lysis buffer containing 150 mM NaCl. FLAG-lipin 1 immunoprecipitates were washed three times with Triton X-100 lysis

buffer. Both FLAG-mLST8/GbL and FLAG-lipin 1 immunoprecipitates were additionally washed twice in 25 mM HEPES (pH 7.4),

20 mM KCL after the three washes in their respective lysis buffers. For elution of FLAG-tagged proteins, beads were incubated in

elution buffer (50 mM HEPES pH 7.4, 500 mM NaCl, 0.1% CHAPS, 50 mg/ml FLAG peptide) for 15 min at 25�C. Kinase assays

were performed as described (Sancak et al., 2007).

For peptide kinase assays, mTORC1 was purified from HEK293T cells stably expressing FLAG-raptor performed as described

previously (Yip et al., 2010). Individual peptide substrates were synthesized by the MIT Koch Institute Biopolymers and Proteomics

Core Facility and purified by reversed phaseHPLC. Kinetic parameters formTORC1 phosphorylation of the optimal peptide substrate

were determined by incubating varying concentrations of peptide with �100 ng mTORC1 in the reaction buffer (25 mM HEPES pH

7.4, 50mMNaCl and 10mMMgCl2) containing 50 mMATP (with1 mCi/ml g-[32P]-ATP) for 30min at room temperature. Aliquots (3.3 ml)

of each reaction were spotted onto P81 phosphocellulose filters in triplicate and quenched in 0.42% H3PO4. Filters were washed

eight times in the same solution, dried, and radioactivity determined.

For lipin 1 immunoprecipitations from differentiated 3T3-L1 cells, the culture medium was replaced with DMEM +10% FBS over-

night and then incubated at 37�C without or with 20 nM rapamycin or 250 nM Torin1. To terminate the incubation, the cells were

rinsed once with cold PBS and then homogenized (1 ml of buffer/ 10 cm-diameter dish) in a syringe with a 20-gauge needle. Homog-

enization Buffer was composed of Buffer A (50 mM b-glycerophosphate, 50 mM NaF, 1 mM EDTA, 1 mM EGTA, and 10 mM sodium

phosphate (pH 7.4)) supplemented with 1 mM phenylmethylsulfonyl fluoride, 10 mg/ml leupeptin, 10 mg/ml aprotinin, 10 mg/ml pep-

statin, and 0.5 mMmicrocystin LR. Homogenates were centrifuged at 16,000 3 g for 10 min, and the supernatants were retained for

analyses. Cell lysates were incubated with lipin 1 antibodies (2 mg) bound to protein A-agarose beads (15 ml, for rabbit antibodies) or

protein G-agarose beads (15 ml, for mouse antibodies) at 4�C for 2 hr with constant mixing. The beads were then washed three times

Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc. S1

with 1 ml of Buffer A and proteins eluted with 1x SDS-loading buffer. After resolving by SDS-PAGE, immunoblots were developed

with the indicated antibodies. Antibodies to lipin 1 (Huffman et al., 2002), phospho-S106 lipin 1 (Harris et al., 2007), total and phos-

pho-S65 and T37/T46 4E-BP1 (Mothe-Satney et al., 2000) have been described previously.

For isolation of protein from mouse livers, RIPA buffer (40 mM HEPES [pH 7.4], 2 mM EDTA, 50 mM NaF, 10 mM pyrophosphate,

10 mM glycerophosphate, 1% sodium deoxycholate, 1% NP40, 0.1% SDS, and one tablet of EDTA-free protease inhibitors per

25 ml) was added to each liver sections (�20 mg). Homogenized lysates were generated by sonication for 7 s using a Tekmar Sonic

Disruptor at 35% duty cycle with power output level 3.5. The soluble fractions of cell lysates were isolated by centrifugation at

13,000 rpm for 10 min in a microcentrifuge and subsequently prepared as described above for cells lysed in Triton X-100 containing

lysis buffer.

