Molecular Phylogenetics and Evolution 40 (2006) 570–584www.elsevier.com/locate/ympev

Molecular evidence for the non-monophyletic status of Naidinae (Annelida, Clitellata, TubiWcidae)

Ida Envall a,b,c,¤, Mari Källersjö c, Christer Erséus d

a Department of Zoology, Stockholm University, SE-106 91 Stockholm, Swedenb Department of Invertebrate Zoology, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Sweden

c Laboratory of Molecular Systematics, Swedish Museum of Natural History, Box 50007, SE-104 05 Stockholm, Swedend Department of Zoology, Göteborg University, Box 463, SE-405 30 Göteborg, Sweden

Received 24 October 2005; revised 9 February 2006; accepted 15 March 2006Available online 8 May 2006

Abstract

Naidinae (former Naididae) is a group of small aquatic clitellate annelids, common worldwide. In this study, we evaluated the phylo-genetic status of Naidinae, and examined the phylogenetic relationships within the group. Sequence data from two mitochondrial genes(12S rDNA and 16S rDNA), and one nuclear gene (18S rDNA), were used. Sequences were obtained from 27 naidine species, 24 speciesfrom the other tubiWcid subfamilies, and Wve outgroup taxa. New sequences (in all 108) as well as GenBank data were used. The data wereanalysed by parsimony and Bayesian inference. The tree topologies emanating from the diVerent analyses are congruent to a great extent.Naidinae is not found to be monophyletic. The naidine genus Pristina appears to be a derived group within a clade consisting of severalgenera (Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus) from another tubiWcid subfamily, Rhyacodrilinae. These results dem-onstrate the need for a taxonomic revision: either Ainudrilus, Epirodrilus, Monopylephorus, and Rhyacodrilus should be included withinNaidinae, or Pristina should be excluded from this subfamily. Monophyly of four out of six naidine genera represented by more than onespecies is supported: Chaetogaster, Dero, Paranais, and Pristina, respectively.© 2006 Elsevier Inc. All rights reserved.

Keywords: Naidinae; Naididae; Rhyacodrilinae; TubiWcidae; 12S rDNA; 16S rDNA; 18S rDNA; Phylogeny; Taxonomy

1. Introduction

Naidid worms are small aquatic clitellate annelids, com-mon worldwide. About 180 species have been described(Erséus, 2005), and 24 genera are currently recognized(Table 1). Most species inhabit freshwater, but some areadapted to brackish or marine habitats (Sperber, 1948).They are primarily found in superWcial sediment layers, orat the surface of aquatic vegetation, and some species areeven active swimmers (Erséus, 2005). Most species are detri-tivorous, but carnivory and parasitism exist (Brinkhurstand Jamieson, 1971).

* Corresponding author. Fax: +46 8 5195 5181.E-mail address: ida.envall@nrm.se (I. Envall).

1055-7903/$ - see front matter © 2006 Elsevier Inc. All rights reserved.doi:10.1016/j.ympev.2006.03.021

Naidids are capable of reproducing asexually, by bud-ding (paratomy) or fragmentation (architomy) (Brinkhurstand Jamieson, 1971; Sperber, 1948). Paratomic Wssion ismost usual. This is a peculiar process in which a new head,and in front of this a new tail, is intercalated in the middleof the original worm’s body. In this way, a transient linkedchain of individuals may be formed (Bely and Wray, 2001,2004; Dehorne, 1916). Partly because of this vegetativemode of reproduction, which makes it possible for a wormto produce many oVspring in a short time, naidid popula-tions may increase rapidly under favorable conditions (e.g.,Armendáriz, 2000; Loden, 1981). Naidids also periodicallyreproduce sexually (e.g., Erséus, 2005; Sperber, 1948).

Naididae was long regarded as a separate family withinthe clitellate order TubiWcida. However, several studies,both morphological (Brinkhurst, 1994; Erséus, 1987, 1990)and molecular, based on 28S rDNA (but referred to as

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 571

“23S”) in combination with the COI gene (Christensen andTheisen, 1998), 18S rDNA (Erséus et al., 2002; Erséus andKällersjö, 2004), and 18S rDNA combined with 16S rDNA(Sjölin et al., 2005), support that the naidids should betreated as an ingroup of another family, TubiWcidae. Thegenitalia have a more anterior position in naidids (in seg-ments IV–V to VII–VIII) compared to in tubiWcids (seg-ments X–XI), and this condition, together with the abilityof Wssion, have been the main reasons assigning Naididaefamily status. Sometimes, Naididae has in fact beenregarded as a “primitive” clitellate group, not even closelyrelated to TubiWcidae (Omodeo, 1998), because of a com-paratively simple circulatory system, and a somewhat leech-like embryology. However, the morphology of the genitaliaof TubiWcidae and Naididae, respectively, is similar, withprostate glands directly associated with the atrium (whichis a part of the male eVerent duct). Moreover, the reproduc-tive structures are located in two consecutive segments inboth groups (although in diVerent segment pairs), with theWrst segment containing one pair of testes and one pair ofspermathecae, and the other segment containing one pair ofovaries and one pair of male eVerent ducts. Furthermore,the spermatozoa exhibit ultrastructural similarities (Ferrag-uti et al., 1999). Erséus and Gustavsson (2002) have sug-gested that Naididae should be treated as a subfamily,

Table 1The genera within Naididae sensu Brinkhurst and Jamieson (1971) (plusthe two genera Bratislavia Kosel, 1976, and Rhopalonais Dzwillo andGrimm, 1974 later described)

A bullet indicates that the genus is represented in this studya A genus which remains inadequately described (Brinkhurst and Jamie-

son, 1971).b Brinkhurst (1985) divided Pristina into Pristina and Pristinella, but the

two groups were reunited, since species with a mix of Pristina andPristinella characters were described by Collado and Schmelz (2000).

c Wapsa is today regarded as a synonym of Paranais (Brinkhurst andCoates, 1985).

Allonais Sperber, 1948 •Amphichaeta Tauber, 1879 •Arcteonais Piguet, 1928Branchiodrilus Michaelsen, 1900Bratislavia Kosel, 1976Chaetogaster von Baer, 1827 •Dero Oken, 1815 •Haemonais Bretscher, 1900Homochaeta Bretscher, 1896Nais Müller, 1773 •Neonaisa Sokolskaya, 1962Ophidonais Gervais, 1838 •Paranais Czerniavsky, 1880 •Piguetiella Sperber, 1939 •Pristina (including Pristinella)b Ehrenberg, 1828 •Rhopalonais Dzwillo and Grimm, 1974Ripistes Dujardin, 1842 •Slavina Vejdovský, 1883 •Specaria Sperber, 1939 •Stephensoniana Cernosvitov, 1938Stylaria Lamarck, 1816 •Uncinais Levinsen, 1884 •Vejdovskyella Michaelsen, 1903 •Wapsac Marcus, 1965

Naidinae, within TubiWcidae, and from now on we will usethe proposed subfamily name Naidinae (sensu Erséus andGustavsson, 2002) in this paper. [Erséus et al. (2005) hasasked the International Commission of Zoological Nomen-clature to conserve the usage of the family group nameTubiWcidae, despite that it is younger than the family groupname Naididae.]

In addition to Naidinae, Wve tubiWcid subfamilies are rec-ognized: Limnodriloidinae, Phallodrilinae, Rhyacodrilinae,Telmatodrilinae, and TubiWcinae (Erséus, 1990), although itis not probable that all these groups are natural (Erséus,1990; Erséus and Ferraguti, 1995; Erséus and Gustavsson,2002; Erséus et al., 2000, 2002; Sjölin et al., 2005). There areindications that Naidinae is closely related to Rhyacodrili-nae. It has been placed close to, or even nested within, Rhya-codrilinae in several phylogenetic studies (Brinkhurst, 1994;Christensen and Theisen, 1998; Erséus, 1990; Erséus et al.,2000, 2002; Sjölin et al., 2005). However, in these studies thenumber of taxa from the two groups has been insuYcient toenable any detailed conclusions.

