Molecular Identiﬁcation of a SNAP-25-Like SNARE Protein in ... · duplications and the high...

EUKARYOTIC CELL, Aug. 2008, p. 1387–1402 Vol. 7, No. 81535-9778/08/$08.00�0 doi:10.1128/EC.00012-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Molecular Identification of a SNAP-25-Like SNARE Proteinin Paramecium�

Christina Schilde,* Kaya Lutter,† Roland Kissmehl, and Helmut PlattnerDepartment of Biology, University of Konstanz, 78457 Konstanz, Germany

Received 8 January 2008/Accepted 25 May 2008

Using database searches of the completed Paramecium tetraurelia macronuclear genome with the metazoanSNAP-25 homologues, we identified a single 21-kDa Qb/c-SNARE in this ciliated protozoan, named P. tetrau-relia SNAP (PtSNAP), containing the characteristic dual heptad repeat SNARE motifs of SNAP-25. Thepresence of only a single Qb/c class SNARE in P. tetraurelia is surprising in view of the multiple genomeduplications and the high number of SNAREs found in other classes of this organism. As inferred from thesubcellular localization of a green fluorescent protein (GFP) fusion construct, the protein is localized on avariety of intracellular membranes, and there is a large soluble pool of PtSNAP. Similarly, the PtSNAP thatis detected with a specific antibody in fixed cells is associated with a number of intracellular membranestructures, including food vacuoles, the contractile vacuole system, and the sites of constitutive endo- andexocytosis. Surprisingly, using gene silencing, we could not assign a role to PtSNAP in the stimulated exocytosisof dense core vesicles (trichocysts), but we found an increased number of food vacuoles in PtSNAP-silencedcells. In conclusion, we identify PtSNAP as a Paramecium homologue of metazoan SNAP-25 that shows severaldivergent features, like resistance to cleavage by botulinum neurotoxins.

Membrane trafficking in eukaryotic cells involves budding ofvesicles from a donor compartment and transport to and fusionwith the acceptor compartment. The soluble N-ethylmaleim-ide-sensitive factor attachment protein receptors (SNAREs)are of central importance in the mediation of membrane fu-sions (32). The crystal structure of the synaptic SNARE com-plex has been resolved (70). The ternary synaptic SNAREcomplex consists of the SNARE motifs of synaptobrevin-2(VAMP2) and syntaxin-1A and the two SNARE motifs fromthe synaptosome-associated protein of 25 kDa (SNAP-25).Structures of different SNARE complexes revealed a highlyconserved four-helix structure, with the difference that thepositions of the two SNARE motifs from SNAP-25 can becontributed by two different SNARE proteins (7). The highlyconserved pattern of SNARE pairing has led to the so-called3Q-plus-1R rule (21). According to this rule, fusogenicSNARE complexes always contain three SNARE motifs con-taining a glutamine residue in the center of the SNARE motif(Q-SNARE) and one SNARE displaying an arginine at thesame position (R-SNARE). Furthermore, Qa-, Qb-, Qc-, andR-SNAREs can be recognized by specific sequence features(40).

Identification of the SNARE components of the synapticSNARE complex and functional analysis have been greatlyfacilitated by the availability of specific inhibitors, e.g., by Clos-tridium botulinum neurotoxins (BoNTs), that specifically cleavecertain neuronal SNAREs (46). BoNTs are zinc-dependent

proteases which, by cleaving SNARE proteins, inhibit neuro-transmitter release. The structural basis for the specificity ofSNAP-25 cleavage by BoNT/A and BoNT/E has been solved,and the interacting amino acids have been mapped (13, 15).

Most SNAREs possess a carboxy-terminal transmembranedomain, whereas others, like the SNAP-25 protein and theR-SNAREs of the Ykt6 family, are attached to the membraneby fatty acid modification. Mammalian SNAP-25 is membraneattached by palmitoylation on a conserved stretch of cysteineresidues situated between the two SNARE motifs (75). How-ever, such a cysteine cluster is absent from the vertebrateproteins SNAP-29 and SNAP-47 (31, 67), as well as from allSNAP-25 homologues outside of the metazoans, and themodes of membrane attachment, if any, of those proteins re-main to be determined. Homologues to mammalian SNAP-25have been found in a variety of organisms ranging from uni-cellular organisms to plants, fungi, and higher eukaryotes (40).

Disassembly of the fully assembled SNARE complex is per-formed by the SNARE-specific chaperone NSF, an AAA-typeATPase (64), and SNAPs recruit NSF to the SNARE complex(59). The exact time point of NSF action before or after mem-brane fusion has been debated, and it is possible that differentrequirements for regulation are met in various membrane fu-sion events (25, 44, 63, 72, 78).

SNARE-mediated fusion is a common feature of all eukary-otic cells, and all of the above-mentioned components of theSNARE fusion machinery have also been identified in theciliated protozoan Paramecium tetraurelia (22, 36, 37, 61). Para-mecium, which must perform all of the autonomous functionsof an entire organism, possesses highly diversified membranetrafficking pathways (53). P. tetraurelia is capable of a fastsynchronous release of dense core vesicles, defensive or-ganelles called “trichocysts,” that has striking similarities todense core vesicle exocytosis of neuroendocrine cells (52, 74).Like many other ciliates, P. tetraurelia has regularly arranged

* Corresponding author. Mailing address: Department of Biology,University of Konstanz, P.O. Box 5560, 78457 Konstanz, Germany.Phone: 49-7531-88-4230. Fax: 49-7531-88-2245. E-mail: [email protected].

† Present address: Institut fur Biochemie und Molekularbiologie I,Universitatsklinikum Dusseldorf, Moorenstrasse 5, 40225 Dusseldorf,Germany.

� Published ahead of print on 13 June 2008.

1387

on March 11, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

cortical structures and organelles, such as ciliary bases, “alve-olar sacs” (calcium stores), sites of constitutive endo- and exo-cytosis (“parasomal sacs”), early endosomes (“terminal cister-nae”), and trichocysts, all of which are arranged in a highlyregular pattern. This feature facilitates the identification oforganelles and membrane interaction sites. For instance, the�1,000 trichocysts are predocked in a fusion-ready state atprecisely predictable sites. Food vacuole uptake and processingoccur in a highly ordered manner by transformation throughdefined stages while moving on a fixed route through the cell(“cyclosis”) (2–5). Many of the membrane interaction sitesinvolved are endowed with different SNAREs (37). Further-more, P. tetraurelia possesses a pair of contractile vacuole sys-tems for osmo- and ion regulation, each consisting of a col-lecting system of five to seven radial canals that empty throughampullae into a central contractile vacuole (1). NSF and dif-ferent SNAREs of the R- and Q-types were also found in thecontractile vacuole system (37, 61).

Here, we investigated the properties and subcellular local-ization of a homologue of the SNARE protein, SNAP-25, in P.tetraurelia. So far, SNAP-25 homologues have been investi-gated only in metazoans, fungi, and plants (11, 14, 16, 30), andthe present work is the first study of a SNAP-25 homologue ina unicellular organism.

MATERIALS AND METHODS

Cell culture. Wild-type strains of P. tetraurelia were stocks of 7S and d4-2,derived from stock 51S (65). Cells were cultivated in a bacterially inoculatedmedium as described previously (38). For permeabilization experiments, cellswere permeabilized in Dryl’s buffer (2 mM sodium citrate, 1 mM NaH2PO4, 1mM Na2HPO4, 1.5 mM CaCl2 [pH 6.8] [19]) supplemented with 0.2% bovineserum albumin (BSA) with 0.2%, 0.5%, or 1% Triton X-100, 0.1% or 0.3%digitonin, or 0.01% saponin. To demonstrate the acidification of food vacuoles,P. tetraurelia cells were fed with pHrodo (Invitrogen, Karlsruhe, Germany) Esch-erichia coli bioparticles for 20 min and results were analyzed by using epifluo-rescence microscopy using an Axiovert 100TV microscope equipped with filterset number 9 and a plan-Neofluar �40 oil immersion objective (numerical

TABLE 1. Oligonucleotides used for amplification and expression of PtSNAP

SNAP type Restrictionrecognition sites Oligonucleotide

Oligonucleotides for RT-PCRDei-1 AACTGGAAGAATTCGCGGCCGCGGAATTTTTTTTTTTTTTTSNAP-A Xho CCGCTCGAGATCCTTTAATGATTTTTTTTGTTTTTTCSNAP-B Spe GGACTAGTAAGCTTATGCAATAATAACAAATATAAAACAGSNAP-C TTAATCACACAAAAATCTCTATTAAAASNAP-D GCCGCATTAAATTAAGAACAAGAASNAP-E Xho CCGCTCGAGGTTTTTTCATTCTACTTGGACSNAP-F Xba GCTCTAGAAAGATCGATTACATTTTGGATGSNAP-G Spe GGACTAGTAAGCTTATGGATCTCAAGTATTCTACTATCSNAP-H GTTCGTCATTGGAGTTTCATCGSNAP-I CACATCTTATGGAGTCAAGTCTCSNAP-K Spe GGACTAGTAAGCTTATGTTCTCTTATCTGTCAATTASNAP-L CAGATTACTTGTTGTTCTTCGSNAP-M Spe GGACTAGTAAGCTTATGTCTTATATTTAACATCTCAATASNAP-O Spe GGACTAGTAAGCTTATGTTCAGCCTCAGCAACAAATSNAP-P GCGAGCTTACTAATCAATATGTGSNAP-Q GTGATTCGCAATTACGGATCTCCSNAP-R CTCCTCTTGTTCTTATTC

