1

Molecular modeling, organ culture and reverse genetics for a

newly identified human rhinovirus C

Yury A Bochkov, Ann C Palmenberg, Wai-Ming Lee, Jennifer A Rathe, Svetlana P Amineva,

Xin Sun, Thomas R Pasic, Nizar N Jarjour, Stephen B Liggett, and James E Gern

Online supplementary materials

Table of Contents

Supplementary Figure 1. Neighbor-joining phylogenetic tree based on 5′-UTR nucleotide

sequences of HRV-A, HRV-B and HRV-C.

Supplementary Figure 2. Construction of the full-length cDNA copy of HRV-C15.

Supplementary Figure 3. Progression of cytopathic effects in transfected HeLa cells.

Supplementary Table 1. Composition correlation coefficients for receptor footprints.

Supplementary Table 2. Coefficient ratios for receptor footprint locales.

Supplementary Table 3. Primers used for construction of the full-length cDNA copy of HRV-

C15.

Supplementary Methods

Supplementary References

100

88100

100

99

95

9452

57

45

51

89

74

87

81

80

52

80

44

81

72

100

05101520p-distance (% change)

HRV-B

HRV-AHRV-C

HEV

HRV-A

A7, 36, 58, 88, 89

(63 types)

HRV-B(25 types)

A45

A12

A78

A71

A65

A51

CV-A13

PV-3I

PV-1m

Supplementary Figure 1. Neighbor-joining phylogenetic tree based on 5′-UTR nucleotidesequences of HRV-A, HRV-B and HRV-C. All major nodes are labeled with bootstrap values(% of 1000 replicates). The HRV-C15 (W10) sequenced in this study is shown in bold type.Branch lengths are proportional to nucleotide similarity (p-distance). Human enteroviruses(HEV) are included as an outgroup. The tree was generated by Mega 4.1 software .

2

HRV-”Ca”

HRV-”Cc”

1

C6 (026, EF582387)

C10 (qce, GQ323774)

C1 (nat001, EF077279)

C7 (ny-074, DQ875932)

C5 (025, EF582386)

C2 (nat045, EF077280)

C9 (n10, GQ223228)

C4 (024, EF582385)

C8 (n4, GQ223227)

C15 (w10, GU219984)

C3 (qpm, EF186077)

C11 (CL-170085, EU840952)

A(n)

2A 2B 2C 3A 3C 3D3B

5’-UTR 1A 1B 1C 1D

1 607 808 1603 2308 3145 3571 3868 48465071 5137

5686 7066 7111

3’UTR

3067 6766

6647

18681 3281

1596

Supplementary Figure 2. Construction of the full-length cDNA copy of HRV-C15. (a) The genomeof the C15 (W10) consists of a single open-reading frame flanked by the 5′ and 3′ untranslatedregions (UTRs), and encodes one large polyprotein that is cleaved to provide mature viral proteins(1A-1D; 2A-2C; 3A-3D). Four overlapping cDNA fragments, shown by thick lines, were synthesizedby RT-PCR from viral genomic RNA using primers (Supplementary Table 3). (b) The PCR fragment(primers w10-2R-f and w10-2R-r) was cloned in reverse orientation into a StuI-linearized vectorpMJ3 to create pW10-2R, which was used to produce antisense probe against viral genome forin situ hybridization. To clone the full-length cDNA of C15, pW10-2R was digested with NheI andXmaI and ligated to insert 4 (“pC15-3’UTR”). Next, the resulting plasmid was cut with SalI andBamHI and separately ligated to insert 1 with an upstream T7 promoter to make “pC15-5’end-insert 1”,and then ligated to insert 3 to make “pC15-3’end”. Insert 2 was then cloned into “pC15-5’end-insert 1”using MluI and XmaI restriction sites to make “pC15-5’end-inserts 1&2”. Next, the cDNA fragmentcontaining inserts 3 and 4 was excised from “pC15-3’end” using BlpI and XmaI, and this fragmentwas then ligated into “pC15-5’end with inserts 1&2” to make pC15. The final recombinant plasmidpC15 contained a full-length cDNA copy of the viral RNA downstream of a T7 promoter.

pMJ33204 bp

Stu I

pW10-2R4071 bp

Nhe I Xma I

pC15-3’UTR3802 bp

Sal IBam HI

pC15-3’end7233 bp

Blp I Xma I

pC15-5’endinsert 15494 bp

Mlu IXma I

pC15-5’endinserts 1&2

6473 bp

Blp IXma I

T7 promoter

Bst BI

pC1510345 bp

Poly(A) Poly(A)

a

b

insert 1insert 2

insert 3

insert 4

3

Xma I

A(n)

moc

kC

15A

1624 h 48 h 72 h

Supplementary Figure 3. Progression of cytopathic effects in transfected HeLa cells. Cytopathiceffects observed 24-72 h after transfection of cell monolayers with full-length HRV-A16 andHRV-C15 RNAs (0.1 µg RNA per well in 12-well plate). Cells were transfected using Lipofectamine2000 as described in the Supplementary Methods. Scale bars, 100 µm.