Three morphology-based hypotheses on the naidine phy-logeny have been formulated in the last century (Lastobkin,1924; Nemec and Brinkhurst, 1987; Sperber, 1948). The twooldest of these were not based on explicit phylogenetic prin-ciples, but rather on mere morphological similarity. Thethree hypotheses are fundamentally diVerent in severalrespects, probably at least partly because of the low numberof independent morphological characters. According to Las-tobkin (1924) there are two groups within “Naididae”, i.e.,Pristininae (Pristina) and Naidinae (sensu Lastobkin) (allother genera). Sperber (1948) identiWed four subfamilies:Pristininae (Pristina), Paranaidinae (Paranais), Chaetogas-trinae (Chaetogaster and Amphichaeta), and Naidinae (sensuSperber) (all remaining genera). According to Nemec andBrinkhurst (1987), Wnally, there are two subfamilies within“Naididae”: Stylarinae and Naidinae (sensu Nemec andBrinkhurst, 1987). Stylarinae consists of the genera Stylaria,Arcteonais, Ripistes, Vejdovskyella, Slavina, Stephensoniana(incertae sedis), and Piguetiella (incertae sedis). Naidinae(sensu Nemec and Brinkhurst, 1987) consists of all theremaining genera, divided into four tribes: Naidini, Derini,Pristinini, and Chaetogastrini.

In a recent study, Bely and Wray (2004) used moleculardata (COI) in the attempt to reconstruct the naidine phy-logeny. The result from this study suggests two groups: onecomprising the genus Pristina, and the other comprising allother genera sampled.

The aim of the present study was to evaluate the mono-phyly of Naidinae sensu Erséus and Gustavsson (2002),with special emphasis on its relationship to Rhyacodrilinae,and to Wnd a hypothesis about the phylogeny within thegroup. 18S rDNA sequences have been used several timesbefore, dealing with clitellate phylogenies (Apakupakulet al., 1999; Erséus et al., 2000, 2002; Erséus and Källersjö,2004; Martin, 2001; Martin et al., 2000; Siddall et al., 2001;Sjölin et al., 2005). However, this nuclear gene is tooslow-evolving to resolve within-family relationships of

572 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

TubiWcidae, or even higher-level relationships satisfactorily.Accordingly, we decided to use two mitochondrial genes,12S rDNA and 16S rDNA, in combination with 18SrDNA, since these generally evolve more rapidly, providingresolution at levels of more recent divergence. Moreover,we were interested in obtaining two independent phyloge-netic estimates (based on mitochondrial and nuclear DNAsequences, respectively).

2. Materials and methods

2.1. Taxon sampling and collection of specimens

Twenty-seven naidine species, representing 15 out of the24 genera currently recognized, were included (Tables 1 and2). The tubiWcid subfamilies TubiWcinae, Phallodrilinae, andLimnodriloidinae were represented by four species each,whereas twelve rhyacodrilines were included to elucidate therelationship between this group and Naidinae in greaterdetail. Five species (Buchholzia fallax, Fridericia tuberosa,Insulodrilus biWdus, Lumbriculus variegatus, and Lumbricuscastaneus) were chosen as outgroup taxa (see Table 2). Theyrepresent four additional families of oligochaetous Clitel-lata, one of which (Phreodrilidae) has been proposed as thesister group to TubiWcidae (Erséus et al., 2002).

Most specimens were collected by Christer Erséus. Thesewere identiWed live and preserved in 80–99% ethanol. Other,likewise ethanol preserved specimens, were provided by col-leagues (for collection site and collector, see Table 2).

2.2. Extraction, gene ampliWcation, and sequencing

DNA was extracted using the QIAamp DNA Mini Kit(Qiagen), following the manufacturer’s recommendations,with the exception of an elution step of 50�l followed byanother elution of 100 �l collected in separate tubes.

The PCRs were carried out with PuReTaq Ready-To-GoPCR Beads (Amersham Pharmacia Biotech), following themanufacturer’s protocol in 25�l volumes, and run on a Per-kin-Elmer 480 Thermal Cycler. All primers used for ampliWca-tion are described in Table 3. The details of the thermocyclingprocedures are described below; however, in many speciesthey were changed slightly to improve the PCR result.

An about 400 bp long fragment of the 12S rDNA regionwas ampliWed using the primers 12SE1 and 12SH (Jamie-son et al., 2002). The PCR was performed with an initialdenaturing step at 95 °C for 5 min, followed by an ampliW-cation proWle of 43 cycles: 95 °C for 40 s, 45 °C for 45 s, and72 °C for 60 s. The procedure was completed with a Wnalextension step at 72 °C for 8 min. Four 12S sequences aremissing in the analyses, since we failed to receive a PCRproduct from Amphichaeta sannio, Dero vaga, Paranais lito-ralis, and Stylaria fossularis.

The ampliWcation of the 16S rDNA region was per-formed using the primers 16Sar-L and 16Sbr-H (Palumbiet al., 1991), giving an about 480 bp long fragment. The ther-mocycling procedure was started with an initial denaturing

step at 95 °C for 5 min. This was followed by 35 cycles of95 °C for 30 s, 45 °C for 30 s, and 72 °C for 60 s, and a Wnalextension step at 72 °C for 8 min. Two additional primers,16S AnnF and 16S AnnR (Sjölin et al., 2005), were used forsome taxa, since 16Sar-L and 16Sbr-H did not work well inthese cases. The same ampliWcation proWle was applied,except for the annealing temperature, which was set to50 °C. These primers give an about 300 bp long fragment.

A nested PCR was performed to produce an about1750 bp long fragment of the 18S rDNA region. First, theentire fragment was ampliWed with the primers TimA andTimB [Tim Littlewood (pers. comm. in Norén and Jonde-lius, 1999)]. Then two fragments were ampliWed from theproduct of the Wrst PCR, with the primer combinationsTimA/1100R [Tim Littlewood (pers. comm. in Norén andJondelius, 1999)], and 660F (Erséus et al., 2002)/TimB,respectively. The same PCR program was used for thesethree primer combinations: an initial denaturing step at95 °C for 5 min, 30 cycles of 95 °C for 30 s, 54 °C for 30 s,and 72 °C for 90 s, and a Wnal extension step at 72 °C for8 min. In some cases, when 660F did not work well, theprimer combination 600F [Tim Littlewood (pers. comm. inNorén and Jondelius, 1999)]/TimB was used instead, withthe same thermocycling procedure, except for the annealingtemperature which was set to 60 °C.

PCR products were puriWed using the QIAquick PCRPuriWcation Kit (Qiagen), or in a few cases the QIAquickGel Extraction Kit (Qiagen). Sequencing reactions wereperformed using the BigDye Terminator Cycle SequencingKit, versions 1.1, 2.0, and 3.1 (Applied Biosystems) underthe standard cycle sequencing conditions. Cycle sequencingproducts were cleaned using the DyeEx 96 Kit (Qiagen)and run on an ABI PRISM 377 DNA Sequencer (AppliedBiosystems) or on an ABI PRISM 3100 Genetic Analyzer(Applied Biosystems). All primers used for sequencing aredescribed in Table 3.

Both strands were sequenced for each gene, and the Sta-den Package (Staden et al., 1998) was used to assemble andevaluate the sequences.

A total number of 52 12S rDNA sequences, 28 16SrDNA sequences, and 28 18S rDNA sequences are new. Inaddition, GenBank data on 16S rDNA and 18S rDNAfrom some taxa were included in the analyses. These weresequenced by Erséus et al. (2000, 2002), Siddall et al. (2001),and Sjölin et al. (2005) (see Table 2).

2.3. Alignments

Sequences were aligned using CLUSTAL X, version 1.83(Thompson et al., 1997). Except for the gap opening penal-ties, default settings were used. Six diVerent gap opening pen-alty combinations were applied (pairwise gap openingpenalty/multiple gap opening penalty): 10/10, 15/15, 15/30,15/45, 30/15, and 30/40. Concerning both 12S rDNA and 16SrDNA, there were large blocks of rather conserved, and thusless ambiguous regions, interspersed by some shorter, morevariable parts. 18S rDNA was consistently less variable.