Mass Spectrometric AnalysisLipin 1 phosphorylation sites were identified by mass spectrometry of trypsin-digested FLAG-lipin 1 purified from HEK293T cells

transiently overexpressing FLAG-lipin 1. The amino acid positions of all lipin 1 phosphorylation sites were numbered according to

NCBI M. musculus lipin 1b protein sequence NP_056578.

Label-free quantification of lipin 1 phosphorylation sites were performed with BioWorks Rev3.3 software according to the meth-

odology utilized in Stokes et al. (2007).

Mammalian Lentiviral TransductionThe GFP control andmouse TSC2 shRNAswere previously described and validated (Peterson et al., 2009). Themouse raptor shRNA

was previously described and validated (Thoreen et al., 2009). As with TSC2 and raptor shRNAs, SREBP-1 shRNAs were obtained

from the collection of The RNAi Consortium (TRC) at the Broad Institute (Moffat et al., 2006). These shRNAs are named with the

numbers found at the TRC public website: http://www.broad.mit.edu/genome_bio/trc/publicSearchForHairpinsForm.php. Mouse

SREBP-1_1 shRNA: TRC candidate; NM_011480.1-3110s1c1Mouse SREBP-1_2 shRNA: TRC candidate; NM_011480.1-1142s1c1.

To generate virus, shRNA or mRNA-encoding plasmids were co-transfected with the Delta VPR (pLKO.1 lentivirus) or Gag-pol

envelope (pMSCV retrovirus) and CMV VSV-G packaging plasmids into actively growing HEK293T using FuGENE 6 transfection

reagent as previously described (Sancak et al., 2008). Virus containing supernatants were collected at 48 hr after transfection, centri-

fuged to eliminate cells, and target cells (100,000-1,000,000) infected in the presence of 8 mg/ml polybrene. 24 hr after infection, the

cells were given or split into freshmedia. Themetap2 or lipin 1 overexpressing and shRNA expressing cells were additionally selected

with 1 mg/ml puromycin. shRNA or mRNA-expressing cells were analyzed 2–7 days post-infection.

Immunofluorescence Assays of Endogenous Lipin 1Endogenous lipin 1 immufluoresence was performed as follows: On day 5 post-differentiation, 3T3-L1 cells were split onto poly-l-

lysine coated coverslips in 6-well plates. For amino acid or glucose starvation, the culture medium was replaced with a low phos-

phate-containing buffered solution containing 145 mM NaCl, 5.4 mM KCl, 1.4 mM CaCl2, 1.4 mM MgSO4, 25 mM NaHCO3,

0.2 mM sodium phosphate, 10 mM HEPES, pH 7.4, and either 5 mM glucose or 1x MEM amino acids (GIBCO) (Wang et al.,

2009). After treatment, cells were washed three times with PBS and fixed in 4% paraformaldehyde for 15 min at room temperature,

washed three times with PBS, and permeabilized with 1% Triton X-100 in 10% Goat Serum in PBS for 10 min. Coverslips were

blocked for 1 hr at room temperature in a blocking buffer of 5% Goat Serum + 0.5% Triton X-100 in PBS. Cells were then incubated

with primary antibody dilutions (1:200 CT-lipin 1 antibody in blocking buffer [Huffman et al., 2002]) at 4�C overnight. After washing

three times with PBS, coverslips were placed in blocking buffer for an additional 30 min, washed three times, incubated with the

secondary antibody dilution for 1 hr at room temperature in the dark. Following five 15 min washes with PBS, coverslips were

mounted onto glass slides using Vectashield containing DAPI and imaged using a 403 objective.

Flow CytometryCells were harvested with trypsin, permeabilized, and stained with Nicoletti buffer (0.1% sodium citrate, 0.1% Triton X-100, 50 mg/ml

propidium iodide), and analyzed for DNA content on a Becton Dickinson (BD) LSR instrument using BD FACSDiva v5.0.2 software. A

minimum of 20,000 events were counted. Values reported are the mean for cells treated in duplicate for each condition.