4

5

Supplementary Table 1. Composition correlation coefficients for receptor footprints.

Pearson rp

Pearson rp

Pearson rp

Pearson rp

Spear- man rs

Spear- man rs

Spear- man rs

Spear- man rs

(a)

HRV protein align

location

(b)

footprint residue(s)

(c)

foot print type

(d)

% most frequent

AA in same receptor

group

(e)

other frequent

AA in same receptor

group

(f)

avg ICAM-1

only

(g)

all ICAM-1 x LDLR

(h)

all ICAM-1 x HRV-

C

(i)

all LDLR x HRV-C

(j)

avg ICAM-1 only

(k)

all ICAM-1 x LDLR

(l)

all ICAM-1 x HRV-

C

(m)

all LDLR x HRVC

205 14-E-2-136 ICAM-1 27% T,D E,G 0.80 0.03 0.26 0.27 0.50 0.13 0.09 0.09

206 16-K-2-137 ICAM-1 28% G K,T,R,S 0.41 0.08 0.60 -0.12 0.45 0.08 0.06 0.05

207 16-G-2-138 ICAM-1 95% G G 1.00 0.97 0.10 0.28 0.30 0.62 0.23 0.59

208

14-N-2-139, 16-N-2-139, A21-K-2-139 ICAM-1 87% N N 0.99 0.43 0.81 0.48 0.62 0.30 0.03 0.14

209 14-V-2-140, 16-V-2-140 ICAM-1 97% V V 1.00 0.99 0.60 0.69 0.53 0.70 0.46 0.69

210 14-S-2-141 ICAM-1 47% T, 41% S - 0.59 0.23 -0.07 0.57 0.56 0.20 0.13 0.16

213 14-K-2-143 ICAM-1 73% G K 0.56 0.97 0.60 0.47 0.45 0.21 0.14 0.21

232 14-V-2-162 ICAM-1 41% gap - 0.63 0.68 0.15 0.69 0.21 0.48 0.12 0.22

236 A21-D-2-167 ICAM-1 100% gap - 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

241 16-K-2-164, 21-A/V-2-168 ICAM-1 45% K R,G 0.61 0.40 0.33 -0.10 0.35 0.06 0.26 0.00

243 A21-E-2-170 ICAM-1 93% P - 0.98 1.00 1.00 1.00 0.68 0.52 0.52 1.00

434 16-K-3-086 ICAM-1 36% K, 26% R P,N 0.84 0.85 0.37 -0.06 0.70 0.36 0.13 0.00

436 14-F-3-086 ICAM-1 73% D F 0.55 0.97 0.89 0.93 0.49 0.37 0.09 0.37

439 14-D-3-089 ICAM-1 72% S D 0.52 0.96 -0.06 -0.05 0.32 0.29 0.01 0.00

440 16-H-3-092 ICAM-1 53% Q G,H 0.41 0.89 -0.07 -0.05 0.19 0.17 0.02 0.00

443 14-K-3-093 ICAM-1 58% A K,S 0.40 0.89 0.46 0.31 0.62 0.11 0.49 0.20

527 14-D-3-177, 16-T-3-179 ICAM-1 73% T D 0.49 -0.07 -0.09 -0.08 0.38 0.10 0.02 0.01

528

14-P-3-178, 16-P-3-180, A21-R-3-180 ICAM-1 96% P P 0.99 0.71 -0.05 -0.10 0.43 0.24 0.04 0.00

529 14-D-3-179, 16-D-3-181 ICAM-1 100% D D 1.00 0.93 1.00 0.92 1.00 0.37 0.52 0.16

530 14-T-3-180, 16-T-3-182 ICAM-1 81% T K 0.97 0.13 -0.05 0.03 0.42 0.25 0.11 0.03

535 16-S-3-185 ICAM-1 72% S T 0.51 0.93 0.41 0.05 0.65 0.52 0.99 0.43

579 14-Q-3-226 ICAM-1 52% N Q,D 0.42 0.66 -0.08 -0.08 0.57 0.68 0.01 0.01

686 14-N-1-092 ICAM-1 29% V, 27% N I,L 0.36 0.62 -0.11 -0.09 0.50 0.18 0.02 0.01

704 14-R-1-094 ICAM-1

55% gap, 28% K - 0.56 0.87 0.89 0.98 0.25 0.11 0.19 0.37

705 14-E-1-095 ICAM-1 37% gap 20% E S 0.50 0.71 0.82 0.85 0.32 0.21 0.14 0.24