Oligonucleotides for fusion PCRfor heterologous expressionof SNAP

SNAP-1 Xho GCGCTCGAGTCCTTTAATGATTTTTTTTGTTTTTTCSNAP-2 GTTGCTCAGGATTTCTTGTTGTTGSNAP-3 GGCAGATTGTTGATTTATTTGGTACSNAP-4 CTTATGTAATTTCTGTTGATTTTGATCSNAP-5 GAAGAGTGCTTTAAATTGGCCCCSNAP-6 GTATTTGTTGTTTTTGATCATCTTTCSNAP-7 GACCTGCCTTTGGGGTGGTTGTTGSNAP-8 CATTTGATTTGTTTGATTAATCATCTCSNAP-9 GATTTGTTAAGAGCTGTTGGTATTTCSNAP-10 CTTTTGGTTTATTCTATCTAATTGGGTASNAP-11 CATTCTGCTTGGACATTTGGACAGSNAP-a Nco GCGCCATGGATCAAGCCGCATTAAATCAAGAACSNAP-b CAACAACAAGAAATCCTGAGCAACSNAP-c GTACCAAATAAATCAACAATCTGCSNAP-d GATCAAAATCAACAGAAATTACATAAGSNAP-e GGGGCCAATTTAAAGCAGTCTTCSNAP-f GAAAGATGATCAAAAACAACAAATACSNAP-g CAACAACCACCCCAAAGGCAGGTCSNAP-h GAGATGATTAATCAAACAAATCAAATGSNAP-i GAAATACCAACAGCTCTTAACAAATCSNAP-j TACCCAATTAGATAGAATAAACCAAAAGSNAP-k CTGTCCAAATGTCCAAGCAGAATG

1388 SCHILDE ET AL. EUKARYOT. CELL


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

VOL. 7, 2008 SNAP-25 IN PARAMECIUM 1389


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

aperture, 1.3) and imaging with a ProgRes C10 plus camera system (Jenoptik,Jena, Germany).

Annotation and characterization of the P. tetraurelia SNAP gene. The Para-mecium genome database (http://paramecium.cgm.cnrs-gif.fr) was BLASTPsearched with the amino acid sequences of the SNAP-25 homologues from otherorganisms obtained from NCBI (http://www.ncbi.nlm.nih.gov). The “supercon-tigs” of positive hits were identified by BLASTN searches, and the gene sequencewas manually completed, starting with an ATG start codon and terminating witha TGA stop codon. Putative introns, which, in Paramecium, are 18 to 35 nucle-otides long and flanked by conserved 5�-GT and 3�-AG sequences (57), weremanually annotated using MapDraw (DNA Star, Madison, WI) software. Theresulting predicted protein sequence was reciprocally analyzed by BLASTPsearches of the NCBI database (6). Conserved motif searches were performedwith either PROSITE (9) or BLAST-RPS software, using Pfam entries of thecorresponding CDD database (12, 45). We also used PSIPRED (34) and MEM-SAT 2 (33, 35), two software methods for secondary structure prediction (in-cluded with the server at http://bioinf.cs.ucl.ac.uk/psipred/ [47]).

PCR of genomic DNA and cDNAs. Total wild-type DNA from strain 7S forPCR was prepared from log-phase cultures as reported by Godiska et al. (24).The open reading frame of the P. tetraurelia SNAP (PtSNAP) gene was amplifiedby reverse transcriptase (RT) PCR, using total RNA prepared according toHaynes et al. (29). RT-PCR was performed in a programmable T3 model ther-mocycler (Biometra, Gottingen, Germany), using a 3� oligo(dTT) primer(5�-AACTGGAAGAATTCGCGGCCGCGGAATTTTTTTTTTTTTT-3�)and a SuperScript III RT (Invitrogen) for first-strand cDNA synthesis. Thesubsequent PCR was performed with Advantage 2 cDNA polymerase mixture(Clontech, Palo Alto, CA) using the PtSNAP-specific oligonucleotides (Table 1)with or without the artificial SpeI/XhoI or XbaI/XhoI restriction site added attheir ends. In general, amplifications were performed with one cycle of denatur-ation (95°C, 1 min), 40 to 42 cycles of denaturation (95°C, 30 s) and annealing (54to 58°C, 45 s), and an extension step (68°C, 3 min), followed by a final extensionstep at 68°C for 5 min. PCR products were subcloned into the pCR2.1 plasmidby using a TOPO-TA cloning kit (Invitrogen) according to the manufacturer’sinstructions. After clones were transformed into E. coli (TOP10F�) cells, positiveclones were sequenced as described below.

Sequencing. Sequencing was done by MWG Biotech (Martinsried, Germany)custom sequencing service. DNA sequences were aligned by the CLUSTAL Wfeature integrated in the DNAStar Lasergene software package (DNAStar, Mad-ison, WI).

Construction and microinjection of GFP expression plasmids. PtSNAP-spe-cific PCR products obtained with the oligonucleotides SNAP-O and SNAP-A orSNAP-K and SNAP-A (Table 1) were cloned into the enhanced green fluores-cent protein (eGFP) expression plasmid pPXV-GFP (27) in front of the eGFPgene, as described by Wassmer et al. (77), between the SpeI and XhoI restrictionsites of the plasmid, using conventional cloning procedures (58). Thus, becausethe actual start codon was unknown in the beginning, a short version and a longversion of a GFP fusion protein were constructed. For microinjection of cells, thepPXV-SNAP-GFP fusion plasmids were linearized with SfiI, which cuts in be-tween the Tetrahymena thermophila inverted telomeric repeats, thus helping tostabilize the DNA in the macronucleus after injection (28). DNA to be injectedwas isopropanol precipitated and resuspended to a concentration range of 1 to5 �g/�l in MilliQ water. For microinjection, postautogamous cells were used,which were allowed to grow for three or four generations in bacterially prein-oculated medium. To avoid disturbing the transformation process, we alsotreated cells with 0.2% aminoethyldextran (AED) to remove trichocysts (54) andequilibrated in Dryl’s buffer (19) supplemented with 0.2% BSA. DNA microin-jections were made with glass microcapillaries, using an Axiovert 100TV phase-contrast microscope (Zeiss, Oberkochen, Germany). Expression of GFP fusionproteins in clonal descendants of microinjected cells was analyzed after 24 to 48 hby epifluorescence microscopy with an Axiovert 100TV microscope (Zeiss)equipped with filter set 13 or 9, a plan-Neofluar �40 oil immersion objective

(numerical aperture, 1.3) and a ProgRes C10 plus camera system from Jenoptik.Excitation light was produced by a 100-W HBO lamp. Images were processedwith either Axiovision software (Zeiss) or Adobe Photoshop (Adobe Systems,San Jose, CA). Confocal images were acquired with an LSM510 Meta confocalscanning microscope (Zeiss) equipped with a plan-Neofluar �63 oil immersionobjective (numerical aperture, 1.4).

Gene silencing by feeding. The coding sequences of the PtSNAP gene, eitheras a �300-bp fragment from genomic DNA or as a full-length cDNA sequence,were amplified by PCR using the PtSNAP-specific oligonucleotides (Table 1) andcloned into the double T7 promoter plasmid pL4440 (71) over the SpeI and XhoIrestriction sites. Plasmids were introduced in the E. coli Ht115 strain, andParamecium cells were fed with these strains as described in detail by Galvaniand Sperling (23) and by Wassmer et al. (77). The Paramecium cells wereanalyzed after 24 to 96 h of feeding. The cells’ capability for trichocyst exocytosiswas routinely tested with a saturated solution of picric acid (56).

Recombinant expression of PtSNAP in E. coli. For heterologous expression ofPtSNAP, we selected a part of the coding region of PtSNAP (Q11-K175; EMBLaccession number CAK57530). After the mutated Paramecium glutamine codons(TAA and TAG) were substituted for the universal glutamine codons (CAA andCAG) by PCR methods (18) (Table 1 lists oligonucleotides), this region ofPtSNAP was cloned into the NcoI/XhoI restriction sites of the pRV11 expressionvector (79), a derivative of the pET system from Novagen (Madison, WI), whichadds an eight-amino-acid peptide to the C terminus of the selected sequence,including a His6 tag for purification of the recombinant peptides. PtSNAPQ11-K175

was then recombinantly expressed in E. coli BL21(DE3)-pLysS cells.Purification of the recombinant PtSNAP and preparation of polyclonal anti-

bodies. The recombinant PtSNAPQ11-K175 protein was purified by affinity chro-matography on Ni2�-nitrilotriacetate agarose under denaturing conditions, asrecommended by the manufacturer (Novagen, Madison, WI). The recombinantpeptide was eluted at pH 4.5 with a buffer containing 8 M urea, 100 mMNaH2PO4, and 10 mM Tris-HCl (pH 4.5) supplemented with 1 M imidazole. Thecollected fractions were analyzed on sodium dodecyl sulfate (SDS)-polyacryl-amide gels, and those containing the purified recombinant protein were pooled,dialyzed against phosphate-buffered saline (PBS; pH 7.4), and used for theimmunization of a rabbit. After the rabbit received several boosts, positive serawere taken and affinity purified by two subsequent chromatography steps asdescribed previously (38).

Cell fractionation. For subcellular fractionation, cells were grown in axenicculture medium at 25°C and harvested at the late logarithmic phase as previouslydescribed (39). Whole-cell homogenates were prepared in 20 mM phase buffer(20 mM Tris-maleate, 20 mM NaOH, 20 mM NaCl, 250 mM sucrose [pH 7.0])as described previously (38). Soluble and particulate fractions were separated bycentrifugation at 100,000 � g for 60 min at 4°C. A protease inhibitor cocktailcontaining 15 �M pepstatin A, 100 mU/ml aprotinin, 100 �M leupeptin, 0.26mM N �-(p-toluene sulfonyl)-L-arginine methyl ester (TAME), 28 �M E64, and0.2 mM Pefabloc SC (all from Sigma-Aldrich, Schnelldorf, Germany) was usedthroughout the preparation. Similarly, P. tetraurelia homogenates were separatedon a 10 to 30% Optiprep (Axis-Shield PoC AS, Oslo, Norway) gradient at 46,000� g for 18 h at 4°C.

