Molecular Epidemiology, Virulence Potential and Source...

Molecular Epidemiology, Virulence Potential and

Source Tracking by Source Specific Markers of

Campylobacter jejuni

By

Fariha Masood Siddiqui

CIIT/FA10-PBS-004/ISB

PhD Thesis

in

Biosciences

COMSATS Institute of Information Technology

Islamabad- Pakistan

Fall, 2015

ii

COMSATS Institute of Information Technology




A Thesis Presented to

COMSATS Institute of Information Technology, Islamabad

in partial fulfilment

of the requirement for the degree of

PhD (Biosciences)

By



Fall, 2015

iii




______________________________________________________

A Post Graduate Thesis submitted to the Department of Biosciences as partial

fulfilment of the requirement for the award of the Degree of PhD (Biosciences).

Name Registration Number

Fariha Masood Siddiqui CIIT/FA10-PBS-004/ISB

Supervisor

Prof. Dr. Syed Habib Bokhari

Professor

Department of Biosciences

COMSATS Institute of Information Technology (CIIT) Islamabad Campus

December, 2015

iv

Final Approval This Thesis titled



Campylobacter jejuni By



Has been approved

For the COMSATS Institute of Information Technology, Islamabad

External Examiner 1: ___________________________________________________

Prof. Dr. Azra Khanum

Professor, PMAS Arid Agriculture University, Rawalpindi

External Examiner 2: ___________________________________________________

Dr. Shahid Mahmood Baig

Head, Health Biotechnology Division, NIBGE, Faislabad

Supervisor: ___________________________________________________________


Professor, Department of Biosciences, CIIT, Islamabad

HOD: _______________________________________________________________

Prof. Dr. Raheel Qamar (T.I.)


Chairperson: ___________________________________________________________

Prof. Dr. Mahmood Akhtar Kayani


Dean, Faculty of Sciences: _____________________________________________

Prof. Dr. Arshad Saleem Bhatti (T.I.)

Professor, Department of Physics, CIIT, Islamabad

v

Declaration

I Fariha Masood Siddiqui, CIIT/FA10-PBS-004/ISB hereby declare that I have produced

the work presented in this thesis, during the scheduled period of study. I also declare that

I have not taken any material from any source except referred and the amount of

plagiarism is within acceptable range. If a violation of HEC rules on research has

occurred in this thesis, I shall be liable to punishable action under the plagiarism rules of

the HEC.

Date: __________________ Signature of the Student:

_______________________



vi

Certificate

It is certified that Fariha Masood Siddiqui, CIIT/FA10-PBS-004/ISB has carried out all

the work related to this thesis under my supervision at the Department of Biosciences,

COMSATS Institute of Information Technology, Islamabad and the work fulfills the

requirement for award of PhD degree.

Date: ___________________

Supervisor:

________________________


Department of Biosciences

Head of Department:

________________________

Prof. Dr. Raheel Qamar (T.I.)

Head, Department of Biosciences

vii

DEDICATION

To my Loving Mother (Late)

To whom I owe sweet memories, who is no more with me but whose prayers

and wishes are with me

and

My Loving Father

Who guides and supports me in each and every step

viii

Acknowledgment

All praises for Almighty ALLAH, who is entire source of knowledge and wisdom

endowed to mankind; who bestowed me courage, abilities, loving parents and talented

teachers. Countless salutations of upon Hazrat Muhammad (SAWW), who is a role

model for humanity and who guided the mankind on true path of life.

I owe my gratitude to my supervisor, Prof. Dr. Habib Bokhari, for his supervision and

guidance. He has extended his kind and valuable suggestions to deal with problems

throughout my research work. I would like to extend my thanks to Prof. Dr. Raheel

Qamar, Head of Department of Biosciences, and my course work teachers Prof. Dr.

Habib Bokhari, Prof. Dr. Farah Mustafa, Dr. Rani Faryal, Dr. Asifa Ahmed, Dr. Tayyaba

Yasmeen and Dr. Muhammad Saeed.