I. Envall et al. / M

olecular Phylogenetics and E

volution 40 (2006) 570–584573

Table 2Taxa included in the study, sources of material, year of collection, name of collector (for newly sequenced specimens), and GenBank accession number for the respective sequences

rDNA 16S rDNA 18S rDNA

59883 AY885581d AF411895c

59884 AY885580d AF209453a

59882 AY885636d AF411906c

59881 AY885579d AF209458a

59885 AY885578d AF209457a

59923 AY885613d AF469007b

59921 AY885610d AF411879c

59925 AY885611d AF411872c

59922 AY885609d AF411873c

59926 AY885619d AF411889c

59928 AY885593d AF411891c

59929 AY885596d AF411870c

59880 DQ459958 DQ459986

59919 AY885621d AF411866c

59918 AY885629d AF411869c

59920 AY885608d AF411899c

59917 AY885628d AF209465a

59887 AY885587d AF411867c

59886 AY885588d AF411871c

59879 AY885635d AF411908c

59924 DQ459957 DQ45998559890 DQ459936 DQ45996359927 AY885616d AF209454a

59930 AY885601d AY885574d

59891 AY885637d AF209459a

59888 DQ459931 DQ45996959893 DQ459938 DQ459965

59889 DQ459932 DQ45996459892 DQ459937 DQ459962

(continued on next page)

Taxon Collection site and year Collector 12S

Annelida, Clitellata, EnchytraeidaeBuchholzia fallax Michaelsen, 1887 Siena, Toscana, Italy, 1995 E. Rota DQ4Fridericia tuberosa Rota, 1995 Siena, Toscana, Italy, 1995 E. Rota DQ4

Annelida, Clitellata, PhreodrilidaeInsulodrilus biWdus Pinder and Brinkhurst, 1997 Bow River tributary, Western Australia, 2000 A. Pinder DQ4

Annelida, Clitellata, LumbricidaeLumbricus castaneus (Savigny, 1826) Nationalstadsparken, Stockholm, Sweden, 1995 C. Erséus et al. DQ4

Annelida, Clitellata, LumbriculidaeLumbriculus variegatus (Müller, 1774) Viktoriadammen Pond, Bergius Botanic Garden, Stockholm,

Sweden, 1993C. Erséus et al. DQ4

Annelida, Clitellata, TubiWcidae, TubiWcinaeLimnodrilus hoVmeisteri Claparède, 1862 Culture maintained at Vörtsjärv Limnological Station,

Rannu, Estonia, 2000T. Timm DQ4

Tubifex ignotus (Stolc, 1886) Lången Lake, near Alingsås, Västergötland, Sweden, 2000 C. Erséus DQ4TubiWcoides benedii (d’Udekem, 1855) Tjärnö, Bohuslän, Sweden, 2000 C. Erséus DQ4TubiWcoides pseudogaster (Dahl, 1960) Tjärnö, Bohuslän, Sweden, 2000 C. Erséus DQ4

Annelida, Clitellata, TubiWcidae, PhallodrilinaeBathydrilus formosus Erséus, 1986 Lee Stocking Island, Great Exuma, Bahamas, 1999 C. Erséus DQ4Inanidrilus aduncosetis Erséus, 1984 Carrie Bow Cay, Belize, 1993 C. Erséus DQ4Olavius algarvensis Giere, Erséus and

Stuhlmacher, 1998Elba, Italy, 2000 C. Erséus DQ4

Pirodrilus minutus (Hrabe, 1973) Kosterfjorden, Bohuslän, Sweden, 1997 C. Erséus DQ4

Annelida, Clitellata, TubiWcidae, LimnodriloidinaeLimnodriloides anxius Erséus, 1982 Lee Stocking Island, Great Exuma, Bahamas, 1999 C. Erséus DQ4Limnodriloides appendiculatus Pierantoni, 1903 Elba, Italy, 2000 C. Erséus DQ4Limnodriloides baculatus Erséus, 1982 Lee Stocking Island, Great Exuma, Bahamas, 1999 C. Erséus DQ4Smithsonidrilus hummelincki (Righi and

Kanner, 1979)Carrie Bow Cay, Belize, 1993 C. Erséus DQ4

Annelida, Clitellata, TubiWcidae, RhyacodrilinaeAinudrilus lutulentus (Erséus, 1984) Haikou, Hainan Island, China, 2000 C. Erséus and H. Wang DQ4Ainudrilus pauciseta Wang and Erséus, 2003 Haikou, Hainan Island, China, 2000 C. Erséus and H. Wang DQ4Bothrioneurum vejdovskyanum Stolc, 1888 Culture maintained at Vörtsjärv Limnological Station,

Rannu, Estonia, 2000T. Timm DQ4

Branchiura sowerbyi Beddard, 1892 Wuhan, Hubei, China, 2000 (Courtesy H. Wang) DQ4Epirodrilus pygmaeus (Hrabe, 1935) Rokytná River, Czech Republic, 2004 J. Schenkova DQ4Heronidrilus heronae (Erséus and Jamieson,

1981)Heron Island, Great Barrier reef, Queensland, Australia, 1994

C. Erséus DQ4

Heterodrilus chenianus Wang and Erséus, 2003 Sanya, Hainan Island, China, 2000 C. Erséus and H. Wang DQ4Monopylephorus rubroniveus Levinsen, 1884 Torö Island, near Stockholm, Södermanland, Sweden, 1998 M. Norén DQ4Rhyacodrilus coccineus (Vejdovský, 1875) Lången Lake, near Alingsås, Västergötland, Sweden, 2003 C. Erséus DQ4Rhyacodrilus falciformis Bretscher, 1901 Vitärtkällan Spring, near Kappelshamn, Gotland, Sweden,

2003C. Erséus DQ4

Rhyacodrilus hiemalis Ohtaka, 1995 Otsu near Lake Biwa, Japan, 2003 T. Narita DQ4Rhyacodrilus subterraneus Hrabe, 1963 Lerum, Västergötland, Sweden, 2004 C. Erséus DQ4

574I. E

nvall et al. / Molecular P

hylogenetics and Evolution 40 (2006) 570–584

Table 2 (contin

a Erséus et alb Siddall et ac Erséus et ald Sjölin et al.e Taxon was

Taxon 12S rDNA 16S rDNA 18S rDNA

Annelida, CliteAllonais inae hain) DQ459907 DQ459952 DQ459967Amphichaeta — DQ459955 DQ459970Chaetogaste DQ459911 DQ459956 DQ459968Chaetogaste DQ459912 AY885586d AF411874c

Dero digitata DQ459908 DQ459954 DQ459984Dero vaga (L ourtesy D. — DQ459953 DQ459966

Nais alpina S . DQ459906 DQ459943 DQ459975Nais commu DQ459895 DQ459949 DQ459980Nais elinguis . DQ459894 DQ459940 DQ459983Nais pardalis . DQ459905 DQ459944 DQ459977Nais variabil DQ459903 DQ459941 DQ459978Ophidonais s DQ459896 DQ459939 DQ459974

Paranais bot DQ459909 DQ459951 DQ459982Paranais fric DQ459910 DQ459950 DQ459981Paranais lito — AY885585d AF411864c

Piguetiella b DQ459898 DQ459948 DQ459979Pristina aequ DQ459914 DQ459934 DQ459961Pristina jenk DQ459916 DQ459935 DQ459959Pristina long DQ459915 AY885589d AF411875c

Pristina prob DQ459913 DQ459933 DQ459960Ripistes para DQ459900 DQ459946 DQ459972Slavina appe DQ459902 AY885582d AF411876c

Specaria josi DQ459897 AY885583d AF411878c,e

Stylaria foss ourtesy D. — DQ459945 DQ459971

Stylaria lacu DQ459901 DQ459947 DQ459973Uncinais unc DQ459904 DQ459942 DQ459976Vejdovskyell DQ459899 AY885584d AY411877d

ued)

. 2000.l. 2001.. 2002. 2005.earlier misidentiWed as Nais communis Piguet, 1906 (Erséus et al., 2002; Erséus and Källersjö, 2004).