BoNT treatment of cell lysates. BoNT/A (Sigma-Aldrich) and BoNT/E (ListBiological Laboratories, Campbell, CA) were reconstituted in sterile double-distilled H2O, supplemented with 1 mg/ml BSA to 0.1 mg/ml and activated in 200mM Tris-HCl (pH 8.0), 500 mM NaCl, and 50 �M ZnCl2 with 5 mM dithio-threitol for 30 min at 37°C. Approximately 30 �g of protein of crude cell lysatesfrom P. tetraurelia or PC12 cells or 5 �g of purified recombinant PtSNAP orrabbit SNAP-25 control peptide (List Biological Laboratories) was incubatedwith 20 ng of the respective BoNTs for 1 h at 37°C. The protein was methanolprecipitated and analyzed by SDS-polyacrylamide gel electrophoresis(PAGE) (see below). Rabbit SNAP-25 was detected on Western blots with ananti-human SNAP-25 mouse monoclonal antibody (clone SP12; Upstate Bio-technology, NY).

FIG. 1. (A) Nucleotide and deduced amino acid sequences of PtSNAP. The bases are numbered referring to the position of the start ATGcodon (bold). The locations of oligonucleotide primers used in this study are indicated below the underlined nucleotide sequence. The hypotheticalN-terminal extended amino acid sequence is indicated in gray capital letters. The first, a Qb-SNARE motif, is marked in yellow, and the second,a Qc-SNARE motif, is marked in blue. Hyphens mark the positions of the introns, and stars mark the translation stop codons TGA. (Ba) Homologybetween the region containing PtSNAP on scaffold_105 (continuous red line) and the corresponding region of scaffold_121 (below). A color barindicating the degree of sequence similarity and a nucleotide ruler are shown above. (Bb) Schematic illustration of the position of PtSNAP (blue)on scaffold_105 and the deletion in the respective region from the sister scaffold_121 below. Numbers above and below refer to the base pairnumber within the respective scaffold.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

1391


http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

SDS-PAGE and immunoblotting. Protein samples were denatured by boilingfor 5 min in SDS sample buffer and subjected to electrophoresis in 15% SDS-polyacrylamide gels, using a discontinuous buffer system described previously(36). Electroblotting onto nitrocellulose membranes and immunobinding werecarried out as described previously (38) by using affinity-purified antibodiesagainst PtSNAP. Bound antibodies were detected with a peroxidase-conjugatedsecondary antibody (anti-rabbit immunoglobulin G [IgG]), using an ECL detec-tion system (Amersham, Munchen, Germany). The anti-proteindisulfide-isomer-ase (anti-PDI) antibody was kindly provided by E. Ladenburger (University ofKonstanz).

Immunofluorescence analysis. Immunofluorescence analyses were performedwith permeabilized cells. Cells suspended in piperazine-N,N�-bis(2-ethanesul-fonic acid) (PIPES)–HCl buffer (5 mM; pH 7.2) supplemented with 1 mM KCland 1 mM CaCl2 were fixed in 4% (wt/vol) freshly depolymerized formaldehydein the same buffer solution. Following fixation, cells were permeabilized with0.5% digitonin (Sigma-Aldrich) for 30 min at 20°C, washed in PBS, and thenincubated twice in PBS supplemented with 50 mM glycine and finally in PBS plus1% BSA. Samples were then exposed to affinity-purified anti-PtSNAP antibodies(1:50) or to monoclonal anti-�-tubulin antibodies (clone DM1A; Sigma-Aldrich),followed by AlexaFluor488- or AlexaFluor594-conjugated F(ab�)2 fragments ofgoat anti-rabbit and goat anti-mouse IgG (Invitrogen), both diluted 1:100 in PBSplus 1% BSA. For controls, either preimmune serum was used or primaryantibodies were omitted. Samples were mounted with Mowiol supplementedwith N-propylgallate to reduce fading. Fluorescence was analyzed with anLSM510 Meta model confocal laser scanning microscope (Zeiss) equipped witha plan-apochromat �63 oil immersion objective (numerical aperture, 1.4) or ina conventional epifluorescence microscope (see above). Images acquired withthe LSM510 software were processed with Photoshop software (Adobe Systems).

RESULTS

Identification of PtSNAP. The developing Paramecium ge-nome database (http://paramecium.cgm.cnrs-gif.fr) based on theParamecium genome project (8, 17, 66, 80) was tBLASTNsearched with the amino acid sequence of SNAP-25 homologuesfrom other organisms. The search with leech (Hirudo medicinalis)SNAP-25 (GenBank accession no. gb|AAC47499) first returnedthree Qc-SNAREs, PtSyx14-1 (emb|CAK58342), PtSyx14-2(emb|CAK88055), and PtSyx15-1 (emb|CAK79412) (37) as ma-jor hits. Eventually, a single SNAP-25-like sequence could beidentified on scaffold_105, and the corresponding coding regionwas completed using flanking sequence information of the respec-tive supercontig (SuperContig_11387). The putative ATG startcodon and the TGA stop codon were manually assigned, as wellas the position of a single 25-bp conventional intron (Fig. 1A).This gene structure prediction fitted well with the automaticallyannotated gene model (GSPATT00028565001; emb|CAK57530)published later (8). Reciprocal BLASTP searches with the

PtSNAP sequence against those of GenBank confirmed theannotation of PtSNAP as a SNAP-25-like protein, in whichthe closest matches were the Anopheles gambiae strain PESTAGAP001394-PA (gb|EAA01106.5), Drosophila pseudoob-scura GA21816-PA (gb|EAL27731.1), the Aedes aegypti syn-aptosome-associated protein (EAT44027.1), and the Dro-sophila melanogaster SNAP-24 protein (gb|AAF73834.1).Generally, the sequence conservation between PtSNAP andhomologues of other species is low (expectation values of�0.21). However, this holds true for many SNAREs, sincethe SNARE motif is structurally conserved, i.e., not neces-sarily with a high degree of sequence homology.

Owing to a recent whole-genome duplication, Parameciumgenes often occur as pairs of closely related orthologues (8),and we previously described a great diversification of the Qa-SNARE and R-SNARE families (37, 61). However, we werenot able to identify any other SNAP-25-like protein in theParamecium genome. We searched the corresponding sisterscaffold_121 for the presence of a PtSNAP orthologue, but inthe respective region, a deletion seems to have occurred (Fig.1B). Sequence searches of the genome for the related ciliate T.thermophila (20) revealed a gene (TTHERM_00526630) sim-ilar to that which encodes PtSNAP. So far, we were not able toidentify SNAP-25 homologues in other ciliates in the CiliateOrtholog Database (http://oxytricha.princeton.edu/COD/).

An algorithm specifically trained on SNARE motifs hasbeen developed (40), and when the respective SNARE data-base was searched with PtSNAP, matches with expectationvalues of e�11 for the consensus SNAP-25 Qb/c motifs wereobtained (Fig. 2A). Furthermore, when reverse PSI-BLAST(rpsBLAST) was performed with PtSNAP, high similarity wasfound with a number of motifs from SNAP-25 homologuesfrom different species (Fig. 2B). Importantly, conservation ofthe characteristic SNARE motif heptad repeats was observedfor PtSNAP (Fig. 2B). In a phylogenetic tree constructed fromthe orthologues, PtSNAP consistently grouped within thisgroup (Fig. 2C), and different methods of tree constructiongave identical branching patterns. A hydrophilicity plot forPtSNAP shows no clear indication of membrane attachmentsites (Fig. 2D).

The neuronal SNAP-25 and SNAP-23 homologues are nor-mally membrane attached by means of palmitoylation on a

FIG. 2. (A) SNARE motif score for PtSNAP with the SNARE motif trained algorithm (SNARE-DB [40]). Shown are the scores for theSNAP.b and SNAP.c motifs and the homology to the consensus motifs. Conserved residues are shaded in black; similar residues are in gray. Theposition of the SNARE motif heptad repeats is indicated above the sequence. (B) Alignment of the Qb- and Qc-SNARE motifs of SNAP-25 withthe Qb/c-SNARE motifs of other SNAP-25 homologues: Tetrahymena thermophila TTHERM_00526630 (Tt00526630; GenBank accession no.gi|89309844); Plasmodium falciparum SNAP-23 (PfSNAP23; gi|23615361); Dictyostelium discoideum GRAM-domain-containing protein(DDB0237970; gi|66827589); Homo sapiens synaptosome-associated protein 23 (HsSNAP23; gi|1374813), SNAP-25 (HsSNAP25; gi|14714976),and SNAP-29 (HsSNAP29; gi|6685982); Hirudo medicinalis SNAP-25 homologue (HmSNAP25; gi|1923252); Caenorhabditis elegans resistance toinhibitors of cholinesterase (RIC-4) family member (CeY22F5A.3; gi|32567202); protein K02D10.5 with two t-SNARE domains (CeK02D10.5;gi|17554000); Drosophila melanogaster synaptosome-associated protein 24 (DmSNAP24; gi|8163739), SNAP-25 (DmSNAP25; gi|548941); Schizo-saccharomyces pombe SNAP-25 homologue (SpSNAP25; gi|3650385); Saccharomyces cerevisiae t-SNARE component Sec9 (ScSec9p; gi|730733),SNAP-25 homologue Spo20p (ScSpo20p; gi|6323659); Arabidopsis thaliana synaptosome-associated protein SNAP25-like SNAP-29 (AtSNAP29;gi|15241436), SNAP-30 (AtSNAP30; gi|15222976), and SNAP-33 (AtSNAP33; gi|15240163). The heptad amino acid repeats of the SNARE motifare shaded black, and the conserved residues are gray. Amino acid positions of the corresponding proteins are indicated on both sides. Presumptivecleavage sites for BoNT/A and BoNT/E are indicated below. (C) Neighbor-joining tree (with 1,000 bootstrap replicates) of phylogeneticrelationships between SNAP-25 homologues. Species names and protein identifiers are the same as those shown in panel A. Bootstrap supportvalues for the nodes are shown, and evolutionary distances are indicated by the scale bar below. (D) Kyte-Doolittle hydrophilicity plot of PtSNAP.Amino acid positions are indicated by the ruler above.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

stretch of four conserved cysteine residues (41, 75). However,such a palmitoylation site is absent from the other mammalianSNAPs, SNAP-29 and SNAP-47. Likewise, we found no pal-mitoylation signal in PtSNAP. In fact, there is not a singlecysteine residue in the amino acid sequence of PtSNAP onwhich fatty acid modification could occur.