I am indebted to British Council (INSPIRE) programme (Grant no. SP0019) for my

academic research visit to University of Exeter, UK. My humble thanks to Prof. Richard

Titball, Dr. Olivia Champion and Dr. Sok Kiang Lau, who provided me opportunity to

take up and conduct research and helped and guided me throughout my research visit.

I am highly grateful to Higher Education Commission for providing me funds through

HEC Indigenous scholarship (Batch - VII) for pursuing my PhD study and research.

I pay my special thanks to my seniors and lab oratory Muhammad Ali Syed, Muhammad

Idrees, Muhammad Ali Shah, Muhammad Akram, Saba Asad, Ayesha Khan, Maryam

Mehmood, Sidra Siddiqui, Mahwish Younas, Shafi Muhammad, Zobia Noreen, Sadaf

Raja, Sobia Kanwal and Maryam Zahra for their advices, utmost cooperation and

valuable company. Thank you all for your support and for creating a fun environment to

work in. The good friends that helped me through this chapter of my life are countless

and I thank you all, you know who you are.

My gratitude to the staff of lab oratory and Biosciences Department for their help and

support.

Words are inadequate to express gratitude for my loving Mother (Late), whose love,

prayers and wishes are my greatest asset. I am highly grateful to my Father for his love,

ix

prayers, moral and financial support, courage and guidance. I would have been nothing

without prayers of my parents.

I am also grateful to my sister and brothers for their support and for tolerating me.

May ALLAH bless all these people.

Finally, all errors that remain are mine alone.



x

ABSTRACT

Globally Campylobacter jejuni, major cause of bacterial human gastroenteritis, is

frequently isolated from poultry, cattle and waste water. The goal of this research was to

assess (1) the isolation frequency of C. jejuni from diverse sources, (2) antibiotic

resistance profiling, (3) source attribution and distribution in clusters, (4) occurrence of

newly identified Type VI secretion system (T6SS). Samples were collected from

Islamabad, Karachi, Lahore, Peshawar and Gilgit. Overall 1305 samples were collected

from different sources, then confirmed by morphology, biochemical tests and PCR.

Antibiotic susceptibility was determined by disc diffusion method according to CLSI

2010. Beta lactamase producing strains were identified by Nitrocefin method. C. jejuni

isolates were grouped into clusters by two triplex predictive PCRs. Multiplex PCR based

on T6SS conserved genes was employed to screen Pakistani C. jejuni isolates and their

gene expression was determined by RT-PCR. C. jejuni strains were isolated from 13.6 %

clinical, 46.47 % poultry, 21.40 % cattle and 22.06 % wastewater samples. Highest

resistance rates were observed among poultry and wastewater isolates. Highest resistance

was observed for nalidixic acid, erythromycin and ceftriaxone. Most sensitive antibiotics

were found to be chloramphenicol and spectinomycin. Beta lactamase producing strains

were detected in 35 % clinical, 57 % poultry, 39 % cattle and 32 % wastewater isolates.

Group clustering showed majority of the isolates were in C4/C6 and C7/C8 groups while

none were assigned to C1/C2/C3 cluster. Results of identification of T6SS in C. jejuni

isolates revealed 4.64 % of all the isolates were positive for T6SS. Gene expression

analysis demonstrated down-regulation of T6SS in acidic environment. Our results

showed a high isolation frequency of multidrug resistant C. jejuni isolates in different

sources. Source tracking PCR revealed majority of clinical isolates were tracked to

nonlivestock sources. Surveillance strategies should be intended to lessen the burden of

C. jejuni infections by limiting transmission from livestock as well as non-livestock

sources. Our findings regarding T6SS highlight the need to establish the role of the T6SS

in environmental survival or virulence.