Gene Expression Analysis Primer SetsThe following primers were used for quantitative real-time PCR:

FASN (M. musculus)

Forward: CAG CAG AGT CTA CAG CTA CCT

Reverse: ACC ACC AGA GAC CGT TAT GC

ACACA (M. musculus)

Forward: GCC TCT TCC TGA CAA ACG AG

Reverse: TGA CTG CCG AAA CAT CTC TG

SCD1 (M. musculus)

Forward: ACGCCGACCCTCACAATTC

S2 Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc.

Reverse: CAGTTTTCCGCCCTTCTCTTT

HMGCR (M. musculus)

Forward: CTTGTGGAATGCCTTGTGATTG

Reverse: AGCCGAAGCAGCACATGAT

FDPS (M. musculus)

Forward: ATGGAGATGGGCGAGTTCTTC

Reverse: CCGACCTTTCCCGTCACA

Lipin 1 (M. musculus)

Forward: CCCTCGATTTCAACGTACCC

Reverse: GCAGCCTGTGGCAATTCA

SREBP-1 (M. musculus)

AAGCAAATCACTGAAGGACCTGG

AAAGACAAGGGGCTACTCTGGGAG

SREBP-2 (M. musculus)

GCGTTCTGGAGACCATGGA

ACAAAGTTGCTCTGAAAACAAATCA

36B4 (gene symbol: Rplp0) (M. musculus)

TAAAGACTGGAGACAAGGTG

GTGTACTCAGTCTCCACAGA

GAPDH (M. musculus)

Forward: TCACCATCTTCCAGGAGGGA

Reverse: GCATTGCTGACAATCTTGAGTGAG

PAP1 Activity MeasurementsPAP1 activity to measure [32P]phosphate release from [32P]phosphatidic acid was determined using a modification of the Carman

and Linmethod (Carman and Lin, 1991). Briefly, samples of cell extracts (5 ml) fromHEK293T cells transfected with EGFP, HA-tagged

wild-type lipin 1, or HA-tagged 17xS/T/ A lipin 1 were added to reaction mixtures (100 ml) containing a final concentration of 2 mM

Triton X-100, 10 mM b-mercaptoethanol, 0.2 mM [32P]phosphatidic acid (5–10,000 cpm/nmol), 50 mM Tris-maleate (pH 7.0), and

1.5 mM MgCl2. After 20 min at 30�C the reactions were terminated by adding 0.5 ml of 0.1 N HCl in methanol. [32P]phosphate

was extracted by vigorousmixing after adding 1ml of chloroform and 1ml of 1 MMgCl2. The [32P]phosphate in 0.5 ml of the aqueous

phase was determined by scintillation counting and EGFP transfected values were subtracted.

Animal ExperimentsDesign of the conditional raptor-loxP mice was recently described (Sengupta et al., 2010). All mice were maintained in a mixed strain

background (129/C57BL/6) and housed in a temperature-controlled environment with 12 hr light/dark cycles. Age-matchedmice had

free access to water and were fed ad libitum a Western-style diet (Harlan Teklad TD 88137) containing 21% (w/w) total lipid (42%

calories as anhydrous milk fat [65% saturated, 32% monounsaturated, 3% polyunsaturated fats]) and 0.2% (w/w) total cholesterol

(of which 0.05% is contributed by milk fat and 0.15% is added). Body weights were recorded bi-monthly, and food intake was

measured tri-weekly. At the end of the feeding period, mice were euthanatized prior to organ harvest. All experiments were approved

by the Committee on Animal Care at theMassachusetts Institute of Technology and conform to the legal mandates and federal guide-

lines for the care and maintenance of laboratory animals.

Adenoviral Hepatocyte DeliveryLipin 1 shRNA constructs targeting nucleotides 594–613 (lipin 1_1) or 896–915 (lipin 1_2) of themouse lipin 1 transcript and an shRNA

construct targeting LacZ were generated as previously described (Finck et al., 2006). Hepatic shRNA-mediated knockdown was

achieved by intravenous administration of adenoviral vectors as previously described (Bernal-Mizrachi et al., 2003).