Experimental verification of PtSNAP by PCR and RT-PCRmethods. To verify the existence of the in silico-identifiedPtSNAP gene and its in vivo expression, the genomic andcDNA sequences of PtSNAP were amplified (Fig. 3A) withspecific PCR primers (Table 1 and Fig. 1, SNAP-B plus SNAP-A), subcloned, and fully sequenced. Thus, the expression of thegene, as well as the predicted intron position, was verified.Since initially there were several possibilities for the position ofthe ATG start codon, we also tried to obtain PCR productsfrom cDNA with primers covering an ATG further upstream(SNAP-G plus SNAP-A) (Fig. 3B). The amplification productswere checked for the presence or absence of the intron bysequencing or digestion with the restriction enzyme NsiI whichcuts within the intron sequence. Surprisingly, amplificationsfrom cDNA could be obtained with primers lying as far as 184bp upstream of the predicted translation start point (SNAP-Hplus SNAP-A) (Fig. 3B). No RT-PCR products were obtainedwith primers lying more than 184 bp upstream from the as-sumed starting ATG codon (SNAP-K/L/M/O/P plus SNAP-A)(Fig. 3C). Thus, there were only two possible localizations ofthe ATG start codon: at bp position 1 or at bp position �116(Fig. 1), resulting in a 20.8-kDa or a 25.3-kDa protein, respec-tively. To address this question, an antibody was raised againstamino acids Q11 to K175 of PtSNAP.

Detection of PtSNAP in Western blots. PtSNAPQ11-K175 wasrecombinantly expressed in E. coli cells. This required substi-tuting 19 TAA and TAG glutamine codons of Paramecium forthe CAA and CAG codons of the universal genetic code by PCRmethods (18). The recombinantly expressed PtSNAPQ11-K175

containing a C-terminal hexahistidine tag was purified byaffinity chromatography on Ni2�-nitrilotriacetate agaroseunder denaturing conditions and was used for immunizationof a rabbit. Polyclonal antibodies were affinity-purified fromthe final serum.

When used in Western blots against P. tetraurelia cell lysates,the anti-PtSNAP antibody recognized two major bands withapparent molecular masses of 20 and 21 kDa (Fig. 4A), con-firming the predicted ATG start position at the second possiblestart codon. An additional immunoreactive band of about 46kDa was present only when the lysates had been boiled for 5min at 95°C and probably represents aggregates of PtSNAP(Fig. 4A), as such irreversible aggregation of membrane pro-teins in SDS at �50°C has been described before (60). WhenP. tetraurelia cell lysates were fractionated into soluble andinsoluble fractions, the 20-kDa band preferentially stayed inthe 16,000 � g supernatant, whereas the 21-kDa band wentwith the pellet fraction. PtSNAP could be extracted from thepellet with 1% Triton X-100, 2 M NaCl, and 4 M urea or 100mM NaCO3 but not by treatment with 1 M hydroxylamine(Fig. 4B), a deacylating reagent that attacks thioester bonds ofpalmitoylated proteins (48, 51). These data suggest that thehigher molecular weight form of PtSNAP is not palmitoylatedand probably not myristoylated but is bound to membranes bymeans of protein-protein interactions. However, we cannotexclude the possibility that the smaller molecular weight formrepresents a degradation product of full-length PtSNAP.

When P. tetraurelia cell lysates were separated on 10 to 30%Optiprep gradients (55), the 21-kDa band segregated withmembrane fractions to the top of the gradient, whereas the20-kDa PtSNAP immunoreactive band segregated to the bot-tom of the gradient, where soluble material accumulates (Fig.4C). The boiling-induced 46-kDa PtSNAP immunoreactiveband was situated in the middle of the gradient (Fig. 4C). Weconclude that the two forms of PtSNAP have distinct distribu-tions in the cell and possibly also function in different com-plexes. However, the type of modification (or degradation) ofPtSNAP remains unknown, as with many PtSNAP-25 homo-logues from other organisms.

We also tested PtSNAP for susceptibility to cleavage byBoNTs. Whereas the cleavage site for BoNT/E (15) is con-served in PtSNAP, the site for BoNT/A (13) is not. When wetested with cell extracts (Fig. 4D) or recombinantly expressedPtSNAP (Fig. 4E), we could not find any cleavage of PtSNAP,either by BoNT/A or by BoNT/E. Activity of the respective

FIG. 3. Amplification of the PtSNAP gene from genomic DNA and cDNA. The downstream primer is always SNAP-A. For the position of theSNAP primers used, refer to Fig. 1A. (A) Amplification of PtSNAP from genomic DNA (gDNA) and cDNA, with upstream oligonucleotideprimers SNAP-B or SNAP-C, amplifies products of the expected size. (B) Amplification of PtSNAP from gDNA and cDNA, with upstreamoligonucleotide primer SNAP-G or SNAP-H, also amplifies products of the expected size. (C) Upstream primers SNAP-K, SNAP-L, and SNAP-Mare able to amplify products from gDNA but not from cDNA. The DNA size marker used throughout all experiments is a 1-kb ladder, and bandsizes (in bp) are indicated to the left.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

botulinum toxins was demonstrated by the cleavage of endog-enous SNAP-25 of PC-12 cells, detected with an anti-humanSNAP-25 antibody, or by the cleavage of recombinant mam-malian SNAP-25. Using a negative control for BoNT/A cleav-age, we also tested mutated BoNT/A* (E224Q), which is un-able to cleave SNAP-25 (Fig. 4D and E). The mutatedBoNT/A* was also not active with PtSNAP but gave rise tosome higher-molecular-weight bands that are immunoreactivewith anti-PtSNAP, as if it were irreversibly binding to theprotein (Fig. 4D).

PtSNAP is distributed ubiquitously over the cell. Since ini-tially there were two possibilities for the localization of theATG start codon of the PtSNAP gene, we cloned two versionswith a C-terminal GFP tag, one starting at ATG at bp position1 and the other one starting at ATG bp position �116. Whenthey were microinjected into P. tetraurelia macronuclei, bothversions resulted in identical localization patterns, and therewas no effect on cell viability. Both constructs gave a highcytosolic GFP fluorescence, with exclusion of the macronu-cleus and the food vacuole lumen (Fig. 5A and B). Above thestrong cytosolic signal, staining of food vacuole membranesand smaller vesicles and along the radial canals of the contrac-

tile vacuole system was observed (Fig. 5A and B, enlargement).Attempts to reduce the strong cytosolic GFP fluorescence bypermeabilizing the cells with Triton X-100, digitonin, or sapo-nin resulted in a complete loss of GFP fluorescence. Thus, themajority of PtSNAP appears to be (detergent) soluble.

To visualize internal membrane structures, we fixedPtSNAP-GFP expressing cells and analyzed them by confocalmicroscopy. This reduced the cytosolic background fluores-cence, and the staining of internal membranes became visible.By using this method, we were able to visualize the food vac-uole membranes, the cell surface membranes, the radial canals,and the central vacuole of the contractile vacuole system (Fig.5C and D). Unexpectedly, there was also signal from cilia andfrom within the macronucleus. The presence of this signalcontrasts with that observed from living cells, where the ma-cronucleus was devoid of GFP fluorescence (Fig. 5A, B), whilestaining of cilia in living cells could not be resolved due to theirmovement, which was faster than the camera frame-grabbingrate. In both cases, we suspect a redistribution of solublePtSNAP upon fixation.

We also found PtSNAP-GFP staining between docked tri-chocysts but not on trichocyst tips (Fig. 5E and F). Enhanced

FIG. 4. Western blot detection of PtSNAP in P. tetraurelia cell lysates. (A) An affinity-purified anti-PtSNAP antibody recognizes two bands of 20 and21 kDa (white and gray arrowheads) each. An additional PtSNAP-cross-reactive band (black arrowhead) of �46 kDa is induced by boiling (�) thesamples and is not present when boiling is omitted (�; right lane). Asterisks indicate probable degradation products of PtSNAP. (B) Distribution of the20- and 21-kDa PtSNAP-immunoreactive bands is indicated by white and gray arrowheads in cell fractionations (L, lysate; S1, supernatant; P1, pellet)and in samples treated (S2, supernatant; P2, pellet) with 1% Triton X-100, 2 M NaCl, 4 M urea, 100 mM NaCO3 and 1 M hydroxylamine. (C) Differentialdistribution of the 20- and 21-kDa PtSNAP immunoreactive bands in a 10 to 30% Optiprep gradient after equilibrium centrifugation. Dense membranessegregate to the top of the gradient (left); less dense membranes and soluble material accumulate at the bottom (right). Arrowheads indicate distributionas described in the legend to panel A. (D) Treatments of P. tetraurelia cell lysates (L, left) or control reactions of PC12 cell lysates (L, right) with BoNT/A,mutated inactive BoNT/A* (E224Q), and BoNT/E are shown. The mutated BoNT/A* gave rise to some higher-molecular-weight bands that areimmunoreactive with anti-PtSNAP antibody. (E) Coomassie blue-stained gels of recombinant PtSNAP (rPtSNAP, top) and a recombinant mammalianSNAP-25 test substrate (rSNAP-25, bottom) treated with BoNT/A, mutated inactive BoNT/A* (E224Q), and BoNT/E.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

FIG. 5. GFP fluorescence in live cells microinjected with a long version (PtSNAP-lv-GFP) (A) and a short version (PtSNAP-sv-GFP) (B), withenlarged details of stained vacuole membranes (middle) and corresponding bright field image (far right). Note that the stained food vacuole (fv)



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

staining at a position diagonal and posterior to trichocystspossibly represents parasomal sacs or other vesicles of theendosomal system (Fig. 5F).