xi

LIST OF ABBREVIATIONS

ATCC American type culture collection

bp base pair

CC clonal complex

CDS coding DNA sequence

cDNA complementary deoxyribonucleic acid

CDT cytolethal distending toxin

CGH comparative genomic hybridization

CLSI clinical and laboratory standards institute

DEPC diethylpyrocarbonate

DNA deoxyribonucleic acid

dNTPs deoxyribo nucleotide triphosphates

DTT dithiothreitol

EDTA ethylenediaminetetraaceticacid

EFSA European food safety authority

GBS Guillian Barre’ Syndrome

gltA citrate synthase gene

hcp hemolysin coregulated protein

icmF intracellular multiplication factor

IID intestinal infectious disease

LOS lipooligosaccharide

LPS lipopolysaccharide

LT heat labile toxin

mCCDA modified charcoal cefoperazone dexoycholate agar

MDR multi drug resistant

MH broth Mueller hinton broth

mL milli litre

MLST multi locus sequence typing

mPCR multiplex polymerase chain reaction

NCTC national collection of type cultures

xii

OD optical density

ORF open reading frame

PBS phosphate buffered saline

PCR polymerase chain reaction

PR plasticity regions

RNA ribonucleic acid

RT reverse transcriptase

RT-PCR reverse transcriptase polymerase chain reaction

ST sequence type

STE sodium chloride tris-EDTA

Taq thermus aquaticus

T3SS type three secretion system

T4SS type four secretion system

T6SS type six secretion system

TE tris EDTA

µL micro litre

UPGMA unweighted pair group method analysis

VBNC viable but non culturable

vgrG valine glycine repeats G

WHO world health organization

WW wildlife and water

xiii

TABLE OF CONTENTS

Introduction …………………………………………………………………………...... 1

1. History of Campylobacter jejuni ……………………………………………….. 3

2. Morphology and Physiology …………………………………………………….. 4

3. Identification and Characterization ……………………………………………… 4

4. Host ……………………………………………………………………………... 5

5. Epidemiology ……………………………………………………………………. 7

6. Environmental Prevalence ……………………………………………............... 9

7. Treatment and Antimicrobial Resistance ………………………………………. 12

8. Factors of Pathogenicity and Virulence of Campylobacter jejuni ……………... 13

8.1 Adhesion and Invasive Factors ………………………………………………. 13

8.1.1 Flagella ………………………………………………………………….. 14

8.1.2 Cell Adherence ……………………………………………………………. 15

8.2 Lipooligosaccharide (LOS) …………………………………………………… 15

8.3 Lipopolysaccharide (LPS) ……………………………………………………. 16

8.4 Enterotoxins ……………………………………………………………………16

8.5 Cytotoxins …………………………………………………………………….. 17

9. Bacterial Secretion System …………………………………………………….. 18

9.1 Type III Secretion System ………………………………………………….... 18

9.2 Type IV Secretion System ……………………………………………………..20

9.3 Type VI Secretion System ……………………………………………………. 20

9.3.1 T6SS Gene Cluster ………………………………………………………. 22

9.3.2 T6SS Association with Virulence ……………………………………….. 22

10. Aims and Objectives …………………………………………………………… 25

Chapter 1. Isolation Frequency and Antibiotic Susceptibility Profiles of

Campylobacter jejuni Isolates from Diverse Sources in Pakistan …………………. 26

1.1 Abstract ………………………………………………………………………… 27

1.2 Introduction …………………………………………………………………….. 28

1.3 Materials and Methods …………………………………………………………. 31

xiv

1.3.1 Sample Collection ……………………………………………………… 31

1.3.2 Culturing Method for Detection of Campylobacter jejuni …………….. 31

1.3.3 Biochemical Identification ………………………………………………32

1.3.4 PCR Technique for the Detection of Campylobacter jejuni …………… 32

1.3.4.1 DNA Isolation ……………………………………………………… 32

1.3.4.2 PCR Technique and Amplification………………………………..... 33

1.3.5 Antibiotic Sensitivity Analysis ………………………………………… 34

1.3.5.1 Kirby-Bauer Disc Diffusion Assay ………………………………… 34

1.3.5.2 Nitrocefin Method ………………………………………………….. 35

1.4 Results ………………………………………………………………………….. 35