For lipin 1 overexpression, primary mouse hepatocytes were isolated and infected as previously described (Chen et al., 2008).

SREBP-Responsive Promoter Luciferase AssaysHepG2 cells were cotransfected by calcium-phosphate coprecipitation with the following: (1) luciferase reporter constructs driven by

a SREBP-1-responsive promoter of either the SCD1 (Bene et al., 2001) or FASN (Kim et al., 1998) genes kindly provided by James

Ntambi (University of Wisconsin-Madison) and Bruce Spiegelman (Harvard Medical School), respectively; (2) an expression

construct driving expression of a truncated (1–460 aa) transcriptionally active form of SREBP-1a ([Shimano et al., 1996] kindly

provided by Jay Horton [UT Southwestern]); (3) a SV40-driven renilla luciferase expression construct to control for transfection effi-

ciency; (4) as well as additionally treatedwith rapamycin, Torin1, or DMSO for 4 hr or co-transfectedwith the indicated empty or lipin 1

expressing vectors. Cell lysate firefly and renilla luciferase activity were assessed by using the Dual-Glo kit (Promega). For all

samples, firefly luciferase activity was normalized to renilla luciferase activity. To allow comparison between disparate conditions,

all experimental samples were further normalized to their respective controls, which were given arbitrary values of 1.0.

Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc. S3

SUPPLEMENTAL REFERENCES

Bene, H., Lasky, D., and Ntambi, J.M. (2001). Cloning and characterization of the human stearoyl-CoA desaturase gene promoter: transcriptional activation by

sterol regulatory element binding protein and repression by polyunsaturated fatty acids and cholesterol. Biochem. Biophys. Res. Commun. 284, 1194–1198.

Bernal-Mizrachi, C., Weng, S., Feng, C., Finck, B.N., Knutsen, R.H., Leone, T.C., Coleman, T., Mecham, R.P., Kelly, D.P., and Semenkovich, C.F. (2003). Dexa-

methasone induction of hypertension and diabetes is PPAR-alpha dependent in LDL receptor-null mice. Nat. Med. 9, 1069–1075.

Burnett, P.E., Barrow, R.K., Cohen, N.A., Snyder, S.H., and Sabatini, D.M. (1998). RAFT1 phosphorylation of the translational regulators p70 S6 kinase and 4E-

BP1. Proc. Natl. Acad. Sci. USA 95, 1432–1437.

Carman, G.M., and Lin, Y.P. (1991). Phosphatidate phosphatase from yeast. Methods Enzymol. 197, 548–553.

Chen, Z., Gropler, M.C., Norris, J., Lawrence, J.C., Jr., Harris, T.E., and Finck, B.N. (2008). Alterations in hepatic metabolism in fld mice reveal a role for lipin 1 in

regulating VLDL-triacylglyceride secretion. Arterioscler. Thromb. Vasc. Biol. 28, 1738–1744.

Finck, B.N., Gropler, M.C., Chen, Z., Leone, T.C., Croce, M.A., Harris, T.E., Lawrence, J.C., Jr., and Kelly, D.P. (2006). Lipin 1 is an inducible amplifier of the

hepatic PGC-1alpha/PPARalpha regulatory pathway. Cell Metab. 4, 199–210.

Harris, T.E., Huffman, T.A., Chi, A., Shabanowitz, J., Hunt, D.F., Kumar, A., and Lawrence, J.C., Jr. (2007). Insulin controls subcellular localization and multisite

phosphorylation of the phosphatidic acid phosphatase, lipin 1. J. Biol. Chem. 282, 277–286.

Huffman, T.A., Mothe-Satney, I., and Lawrence, J.C., Jr. (2002). Insulin-stimulated phosphorylation of lipinmediated by themammalian target of rapamycin. Proc.

Natl. Acad. Sci. USA 99, 1047–1052.

Kim, D.-H., Sarbassov, D.D., Ali, S.M., King, J.E., Latek, R.R., Erdjument-Bromage, H., Tempst, P., and Sabatini, D.M. (2002). mTOR interacts with raptor to form

a nutrient-sensitive complex that signals to the cell growth machinery. Cell 110, 163–175.