To consolidate the data obtained from GFP overexpression,we used the affinity-purified anti-PtSNAP antibody for local-ization of PtSNAP by immunostaining. Staining of food vacu-ole membranes (Fig. 6A) and along the radial canals and of thecentral vacuole of the contractile vacuole system (Fig. 6B)could be confirmed. Staining peripherally between trichocysts

(Fig. 6A) was also found and probably represents endoplasmicreticulum (ER) subdomains. Furthermore, we also observedstaining with anti-PtSNAP in the macronucleus, confirming theresults obtained from fixed PtSNAP-GFP-expressing cells (Fig.6B). Staining of the sites of constitutive endo- and exocytosis(parasomal sacs) with anti-PtSNAP is visible when we focusedon the cell surface (Fig. 6C). To correctly address the punctatesurface staining pattern, we also performed confocal micros-copy imaging with cells double stained for PtSNAP and �-tu-

has moved during the objective lens change in the enlargement shown at the right compared to that shown at the left. mac, unstained macronucleus.(B, middle panel) A vacuole (vac) is located on top of the dark appearing macronucleus. The radial canals (rc) and ampullae (amp) of thecontractile vacuole system are also weakly stained. (C to F) Confocal image slices (thickness, 1 �m) of fixed PtSNAP-sv-GFP-expressing cells. (C)Median slice showing staining of the membrane of food vacuoles, in the vicinity of trichocysts (tr; the dark, carrot-shaped cortical objects), on cilia(ci) and inside the macronucleus. (D) Median slice showing staining of radial canals and the central contractile vacuole of the contractile vacuolesystem, between trichocysts and inside the macronucleus. (E) Superficial slice showing staining of dot-like structures and the whole cell surface.cs, cytostome. (F) Enlarged image of a superficial slice showing staining of the whole cell surface and on the regularly arranged parasomal sacs(ps; encircled, between dark trichocysts) but not on trichocyst tips (trt) (indicated by arrows), whose positions can be extrapolated from theirregular pattern. Scale bars � 10 �m.

FIG. 6. Immunostaining with an affinity-purified anti-PtSNAP antibody. Left panels show the whole cells, and right panels show an enlargementof the indicated areas. (A) Median view showing staining of food vacuole membranes (fv) alongside the cytostome (cs) and between trichocysts.(B) Median view showing staining of the radial canals (rc) and central pulsating vacuole of the contractile vacuole system, as well as staining ofthe macronucleus (mac). (C) Surface focus showing staining of regularly arranged parasomal sacs. Occasional doublets of parasomal sacs, indicatedby arrows, may possibly represent division situations. Scale bars � 10 �m.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

bulin (Fig. 7). We observed PtSNAP antibody staining at thecytostome (Fig. 7B), where a great number of parasomal sacsare located (R. D. Allen, electron micrograph [http://www5.pbrc.hawaii.edu/allen/ch10/14-pca740125-18.html]), and onthe cell surface in very close apposition to basal bodies (Fig. 7Cand D). However, discriminating between the 20- and 21-kDaforms of PtSNAP was not possible with this method. In sum-mary, we found PtSNAP in a regular cortical pattern, at foodvacuoles, between trichocysts, and on the radial arms and cen-tral vacuole of the contractile vacuole system.

Dissection of PtSNAP function by gene silencing. Owing toits homology to SNAP-25, the SNARE involved in stimulatedexocytosis in neuronal cells, and because Paramecium is capa-

ble of stimulated exocytosis of dense core vesicles, we firstconcentrated on the effects of the PtSNAP posttranscriptionalgene silencing on the exocytosis of trichocysts. Surprisingly,however, we could find no such effect for PtSNAP. Exocytosisstimulated with picric acid (a fixing agent used for rapid ge-netic screening) or with the secretagogue AED occurred to thesame extent as that of the wild-type control cells (Fig. 8A, B).Also, neither the docking of trichocysts nor their ability todecondense their contents was affected in PtSNAP-silencedcells. However, when those cells were examined with a lightmicroscope, they appeared completely filled with food vacu-oles (Fig. 8D and G). There was also no effect of PtSNAPsilencing on cell viability. We even observed a consistent, al-

FIG. 7. Confocal microscopy image slices (0.9 �m, thickness) of a P. tetraurelia cell double stained with anti-PtSNAP (green) and anti-�-tubulin(red) antibodies. (A) Overview of a slice from the cortical region. The outline of the cell is indicated by a thin white oval line, with the anteriorend of the cell orientated at the top. (B, C, and D) Enlarged details from the boxed regions of panel A. The regular staining pattern probablyrepresents parasomal sacs (green), generally one juxtaposed to duplicate basal bodies (red, arrows). Scale bar � 10 �m.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

though not statistically significant, increase in the division rateof PtSNAP-silenced cells compared to that of controls (Fig. 8Eand F). The number of food vacuoles was increased (P 0.013) after 72 to 96 h of silencing compared to that of controlcells that were fed with the same strain of bacteria, while thenumber of acidified food vacuoles, as determined by feedingwith pH-sensitive fluorophore-labeled bacteria, was un-changed (Fig. 8G). Efficient silencing was demonstrated by thedownregulation of PtSNAP levels after 72 h of silencing, asprobed in Western blots with the specific anti-PtSNAP anti-body (Fig. 8H).

These results were surprising because of the central role ofmammalian SNAP-25 homologues in stimulated exocytosisand because PtSNAP is the only candidate for a SNAP-25gene-like gene identified in Paramecium so far. Additionally,PtSNAP posttranslational gene silencing in exocytosis-defi-cient nd9-1 cells, where the trichocyst docking sites are notformed, did not lead to a morphological undocking of tricho-cysts (data not shown).

According to the localization of PtSNAP in parasomal sacs,we suspected it might have a function in the constitutive exo-cytosis of surface antigens. However, we could find no differ-ences between the presence and expression patterns of surfaceantigens A, B, D, and H of PtSNAP-silenced cells compared tothat of control cells (data not shown).

DISCUSSION

Number of SNAP-25 genes. The SNAP-25-like proteins be-longing to the class of Qb/Qc-SNAREs are the only examplesknown so far of dual-SNARE-motif-containing proteins (40).Here, we identify and characterize a single SNAP-25 homo-logue in the ciliate P. tetraurelia. Like all SNAREs of ciliates(37, 61), it shares only a low degree of overall sequence ho-mology with mammalian homologues. However, a gene similarto the SNAP-25 gene (TTHERM_00526630) exists in the re-lated ciliate T. thermophila, and it will be interesting to see ifthere are similar homologues found in other ciliates. Thiswould be important to ascertaining an evolutionary origin ofSNAP-25-like genes before the emergence of multicellular or-ganisms. Three SNAP-25 homologues have also been identi-fied in the plant Arabidopsis thaliana (30), a genus thatbranched off in the phylogenetic tree well before the fungus/animal split (10). There is, however, no evidence so far for arole of those SNAP-25 homologues in stimulated exocytosisoutside the animal kingdom. So, if SNAP-25-like genes werepart of the original gene repertoire of the last common eu-karyotic ancestor, what was their exact role? Were they origi-nally involved in membrane fusion or associated with othercellular processes? A more comprehensive sampling of SNAP-25-like genes from other taxa will be necessary to answer thesequestions.

The PtSNAP gene apparently has retained no sister iso-form from the recent genome duplication (8). Instead, thereis a deletion in the corresponding region of the sister scaf-fold_121. Similarly, there is only a single SNAP-25 genehomologue present in the genome of T. thermophila(TTHERM_00526630) (20). This finding was surprising be-cause mammals contain at least four SNAP-25 homologues,SNAP-23, SNAP-25, SNAP-29, and SNAP-47 (40), which can

be functionally diversified further by alternative splicing. Cili-ates, however, possess no alternative splicing, and, therefore,all Qb/c-SNARE functions have to be performed by a singlePtSNAP gene product.

Posttranslational modification. All plant SNAP-25-like pro-teins lack the conserved cysteine cluster of mammalianSNAP-25 that could act as attachment points for palmitateresidues. However, the A. thaliana SNAP-33 (AtSNAP-33)protein, which is also devoid of a central cysteine cluster, atleast was shown to localize to the plasma membrane (30),although the mechanism of its membrane attachment is alsonot known. There is evidence for an N-myristoylation sequencemotif (G83-L88) at an equivalent position of the cysteine clus-ter in PtSNAP, but this localization between the two SNAREmotifs does not agree with conventional N-terminal co- orposttranslational myristoylation. On the other hand, it hasbeen reported that myristoyl residues can be posttranslation-ally attached to lysine residues (68, 69), so it is possible thatmyristoylation on one or several of the numerous lysine resi-dues of PtSNAP could occur. Likewise, palmitoylation of lysineresidues had been found in adenylate cyclase toxin by massspectrometry (26). At this point, we cannot exclude the possi-bility that this modification pathway is used in Paramecium.Because myristoylation or palmitoylation on lysine residues isthrough O-ester and not through thioester bonds, the treat-ment with 1 M hydroxylamine at a neutral pH would notnecessarily have hydrolyzed these bonds. Therefore, we cannotwith certainty exclude fatty acid modification of PtSNAP. An-other possibility is that the smaller PtSNAP immunoreactiveband simply represents a proteolytic degradation product ofthe full-length protein, because the relative ratios detectedbetween those two bands showed some variability betweenexperiments.

