Molecular methods in Behavioral Ecology and Forensics Clemens Küpper.
-
date post
19-Dec-2015 -
Category
Documents
-
view
221 -
download
1
Transcript of Molecular methods in Behavioral Ecology and Forensics Clemens Küpper.
Molecular methods in Behavioral Ecology and Forensics
Clemens Küpper
Outline
• Sex typing• DNA fingerprinting• Short tandem repeats / microsatellites- parentage- forensics- estimating relatedness
Sex typing
Sex typing
• in monomorphic species such as birds, reptiles and amphibians with genetic sex determination
• Birds: ZZ, ZW♂ ♀
• several sex typing markers available• CHD1 is found on Z and W, intron copies with
different length
Sex ratio and survival of Kentish plovers
Survival of sons is greater than daughters
Mating opportunities for deserting females are higher than for males
Polyandrous mating system
Male-biased population sex ratio
Székely et al. (2004) Behavioral Ecology
Kosztolanyi et al. (2011) J Evol Biol
Pitfalls of sex typing
• poor sample quality can lead to allelic dropout
• ZZ’ polymorphism in males in some species:
fragment pattern like females• Moorhens: ZZ’ male have low
survival
Lee et al. (2002) Evolution 56:2548-2553
DNA fingerprinting
• based on non-coding repetitive DNA (minisatellites)
• after DNA digestion and gel electrophoresis individual characteristic band pattern is visualized
• relatives share bands
Alex Jeffreys (1984)
DNA fingerprinting: Paternity tests
Red winged blackbirdWestneat (1991) Behavioral Ecology 4:49-60
DNA fingerprinting: Paternity tests
DunnockBurke et al. (1989) Nature 338:249-251
DNA fingerprinting: problems
Classic DNA fingerprinting is now rarely used:• laborious• large amounts of sample needed• band assignment by humans is subjective• fingerprints on different gels are hard to
compare
Microsatellites (or short tandem repeats)
• single locus co-dominant markers• alleles vary in repeat length• high mutation rate (10-3 - 10-5)• many microsats available• genetic profiles can be stored in data bases
2. DNA Polymerase stops during replication. Melting and wrong assembly of strands
ACCCCACACACACACACACATGGTACCTGTGGGGTGTGTGT GT
ACCCCACACACACACACACATGGTACCTGTGGGGTGTGTGTGTGTGTGTACCATGGAC
1. Microsatellite allele with 8 repeats
ACCCCACACACACACACACACATGGTACCTGTGGGGTGTGTGTGTGTGTGTGTACCATGGAC
3. Completion of synthesis and repair of strands results in two microsatellite alleles one with 8 and one with 9 repeats
ACCCCACACACACACACACATGGTACCTGTGGGGTGTGTGTGTGTGTGTACCATGGAC
Microsatellites: mutation process
Females increase heterozygosity in offspring through extra pair fertilizations
Foerster et al. (2003) Nature 425:714-717
Validation of Bateman’s principles in the rough-skinned newt
Jones et al. (2002) Proc R Lond B 269:2533-2539
Variance for mating (7x) and repr. success (19x) higher in than ♂♂ ♀
♀
Microsatellites in DNA profiling
• 13 highly polymorphic microsatellite markers with 5 to 20 alleles• Tetra- and pentanucleotide motifs• 1 in 113 000 000 0000 are expected to share identical genetic profiles• only needs one DNA molecule for profiling• FBI database (CODIS): 9 Mio entries in 2010, mainly offenders but also missing persons• 62k investigations aided in 2007
Problems with DNA profiling and data bases
• falsified DNA profiles (DNA spray, blood and saliva samples) • contamination (by sample takers / lab workers)• incomplete profiles e.g. if little sample is available•match can be higher (e.g. if you happen to have common alleles)• relatives share alleles, monozygotic twins have identical twins• security of DNA data bases
Calculating relatedness (r)
• r describes how much genetic information is shared between individuals • important for understanding of social evolution • occurrence of inbreeding and inbreeding avoidance • best estimate require pedigree but need long term studies and relatedness in first generation is unknown• dominant markers band sharing coefficient :
2Nab/(Na+Nb)
• co-dominant markers: Queller Goodnight’s r
Queller Goodnight’s r
x k lx
x k ly
PP
PPr
*
*
R = relatedness between individuals x and y where Px = frequency of allele l at locus k within individual xPy = frequency of same allele in individuals to which x is comparedP* = frequency of the allele in population at large (background allele frequency) rare alleles are more informative than common allelesnegative values possible : less related than pop average
Queller and Goodnight (1989) Evolution 43:258-275
Relatedness in haplodiploid species
Relatedness in hyaena packs
Van Horn et al. (2004) Mol Ecol 13:449-458
Problems with molecular r estimates
Csilléry et al. (2006) Genetics 173:2091-2101