Kim, D.H., Sarbassov, D.D., Ali, S.M., Latek, R.R., Guntur, K.V., Erdjument-Bromage, H., Tempst, P., and Sabatini, D.M. (2003). GbetaL, a positive regulator of the

rapamycin-sensitive pathway required for the nutrient-sensitive interaction between raptor and mTOR. Mol. Cell 11, 895–904.

Kim, H.B., Kumar, A., Wang, L., Liu, G.H., Keller, S.R., Lawrence, J.C., Jr., Finck, B.N., and Harris, T.E. (2010). Lipin 1 represses NFATc4 transcriptional activity in

adipocytes to inhibit secretion of inflammatory factors. Mol. Cell. Biol. 30, 3126–3139.

Kim, J.B., Sarraf, P., Wright, M., Yao, K.M., Mueller, E., Solanes, G., Lowell, B.B., and Spiegelman, B.M. (1998). Nutritional and insulin regulation of fatty acid

synthetase and leptin gene expression through ADD1/SREBP1. J. Clin. Invest. 101, 1–9.

Liu, Q., Chang, J.W., Wang, J., Kang, S.A., Thoreen, C.C., Markhard, A., Hur, W., Zhang, J., Sim, T., Sabatini, D.M., and Gray, N.S. (2010). Discovery of 1-(4-(4-

propionylpiperazin-1-yl)-3-(trifluoromethyl)phenyl)-9-(quinolin-3-yl)benzo[h][1,6]naphthyridin-2(1H)-one as a highly potent, selective mammalian target of rapa-

mycin (mTOR) inhibitor for the treatment of cancer. J. Med. Chem. 53, 7146–7155.

Moffat, J., Grueneberg, D.A., Yang, X., Kim, S.Y., Kloepfer, A.M., Hinkle, G., Piqani, B., Eisenhaure, T.M., Luo, B., Grenier, J.K., et al. (2006). A lentiviral RNAi

library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283–1298.

Mothe-Satney, I., Brunn, G.J., McMahon, L.P., Capaldo, C.T., Abraham, R.T., and Lawrence, J.C., Jr. (2000). Mammalian target of rapamycin-dependent phos-

phorylation of PHAS-I in four (S/T)P sites detected by phospho-specific antibodies. J. Biol. Chem. 275, 33836–33843.

Peterson, T.R., Laplante, M., Thoreen, C.C., Sancak, Y., Kang, S.A., Kuehl, W.M., Gray, N.S., and Sabatini, D.M. (2009). DEPTOR is an mTOR inhibitor frequently

overexpressed in multiple myeloma cells and required for their survival. Cell 137, 873–886.

Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A., Spooner, E., Carr, S.A., and Sabatini, D.M. (2007). PRAS40 is an insulin-regulated inhibitor

of the mTORC1 protein kinase. Mol. Cell 25, 903–915.

Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L., and Sabatini, D.M. (2008). The Rag GTPases bind raptor andmediate amino

acid signaling to mTORC1. Science 320, 1496–1501.

Sengupta, S., Peterson, T.R., Laplante, M., Oh, S., and Sabatini, D.M. (2010). mTORC1 controls fasting-induced ketogenesis and its modulation by ageing.

Nature 468, 1100–1104.

Shimano, H., Horton, J.D., Hammer, R.E., Shimomura, I., Brown, M.S., and Goldstein, J.L. (1996). Overproduction of cholesterol and fatty acids causes massive

liver enlargement in transgenic mice expressing truncated SREBP-1a. J. Clin. Invest. 98, 1575–1584.

Stokes, M.P., Rush, J., Macneill, J., Ren, J.M., Sprott, K., Nardone, J., Yang, V., Beausoleil, S.A., Gygi, S.P., Livingstone, M., et al. (2007). Profiling of UV-induced

ATM/ATR signaling pathways. Proc. Natl. Acad. Sci. USA 104, 19855–19860.