1.4.1 Confirmation of Isolates as Campylobacter jejuni ……………………...35

1.4.2 Isolation Frequency of C. jejuni in Different Sources …………………. 37

1.4.3 Antibiotic susceptibility of C. jejuni Isolates …………………………... 40

1.4.3.1 Multidrug Resistance in C. jejuni Isolates …………………………. 45

1.5 Discussion ……………………………………………………………………… 46

Chapter 2. Source Attribution and Strain Clustering of C. jejuni Isolates from

Diverse Sources ……………………………………………………………………….. 51

2.1 Abstract ………………………………………………………………………….. 52

2.2 Introduction ……………………………………………………………………… 53

2.3 Materials and Methods …………………………………………………………... 55

2.3.1 Growth of Bacterial Strains …………………………………………………. 55

2.3.2 DNA Extraction ……………………………………………………………... 55

2.3.3 Distribution of C. jejuni Isolates from Diverse Sources in Strain Clusters …..56

2.4 Results ……………………………………………………………………………..58

2.4.1 Cluster Prediction by Predictive Multiplex PCR …………………………….. 58

2.4.2 Distribution of C. jejuni Isolates in Strain Clusters and Source Attribution … 58

2.5 Discussion ………………………………………………………………………... 62

Chapter 3. Molecular Detection and Surveillance of Type Six Secretion System in

Campylobacter jeuni Isolates ……………………………………………………......... 65

3.1 Abstract …………………………………………………………………………… 66

xv

3.2 Introduction ………………………………………………………………………. 66

3.3 Materials and Methods …………………………………………………………… 68

3.3.1 Growth of Bacterial Strains and DNA Extraction ……………………………. 68

3.3.2 Screening PCR Assay for T6SS Conserved Genes ………………………….. 70

3.3.3 Preparation of RNA Template ………………………………………………... 72

3.3.4 RNA Isolation ……………………………………………………………........ 73

3.3.5 DNase Treatment of RNA Samples Prior to RT-PCR ………………………... 73

3.3.6 RT-PCR (Reverse Transcriptase PCR) for T6SS Conserved Genes …………. 74

3.3.7 Distribution of C. jejuni Isolates harboring T6SS in Strain Clusters ………… 75

3.4 Results ……………………………………………………………………………... 75

3.4.1 Indication of T6SS in C. jejuni Isolates from Diverse Sources ……………….. 75

3.4.2 Gene Expression of T6SS Conserved Genes ………………………………….. 79

3.4.3 Strain Clusters of T6SS +ve C. jejuni Isolates ………………………………… 82

3.5 Discussion ……………………………………………………………………….. 85

Conclusions ………………………………………………………………………….... 88

References …………………………………………………………………………….. 90

Appendix 1: Antibiotic Resistance Profiles of C. jejuni Isolates ………………………116

Appendix 2: Multiantibiotic Resistance Profiles of C. jejuni Isolates ………………... 126

Appendix 3: PCR Profiles of C. jejuni Isolates for Prediction of Strain Clusters ……. 132

xvi

LIST OF FIGURES

Figure 1. Pathways to Campylobacter jejuni human infection (Perko-Makela, 2011) …11

Figure 2. Schematic diagram of the T3SS apparatus (Sato and Frank, 2011) …………..19

Figure 3. Role of bacteria harboring T6SS in the mammalian intestines (Russell et al.,

2014) .…………………………………………………………………........................... 21

Figure 4. Schematic representation of the general model of T6SS assembly (Shneider et

al., 2013) ……………………………………………………………………………….. 23

Figure 5. Gene arrangement of T6SS cluster in Campylobacter jejuni 414 (Harrison et al.,

2014)……………………………………………………………………………………..24

Figure 1.1 (A) Isolates positive for 16s rRNA (B) for hipO gene……………………… 36

Figure 1.2 Isolation frequency of C. jejuni from Islamabad, Karachi, Lahore, Peshawar

and Gilgit. ……………………………………………………………………………….39

Figure 1.3 Mueller-Hinton plate of C. jejuni isolate showing antibiotic discs with zones

of inhibition………………………………………………………………………………41

Figure 1.4 Antibiotic susceptibility patterns of C. jejuni isolated from (A) human

diarrheal, (B) poultry, (C) cattle, (D) wastewater samples

…………………………………………………………………………..………………..42

Figure 1.5 Beta lactamase producing C. jejuni isolates from different sources …..…….43