Collection site and year Collector

llata, TubiWcidae, Naidinaequalis (Stephenson, 1911) Pacaya-Samiria Reserve, Amazon Basin, Peru, 2003 (Courtesy D. S sannio Kallstenius, 1892 Tjärnö, Bohuslän, Sweden, 2000 C. Erséus

r diaphanus (Gruithuisen, 1828) Lången Lake, near Alingsås, Västergötland, Sweden, 2002 C. Erséusr diastrophus (Gruithuisen, 1828) Lången Lake, near Alingsås, Västergötland, Sweden, 2000 C. Erséus (Müller, 1773) Lången Lake, near Alingsås, Västergötland, Sweden, 2002 C. Erséuseidy, 1880) Bear Creek, Calveras Co., California, USA, 2003 J. Hayworth (c

Kathman)perber, 1948 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et al

nis Piquet, 1906 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et al. Müller, 1773 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et al Piguet, 1906 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et alis Piquet, 1906 Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et al.erpentina Müller, 1773 San Fransisquito Creek, San Mateo Co., California, USA,

2003S. Fend

niensis Sperber, 1948 Hoburgen, Gotland, Sweden, 2003 C. Erséusi Hrabe, 1941 Tjärnö, Bohuslän, Sweden, 2000 C. Erséusralis (Müller, 1784) Tjärnö, Bohuslän, Sweden, 1998 C. Erséuslanci (Piguet, 1906) Lången Lake, near Alingsås, Västergötland, Sweden, 2002 C. Erséusiseta Bourne, 1891 Lången Lake, near Alingsås, Västergötland, Sweden, 2003 C. Erséusinae sensu lato (Stephenson, 1931) Lången Lake, near Alingsås, Västergötland, Sweden, 2003 C. Erséusiseta Ehrenberg, 1828 Lången Lake, near Alingsås, Västergötland, Sweden, 2000 C. Erséusoscidea Beddard, 1896 Esperence, Western Australia, 2003 H. Wangsita (Schmidt, 1847) Lången Lake, near Alingsås, Västergötland, Sweden, 2002 C. Erséusndiculata (d’Udekem, 1855) Lången Lake, near Alingsås, Västergötland, Sweden, 2000 C. Erséusnae (Vejdovský, 1883) Igelbäcken Stream, Solna, Uppland, Sweden, 2002 C. Erséus et al.ularis Leidy, 1852 Seven Mile Slough, Sacramento Co., California, USA, 2003 J. Hayworth (c

Kathman)stris (Linnaeus, 1767) Lången Lake, near Alingsås, Västergötland, Sweden, 2002 C.Erséusinata (Oersted, 1842) Lången Lake, near Alingsås, Västergötland, Sweden, 2003 C.Erséusa comata (Vejdovský, 1883) Lången Lake, near Alingsås, Västergötland, Sweden, 2000 C.Erséus

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 575

2.4. Analyses

Parsimony jackknife analyses (Farris et al., 1996) basedon the diVerent alignments of each gene were performed, tocompare the impact of diVerent gap opening penalties onthe phylogenetic results. The computer program Xac(which codes gaps as missing data) (Farris, 1997a; discussedin Källersjö et al., 1998) was used, with one thousand repli-cates, global branch swapping, and 10 random additionsequences each. There were no supported conXicts amongthe taxa of concern, between the respective gene trees basedon diVerent alignments. Hence, just two gap opening pen-alty combinations were selected for the analyses of thecombined data set: 15/15 and 15/45. The combined data setwas analysed by parsimony jackkniWng, using the computerprograms Xac and Gax (which codes gaps as a Wfth charac-ter state) (Farris, 1997b), with settings as above. (Gax wasused to utilise the phylogenetic information of gaps. Codinggaps as a Wfth character state may give gaps too muchweight, but, the other hand, coding gaps as missing datagives gaps too little weight, why we Wnd it appropriate toperform both analyses.) Trees were rooted using the out-group criterion (Farris, 1972).

Furthermore, the combined data set (15/15 and 15/45alignments) was analysed by Bayesian inference, usingMrBayes, version 3.0b4 (Huelsenbeck and Ronquist, 2001;Ronquist and Huelsenbeck, 2003). The models for the anal-yses were selected using the Akaike information criterion inMrModeltest, version 2.1 (Nylander, 2004), in conjunctionwith PAUP¤, version 4.0b10 (SwoVord, 2002). The samemodel, GTR+I+G (a general time-reversible model withestimated proportion of invariable sites, and gamma dis-tributed rate variation across sites), was selected for allthree genes. Substitution rates, character state frequencies,gamma shape parameter, and proportion of invariable siteswere unlinked between the genes. Four Markov chains (onecold and three heated) were run simultaneously for 2 mil-lion generations, with trees sampled every 100th generation.Each of the chains was started from a random starting tree.

Trees sampled during the burn-in phase were discarded.Four replicate analyses (times four Markov chains each)were performed, to insure that the individual runs con-verged on the same target distribution (Huelsenbeck et al.,2002).

3. Results

3.1. Trees based on analyses of the combined data set

Regarding the 15/45 alignment, there were 800 informa-tive sites when gaps were coded as missing data, and 829when gaps were coded as a Wfth character state. The totalnumber of sites was 2699. The corresponding number forthe 15/15 alignment was 772 and 813, respectively, out of atotal number of 2722 sites.

Since the topologies of all of the trees emanating from thediVerent analyses based on the combined data set are similar, wehave chosen to describe the parsimony tree based on the 15/45alignment in more detail, and just present in which importantrespects the other trees diVer from this one.

When jackknife frequencies diVer between the Xac (gapstreated as missing data) and the Gax (gaps treated as a Wfthcharacter state) analyses, they are presented in the follow-ing way: (Xac/Gax). Posterior probabilities from the fourindividual runs (of each of the two alignments) in MrBayesare reported as a range, when they are not identical.

3.1.1. Parsimony, alignment 15/45 (Fig. 1)There is strong support (jackknife frequency 100%) for

TubiWcidae (sensu Erséus and Gustavsson, 2002; i.e., includ-ing the former Naididae). The rhyacodriline Heronidrilus her-onae is placed as the sister to Naidinae + Rhyacodrilus spp.,Epirodrilus pygmaeus, Ainudrilus spp., and Monopylephorusrubroniveus, albeit weakly supported (52%/71%). The cladecontaining Naidinae and Rhyacodrilus spp., Epirodrilus pyg-maeus, Ainudrilus spp., and Monopylephorus rubroniveus isstrongly supported (100%). These rhyacodriline generagroup together with Pristina spp. (95%), but the clade that

Table 3Primers used for ampliWcation and sequencing (5�–3�)

Primer name Used for Primer sequence Reference

12SE1 PCR, sequencing (12S) AAAACATGGATTAGATACCCRYCTAT Jamieson et al. (2002)12SH PCR, sequencing (12S) ACCTACTTTGTTACGACTTATCT Jamieson et al. (2002)16Sar-L PCR, sequencing (16S) CGCCTGTTTATCAAAAACAT Palumbi et al. (1991)16Sbr-H PCR, sequencing (16S) CCGGTCTGAACTCAGATCACGT Palumbi et al. (1991)16S AnnF PCR, sequencing (16S) GCGGTATCCTGACCGTRCWAAGGTA Sjölin et al. (2005)16S AnnR PCR, sequencing (16S) TCCTAAGCCAACATCGAGGTGCCAA Sjölin et al. (2005)TimA PCR, sequencing (18S) AMCTGGTTGATCCTGCCAG Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)TimB PCR (18S) TGATCCATCTGCAGGTTCACCT Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)1100R PCR, sequencing (18S) GATCGTCTTCGAACCTCTG Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)660F PCR, sequencing (18S) GATCTCGGGTCCAGGCT Erséus et al. (2002)600F PCR, sequencing (18S) GGTGCCAGCMGCCGCGGT Tim Littlewood (pers. comm. in Norén and Jondelius, 1999)18S4FB Sequencing (18S) CCAGCAGCCGCGGTAATTCCAG Norén and Jondelius (1999)18S4FBK Sequencing (18S) CTGGAATTACCGCGGCTGCTGG Norén and Jondelius (1999)18S5F Sequencing (18S) GCGAAAGCATTTGCCAAGAA Marta Riutort (pers. comm. in Norén and Jondelius, 1999)18S7FK Sequencing (18S) GCATCACAGACCTGTTATTGC Marta Riutort (pers. comm. in Norén and Jondelius, 1999)1806R Sequencing (18S) CCTTGTTACGACTTTTACTTCCTC Michael Norén (pers. comm. in Hovmöller et al., 2002)

576 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

these taxa constitute is an unresolved tetrachotomy: Rhyaco-drilus subterraneus is placed together with R. falciformis(67%/75%), Epirodrilus pygmaeus is placed together withMonopylephorus rubroniveus (100%), Rhyacodrilus hiemalis isplaced together with R. coccineus (100%), and Ainudrilus spp.(100%) and Pristina spp. (100%) are sister groups (82%/92%).