Thoreen, C.C., Kang, S.A., Chang, J.W., Liu, Q., Zhang, J., Gao, Y., Reichling, L.J., Sim, T., Sabatini, D.M., andGray, N.S. (2009). An ATP-competitive mammalian

target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. J. Biol. Chem. 284, 8023–8032.

Wang, L., Lawrence, J.C., Jr., Sturgill, T.W., and Harris, T.E. (2009). Mammalian target of rapamycin complex 1 (mTORC1) activity is associated with phosphor-

ylation of raptor by mTOR. J. Biol. Chem. 284, 14693–14697.

Yip, C.K., Murata, K., Walz, T., Sabatini, D.M., and Kang, S.A. (2010). Structure of the human mTOR complex I and its implications for rapamycin inhibition. Mol.

Cell 38, 768–774.

S4 Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc.

Figure S1. Further Characterization of the Regulation of Nuclear Eccentricity upon mTORC1, MAPK, or Cell-Cycle Perturbation, Related to

Figure 1

(A) Representative images from NIH 3T3 cells processed as in Figure 1B were analyzed for nuclear eccentricity based on lamin A immunofluorescence by image

analysis software (Carpenter et al., 2006).

(B) NIH 3T3 cells treated with the indicated compounds (10 mMPD184352, 25 mMLY294002, 250 nM Torin1) or vehicle for 24 hr were analyzed by flow cytometry

for DNA content. Double (2x) thymidine block was performed as follows: 2 mM thymidine for 12 hr/ 12 hr re-fresh media without thymidine/ 12 hr 2 mM

Thymidine. The values shown in the table in (B) are the mean values for n = 2 or 3.

(C) Cells treated as in (B) were processed in an immunofluorescence assay to detect lamin A and DNA content, imaged, and analyzed for mean nuclear

eccentricity based on lamin A immunofluorescence by image analysis software. Nuclear eccentricity distributions for each cell treatment are shown. Mean

eccentricity values for three independent fields for each condition (>500 cells total) are as follows: DMSO (black) 0.636; PD184352 (gray hatched line) 0.636; 2x

thymidine (gray solid line) 0.625; LY294002 (orange) 0.726; Torin1 (red) 0.756.

Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc. S5

Figure S2. Further Characterization of the Regulation of Lipin 1 Localization upon mTORC1, Nutrient, MAPK, CDK, or Cell-Cycle Pertur-

bation, Related to Figure 2

(A) FLAG-lipin 1-overexpressing AML12 cells were treated with 100 nM rapamycin, 250 nM Torin1 for 8 hr, processed in an immunofluorescence assay to detect

FLAG, and imaged.

(B) FLAG-lipin 1-overexpressing HEK293T cells were treated with 100 nM rapamycin, 250 nM Torin1 for 8 hr and analyzed by immunoblotting for the levels and

phosphorylation state of 4E-BP1.

(C) Cells treated as in (B) were processed in an immunofluorescence assay to detect FLAG and imaged.

(D) 3T3-L1 cells were treated with vehicle, 250 nM Torin1, 20 nM rapamycin or were deprived of serum and glucose or amino acids for 12 hr were processed in an

immunofluorescence assay to detect lipin 1 (green), costained with DAPI for DNA content (blue), and imaged.

(E) FLAG-lipin 1-overexpressing p53�/� or rictor�/�; p53�/�� MEFs were treated with 250 nM Torin1 or vehicle for 8 hr and imaged as in (C).

(F) HEK293T cells overexpressing FLAG-lipin 1 were starved of amino acids for 2 hr and imaged as in (C).

(G) FLAG-lipin 1-overexpressing NIH 3T3 were treated with the indicated compounds (25 mm LY294002, 2 mM AICAR, 14 mm roscovitine, 10 mM PD184352) or

vehicle for 12 hr and imaged as in (B). 2x thymidine block was performed as follows: 2 mM thymidine for 12 hr/ 12 hr re-fresh media without thymidine/ 12 hr

2 mM thymidine.