711 16-K-1-095, A21-I-1-102 ICAM-1 26% D,K T 0.33 0.67 0.58 0.49 0.46 0.31 0.35 0.20

713 14-K-1-103, A21-N-1-104 ICAM-1 57% K Q 0.86 0.23 0.41 0.04 0.28 0.18 0.11 0.01

769 14-P/H-1-155 ICAM-1 98% P P 1.00 1.00 1.00 1.00 0.68 0.52 0.52 1.00

770 16-G-1-148 ICAM-1 100% G G 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

6

773

14-N/K-1-159, 16-I-1-151, A21-R-1-161 ICAM-1 25% I,N L,V 0.31 0.73 -0.12 -0.02 0.59 0.43 0.00 0.01

775 14-K-1-161, 16-T-1-153 ICAM-1

28% K 20% T E 0.68 0.81 0.32 0.52 0.35 0.45 0.15 0.43

821 14-H-1-206, A21-R-1-209 ICAM-1 62% G H 0.38 0.74 0.75 0.64 0.46 0.28 0.10 0.08

828 A21-N-1-216 ICAM-1 100% gap - 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

831 A21-D-1-218 ICAM-1 89% D - 0.99 0.82 0.64 0.53 0.62 0.56 0.06 0.19

832 14-D-1-208, A21-A-1-219 ICAM-1 24% D S,Q,G,T 0.55 0.44 0.11 0.04 0.66 0.09 0.08 0.01

833 16-Y-1-202 ICAM-1 26% P T,A,E 0.54 0.17 0.01 0.32 0.42 0.21 0.02 0.14

834 14-E-1-210, 16-K-1-203 ICAM-1 26% D

G,N,S,E,T 0.49 0.49 0.44 -0.08 0.64 0.27 0.47 0.00

835 14-T-1-211 ICAM-1 62% S T 0.43 0.60 0.22 0.32 0.50 0.63 0.07 0.08

836 14-Q-1-212, 16-R-1-205 ICAM-1 33% R P,Q 0.43 0.13 -0.09 0.73 0.54 0.13 0.02 0.22

840 16-V-1-209 ICAM-1 33% V T,S,N,I 0.43 0.87 0.25 -0.01 0.37 0.47 0.26 0.20

841 14-V-1-217 ICAM-1 97% V - 1.00 0.84 0.13 0.31 0.53 0.09 0.06 0.10

842 A21-I-1-229 ICAM-1 66% T V 0.47 0.82 0.93 0.87 0.34 0.42 0.24 0.52

843 A21-N-1-230 ICAM-1 99% N - 1.00 1.00 1.00 1.00 0.68 0.52 0.52 1.00

844 14-H-1-220, 16-D-1-213 ICAM-1 54% D H 0.55 0.20 0.77 0.30 0.67 0.21 0.11 0.10

847 14-S-1-223 ICAM-1 66% T S 0.57 0.94 0.92 0.88 0.63 0.79 0.39 0.23

915 14-K-1-280 ICAM-1 33% R I 0.56 0.58 0.92 0.49 0.38 0.17 0.22 0.05

916 16-R-1-277 ICAM-1 29% K R,A 0.62 0.37 0.58 0.26 0.52 0.50 0.34 0.20

917 14-R-1-282 ICAM-1 16% N,D,K P,T 0.15 0.28 0.43 0.17 0.30 0.18 0.08 0.04

918 14-K-1-283 ICAM-1 54% R V 0.85 0.94 0.85 0.86 0.43 0.16 0.23 0.25

924 14-Y-1-289 ICAM-1 37% V Y,A 0.39 0.47 0.41 0.59 0.72 0.36 0.41 0.57

687 2-T-1-085 LDLR 27% T,D E,N 0.43 0.51 -0.11 -0.11 0.54 0.46 0.04 0.01

689 2-A-1-087 LDLR 33% A T 0.30 0.15 -0.13 -0.11 0.26 0.09 0.05 0.02

690 2-N-1-088 LDLR 47% H N,E 0.38 0.40 -0.05 -0.09 0.40 0.08 0.00 0.01

753 2-L-1-132 LDLR 40% L,R - 0.58 -0.11 -0.11 -0.08 0.24 0.00 0.05 0.01

856 2-K-1-224 LDLR 100% K - 0.40 0.19 -0.05 0.09 0.56 0.06 0.10 0.11

858 2-I-1-226 LDLR 40% I A,V 0.48 0.23 0.57 0.08 0.34 0.23 0.47 0.14

860 2-K-1-228 LDLR 47% D K,S 0.46 0.15 0.00 0.89 0.46 0.09 0.02 0.17

footprint 0.63 0.66 0.46 0.42 0.50 0.36 0.25 0.27

capsid 0.78 0.88 0.61 0.57 0.71 0.59 0.48 0.50

(n)