Insensitivity of PtSNAP to botulinum toxins. Using bio-chemical methods, we find PtSNAP is not cleaved by BoNT/Aor BoNT/E, even though the site of BoNT/E cleavage is con-served in the primary amino acid sequence of PtSNAP. How-ever, because the recognition motif of BoNTs is a conforma-tional rather than an amino acid motif (13, 15), the greatevolutionary distance to mammals may entail that PtSNAP isnot a substrate for those toxins. Earlier analyses in our labo-ratory showed that injection of BoNT/A into Paramecium cellshad no effect on wild-type cells (75a), while it prevented re-docking of trichocysts after chemically induced undocking withcytochalasin B in nd9-1 cells at nonpermissive temperatures,where trichocysts are attached to the cortical Ca2� stores, butnot at the plasma membrane (50). These effects of BoNTs onthe redocking of detached trichocysts in nd9-1 cells may beexplained by unspecific cleavage of other proteins.

Localization of PtSNAP. We found that on Western blots,PtSNAP appears in two different forms and that the higher-molecular-weight form clearly behaves as a membrane-associ-ated protein, even though any possible type of modification onPtSNAP remains so far unknown. However, we cannot tellwhich one of the two forms is posttranslationally modified orwhether both forms are posttranslationally modified. BothPtSNAP forms sediment with different fractions on a densitygradient. We also found evidence for a dynamic distribution ofPtSNAP between a soluble cytosolic and a membrane-boundpool, whereas the functional significance of this is still unclear.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

FIG. 8. Posttranscriptional gene silencing of PtSNAP (PtSNAP-RNAi). Stimulation of trichocyst release with picric acid in a control (A) anda typical PtSNAP-silenced cell (B), both showing complete discharge of trichocysts. (C and D) Bright field images of a typical control cell (C) and aPtSNAP-silenced cell (D) showing moderate enrichment of vacuoles in the latter. Scale bars � 10 �m. (E) Division rates of controls (black) andPtSNAP-silenced cells (gray) from one set of experiments. Asterisks indicate a reduced division rate during the first 24 h of silencing due to a lageffect after transfer from normal medium to feeding solution. Note the increased division rate of PtSNAP-silenced cells from 48 h onward. (F)



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

We could localize PtSNAP on a number of internal mem-branes, i.e., the membranes of food vacuoles, the contractilevacuole system, and the internal ER subdomains and paraso-mal sacs, as well as on the plasma membrane (Fig. 9). Further-more, there is a large cytosolic pool of PtSNAP. This suggeststhe involvement of PtSNAP in a number of membrane fusionprocesses. We could not detect any accumulation of PtSNAPon trichocyst tips, where exocytic fusion sites are preformed.However, we saw an overall labeling of the cell surface in fixedPtSNAP-GFP-expressing cells equivalent to the localization ofSNAP-25 in neuronal and neuroendocrine cells. Labeling ofPtSNAP-GFP in the vicinity of trichocysts probably representsperipheral ER extensions. The pronounced labeling of the sitesof constitutive endo- and exocytosis, the parasomal sacs, withboth the PtSNAP-GFP construct and the anti-PtSNAP anti-body suggests the involvement of PtSNAP in membrane traf-ficking there. Because several other SNAREs were found inthose compartments (37, 61; C. Schilde, unpublished results),we expect that PtSNAP is a SNARE partner in several differ-ent SNARE complexes there. A challenging finding is theoccurrence of PtSNAP in the contractile vacuole system.Again, several other SNAREs (37, 61; C. Schilde, unpublisheddata), as well the SNARE-specific chaperone NSF (36), local-ize to the contractile vacuole system as if there was a highextent of membrane trafficking. At this time, we can only spec-ulate about the function of SNAREs in the osmoregulatorysystem.

The observation of macronuclear PtSNAP after fixation ofcells but not before needs further explanation. Most likelythere is a redistribution of soluble PtSNAP during fixation.

Native PtSNAP (molecular mass, 20.8 kDa), as well as theGFP-fused molecule (molecular mass, 46.8 kDa), are smallenough to diffuse freely through nuclear pore complexes. Weassume an active mechanism for the retention of PtSNAP inthe cytosolic compartment, which becomes inactivated uponfixation.

Functional aspects. Unlike the role expected from its ho-mology to mammalian SNAP-25, we could not find a role forPtSNAP in the stimulated exocytosis of dense core vesicles(trichocysts). This was unexpected, because PtSNAP exists as asingle transcript and successful gene silencing could be dem-onstrated by Western blotting with the specific anti-PtSNAPantibody. However, Paramecium contains several other Qb-and Qc-SNAREs (C. Schilde, unpublished results), so therecould be redundancy of function. Such a functional redun-dancy has been observed for SNAREs in many other cases (43,62, 76). Accordingly, in certain mammalian cell types, post-transcriptional gene silencing or expression of a dominant-negative mutant form of SNAP-23 has not led to any pheno-typic defects in secretion, even though SNAP-23 is the onlySNAP-25 homologue normally present in those cells (49). Inconclusion, from our data, we cannot exclude the possibilitythat redundancy of function masked a possible effect ofPtSNAP on trichocyst exocytosis.

We observed an increase in the number of food vacuoles percell in PtSNAP-silenced Paramecium cells. Feeding of silencedcells with pH indicator Congo red-stained yeast cells showedthat this is due to an increased uptake of food vacuoles (datanot shown), not to a defect in food vacuole processing and/ordefecation, and we could exclude a defect in the acidification of

The averaged percentage difference in division rate between the control and PtSNAP-silenced cells is statistically significantly increased. Bar,standard error of the mean (SEM); P value, from paired t test. (G) Increase in the total number of food vacuoles in PtSNAP-silenced cells. Shownare averages of the number of food vacuoles per cell in control (black) and PtSNAP-silenced cells (gray). No change in the number of acidifiedvacuoles was found (hatched columns). Bars, SEM P value, from unpaired t test. (H) Demonstration of successful PtSNAP gene silencing byWestern blotting of lysates from cells with different durations of silencing detected with the anti-PtSNAP antibody. In PtSNAP-silenced cells,PtSNAP becomes highly reduced from the third day of silencing onward (bottom). No decrease is seen in the loading control detected with ananti-proteindisulfide-isomerase (anti-PtPDI) antibody (top).

FIG. 9. Paramecium trafficking network (based on data from R. D. Allen and A. K. Fok [3]) superimposed with PtSNAP distribution (green).Dotted lines mark the path of organelles, whereas continuous arrows mark vesicle delivery pathways. Question marks indicate putative traffickingpathways for which PtSNAP involvement has not been demonstrated so far. Abbreviations: as, acidosome; ci, cilium; cp, cytoproct; cph,cytopharynx; cs, cytostome; cvc, contractile vacuole complex; ds, decorated spongiome of the cvc; dv, discoidal vesicle; ee, early endosome (terminalcisterna); er, endoplasmic reticulum; fv, food vacuole; ga, Golgi apparatus; gh, ghost; pm, plasma membrane; ps, parasomal sac (coated pit); rv,recycling vesicles; ss, smooth spongiome of the cvc; tr, trichocyst; trp, trichocyst precursor.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

food vacuoles. Another possibility is that the total capacity ofthe digestive system is limited by the availability of acidosomes.The slightly enhanced division rate of PtSNAP-silenced cellscould point to an increased energy supply from an increasednumber of food vacuoles. The localization of PtSNAP ob-served at the cytostome could indicate a role there in fooduptake.

Attenuation of SNARE expression does not always have tobe deleterious, as shown by the improved salt tolerance of A.thaliana plants depleted of AtVAMP714 (42). Also, a role forso-called inhibitory SNAREs in fine-tuning membrane fusionspecificity by engagement in nonproductive SNARE com-plexes has been suggested (73). Thus, the lack of a deleteriouseffect of PtSNAP silencing could be explained by a release ofan inhibition state, if PtSNAP would act as an inhibitorySNARE. A closer investigation of the effects of PtSNAP genesilencing on food vacuole processing will be needed to clarifythe exact role of PtSNAP in this process.

Conclusions. In summary, the present work is the first in-vestigation of a SNAP-25 homologue in protists and opens theexciting opportunity to study the role of such dual-SNARE-motif-containing proteins outside the animal kingdom. Theresults from the glutamine-rich PtSNAP of Paramecium areimportant because a similar asparagine-rich SNAP-25 homo-logue exists in the malaria parasite Plasmodium falciparum(gi|23619154), an apicomplexan related to ciliates, both ofwhich are contained in the phylum Alveolata. Although it isdifficult to assign a precise role to PtSNAP in the phagocyticcycle, it evidently plays a role in this complex process.

ACKNOWLEDGMENTS

We thank T. Wassmer (presently, University of Bristol, UnitedKingdom) for microinjection of the PtSNAP-GFP constructs, E. Lad-enburger (University of Konstanz) for provision of the anti-PDI anti-body, M. Simon (Technical University of Kaiserslautern, Germany) forthe surface antigen antibodies, and E. May for access to the ZeissLSM510 Meta confocal microscope (University of Konstanz). Wethank N. Dierdorf, D. Loeffler, and A. Stemke for technical supportand R. Vogele for the gift of the pRV11 expression vector (all, Uni-versity of Konstanz). We also acknowledge early access to the P.tetraurelia genome sequence provided by J. Cohen and L. Sperling(CGM, CNRS, Gif-Sur-Yvette, France).

This work was supported by Deutsche Forschungsgemeinschaft TR-SFB11 project C4 and grant PL78/20-3, both to H.P.

REFERENCES

1. Allen, R. D. 2000. The contractile vacuole and its membrane dynamics.Bioessays 22:1035–1042.

2. Allen, R. D. 1974. Food vacuole membrane growth with microtubule-asso-ciated membrane transport in Paramecium. J. Cell Biol. 63:904–922.

3. Allen, R. D., and A. K. Fok. 2000. Membrane trafficking and processing inParamecium. Int. Rev. Cytol. 198:277–318.

4. Allen, R. D., and A. K. Fok. 1983. Phagosome fusion vesicles of Paramecium.I. Thin-section morphology. Eur. J. Cell Biol. 29:150–158.