S6 Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc.

Figure S3. Further Characterization of Lipin 1 Phosphorylation, Catalytic Activity, Localization, and Lipin 1-Dependent Regulation of Nuclear

Eccentricity, Related to Figure 3

(A) NIH 3T3 were transfected with the indicated FLAG-lipin 1 expression vectors, cell lysates prepared, and FLAG-immunoprecipitates were analyzed by

immunoblotting for lipin 1 phosphorylation and FLAG.

(B) 3T3-L1 cells were treated with 20 nM rapamycin, 250 nM Torin1, or vehicle for 4 hr. Cell lysates were prepared and lipin 1 immunoprecipitates and cell lysates

were analyzed by immunoblotting for the phosphorylation states and levels of the specified proteins.

(C) HEK293T cells overexpressing FLAG-lipin 1 were treated with the indicated inhibitors (100 nM rapamycin, 250 nM Torin1, or 600 nM staurosporine) or vehicle

for 12 hr. FLAG immunoprecipitates were prepared, trypsin digested, and the ratio of peptides containing the phosphorylated versus nonphosphorylated forms of

S237 and S472 lipin 1 were quantified by mass spectrometry (‘‘�’’ indicates the phosphorylated form was not detected, ‘‘+’’ indicates the phosphorylated form

was detected).

(D) HEK293T cells overexpressing FLAG-mLST8/GbLwere infected with lentivirus expressing an shRNA targeting raptor or GFP. FLAG immunoprecipitates were

prepared from cell lysates and analyzed for mTOR kinase activity toward 4E-BP1 in the presence of 250 nM Torin1 or vehicle.

(E) HEK293T cells overexpressing FLAG-raptor. FLAG immunoprecipitates were prepared from cell lysates and subject to gel filtration to obtain highly purified

mTORC1 (Yip et al., 2010). mTORC1 kinase activity toward 4E-BP1 or lipin 1 peptides containing the T37 or S106 residues, respectively, in the presence of

250 nM Torin1 or vehicle was analyzed by autoradiography.

(F) Cell lysates were prepared from HEK293T cells and a control (p53) or mTOR immunoprecipitates were prepared and analyzed by autoradiography for mTOR

kinase activity toward wild-type lipin 1, 17xS/T/ A lipin 1, or S6K1.

(G) HEK293T cells were transfected with the indicated cDNAs in expression vectors, cell lysates prepared, and lysates and FLAG-immunoprecipitates were

analyzed by immunoblotting for the amounts of the specified recombinant proteins.

(H) FLAG-wild-type or 17xS/T/ A lipin 1-overexpressing AML12 cells were processed in an immunofluorescence assay to detect FLAG and imaged.

(I) Wild-type or fldMEFs were treatedwith 250 nMTorin1 or vehicle for the indicated times. Cells were processed in an immunofluorescence assay to detect lamin

A and DNA content and analyzed for nuclear eccentricity based on lamin A immunofluorescence by image analysis software for three independent fields for each

condition (>500 cells total). Error bars indicate standard error for n = 3.

(J) HEK293T cells transfected with GFP or the indicated HA-lipin 1 expression vectors were analyzed for PAP1 activity. Cell lysates were prepared and analyzed

by immunoblotting for the levels of HA-tagged proteins. * indicate nonspecific bands.

(K) NIH 3T3 cells stably expressing the indicated FLAG-lipin 1 expression vectors were processed in an immunofluorescence assay to detect FLAG and imaged.

Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc. S7

Figure S4. Further Characterization of mTORC1- and Lipin 1-Dependent Regulation of SREBP and SREBP Target Gene Expression, Related

to Figure 4

(A) NIH 3T3 cells were treated with 100 nM rapamycin, 250 nM Torin1, or vehicle for the indicated times. SREBP-1 and SREBP-2 mRNA were measured by qRT-

PCR and normalized to 36B4 mRNA levels. Error bars indicate standard error for n = 4.