Naidinae sensu stricto (without Pristina), is well-supported(99%/91%), although poorly resolved. Within this clade the

genus Chaetogaster (100%) is the sister group to the rest.Dero spp. are recovered as monophyletic (100%) as are Para-nais spp. (100%). A third group, although more weakly sup-ported (77%/80%), contains Ophidonais serpentina, Slavinaappendiculata, Vejdovskyella comata, Nais spp., Specaria josi-nae, Piguetiella blanci, Stylaria spp., Ripistes parasita, andUncinais uncinata. The two Stylaria species are placedtogether with Ripistes parasita, and this assemblage is well-

Fig. 1. Phylogenetic tree obtained from the parsimony analysis of the combined data set, alignment 15/45, with gaps coded as missing data (Xac). Jackknifefrequencies 750% are indicated in front of the nodes. Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 577

supported (96%). Nais alpina, N. pardalis, and N. variabilisform a clade together with Uncinais uncinata (100%/99%).

Limnodriloidinae is recovered as monophyletic (100%). Inthe Gax tree, TubiWcinae forms a clade together with the rhy-acodriline Branchiura sowerbyi (89%), but this assemblage isnot recovered in the Xac tree. The three tubiWcine speciesLimnodrilus hoVmeisteri, TubiWcoides pseudogaster, and Tubi-fex ignotus are consistently clustered together (73%/86%).The four phallodriline species form a clade together with therhyacodrilines Bothrioneurum vejdovskyanum and Heterodri-lus chenianus (92%/83%), making Phallodrilinae appearingnon-monophyletic. The rhyacodriline species are scattered inthe tree, suggesting the group is polyphyletic.

3.1.2. Parsimony, alignment 15/15 (Fig. 2)The Pristina species are not clustered together with the

rhyacodriline genera Ainudrilus, Rhyacodrilus, Epirodrilus,and Monopylephorus. The four Pristina species form astrongly supported group (jackknife frequency 100%), butthis clade holds a basal position in the Rhyacodrilinae/Naidinae clade (which is strongly supported; 100%) in theXac tree (although the support for the sister group is weak;61%), and is part of a polytomy in the Gax tree. The rhya-codriline Heronidrilus heronae is the sister to this clade(63%) in the Gax tree (as it was in the 15/45 trees), but thisnode is not present in the Xac tree. Within Naidinae sensustricto, there is a group (although weakly supported; 64%/53%) comprising Ophidonais serpentina and Nais elinguis,not recovered in the 15/45 trees.

In the Gax tree, the monophyly of TubiWcinae is sup-ported (71%).

3.1.3. Bayesian inference, alignment 15/45 (Fig. 3)TubiWcidae is divided into two groups. One comprises

Naidinae and the rhyacodrilines Rhyacodrilus spp., Ainudri-lus spp., Epirodrilus pygmaeus, Monopylephorus rubroniveus,and Heronidrilus heronae (posterior probability 0.99–1.00).The other clade consists of the rest of the rhyacodrilinestogether with Phallodrilinae, TubiWcinae, and Limnodrilo-idinae.

Dero spp. is suggested to be monophyletic (1.00), and hasa basal position in the Naidinae sensu stricto clade, insteadof Chaetogaster spp., the group holding that position in theparsimony trees. Allonais inaequalis is the second branch.Specaria josinae, Piguetiella blanci, and Nais communis areclustered together (0.87–0.93).

TubiWcinae is recovered as monophyletic (0.90–0.95) andthis group is placed as the sister to Branchiura sowerbyi (1.00).

3.1.4. Bayesian inference, alignment 15/15 (Fig. 4)The rhyacodriline Bothrioneurum vejdovskyanum is

placed as the sister to the remaining tubiWcid clade, the lat-ter holding posterior probability 0.97–1.00.

Specaria josinae, Piguetiella blanci, and Nais communisare clustered together (0.84–0.88). Slavina appendiculata,Vejdovskyella comata, Ophidonais serpentina, and Nais elin-guis form an assemblage (0.75–0.78).

TubiWcinae is recovered as monophyletic (0.98–0.99), andthis group is the sister to Branchiura sowerbyi (0.99–1.00).

3.2. Gene trees (parsimony)

Jackknife frequencies are presented as a range when theyare not identical in all of the trees (based on the six diVerentalignments, respectively).

3.2.1. 12S rDNA (trees not shown)The six alignments varied in length between 414 (align-

ment 15/45) and 441 (10/10) base pairs, of which the num-ber of informative sites ranged from 290 (15/15) to 304 (15/45). The tree topologies are similar, with no important sup-ported conXicts, regardless of alignment parameters.

A clade containing Naidinae and the rhyacodrilinegenera Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopyle-phorus is present in all of the trees (jackknife frequency55–90%), except for in the 30/15 tree, in which the Pristinaspecies are placed as part of an unresolved basal node.Pristina spp. are placed together, consistently stronglysupported (100%). Within the Naidinae/Rhyacodrilinaeclade, Naidinae sensu stricto (without Pristina) is stronglysupported (99–100%). However, within this clade, resolu-tion is low, but the genera Paranais and Chaetogaster showstrong support (100% and 91–99%, respectively).

The four species belonging to Limnodriloidinae are clus-tered together (88–100%).

3.2.2. 16S rDNA (trees not shown)The six alignments varied in length between 510 (15/45)

and 527 (30/15) base pairs, and the number of informativesites ranged from 300 (10/10) to 321 (15/30). The tree topol-ogies are similar, regardless of alignment parameters.

The same Naidinae/Rhyacodrilinae clade as recovered inthe 12S rDNA trees is identiWed by 16S rDNA (jackknifefrequency 55–96%). Naidinae sensu stricto (without Pristina)is strongly supported in all of the trees (97–100%), and Pri-stina is recovered as monophyletic (100%). Within Naidinaesensu stricto, resolution is low. However, Paranais and Chae-togaster are each supported by 100%, and Dero by 84–100%.

The four species belonging to Limnodriloidinae are clus-tered together (55–84%).

3.2.3. 18S rDNA (trees not shown)The six alignments varied in length between 1775 (15/45)

and 1779 (10/10) sites, and the number of informative sitesranged from 174 (10/10) to 177 (15/30 and 30/40). The treetopologies are virtually identical, regardless of alignmentparameters.

TubiWcidae (sensu Erséus and Gustavsson, 2002) is sup-ported (jackknife frequency 81–96%).

The Naidinae/Rhyacodrilinae clade recovered in the twomitochondrial gene trees is identiWed by 18S rDNA as well(94–97%). Pristina is recovered as monophyletic (92–95%).Nais alpina, N. pardalis, N. variabilis and Uncinais uncinataform a well-supported clade (93–95%). Stylaria lacustris, S.

578 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

fossularis and Ripistes parasita group together (76–79%).Monophyly of the genus Chaetogaster is supported (81–91%).

The four species belonging to Limnodriloidinae clustertogether (52–65%). Another clade containing the rhyacodr-iline Heterodrilus chenianus and the phallodrilines Pirodri-lus minutus, Olavius algarvensis, and Inanidrilus aduncosetis

is recovered in all of the trees (74–90%). Furthermore, therhyacodriline Branchiura sowerbyi forms a clade togetherwith the four species belonging to TubiWcinae (64–71%).

Jackknife frequencies and posterior probabilities for themost important clades are listed in Table 4.

Fig. 2. Phylogenetic tree obtained from the parsimony analysis of the combined data set, alignment 15/15, with gaps coded as missing data (Xac). Jackknifefrequencies 750% are indicated in front of the nodes. Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, TubiWcinae; Lim, Limnodriloidinae.