5. Allen, R. D., and A. K. Fok. 1983. Phagosome fusion vesicles of Paramecium.II. Freeze-fracture evidence for membrane replacement. Eur. J. Cell Biol.29:159–165.

6. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generationof protein database search programs. Nucleic Acids Res. 25:3389–3402.

7. Antonin, W., D. Fasshauer, S. Becker, R. Jahn, and T. R. Schneider. 2002.Crystal structure of the endosomal SNARE complex reveals common struc-tural principles of all SNAREs. Nat. Struct. Biol. 9:107–111.

8. Aury, J. M., O. Jaillon, L. Duret, B. Noel, C. Jubin, B. M. Porcel, B.Segurens, V. Daubin, V. Anthouard, N. Aiach, O. Arnaiz, A. Billaut, J.Beisson, I. Blanc, K. Bouhouche, F. Camara, S. Duharcourt, R. Guigo, D.Gogendeau, M. Katinka, A. M. Keller, R. Kissmehl, C. Klotz, F. Koll, A. LeMouel, G. Lepere, S. Malinsky, M. Nowacki, J. K. Nowak, H. Plattner, J.

Poulain, F. Ruiz, V. Serrano, M. Zagulski, P. Dessen, M. Betermier, J.Weissenbach, C. Scarpelli, V. Schachter, L. Sperling, E. Meyer, J. Cohen,and P. Wincker. 2006. Global trends of whole-genome duplications revealedby the ciliate Paramecium tetraurelia. Nature 444:171–178.

9. Bairoch, A., P. Bucher, and K. Hofmann. 1997. The PROSITE database, itsstatus in 1997. Nucleic Acids Res. 25:217–221.

10. Baldauf, S. L., A. J. Roger, I. Wenk-Siefert, and W. F. Doolittle. 2000. Akingdom-level phylogeny of eukaryotes based on combined protein data.Science 290:972–977.

11. Bark, I. C. 1993. Structure of the chicken gene for SNAP-25 reveals dupli-cated exon encoding distinct isoforms of the protein. J. Mol. Biol. 233:67–76.

12. Bateman, A., L. Coin, R. Durbin, R. D. Finn, V. Hollich, S. Griffiths-Jones,A. Khanna, M. Marshall, S. Moxon, E. L. Sonnhammer, D. J. Studholme, C.Yeats, and S. R. Eddy. 2004. The Pfam protein families database. NucleicAcids Res. 32:D138–D141.

13. Breidenbach, M. A., and A. T. Brunger. 2004. Substrate recognition strategyfor botulinum neurotoxin serotype A. Nature 432:925–929.

14. Brennwald, P., B. Kearns, K. Champion, S. Keranen, V. Bankaitis, and P.Novick. 1994. Sec9 is a SNAP-25-like component of a yeast SNARE complexthat may be the effector of Sec4 function in exocytosis. Cell 79:245–258.

15. Chen, S., and J. T. Barbieri. 2007. Multiple pocket recognition of SNAP25by botulinum neurotoxin serotype E. J. Biol. Chem. 282:25540–25547.

16. Couve, A., and J. E. Gerst. 1994. Yeast Snc proteins complex with Sec9.Functional interactions between putative SNARE proteins. J. Biol. Chem.269:23391–23394.

17. Dessen, P., M. Zagulski, R. Gromadka, H. Plattner, R. Kissmehl, E. Meyer,M. Betermier, J. E. Schultz, J. U. Linder, R. E. Pearlman, C. Kung, J.Forney, B. H. Satir, J. L. Van Houten, A. M. Keller, M. Froissard, L.Sperling, and J. Cohen. 2001. Paramecium genome survey: a pilot project.Trends Genet. 17:306–308.

18. Dillon, P. J., and C. A. Rosen. 1993. Use of polymerase chain reaction for therapid construction of synthetic genes. Methods Mol. Biol. 15:263–269.

19. Dryl, S. 1959. Effect of adaptation to the environment on chemotaxis ofParamecium caudatum. Acta Biol. Exp. 19:83–93.

20. Eisen, J. A., R. S. Coyne, M. Wu, D. Wu, M. Thiagarajan, J. R. Wortman,J. H. Badger, Q. Ren, P. Amedeo, K. M. Jones, L. J. Tallon, A. L. Delcher,S. L. Salzberg, J. C. Silva, B. J. Haas, W. H. Majoros, M. Farzad, J. M.Carlton, R. K. Smith, Jr., J. Garg, R. E. Pearlman, K. M. Karrer, L. Sun, G.Manning, N. C. Elde, A. P. Turkewitz, D. J. Asai, D. E. Wilkes, Y. Wang, H.Cai, K. Collins, B. A. Stewart, S. R. Lee, K. Wilamowska, Z. Weinberg, W. L.Ruzzo, D. Wloga, J. Gaertig, J. Frankel, C. C. Tsao, M. A. Gorovsky, P. J.Keeling, R. F. Waller, N. J. Patron, J. M. Cherry, N. A. Stover, C. J. Krieger,C. del Toro, H. F. Ryder, S. C. Williamson, R. A. Barbeau, E. P. Hamilton,and E. Orias. 2006. Macronuclear genome sequence of the ciliate Tetrahy-mena thermophila, a model eukaryote. PLoS Biol. 4:e286.

21. Fasshauer, D., R. B. Sutton, A. T. Brunger, and R. Jahn. 1998. Conservedstructural features of the synaptic fusion complex: SNARE proteins reclas-sified as Q.- and R-SNAREs. Proc. Natl. Acad. Sci. USA 95:15781–15786.

22. Froissard, M., R. Kissmehl, J. C. Dedieu, T. Gulik-Krzywicki, H. Plattner,and J. Cohen. 2002. N-ethylmaleimide-sensitive factor is required to orga-nize functional exocytotic microdomains in Paramecium. Genetics 161:643–650.

23. Galvani, A., and L. 2002. Sperling. RNA interference by feeding in Parame-cium. Trends Genet. 18:11–12.

24. Godiska, R., K. J. Aufderheide, D. Gilley, P. Hendrie, T. Fitzwater, L. B.Preer, B. Polisky, and J. R. Preer, Jr. 1987. Transformation of Parameciumby microinjection of a cloned serotype gene. Proc. Natl. Acad. Sci. USA84:7590–7594.

25. Grote, E., C. M. Carr, and P. J. Novick. 2000. Ordering the final events inyeast exocytosis. J. Cell Biol. 151:439–452.

26. Hackett, M., L. Guo, J. Shabanowitz, D. F. Hunt, and E. L. Hewlett. 1994.Internal lysine palmitoylation in adenylate cyclase toxin from Bordetellapertussis. Science 266:433–435.

27. Hauser, K., W. J. Haynes, C. Kung, H. Plattner, and R. Kissmehl. 2000.Expression of the green fluorescent protein in Paramecium tetraurelia. Eur.J. Cell Biol. 79:144–149.

28. Haynes, W. J., K. Y. Ling, Y. Saimi, and C. Kung. 1995. Induction ofantibiotic resistance in Paramecium tetraurelia by the bacterial gene APH-3�-II. J. Eukaryot. Microbiol. 42:83–91.

29. Haynes, W. J., B. Vaillant, R. R. Preston, Y. Saimi, and C. Kung. 1998. Thecloning by complementation of the pawn-A gene in Paramecium. Genetics149:947–957.

30. Heese, M., X. Gansel, L. Sticher, P. Wick, M. Grebe, F. Granier, and G.Jurgens. 2001. Functional characterization of the KNOLLE-interacting t-SNARE AtSNAP33 and its role in plant cytokinesis. J. Cell Biol. 155:239–249.

31. Holt, M., F. Varoqueaux, K. Wiederhold, S. Takamori, H. Urlaub, D.Fasshauer, and R. Jahn. 2006. Identification of SNAP-47, a novel Qbc-SNARE with ubiquitous expression. J. Biol. Chem. 281:17076–17083.

32. Jahn, R., and R. H. Scheller. 2006. SNAREs: engines for membrane fusion.Nat. Rev. Mol. Cell Biol. 7:631–643.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

33. Jones, D. T. 1998. Do transmembrane protein superfolds exist? FEBS Lett.423:281–285.

34. Jones, D. T. 1999. Protein secondary structure prediction based on position-specific scoring matrices. J. Mol. Biol. 292:195–202.

35. Jones, D. T., W. R. Taylor, and J. M. Thornton. 1994. A model recognitionapproach to the prediction of all-helical membrane protein structure andtopology. Biochemistry 33:3038–3049.

36. Kissmehl, R., M. Froissard, H. Plattner, M. Momayezi, and J. Cohen. 2002.NSF regulates membrane traffic along multiple pathways in Paramecium.J. Cell Sci. 115:3935–3946.

37. Kissmehl, R., C. Schilde, T. Wassmer, C. Danzer, K. Nuehse, K. Lutter, andH. Plattner. 2007. Molecular identification of 26 syntaxin genes and theirassignment to the different trafficking pathways in Paramecium. Traffic8:523–542.

38. Kissmehl, R., I. M. Sehring, E. Wagner, and H. Plattner. 2004. Immunolo-calization of actin in Paramecium cells. J. Histochem. Cytochem. 52:1543–1559.

39. Kissmehl, R., T. Treptau, H. W. Hofer, and H. Plattner. 1996. Proteinphosphatase and kinase activities possibly involved in exocytosis regulationin Paramecium tetraurelia. Biochem. J. 317:65–76.

40. Kloepper, T. H., C. N. Kienle, and D. Fasshauer. 2007. An elaborate clas-sification of SNARE proteins sheds light on the conservation of the eukary-otic endomembrane system. Mol. Biol. Cell 18:3463–3471.

41. Lane, S. R., and Y. Liu. 1997. Characterization of the palmitoylation domainof SNAP-25. J. Neurochem. 69:1864–1869.

42. Leshem, Y., N. Melamed-Book, O. Cagnac, G. Ronen, Y. Nishri, M.Solomon, G. Cohen, and A. Levine. 2006. Suppression of Arabidopsisvesicle-SNARE expression inhibited fusion of H2O2-containing vesicleswith tonoplast and increased salt tolerance. Proc. Natl. Acad. Sci. USA103:18008–18013.