(B) Wild-type and fld MEFs were treated with 250 nM Torin1 or vehicle for the indicated times. SREBP-1 mRNA was measured by qRT-PCR and normalized to

36B4mRNA levels. To allow comparison betweenwild-type and fldMEFs, each treated sample was normalized to the level of the vehicle controls of the same cell

type. Error bars indicate standard error for n = 4.

(C) HepG2 cells were transfected with expression constructs containing a transcriptionally active, truncated form of SREBP-1 or an empty vector and treatedwith

20 nM rapamycin, 250 nM Torin1, or vehicle for 4 hr. Cell lysates were prepared and analyzed by immunoblotting for the levels and phosphorylation state of the

indicated proteins.

S8 Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc.

Figure S5. Further Characterization of mTORC1- and Lipin 1-Dependent Regulation of Nuclear SREBP Protein Expression and Localization,

Related to Figure 5

(A) mRNA analysis of SREBP and SREBP-target gene expression in NIH 3T3 with RNAi-mediated knockdown of a control protein or SREBP-1. SREBP and

SREBP target gene mRNA were measured by qRT-PCR and normalized to 36B4 mRNA levels. Error bars indicate standard error for n = 4. * indicates p < 0.05

comparing SREBP-1 with control knockdown cells.

(B) mRNA analysis of SREBP and SREBP-target gene expression in TSC2�/�; 53�/� MEFs with RNAi-mediated knockdown of a control protein or SREBP-1.

mRNA was prepared and analyzed as in (A). Error bars indicate standard error for n = 4. * indicates p < 0.03 comparing SREBP-1 with control knockdown cells.

(C) HEK293T cells were treated with 250 nM Torin1 or vehicle for 8 hr, nuclei were isolated from which soluble proteins were extracted, and the levels of the

indicated proteins were analyzed by immunoblotting. Processed SREBP-1 and SREBP-2 proteins were detected at 68–70 kDa.

(D) HEK293T cells were starved of serum or serum and amino acids for 6 hr. Nuclear extracts were prepared and analyzed as in (C).

(E) Wild-type or 17xS/T/ A mutant lipin 1 were stably expressed in fld MEFs. Nuclear extracts were prepared and analyzed as in (C).

(F) Wild-type or 17xS/T/ A mutant lipin 1 were stably expressed in HEK293T. Nuclear extracts were prepared and analyzed as in (C).

(G) NIH 3T3 cells overexpressing FLAG-SREBP-2 were treated with 250 nM Torin1 or vehicle for 8 hr. Cells were then processed in an immunofluorescence assay

to detect FLAG (green), costained with DAPI for DNA content (blue), and imaged.

(H) Fld MEFs coexpressing wild-type or 17xS/T/ A mutant FLAG-lipin 1 and HA-SREBP-1 were processed in an immunofluorescence assay to detect FLAG

(green) and HA (red), costained with DAPI for DNA content (blue), and imaged.

Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc. S9

Figure S6. Further Phenotypic Characterization of Li-RapKO Mice, Related to Figure 6

(A) Mouse hepatocytes were isolated and infected with adenovirus driving expression of HA-tagged lipin 1. Forty-eight hours post-infection, hepactocytes were

treated with 400 nM Torin1 or vehicle for 4 hr. HA immunoprecipitates were prepared from cell lysates and immunoprecipitates and cell lysates were analyzed by

immunoblotting for the phosphorylation states and levels of the specified proteins.

(B) Mice fasted for 24 hr were injected with insulin (10 mU/g body weight) or saline for 1 hr. Livers were harvested 10min later and lipin 1 immunoprecipitates were

prepared and analyzed by immunoblotting for lipin 1 phosphorylation and levels.

(C) 4-month-old male control and Li-RapKO mice were fed chow or a Western diet for 2 months. Body weights were measured bimonthly. Error bars indicate

standard error for n = 6.

(D) Daily food consumption is unaffected by raptor genotype or diet. Control, Ctrl. Error bars indicate standard error for n = 6.

S10 Cell 146, 408–420, August 5, 2011 ª2011 Elsevier Inc.