genome 0.77 0.91 0.62 0.57 0.71 0.59 0.50 0.51

Abbreviations: HRV, human rhinovirus; ICAM-1, intercellular receptor molecule 1; LDLR, low-density lipoprotein receptor. (a) Polyprotein alignment position; 2265 columns total. (b) Mapped receptor footprint nomenclature identifies: virus (HRV-A2, A16, B14, or human

coxsackievirus A21), residue type (single letter code), capsid protein (VP2, VP3 or VP1) and residue number within that protein for the (unaligned) sequences.

(c) Receptor type contacted by residue(s). (d) Most frequent HRV amino acid(s) at that alignment position for that receptor group.

7

(e) Other frequent HRV amino acids (if >15% total composition). (f) The amino acid composition (percent) was tabulated for 3 randomized groups of ICAM-1 binding

sequences (Ma, Mb, Mc, 39 seqs each). Average of Pearson product moment correlation coefficients (rp) for pairwise comparisons among these groups is shown. Values closest to 1.0 have the highest congruence. Lower values have poorer correlation, and negative values reject any population similarities. The population of LDLR binding sequences (11 HRV types, 14 sequences) is too small for parallel, internal baseline composition averaging.

(g) rp values for all HRV ICAM-1 binding sequences vs all HRV LDLR binding sequences at indicated

alignment position. (h) rp values for all HRV ICAM-1 binding sequences vs all HRV-C sequences at indicated alignment

position. (i) rp values for all HRV LDLR binding sequences vs all HRV-C sequences at indicated alignment

position. (j) The ICAM-1 binding group (Ma, Mb, Mc) compositions (f) were reordered according to rank. The

(average) Spearman correlation coefficient (rs) was calculated as the square (rsq) of the Pearson correlation coefficient between group-pairs of these ranked values.

(k) rs values for all HRV ICAM-1 binding sequences vs all HRV LDLR binding sequences at indicated

alignment position. (l) rp values for all HRV ICAM-1 binding sequences vs all HRV-C sequences at indicated alignment

position. (m) rp values for all HRV LDLR binding sequences vs all HRV-C sequences at indicated alignment

position. (n) Average rp and rs values for all alignment positions covered by any receptor footprint, complete

HRV capsid, or complete HRV polyprotein (genome).

8

Supplementary Table 2. Coefficient ratios for receptor footprint locales.

Pearson

ratios Pearson

ratios Spearman

ratios Spearman

ratios

(a) footprint residue(s)

(b)

foot print type

(c)

all ICAM-1 / LDLR

(d)

all ICAM-1 / HRV-C

(e)

all ICAM-1 / LDLR

(f)

all ICAM-1 / HRV-C

(g)

Pearson predicts

ICAM-1 vs LDLR

discrimination

(h) Pearson predicts

ICAM-1 or LDLR

match for HRV-C

(i)

Spearman predicts

ICAM-1 vs LDLR

discrimination

(j) Spearman predicts

ICAM-1 or LDLR

match for HRV-C

14-E-2-136 ICAM-1 30.02 3.10 3.87 5.51 strong no weak no 16-K-2-137 ICAM-1 4.99 0.69 5.81 7.22 weak no strong no 16-G-2-138 ICAM-1 1.03 10.25 0.48 1.31 poor no poor no 14-N-2-139, 16-N-2-139, A21-K-2-139 ICAM-1 2.27 1.22 2.06 21.32 weak yes weak no 14-V-2-140, 16-V-2-140 ICAM-1 1.01 1.68 0.76 1.15 poor no poor no

14-S-2-141 ICAM-1 2.51 -8.13 2.87 4.41 weak no weak no 14-K-2-143 ICAM-1 0.58 0.93 2.12 3.28 poor no weak no 14-V-2-162 ICAM-1 0.92 4.25 0.44 1.75 poor no poor no

A21-D-2167 ICAM-1 1.00 1.00 1.00 1.00 poor no poor no

16-K-2-164, 21-A/V-2-168 ICAM-1 1.52 1.86 5.81 1.35 poor no strong no A21-E-2-170 ICAM-1 0.98 0.98 1.30 1.30 poor no poor no