43. Lipka, V., C. Kwon, and R. Panstruga. 2007. SNARE-ware: the role ofSNARE-domain proteins in plant biology. Annu. Rev. Cell Dev. Biol. 23:147–174.

44. Littleton, J. T., E. R. Chapman, R. Kreber, M. B. Garment, S. D. Carlson,and B. Ganetzky. 1998. Temperature-sensitive paralytic mutations demon-strate that synaptic exocytosis requires SNARE complex assembly and dis-assembly. Neuron 21:401–413.

45. Marchler-Bauer, A., J. B. Anderson, P. F. Cherukuri, C. DeWeese-Scott,L. Y. Geer, M. Gwadz, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J.Lanczycki, C. A. Liebert, C. Liu, F. Lu, G. H. Marchler, M. Mullokandov,B. A. Shoemaker, V. Simonyan, J. S. Song, P. A. Thiessen, R. A. Yamashita,J. J. Yin, D. Zhang, and S. H. Bryant. 2005. CDD: a conserved domaindatabase for protein classification. Nucleic Acids Res. 33:D192–D196.

46. Marvaud, J. C., S. Raffestin, and M. R. Popoff. 2002. Botulism: the agent,mode of action of the botulinum neurotoxins, forms of acquisition, treatmentand prevention. C. R. Biol. 325:863–878. (In French.)

47. McGuffin, L. J., K. Bryson, and D. T. Jones. 2000. The PSIPRED proteinstructure prediction server. Bioinformatics 16:404–405.

48. Morrison, D. F., P. J. O’Brien, and D. R. Pepperberg. 1991. Depalmitylationwith hydroxylamine alters the functional properties of rhodopsin. J. Biol.Chem. 266:20118–20123.

49. Okayama, M., T. Arakawa, I. Mizoguchi, Y. Tajima, and T. Takuma. 2007.SNAP-23 is not essential for constitutive exocytosis in HeLa cells. FEBSLett. 581:4583–4588.

50. Pape, R., and H. Plattner. 1990. Secretory organelle docking at the cellmembrane of Paramecium cells: dedocking and synchronized redocking oftrichocysts. Exp. Cell Res. 191:263–272.

51. Pepperberg, D. R., D. F. Morrison, and P. J. O’Brien. 1995. Depalmitoyla-tion of rhodopsin with hydroxylamine. Methods Enzymol. 250:348–361.

52. Plattner, H., and R. Kissmehl. 2003. Dense-core secretory vesicle dockingand exocytotic membrane fusion in Paramecium cells. Biochim. Biophys.Acta 1641:183–193.

53. Plattner, H., and R. Kissmehl. 2003. Molecular aspects of membrane traf-ficking in Paramecium. Int. Rev. Cytol. 232:185–216.

54. Plattner, H., H. Matt, H. Kersken, B. Haacke, and R. Sturzl. 1984. Synchro-nous exocytosis in Paramecium cells. I. A novel approach. Exp. Cell Res.151:6–13.

55. Plonne, D., I. Cartwright, W. Linss, R. Dargel, J. M. Graham, and J. A.Higgins. 1999. Separation of the intracellular secretory compartment of ratliver and isolated rat hepatocytes in a single step using self-generating gra-dients of iodixanol. Anal. Biochem. 276:88–96.

56. Pollack, S. 1974. Mutations affecting the trichocysts in Paramecium aurelia.I. Morphology and description of the mutants. J. Protozool. 21:352–362.

57. Russell, C. B., D. Fraga, and R. D. Hinrichsen. 1994. Extremely short 20–33

nucleotide introns are the standard length in Paramecium tetraurelia. NucleicAcids Res. 22:1221–1225.

58. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

59. Scales, S. J., B. Y. Yoo, and R. H. Scheller. 2001. The ionic layer is requiredfor efficient dissociation of the SNARE complex by alpha-SNAP and NSF.Proc. Natl. Acad. Sci. USA 98:14262–14267.

60. Schagger, H. 2006. Tricine-SDS-PAGE. Nat. Protoc. 1:16–22.61. Schilde, C., T. Wassmer, J. Mansfeld, H. Plattner, and R. Kissmehl. 2006. A

multigene family encoding R-SNAREs in the ciliate Paramecium tetraurelia.Traffic 7:440–455.

62. Schoch, S., F. Deak, A. Konigstorfer, M. Mozhayeva, Y. Sara, T. C. Sudhof,and E. T. Kavalali. 2001. SNARE function analyzed in synaptobrevin/VAMPknockout mice. Science 294:1117–1122.

63. Søgaard, M., K. Tani, R. R. Ye, S. Geromanos, P. Tempst, T. Kirchhausen,J. E. Rothman, and T. Sollner. 1994. A rab protein is required for theassembly of SNARE complexes in the docking of transport vesicles. Cell78:937–948.

64. Sollner, T., M. K. Bennett, S. W. Whiteheart, R. H. Scheller, and J. E.Rothman. 1993. A protein assembly-disassembly pathway in vitro that maycorrespond to sequential steps of synaptic vesicle docking, activation, andfusion. Cell 75:409–418.

65. Sonneborn, T. M. 1974. Paramecium aurelia, p. 469–594. In R. C. Kung (ed.),Handbook of genetics, vol. 2. Plenum Press, New York, NY.

66. Sperling, L., P. Dessen, M. Zagulski, R. E. Pearlman, A. Migdalski, R.Gromadka, M. Froissard, A. M. Keller, and J. Cohen. 2002. Random se-quencing of Paramecium somatic DNA. Eukaryot. Cell 1:341–352.

67. Steegmaier, M., B. Yang, J. S. Yoo, B. Huang, M. Shen, S. Yu, Y. Luo, andR. H. Scheller. 1998. Three novel proteins of the syntaxin/SNAP-25 family.J. Biol. Chem. 273:34171–34179.

68. Stevenson, F. T., S. L. Bursten, C. Fanton, R. M. Locksley, and D. H. Lovett.1993. The 31-kDa precursor of interleukin 1 alpha is myristoylated on spe-cific lysines within the 16-kDa N-terminal propiece. Proc. Natl. Acad. Sci.USA 90:7245–7249.

69. Stevenson, F. T., S. L. Bursten, R. M. Locksley, and D. H. Lovett. 1992.Myristyl acylation of the tumor necrosis factor alpha precursor on specificlysine residues. J. Exp. Med. 176:1053–1062.

70. Sutton, R. B., D. Fasshauer, R. Jahn, and A. T. Brunger. 1998. Crystalstructure of a SNARE complex involved in synaptic exocytosis at 2.4 Åresolution. Nature 395:347–353.

71. Timmons, L., D. L. Court, and A. Fire. 2001. Ingestion of bacterially ex-pressed dsRNAs can produce specific and potent genetic interference inCaenorhabditis elegans. Gene 263:103–112.

72. Ungermann, C., and D. Langosch. 2005. Functions of SNAREs in intracel-lular membrane fusion and lipid bilayer mixing. J. Cell Sci. 118:3819–3828.

73. Varlamov, O., A. Volchuk, V. Rahimian, C. A. Doege, F. Paumet, W. S. Eng,N. Arango, F. Parlati, M. Ravazzola, L. Orci, T. H. Sollner, and J. E.Rothman. 2004. i-SNAREs: inhibitory SNAREs that fine-tune the specificityof membrane fusion. J. Cell Biol. 164:79–88.

74. Vayssie, L., F. Skouri, L. Sperling, and J. Cohen. 2000. Molecular genetics ofregulated secretion in Paramecium. Biochimie 82:269–288.

75. Veit, M., T. H. Sollner, and J. E. Rothman. 1996. Multiple palmitoylation ofsynaptotagmin and the t-SNARE SNAP-25. FEBS Lett. 385:119–123.

75a.Vetter, D. 1996. Functional analysis of trichocyst exocytosis in Parameciumcells by clostridium toxins. Diploma thesis. University of Constance, Kon-stanz, Germany.

76. Washbourne, P., P. M. Thompson, M. Carta, E. T. Costa, J. R. Mathews, G.Lopez-Bendito, Z. Molnar, M. W. Becher, C. F. Valenzuela, L. D. Partridge,and M. C. Wilson. 2002. Genetic ablation of the t-SNARE SNAP-25 distin-guishes mechanisms of neuroexocytosis. Nat. Neurosci. 5:19–26.

77. Wassmer, T., M. Froissard, H. Plattner, R. Kissmehl, and J. Cohen. 2005.The vacuolar proton-ATPase plays a major role in several membrane-bounded organelles in Paramecium. J. Cell Sci. 118:2813–2825.

78. Wickner, W., and A. Haas. 2000. Yeast homotypic vacuole fusion: a windowon organelle trafficking mechanisms. Annu. Rev. Biochem. 69:247–275.

79. Wirsel, S. G. R., R. Vogele, R. Banninger, and K. W. Mendgen. 2004. Cloningof -tubulin and succinate dehydrogenase genes from Uromyces fabae andestablishing selection conditions for their use in transformation. Eur. J. PlantPathol. 110:767–777.

80. Zagulski, M., J. K. Nowak, A. Le Mouel, M. Nowacki, A. Migdalski, R.Gromadka, B. Noel, I. Blanc, P. Dessen, P. Wincker, A. M. Keller, J. Cohen,E. Meyer, and L. Sperling. 2004. High coding density on the largest Para-mecium tetraurelia somatic chromosome. Curr. Biol. 14:1397–1404.



http://ec.asm.org/

Dow

nloaded from

http://ec.asm.org/

Molecular Identiﬁcation of a SNAP-25-Like SNARE Protein in ... · duplications and the high...

Documents

Transcript of Molecular Identiﬁcation of a SNAP-25-Like SNARE Protein in ... · duplications and the high...