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 579

4. Discussion

The decision to use two mitochondrial genes in combina-tion with the frequently used nuclear gene 18S rDNA provedto be fruitful. The trees based on the combined data set aremore resolved and have stronger supported nodes than thetrees based on 18S rDNA alone. Moreover, several clades aresupported by all three individual genes, which is positive,bearing in mind that the mitochondrial and nuclear genomesare separate genetic entities. A possible disadvantage dealing

with fast-evolving mitochondrial genes is that there may behyper-variable regions, leading to ambiguous alignments.These “noisy” regions may have an impact on the outcomeof the phylogenetic analysis, if the signal of the more stableregions is not strong enough. However, since we obtained thesame basic phylogenetic pattern from all the alignments thatwe investigated, we found it justiWable to ignore these appre-hensions in our case.

The monophyletic status of TubiWcidae sensu Erséus andGustavsson (2002), that is, the hypothesis that “Naididae”

Fig. 3. Phylogenetic tree obtained from one of the four Bayesian analyses (MrBayes) of the combined data set, alignment 15/45. Posterior probabilities70.75 are indicated in front of the nodes (lowest–highest value from the four runs). Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, Tubi-Wcinae; Lim, Limnodriloidinae.

580 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

is a derived group within TubiWcidae (see also Brinkhurst,1994; Christensen and Theisen, 1998; Erséus, 1987, 1990;Erséus and Källersjö, 2004; Erséus et al., 2000, 2002; Fer-raguti et al., 1999; Sjölin et al., 2005) is strongly supportedby the combined data set, regardless of method used. Thisclade is recovered in the 18S rDNA trees as well, but not inthe gene trees based on the analyses of 12S rDNA and 16SrDNA, respectively. However, the support for this clade is

stronger in the trees based on the combined data set than inthe 18S rDNA trees. As noted above, the two most impor-tant reasons for assigning “Naididae” family status havebeen the ability of asexual reproduction, and the uniqueanterior position of the genitalia. However, these charactersare probably coupled. Shifts in the position of genitaliamost certainly occur occasionally in individuals of any oli-gochaete species, either as the result of a mutation or as a

Fig. 4. Phylogenetic tree obtained from one of the four Bayesian analyses (MrBayes) of the combined data set, alignment 15/15. Posterior probabilities70.75 are indicated in front of the nodes (lowest–highest value from the four runs). Nai, Naidinae; Rhy, Rhyacodrilinae; Pha, Phallodrilinae; Tub, Tubi-Wcinae; Lim, Limnodriloidinae.

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 581

Tab

le 4

Com

pari

son

of t

rees

wit

h su

ppor

ts f

or v

ario

us c

lade

s

Ran

ges

repo

rted

for

the

indi

vidu

al g

ene

tree

s re

fer

to t

he s

ix d

iVer

ent

alig

nmen

ts; r

ange

s re

port

ed f

or t

he B

ayes

ian

tree

s re

fer

to t

he f

our

sepa

rate

run

s in

MrB

ayes

.

Cla

de12

S rD

NA

, X

ac, j

ackk

nife

fr

eque

ncy

(%)

16S

rDN

A,

Xac

, jac

kkni

fe

freq

uenc

y (%

)

18S

rDN

A,

Xac

, jac

kkni

fe

freq

uenc

y (%

)

Com

b. d

ata

set,

Xac

, (15

/15)

, ja

ckkn

ife

freq

uenc

y (%

)

Com

b. d

ata

set,

Gax

, (15

/15)

, ja

ckkn

ife

freq

uenc

y (%

)

Com

b. d

ata

set,

Xac

, (15

/45)

, ja

ckkn

ife

freq

uenc

y (%

)

Com

b. d

ata

set,

Gax

, (15

/45)

, ja

ckkn

ife

freq

uenc

y (%

)

Com

b. d

ata

set,

MrB

ayes

, (1

5/15

), po

ster

ior

prob

abili

ty

Com

b. d

ata

set,

MrB

ayes

, (15

/45)

, po

ster

ior

prob

abili

ty

Tub

iWci

dae

(inc

l. N

aidi

nae)

(15/

30: 5

2%)

—81

–96

100

100

100

100

1.00

1.00

Nai

dina

e+

Ain

udri

lus,

Rhy

acod

rilu

s,

Epi

rodr

ilus,

and

Mon

opyl

epho

rus

55–9

055

–96

94–9

710

010

010

010

01.

001.

00

Nai

dina

e+

Her

onid

rilu

s, A

inud

rilu

s,

Rhy

acod

rilu

s, E

piro

drilu

s, a

nd

Mon

opyl

epho

rus

——

——

6352

710.

93–0

.96

0.99

–1.0

0

Nai

dina

e w

itho

ut P

rist

ina

99–1

0097

–100

—10

010

099

911.

001.

00P

rist

ina

+A

inud

rilu

s, R

hyac

odri

lus,

E

piro

drilu

s, a

nd M

onop

ylep

horu

s—

(15/

15: 5

5%,

15/4

5: 5

8%)

——

—95

950.

88–0

.93

1.00

developmental “error.” If caused by an occasional geneticvariation in a single specimen, the forward shift may berapidly spread, and Wnally established, in the population bycloning (Erséus, 1984).

A clade containing Naidinae and the four rhyacodrilinegenera Ainudrilus, Rhyacodrilus, Epirodrilus, and Monopyle-phorus is recovered in all of our trees based on the individ-ual genes (except for 12S, alignment 30/15), as well as thecombined data set. Interestingly, according to our analyses,Naidinae is a non-monophyletic group, with these rhya-codriline genera nested within. As mentioned above, thenaidines were placed among, or at least close to, rhyacodri-lines in previous phylogenetic studies, based on morpholog-ical (Brinkhurst, 1994; Erséus, 1990) as well as molecular(Christensen and Theisen, 1998; Erséus et al., 2000, 2002;Sjölin et al., 2005) data. The coelomic Xuid of most naidinesand most rhyacodrilines is mingled with numerous coe-lomocytes (a special type of freely circulating cells) (Jamie-son, 1981). Moreover, both groups have prostate glandsthat cover most of the surface of the atrium (so called“diVuse” prostate glands) (Erséus, 1990). Morphogeneticstudies of the male genitalia have shown that the prostateglands of species belonging to Naidinae and Rhyacodrili-nae are of mesodermal instead of ectodermal origin, andthis is probably a homology (Gustavsson and Erséus, 1997,1999; Gustavsson, 2004). Another similarity is the posses-sion of modiWed penial chaetae (a special type of chaetaeassociated with the male genital openings) (Erséus, 1990).

Within the clade comprising Naidinae and four particu-lar genera of Rhyacodrilinae, Pristina is of special interest;Pristina is the group that makes Naidinae non-monophy-letic. In both of the parsimony analyses (Xac/Gax) of thecombined data set, aligned with gap opening penalty com-bination 15/45, Pristina forms a clade together with the fourrhyacodriline genera, and this is well supported. This is theoutcome of the Bayesian analyses as well. The Xac analysisof the 15/15 alignment puts Pristina as the sister to a groupcontaining the rest of the naidines together with Ainudrilus,Rhyacodrilus, Epirodrilus, and Monopylephorus [althoughthis latter clade is weakly supported (61%)], whereas Pri-stina is one of four unresolved groups in the tree reXectingthe Gax analysis of the 15/15 alignment of the combineddata set. That is, interestingly, Pristina is never clusteredtogether with the rest of the naidines. Pristina is actuallymorphologically deviant as compared to the other naidines.Its species possess testes and spermathecae in segment VII,and ovaries and atria in segment VIII, which is more pos-terior than the condition in the other naidines. Moreover,they usually have dorsal chaetae from segment II, which isthe usual tubiWcid condition, whereas almost all other nai-dines have at least some anterior segments devoid of dorsalchaetae. Furthermore, Pristina forms seven segments ante-riorly during Wssion, whereas the other naidines only formfour to Wve segments (Brinkhurst and Jamieson, 1971; Sper-ber, 1948). Our results indicate that the ability of Wssioneither has arisen once and later disappeared among particu-lar rhyacodrilines, or has it arisen twice: once in the Pristina

582 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

lineage, and once in the lineage leading to the remainingnaidines. The last explanation may be the most probable,taking the deviant Pristina morphology into consideration.