16-K-3-086 ICAM-1 0.99 2.26 1.92 5.61 poor no poor no 14-F-3-086 ICAM-1 0.57 0.62 1.35 5.49 poor no poor no 14-D-3-089 ICAM-1 0.54 -8.04 1.10 30.28 poor no poor no 16-H-3-092 ICAM-1 0.46 -6.23 1.15 7.95 poor no poor no 14-K-3-093 ICAM-1 0.45 0.88 5.47 1.26 poor no strong yes 14-D-3-177, 16-T-3-179 ICAM-1 -7.40 -5.64 3.98 24.56 strong no weak no 14-P-3-178, 16-P-3-180, A21-R-3-180 ICAM-1 1.39 -19.43 1.83 10.69 poor no poor no 14-D-3-179, 16-D-3-181 ICAM-1 1.08 1.01 2.73 1.91 poor no weak no 14-T-3-180, 16-T-3-182 ICAM-1 7.36 -18.26 1.63 3.81 strong no poor no 16-S-3-185 ICAM-1 0.54 1.23 1.24 0.65 poor no poor no 14-Q-3-226 ICAM-1 0.64 -5.12 0.84 54.15 poor no poor no

14-N-1-092 ICAM-1 0.58 -3.33 2.69 23.37 poor no weak no

14-R-1-094 ICAM-1 0.64 0.63 2.19 1.28 poor no weak no

14-E-1-095 ICAM-1 0.71 0.61 1.50 2.35 poor no poor no 16-K-1-095, A21-I-1-102 ICAM-1 0.50 0.58 1.51 1.32 poor no poor no 14-K-1-103, A21-N-1-104 ICAM-1 3.76 2.08 1.51 2.63 weak no poor no 14-P/H-1-155 ICAM-1 1.00 1.00 1.30 1.30 poor no poor no

16-G-1-148 ICAM-1 1.00 1.00 1.00 1.00 poor no poor no 14-N/K-1-159, 16-I-1-151, A21-R-1-161 ICAM-1 0.43 -2.71 1.36 364.93 poor no poor no 14-K-1-161, 16-T-1-153 ICAM-1 0.83 2.10 0.79 2.31 poor no poor no 14-H-1-206, A21-R-1-209 ICAM-1 0.51 0.50 1.63 4.72 poor no poor no

A21-N-1-216 ICAM-1 1.00 1.00 1.00 1.00 poor no poor no A21-D-1-218 ICAM-1 1.21 1.56 1.10 11.10 poor no poor no 14-D-1-208, A21-A-1-219 ICAM-1 1.26 4.80 7.24 7.90 poor no strong no 16-Y-1-202 ICAM-1 3.14 69.67 2.04 26.07 weak no weak no

9

14-E-1210, 16-K-1203 ICAM-1 1.00 1.13 2.39 1.37 poor no weak yes 14-T-1211 ICAM-1 0.72 1.91 0.80 7.56 poor no poor No 14-Q-1212, 16-R-1205 ICAM-1 3.19 -4.80 4.27 30.96 weak no weak No 16-V-1209 ICAM-1 0.50 1.73 0.78 1.41 poor no poor No 14-V-1217 ICAM-1 1.20 7.54 5.90 9.45 poor no strong No A21-I-1229 ICAM-1 0.57 0.50 0.82 1.42 poor no poor No A21-N-1230 ICAM-1 1.00 1.00 1.30 1.30 poor no poor No 14-H-1-220, 16-D-1-213 ICAM-1 2.72 0.71 3.16 5.93 weak no weak No 14-S-1-223 ICAM-1 0.60 0.62 0.81 1.61 poor no poor No 14-K-1-280 ICAM-1 0.97 0.61 2.32 1.74 poor no weak No 16-R-1-277 ICAM-1 1.70 1.07 1.03 1.51 poor no poor No

