Molecular Exercise PhysiologySkeletal Muscle Hypertrophy

Seminar 8Henning Wackerhage

Why was Robert Wadlow that tall?

What would have happened if he had a defect in the IGF-1 gene?

Task

Why was Robert Wadlow that tall? Because he had an overexpression of growth hormone.

What would have happened if he had a defect in the IGF-1 gene? IGF-1 is a second messenger for growth hormone. He would have been smaller.

Answer

Task

There is evidence that athletes dope with growth hormone. Is growth hormone alone an effective treatment? Carry out a literature search.

Claims for the anabolic effects of growth hormone: a case of the emperor's new clothes?

Rennie MJ.

Faculty of Life Sciences, Old Medical School, University of Dundee, Scotland, UK. m.j.rennie@dundee.ac.uk

This review examines the evidence that growth hormone has metabolic effects in adult human beings. The conclusion is that growth hormone does indeed have powerful effects on fat and carbohydrate metabolism, and in particular promotes the metabolic use of adipose tissue triacylglycerol. However, there is no proof that net protein retention is promoted in adults, except possibly of connective tissue. The overexaggeration of the effects of growth hormone in muscle building is effectively promoting its abuse and thereby encouraging athletes and elderly men to expose themselves to increased risk of disease for little benefit.

Answer

Researchers noted that injected growth hormone induced protein synthesis in various tissues. In contrasts, if these tissues were incubated with growth hormone outside the body, then protein synthesis did not occur. The best explanation was that growth hormone induced an intermediate hormone (termed somatomedin and now IGF-1) that does would induce protein synthesis and growth. IGF-1 is mainly released by the liver (Le Roith et al. 2001).

Original IGF-1/somatomedin hypothesis

Growth hormone IGF-1 Growth

IGF-1 splice variants

IGF-1Ec has been termed mechano-growth factor (MGF) to avoid (or increase?) confusion

Muscle IGF-1 induces muscle hypertrophy

Fibre type I IIa IId/x, IIb

Control 675 1256 1975

IGF-1 muscle 1447 2435 3518transgenic

Coleman et al. (1995) generated transgenic mice where IGF-1 was overexpressed only in skeletal muscle. This led to large increases in the fibre area, indicating that IGF-1 could induce skeletal muscle hypertrophy. This confirmed that IGF-1 could act via an autocrine/paracrine mechanisms in skeletal muscle.

Table. Fibre area in µm2 in control and IGF-1 muscle transgenic mice.

IGF-1IGF-1

What regulates muscle IGF-1 expression?

Yang et al. (1996) found that stretch induced an increased expression of an IGF-1 splice variant which they termed mechano-growth factor (MGF).

Stretch

IGF-1 (MGF)

MGF and IGF in response to resistance exerciseFigure a shows that MGF mRNA increases significantly only in young subjects in response to resistance. IGF-IEa does not change significantly. The data appear a bit inconclusive and it is unclear whether 2.5 h after resistance exercise was a time point where MGF/IGF-1 expression was highest (Hameed et al. 2003).

Anabolic steroids induce IGF-1

Nandrolone (nan, anabolic steroid) increases IGF-1 expression in rat skeletal muscle (Lewis et al. 2002).

Summary: Regulation of IGF-1 expression

The expression of the IGF-1 gene is activated by testosterone (tes), growth hormone (gh) and inhibited by glucocorticoids (gc). These hormones bind to their receptor; e.g. testosterone to the androgen receptor. Proinflammatory cytokines such as TNF and interleukin-1 are increased in many situations associated with muscle wasting and inhibit IGF-1 expression (reviewed by Frost and Lang 2003).

Tes

IGF-1

GH GC

Proinflammatory cytokines (TNF, Il-1)

Resistance training

??

Food intake

Alternative splicing

Task

IGF-1 is advertised as an anti-ageing treatment. Is IGF-1 alone effective in inducing muscle growth and why might it be advertised as an anti-ageing treatment?

Anwer

GH/IGF-1 knockout animals appear to live longer.

Animal models of genetic GH deficiencies such as Snell mice (Pit-1 gene mutations) the Ames mice (PROP-1 gene mutation) and the Laron mice (GH receptor gene knock-out) have a statistically significant higher longevity compared to normal controls. On the contrary, mice transgenic for GH and acromegalic patients secreting high amounts of GH have premature death.

To better understand the role of the insulin-like receptors in mammalian lifespan regulation and ageing, we explored the phenotype of heterozygous IGF-I receptor (IGF1R) knockout mice. Compared with control littermates these mutants live longer without any obvious impairment of their health and physiology, except a reduced glucose tolerance that we observed in males.

Translation

AUCUUAACCUCCCCAGCAGCUGGGACUACAGCCACGCGCCACUGCAC

mRNA

(3) During translation, an amino acid chain (peptide chain, protein) is synthesized by the ribosome. The mRNA serves as a template.