Our results are congruent with the study by Bely andWray (2004), using the mitochondrial gene cytochrome oxi-dase I (COI), and including 26 species of naidines. In theiranalysis, Pristina came out as the sister to all other naidinetaxa. However, they included only one representative ofRhyacodrilinae, Branchiura sowerbyi, a species that was notplaced together with the naidines neither in our study, norin theirs.

Unfortunately, the resolution within Naidinae sensustricto is low, and the trees based on parsimony and Bayes-ian inference, respectively, are not completely concordant,especially not in the basal parts. It is, thus, impossible tomake any detailed conclusions about naidine phylogeny onthe basis of the present study. Nevertheless, some groups arewell-supported in all of the analyses based on the combineddata set, as well as the individual genes. Three out of the sixnaidine genera represented by more than one species arerecovered as monophyletic, with strong support: Pristina,Chaetogaster, and Paranais (Paranais not supported by 18SrDNA), respectively. Dero is well-supported in the parsi-mony trees based on the combined data set, and in the treesbased on the Bayesian analyses of the 15/45 alignment (com-bined data set), but this clade is not present in the treesbased on Bayesian analyses of the 15/15 alignment (com-bined data set). Dero is supported in the trees based on 16SrDNA, too, but not in the trees based on 18S rDNA.(Regarding 12S rDNA, only one of the two Dero specieswas included). Interestingly, Nais is not recovered as mono-phyletic: N. alpina, N. pardalis, and N. variabilis form a well-supported clade together with Uncinais uncinata in all of thetrees based on the combined data set, while N. elinguis andN. communis are not part of this clade. This is partly inaccordance with the results of the study by Bely and Wray(2004), based on COI. They included three Nais species: N.bretscheri, N. communis, and N. variabilis, and in their analy-sis N. communis was separated from the other two.

The two Stylaria species are consistently placed togetherwith Ripistes parasita in the trees based on the combineddata set, as well as in the trees based on 12S rDNA (how-ever, 12S rDNA from Stylaria fossularis not included inthe analysis), and 18S rDNA, respectively. This is especiallyinteresting in the light of an annotation of Sperber (1948):the genera Stylaria, Arcteonais (not represented in thisstudy), and Ripistes have several peculiar characters mainlyto themselves, i.e., a more or less pronounced proboscis,a suddenly dilating stomach, and a special mode ofswimming.

The results of our study are congruent with the mor-phology-based division of the former Naididae, made byLastobkin (1924). As described in Introduction, accordingto him, there are two groups within “Naididae”: Pristininae(Pristina) and Naidinae sensu Lastobkin (all other genera).However, resolution within this clade is too low to enableany detailed evaluation of the concordance between the

results of our study and the classiWcations proposed bySperber (1948) and Nemec and Brinkhurst (1987).

The non-monophyletic status of Rhyacodrilinae wassuggested by Erséus (1990) on the basis of morphologicalcharacters, and this taxon is not supported by any of ourpresent analyses, since most rhyacodrilines (Rhyacodrilusspp., Epirodrilus pygmaeus, Monopylephorus rubroniveus,and Ainudrilus spp.) are nested within Naidinae. In the treesbased on the analyses of the combined data set, Heronidri-lus heronae is the sister to this group (or is placed unre-solved outside it), Branchiura sowerbyi is most oftenclustered with the tubiWcines, and Heterodrilus chenianus isconsistently placed together with the phallodrilines Pirodri-lus minutus, Olavius algarvensis, and Inanidrilus aduncosetis.A close relationship between Heterodrilus and Phallodrili-nae has been proposed before, based on ciliated atria andlack of hair chaetae (Erséus, 1990), and this is also congru-ent with the studies by Erséus et al. (2000, 2002), based on18S rDNA, and Sjölin et al. (2005), based on combined 16SrDNA and 18S rDNA data.

Regarding the other tubiWcid subfamilies, the taxonsampling is too limited to enable any conclusions. However,it is worth mentioning that a monophyletic Limnodriloidi-nae clade was recovered in all of our trees, also in the indi-vidual gene trees. Limnodriloidinae was monophyletic inthe study by Sjölin et al. (2005), but they did not use 12SrDNA. In our study, Limnodriloidinae is strongly sup-ported also by this particular gene.

To summarize, the most interesting results from thisstudy is the close relationship between Naidinae and therhyacodriline genera Rhyacodrilus, Epirodrilus, Monopyle-phorus, and Ainudrilus, and the suggestion that Naidinae aswell as Rhyacodrilinae are non-natural groups. This is sup-ported regardless of alignment parameters and phyloge-netic method. Naidinae sensu stricto (without Pristina spp)is consistently recovered as monophyletic, but Pristinaappears to represent a separate lineage among these rhyac-odrilines. The taxonomic implication of this would be thateither the rhyacodriline genera Rhyacodrilus, Epirodrilus,Monopylephorus, and Ainudrilus should be included withinNaidinae, or Pristina should be excluded from this subfam-ily.

Acknowledgments

We are indebted to Emilia Rota, Adrian Pinder,Tarmo Timm, Hongzhu Wang, Michael Norén, TetsuyaNarita, Dan Shain, Steve Fend, Jana Schenkova, andDeedee Kathman for the donation of specimens. We arealso grateful to Bodil Cronholm for skilful assistancewith the laboratory work; to Steve Farris for providingsoftware; to Johan A. Nylander and Martin Irestedt foradvices regarding Bayesian analysis; and to LenaGustavsson and Erica Sjölin for inspiring discussionsabout worms among other things. This research was sup-ported by the Swedish Research Council (Grant number621-2001-2788 to CE).

I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584 583

References

Apakupakul, K., Siddall, M.E., Burreson, E.M., 1999. Higher level rela-tionships of leeches (Annelida: Clitellata: Euhirudinea) based on mor-phology and gene sequences. Mol. Phylogenet. Evol. 12, 350–359.

Armendáriz, L.C., 2000. Population dynamics of Stylaria lacustris (Lin-naeus, 1767) (Oligochaeta, Naididae) in Los Talas, Argentina. Hydro-biologia 438, 217–226.

Bely, A.E., Wray, G.A., 2001. Evolution of regeneration and Wssion inannelids: insights from engrailed- and orthodenticle-class gene expres-sion. Development 128, 2781–2791.

Bely, A.E., Wray, G.A., 2004. Molecular phylogeny of naidid worms(Annelida: Clitellata) based on cytochrome oxidase I. Mol. Phylogenet.Evol. 30, 50–63.

Brinkhurst, R.O., 1985. The generic and subfamilial classiWcation of theNaididae (Annelida: Oligochaeta). Proc. Biol. Soc. Wash. 98, 470–475.

Brinkhurst, R.O., 1994. Evolutionary relationships within the Clitellata: anupdate. Megadrilogica 5, 109–116.

Brinkhurst, R.O., Coates, K.A., 1985. The genus Paranais (Oligochaeta,Naididae) in North America. Proc. Biol. Soc. Wash. 98, 303–313.

Brinkhurst, R.O., Jamieson, B.G.M., 1971. Aquatic Oligochaeta of theWorld. Oliver & Boyd, Edinburgh.

Christensen, B., Theisen, B.F., 1998. Phylogenetic status of the familyNaididae (Oligochaeta, Annelida) as inferred from DNA analyses. J.Zool. Syst. Evol. Res. 36, 169–172.

Collado, R., Schmelz, R.M., 2000. Pristina silvicola and Pristina terrenaspp. nov., two new soil-dwelling species of Naididae (Oligochaeta,Annelida) from the tropical rain forest near Manaus, Brazil, with com-ments on the genus Pristinella. J. Zool. 251, 509–516.

Dehorne, L., 1916. Les naïdimorphes et leur reproduction asexuée. Arch.Zool. Exp. Gén. 56, 25–157.

Erséus, C., 1984. Aspects of the phylogeny of the marine TubiWcidae. Hyd-robiologia 115, 37–44.

Erséus, C., 1987. Phylogenetic analysis of the aquatic Oligochaeta underthe principle of parsimony. Hydrobiologia 155, 75–89.