14-R-1-282 ICAM-1 0.55 0.35 1.63 3.86 poor no poor No 14-K-1-283 ICAM-1 0.90 1.00 2.64 1.86 poor no weak No 14-Y-1-289 ICAM-1 0.83 0.94 2.00 1.77 poor no weak No 2-T-1-085 LDLR 0.84 -3.90 1.19 15.34 poor no poor No 2-A-1-087 LDLR 2.06 -2.28 2.95 5.50 weak no weak No 2-N-1-088 LDLR 0.95 -8.27 4.88 142.15 poor no weak No 2-L-1-132 LDLR -5.26 -5.27 52.02 4.47 strong no strong No 2-K-1-224 LDLR 2.05 -8.51 8.84 5.36 weak no strong No 2-I-1-226 LDLR 2.09 0.84 1.49 0.73 weak no poor No 2-K-1-228 LDLR 3.19 94.85 5.06 24.01 weak yes strong No

footprint 0.96 1.37 1.39 2.00 capsid 0.88 1.28 1.20 1.48 (k)

genome 0.85 1.23 1.22 1.44

Abbreviations: HRV, human rhinovirus; ICAM-1, intercellular receptor molecule 1; LDLR, low-density lipoprotein receptor. (a) Mapped receptor footprints: nomenclature as in Supplementary Table 1 column (b). (b) Receptor type contacted by residue(s). (c) Ratio of rp values in columns “f” and “g” from Supplementary Table 1. (d) Ratio of rp values in columns “f” and “h” from Supplementary Table 1. (e) Ratio of rs values in columns “j” and “k” from Supplementary Table 1. (f) Ratio of rs values in columns “j” and “l” from Supplementary Table 1. (g) Assessment of whether Pearson metrics (“c”) indicates a “strong” (>6.0 or <0.0), “weak” (<6.0,

>2.0) or “poor” (<2.0, >0.0) compositional bias that may discriminate between ICAM-1 binders and LDLR binders.

(h) If ICAM-1 binding locations (red) show a moderate compositional bias (Supplementary Table 1

“f” >0.6) that discriminates even weakly against LDLR binders (Supplementary Table 2 “c” >2.0) and correlates with the HRV-C sequences (Supplementary Table 2 “d” 0.5<>1.5), the location scores “yes”, otherwise “no”. For LDLR binding locations (green), if there is a compositional bias against ICAM-1 (Supplementary Table 1 “g” <0.6) and similarity between LDLR binders and the HRV-C (Supplementary Table 1 “i” >0.6) the location scores “yes”, otherwise “no”.

(i) Assessment of whether Spearman metrics (“e”) indicates a “strong” (>6.0 or <0.0), “weak” (<6.0,

>2.0) or “poor” (<2.0, >0.0) compositional bias that may discriminate between ICAM-1 binders and LDLR binders.

(j) Same location calls as in “h” except with corresponding Spearman instead of Pearson coefficient

data. (k) Average ratios as in columns “c”, “d”, “e” and “f” for all alignment positions covered by any

receptor footprint, complete HRV capsid, or complete HRV polyprotein (genome).

10

Supplementary Table 3. Primers used for construction of the full-length cDNA copy of HRV-C15.

Primer Sequence( 5′–3′)a Primer length

Amplicon size (base pairs),

insert # b w10-2R-f w10-2R-r OligoT-r NdeI-f 3UTR-r BlpI-f BamHI-r pMJ3-f T7prom-r 5'end-f BamHI2-r MluI-f BlpI-r PflMI-f MfeI-r PflMI-r NheI-r NheI-f

CAAGCACTTCTGTTACCCC TGCCATTCAACACTATCCAG ATATCCCGGGTTCGAATCGAT(25) ATTATAGCATATGGTGATGATGTAGT ATATCCCGGGTTCGAATCGA GATTGTCGACCTAACTCTAGTGGACCTGATG TGTACTGCCCTTGTCTGGTGGAG TGCGGGCCTCTTCGCTATTA ACCTATACCCAGTTTTAACCTATAGTGAGTCGTATTAATTTCG TAATACGACTCACTATAGGTTAAAACTGGGTATAGGTTGTTCC TCATTTCTAGGGGCAGAACAAG AACGCCAAGGCTTGCCAACG GACTCCCGGGGCCTGGAACATTGGTACTA GTTATCTAGACCATAGGCATGAACCAGTTTG CGTTGGTGTTCTGGGATGAACCT TGGGTGAGTCCTCTAGCGATT TGGATGGGTCCTGAGAAAAGTC GTCAGTAGACAAAACAATGGCACA

19

20

45

26

20

31

23

20

43

43

22

20

29

31

23

21

22

24

867

510, insert 4

3703, insert 3

203

1887, insert 1

1692, insert 2

Abbreviations: f, forward primer; r, reverse primer.

a Restriction sites used for cloning are underlined.

b Amplicon size and insert number (Supplementary Fig. 2) are indicated where appropriate.