(1) Transfer RNA (tRNA) has an anticodon that only binds to a particular mRNA codon

(2) One amino acid corresponding to the anticodon is bound to tRNA

Researchers at the School of Life Sciences have made numerous contributions to elucidating the PKB pathway which is involved not also in mediating muscle hypertrophy but also cardiac hypertrophy, diabetes, cancer and many other growth situations. The key researchers on this pathway are shown below (I have probably omitted one or two). Before looking at the structure of the pathway, you will see the results of an experiment where PKB was activated on muscle to show that active PKB can cause hypertrophy.

PKB pathway

Sir Philip Cohen Dario Alessi Peter DownesChris Proud

PKB transfection

In this experiment, an italian group of researchers have injected an activated PKB DNA constructs into a muscle and the construct has been taken up by the fibres that are stained light. PKB kinase activity was very high in these fibres and led to a dramatic hypertrophy compared to the much smaller fibres that are unstained (Pallafacchina et al. 2002).

PKB activation causes hypertrophy

IGF-1 or insulin

PKB

mTOR

4E-BP1 p70S6kP

eIF4E

S6 PTranslation activationP

RibosomeSkeletal muscle fibre

PI3K

P

The whole picture

PDK1

Rates of (a) protein synthesis and (b) p70 S6k activity in rat muscle in sedentary control (sed; open bars) and exercised (ex; solid bars) groups of rats studied after resistance exercise  (Hernandez et al. 2000). The data show that p70 S6k activity increases first after 6 h and that p70 S6k activity and protein synthesis are increased 12 and 24 after resistance exercise.

(a) (b)

Protein synthesis and p70 S6k responses are slow

PKB

mTORAMPKAmino acids

High energy

turnover, hypoxia

Skeletal muscle fibre

raptor

IGF-1, insulin

Translation,protein

synthesis

AMPK, amino acids and mTOR signalling

Task

Why might glucose increase protein synthesis?

Answer

High glucose increases insulin which may stimulate protein synthesis.

Stimulating muscle growth via the PKB pathway: Doping and the clever wayThe message of all the slides is: If you manage to activate the PKB pathway, growth will occur. Some athletes try to activate the PKB pathway with doping agents. They are:

1) Human growth hormone (Is it effective? See Rennie 2003);

2) Insulin (see BBC report on next slide)

3) Clenbuterol (Katrin Krabbe)

Obviously, testosterone and androgenic steroids will also affect IGF-1 expression in muscle and thus will probably affect the PKB pathway.

The natural and clever way is resistance training (which increases MGF and possibly IGF-1) and protein (which, when digested will increase the amino acid concentration). However, the timing is important. Two papers suggest that the proteins have to be taken directly after resistance exercise.

Two groups of old subjects (70-80 years) performed a period of endurance training. Both groups received a gel containing 10 g protein (from skimmed milk and soybean), 7 g carbohydrate and 3.3 g lipid either directly after exercise (P0) or 2 h after exercise (P2). Only ingestion directly after exercise caused hypertrophy (Esmarck et al. 2001).

Eat protein directly after resistance exercise!

Cro

ss-s

ect

ion

al are

a o

f q

uad

rice

ps

fem

ori

s

0.00

0.03

0.06

0.09

0.12

0 10 20 30 40 EAA (g)

FSR (% h-1)

Young Elderly

Muscle protein synthesis in response to amino acids

In this important study by Cutherbertson, Smith and Rennie, young and elderly subjects were given up to 40 g of essential amino acids (EAA). The data show that the maximal rate of protein synthesis is lower in the elderly.

Task

You can achieve a maximal stimulation of protein synthesis with 10 to 20 g of amino acids. How many eggs, pints of milk, steaks is that?

Protein supplements are heavily advertised in body building magazines. Are high amounts of protein needed? Are they effective? Are they dangerous?

Answer

You can achieve a maximal stimulation of protein synthesis with 10 to 20 g of essential amino acids. How many eggs, pints of milk, steaks is that?

10 g of EAA is roughly 20 g of total amino acids (and thus protein).

7 g of protein per egg

8 g per cup of milk

30 g fillet steak

(1) Stretch, other signals

IGF promoter

Nucleus

(2) IGF-1 precursor

splicing into IGF-1, MGF

(4) Systemic IGFs IGF-1/MGF binding to receptor(5)

(3) Autocrine, paracrine IGFs

PKB

(6)

mTORAMPK

(8) Amino acids

4E-BP1 p70S6kP

eIF4E

Peptide/protein

S6 P (10) Translation of ribosomal

proteins

(9) eIF3 and translation activation

P

(7) High energy

turnover, hypoxia

Ribosome

Skeletal muscle fibre

PI3K

PDK1

raptor

The End