Erséus, C., 1990. Cladistic analysis of the subfamilies within the TubiWci-dae (Oligochaeta). Zool. Scr. 19, 57–63.

Erséus, C., 2005. Phylogeny of oligochaetous Clitellata. Hydrobiologia535/536, 357–372.

Erséus, C., Ferraguti, M., 1995. The use of spermatozoal ultrastructure inphylogenetic studies of TubiWcidae (Oligochaeta). In: Jamieson,B.G.M., Ausio, J., Justine J.-L. (Eds.), Advances in Spermatozoal Phy-logeny and Taxonomy. Mém. Mus. Natn. Hist. Nat. 166, 189–201.

Erséus, C., Gustavsson, L., 2002. A proposal to regard the former familyNaididae as a subfamily within TubiWcidae (Annelida, Clitellata). Hyd-robiologia 485, 253–256.

Erséus, C., Gustavsson, L., Brinkhurst, R.O., 2005. TubiWcidae Vejdovský,1876 (Annelida, Clitellata): proposed precedence over Naididae Ehren-berg, 1828. Bull. Zool. Nomencl. 62, 226–231.

Erséus, C., Källersjö, M., 2004. 18S rDNA phylogeny of Clitellata (Annel-ida). Zool. Scr. 33, 187–196.

Erséus, C., Källersjö, M., Ekman, M., Hovmöller, R., 2002. 18S rDNAphylogeny of the TubiWcidae (Clitellata) and its constituent taxa: dis-missal of the Naididae. Mol. Phylogenet. Evol. 22, 414–422.

Erséus, C., Prestegaard, T., Källersjö, M., 2000. Phylogenetic analysis ofTubiWcidae (Annelida, Clitellata) based on 18S rDNA sequences. Mol.Phylogenet. Evol. 15, 381–389.

Farris, J.S., 1972. Inferring phylogenetic trees from distance matrices. Am.Naturalist 106, 645–668.

Farris, J.S., 1997a. Xac (Computer Software and Manual). Distributed bythe author. Laboratory of Molecular Systematics, Swedish Museum ofNatural History, Stockholm.

Farris, J.S., 1997b. Gax (Computer Software and Manual). Distributed bythe author. Laboratory of Molecular Systematics Swedish Museum ofNatural History, Stockholm.

Farris, J.S., Albert, V.A., Källersjö, M., Lipscomb, D., Kluge, A.G., 1996.Parsimony jackkniWng outperforms neighbor-joining. Cladistics 12,99–124.

Ferraguti, M., Erséus, C., Kaygorodova, I., Martin, P., 1999. New spermtypes in Naididae and Lumbriculidae (Annelida: Oligochaeta) andtheir possible phylogenetic implications. Hydrobiologia 406, 213–222.

Gustavsson, L.M., 2004. Development of the genital ducts in Telmatodrili-nae (TubiWcidae, Clitellata). J. Morphol. 262, 791–799.

Gustavsson, L.M., Erséus, C., 1997. Morphogenesis of the genital ductsand spermathecae in Clitellio arenarius, Heterochaeta costata, TubiWco-ides benedii (TubiWcidae) and Stylaria lacustris (Naididae) (Annelida,Oligochaeta). Acta Zool. 78, 9–31.

Gustavsson, L.M., Erséus, C., 1999. Development of the genital ducts andspermathecae in the rhyacodrilines Rhyacodrilus coccineus and Monop-ylephorus rubroniveus (Oligochaeta, TubiWcidae). J. Morphol. 242, 141–156.

Hovmöller, R., Pape, T., Källersjö, M., 2002. The Palaeoptera problem:basal pterygote phylogeny inferred from 18S and 28S rDNAsequences. Cladistics 18, 313–323.

Huelsenbeck, J.P., Larget, B., Miller, R.E., Ronquist, F., 2002. Potentialapplications and pitfalls of Bayesian inference of phylogeny. Syst. Biol.51, 673–688.

Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference ofphylogenetic trees. Bioinformatics 17, 754–755.

Jamieson, B.G.M., 1981. The Ultrastructure of the Oligochaeta. AcademicPress, London, pp. 62–95.

Jamieson, B.G.M., Tillier, S., Tillier, A., Justine, J.-L., Ling, E., James, S.,McDonald, K., Hugall, A.F., 2002. Phylogeny of the Megascolecidaeand Crassiclitellata (Annelida, Oligochaeta): combined versus parti-tioned analysis using nuclear (28S) and mitochondrial (12S, 16S)rDNA. Zoosystema 24, 707–734.

Källersjö, M., Farris, J.S., Chase, M.W., Bremer, B., Fay, M.F., Humphries,C.J., Petersen, G., Seberg, O., Bremer, K., 1998. Simultaneous parsi-mony jackknife analysis of 2538 rbcL DNA sequences reveals supportfor major clades of green plants, land plants, seed plants and Xoweringplants. Plant Syst. Evol. 213, 259–287.

Lastobkin, D.A., 1924. New and rare Copepoda and Oligochaeta from Cen-tral Russia. Bull. Inst. Hydrol. Russ. Leningrad, 9 [cited in Sperber, 1948].

Loden, M.S., 1981. Reproductive ecology of Naididae (Oligochaeta). Hyd-robiologia 83, 115–123.

Martin, P., 2001. On the origin of the Hirudinea and the demise of the Oli-gochaeta. Proc. R. Soc. Lond. B 268, 1089–1098.

Martin, P., Kaygorodova, I., Sherbakov, D.Yu., Verheyen, E., 2000. Rap-idly evolving lineages impede the resolution of phylogenetic relation-ships among Clitellata (Annelida). Mol. Phylogenet. Evol. 15, 355–368.

Nemec, A.F.L., Brinkhurst, R.O., 1987. A comparison of methodologicalapproaches to the subfamilial classiWcation of the Naididae (Oligocha-eta). Can. J. Zool. 65, 691–707.

Norén, M., Jondelius, U., 1999. Phylogeny of the Prolecithophora (Platy-helminthes) inferred from 18S rDNA sequences. Cladistics 15, 103–112.

Nylander, J.A.A., 2004. MrModeltest 2.1. (Computer Software). Distrib-uted by the author. Evolutionary Biology Centre, Uppsala University,Uppsala.

Omodeo, P., 1998. History of Clitellata. Ital. J. Zool. 65, 51–73.Palumbi, S.R., Martin, A.P., Romano, S.R., McMillan, W.O., Stice, L.,

Grabowski, G., 1991. The simple fool’s guide to PCR. Version 2.0.Department of Zoology, University of Hawaii, Honolulu.

Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogeneticinference under mixed models. Bioinformatics 19, 1572–1574.

Siddall, M.E., Apakupakul, K., Burreson, E.M., Coates, K.A., Erséus, C.,Gelder, S.R., Källersjö, M., Trapido-Rosenthal, H., 2001. ValidatingLivanow: Molecular data agree that leeches, branchiobdellidans, andAcanthobdella peledina form a monophyletic group of oligochaetes.Mol. Phylogenet. Evol. 21, 346–351.

Sjölin, E., Erséus, C., Källersjö, M., 2005. Phylogeny of TubiWcidae (Annel-ida, Clitellata) based on mitochondrial and nuclear sequence data.Mol. Phylogenet. Evol. 35, 431–441.

Sperber, C., 1948. A taxonomical study of the Naididae. Zool. Bidrag Upp-sala 28, Uppsala.

Staden, R., Beal, K.F., BonWeld, J.K., 1998. The Staden Package. In: Mis-ener, S., Krawets, S.A. (Eds.), Computer Methods in Molecular Biology

584 I. Envall et al. / Molecular Phylogenetics and Evolution 40 (2006) 570–584

132: Bioinformatics Methods and Protocols. Humana Press, Totowa,pp. 115–130.

SwoVord, D.L., 2002. PAUP¤. Phylogentic Analysis Using Parsimony (¤ andother methods). Version 4.0b10. Sinauer Associates, Sunderland, MA.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G.,1997. The ClustalX windows interface: Xexible strategies for multiplesequence alignment aided by quality analysis tools. Nucleic Acids Res.25, 4876–4882.