11

SUPPLEMENTARY METHODS

Virus infection of transformed and primary cells. WI-38 cells (human embryonic lung

fibroblasts; ViroMed Laboratories) were cultured in glass tube format (16 × 125 mm) in Eagle's

Minimum Essential Medium supplemented by 10% fetal bovine serum. BEAS-2B bronchial

epithelial cells (ATCC CRL 9609) and A549 lung carcinoma cells (ATCC CCL 185) were

grown in bronchial epithelial growth medium (BEGM, Lonza) and F-12K (Mediatech) with 10%

fetal bovine serum (FBS), respectively. Primary fibroblasts, kindly provided by Dr. Becky Kelly

(University of Wisconsin-Madison) were isolated from bronchial biopsy specimens as

described2. These cells were grown in fibroblast basal medium (FBM, Clonetics) supplemented

with 10% fetal calf serum. H1-HeLa cells were grown in suspension culture (modified Eagle’s

medium (MEM, Gibco), 10% FBS), and plated 24 h before virus infection. WisL cells3 (human

embryonic lung fibroblasts) were grown in MEM (Gibco) with 10% FBS. Primary epithelial cell

cultures were established after enzymatic digestion of bronchi, sinus mucosa or adenoid tissues

obtained as byproducts after surgical procedures4. These cells were cultured in BEGM (Lonza) in

collagen-coated flasks or plates. Subconfluent monolayers of transformed and primary cells in 6

or 12-well plates were inoculated with HRV-C-positive nasal lavage samples, or 2 × 108 viral (v)

RNA copies ml-1 of HRV-C15 (passages 3–5) or recombinant HRV-C15, in parallel with HRV-

A1 and HRV-A16, and incubated for 3 h at 34 °C. After PBS wash cells were incubated for 24–

72 h (34 °C, 5% CO2).

RNA in situ hybridization. Formaldehyde-fixed and dehydrated sinus tissues were rehydrated,

treated with proteinase K then refixed with 4% formaldehyde and 0.2% glutaraldehyde.

Hybridization with digoxigenin-labeled viral RNA probe was performed under stringent

conditions (1.3 × SSC, pH 5.0; 50% formamide) in buffer (0.2% Tween-20, 0.5% CHAPS) at 70

°C overnight. Washed tissues were blocked (2% blocking solution, Roche, and 20% sheep

12

serum) and then incubated overnight with alkaline phosphatase-coupled anti-digoxigenin

antibodies (Roche). After extensive washes, the tissues were stained (BM purple, Roche) for 2–4

hours. After color development, the tissues were embedded in plastic (JB-4 embedding kit,

Polysciences, Inc), sectioned (10 μm), mounted, and counterstained with eosin before

photography.

HRV-C15 genome characterization. Partial sequence of the 5′-UTR region of the W10

prototype strain (EU126769) had been published5. The full-length genome sequence of HRV-

C15 (independently isolated strain genetically similar to W10), using RNA materials amplified

in mucosal organ culture (passage 4) was completed using the sequence-independent, single-

primer amplification method6,7. The assigned GenBank accession number is GU219984. The

HRV-C15 RNA and derived protein sequences were added to refined published core alignments

as described below. Phylogenetic context was evaluated from these alignments using neighbor-

joining method with bootstrap confidence tests (1000 replicates) and was consistent with other

available methods (Minimum Evolution, Maximum Parsimony, Maximum Likelihood and

UPGMA) integrated within MEGA 4.1 software1.

RNA in vitro transcription, transfection and electron microscopy. RNA transcripts were

synthesized from the linearized (BstBI) pC15 DNA with a RiboMax large-scale RNA production

system T7 (Promega), then RQ1 DNase I treated (Promega), purified with an RNeasy Mini Kit

(Qiagen) and analyzed by agarose gel electrophoresis. RNA (1µg) and 5 µl of Lipofectamine

2000 (Invitrogen) were diluted each in 0.25 ml Opti-MEM (Invitrogen) before mixing (final

volume is 0.5 ml) and incubation at room temperature for 20 min. Cells (in 12-well plates) were

washed, then overlaid with 0.2 ml Opti-MEM and 125 µl transfection mixture per well. After 1 h

incubation at 34 °C, transfection media were replaced with growth media (1 ml per well) and

13

cells were incubated at 34 °C for up to 72 h. Full-length RNA derived from pR16.11 infectious

clone which produce recombinant HRV-A16 virus8 was used in parallel experiments. RNA

transcripts produced from control DNA (luciferase gene) included with the T7 RNA production

system (Promega) served as negative control (mock). Concentrated (200,000 × g, 2 h) WisL cell

lysates collected 24 h after transfection were stained with methylamine tungstate and examined

by electron microscopy at the University of Wisconsin School of Medicine and Public Health

Electron Microscopy Facility.

Evaluation of HRV Receptor Footprints. Described HRV structure-based polyprotein and

RNA alignments7 were augmented with recent HRV-A sequences (GQ415051, GQ415052) and

HRV-C sequences (GQ323774, GQ223227, GQ223228) including HRV-C15 (GU219984). The

array contained 102 HRV-A (distributed among 76 types), 31 HRV-B (24 types), 11 HRV-C,

and 8 human enterovirus (HEV) outgroups including species A (AY421760, U22521), B

(M16572), C (AF499637, AF546702, V01149, K01392) and D (AY426531). The full datasets

are available upon request. The HRV-A and B sequence order within the protein alignment was

annotated according to whether each virus uses ICAM-1 (“M” major group, 119 sequences) or

LDLR (“m” minor group, 14 sequences) as its receptor9. To provide a baseline for composition

comparisons, the major group sequences were randomly assigned to one of three subgroups (Ma,

Mb, Mc). For every column position within the alignment, the observed amino acid composition

(percent, or composition rank) for each cohort of sequences (M, m, Ma, Mb, Mc, HRV-C) was

recorded into a spreadsheet. The arrays were evaluated pairwise for the Pearson product moment

correlation coefficient (rp) and Spearman’s rank correlation coefficient (rs) at each column

position. Both methods provide non-parametric function evaluations, ranking observed

similarities (values closest to 1.0) or differences (negative values or those closest to 0), between

cohort populations, or in this case, the amino acid compositions, without assumptions about the

14

particular nature of the relationships. Structure determinations of HRV-B14 and HRV-A16

bound to ICAM-110, coxsackievirus A21 bound to ICAM-111 and HRV-A2 bound to LDLR12

have identified capsid surface (footprints) contributing to the respective receptor interactions.

The rp and rs values for alignment positions (n = 57) including any of these identified contact

residues were summarized (Supplementary Table 1) along with averaged values for the sum of

these positions, the full (P1) capsid region, and the polyprotein as a whole. Among the subset of

footprint alignment positions, ratios for the rp and rs values between compared cohorts of

sequences were binned (Supplementary Table 2) according to “strong, weak or poor”

discrimination between ICAM-1 binders versus LDLR binders, and by whether the observed

amino acid compositions of the HRV-C sequences showed consistency with those of the ICAM-

1 binders or the LDLR binders (“yes, no”) at these same positions.

15

SUPPLEMENTARY REFERENCES

1. Tamura, K., Dudley, J., Nei,M., & Kumar, S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596–1599 (2007).

2. Nakamura, Y. et al. Ets-1 regulates TNF-alpha-induced matrix metalloproteinase-9 and tenascin expression in primary bronchial fibroblasts. J. Immunol. 172, 1945–1952 (2004).

3. Minor, T.E., Allen, C.I., Tsiatis, A.A., Nelson, D.B., & D'Alessio, D.J. Human infective dose determinations for oral poliovirus type 1 vaccine in infants. J. Clin. Microbiol. 13, 388–389 (1981).

4. Schroth, M.K. et al. Rhinovirus replication causes RANTES production in primary bronchial epithelial cells. Am. J. Respir. Cell Mol. Biol. 20, 1220–1228 (1999).

5. Lee, W.M. et al. A diverse group of previously unrecognized human rhinoviruses are common causes of respiratory illnesses in infants. PLoS. One. 2, e966 (2007).

6. Djikeng, A. et al. Viral genome sequencing by random priming methods. BMC Genomics 9, 5 (2008).

7. Palmenberg, A.C. et al. Sequencing and analyses of all known human rhinovirus genomes reveal structure and evolution. Science 324, 55–59 (2009).

8. Lee, W.M. & Wang, W. Human rhinovirus type 16: mutant V1210A requires capsid-binding drug for assembly of pentamers to form virions during morphogenesis. J. Virol. 77, 6235–6244 (2003).

9. Vlasak, M. et al. The minor receptor group of human rhinovirus (HRV) includes HRV23 and HRV25, but the presence of a lysine in the VP1 HI loop is not sufficient for receptor binding. J. Virol. 79, 7389–7395 (2005).

10. Xiao, C. et al. Discrimination among rhinovirus serotypes for a variant ICAM-1 receptor molecule. J. Virol. 78, 10034–10044 (2004).

11. Xiao, C. et al. The crystal structure of coxsackievirus A21 and its interaction with ICAM-1. Structure. 13, 1019–1033 (2005).

12. Hewat, E.A. et al. The cellular receptor to human rhinovirus 2 binds around the 5-fold axis and not in the canyon: a structural view. EMBO J. 19, 6317–6325 (2000).