Figure 1.6 C. jejuni isolates resistant to multiantibiotics ……………………………......45

Figure 2.1 Prediction of strain cluster groups by multiplex PCR………………...59

Figure 2.2 Dendrogram showing distribution of C. jejuni isolates from diverse sources in

strain cluster groups (C1-C9) ………………………………………………………….. 60

Figure 2.3 Distribution of C. jejuni isolates from diverse sources in strain cluster

groups………………………………………………………………………………….... 61

Figure 3.1 (A) Hcp positive C. jejuni isolates (B) strain 255 showing T6SS conserved

genes …………………………………………………………………………………… 76

xvii

Figure 3.2 Map showing location of C. jejuni samples collected from different

sources……………………………………………………………………………………78

Figure 3.3 RT-PCR analysis of hcp, vgrG and icmF expression in strain 255 ……….....80

Figure 3.4 Differential expression of T6SS conserved genes……………………………81

Figure 3.5 Multiplex PCR for prediction of strain clusters …………………………......82

Figure 3.6 Phenogram displaying clusters of T6SS possessing C. jejuni strains ……….84

xviii

LIST OF TABLES

Table 1.1 Isolation rates of Campylobacter jejuni in investigated different sources…… 38

Table 1.2 Antimicrobial resistance rates of Campylobacter jejuni isolated from different

sources………..…………………………………………………………………………. 44

Table 2.1 Primers for strain cluster attribution of C. jejuni isolates ………………........ 57

Table 3.1 Primers for screening conserved T6SS genes (hcp, vgrG, icmF using gltA as

internal control) ………………………………………………………………………… 71

Table 3.2 T6SS positive C. jejuni strains ………………………………………………. 77

Table 3.3 Strain cluster attribution by predictive PCR ………………………………… 83

Introduction

1

Introduction

Introduction

2

Introduction

Campylobacter spp, are identified as causative bacterial agent of most frequently occurring

foodborne diarrhea worldwide (Park, 2002; Silva et al., 2011). Causative agent of mostly

reported Campylobacteriosis cases is Campylobacter jejuni, a bacterium that survives in

the intestinal tract of many birds and mammals as a commensal (Humphrey and Madsen,

2007). Since the 1990’s, incidence of campylobacteriosis has been increasing gradually

and continually rising in many countries (Baker et al., 2007; WHO, 2011).

Campylobacteriosis is generally a self-limited disease with an incubation time of one to

seven days. The main symptoms are cramps in the abdomen followed by watery,

sometimes bloody diarrhoea. General symptoms such as fever, vomiting, headache and

dizziness may also occur (Moore et al., 2005; Blaser and Engberg, 2008). Other associated

clinical signs can include asthenia and anorexia (Moore et al., 2005). Symptoms include

mild as well as severe ones and may cause death in patients with weak immunity. The

bacteria are diverse in environment and have been isolated from various reservoirs of

animals, e.g., chicken, cattle, and pets (Anonymous, 2006). Campylobacter spp. is highly

prevalent in chickens; hence, contact and consumption of poultry is recognized as an

eminent risk factor for campylobacteriosis. Campylobacter spp require special conditions

for their growth and are unable to grow and reproduce in the presence of oxygen, still the

bacteria can survive on food or in the environment for many days. Furthermore, infective

dose for humans is quite low i.e. 500 cells (Robinson, 1981; Black et al., 1988).

Genus Campylobacter consists of 25 species and 8 subspecies and belongs to family

Campylobacteraceae, these have been detected in humans, cattle and birds (Man, 2011).

Campylobacter jejuni is divided into two subspecies, namely jejuni which is most common

in human cases and doylei (On, 2005). Any further reference to Campylobacter jejuni

specifically means C. jejuni subspecie. jejuni.

Infection caused by Campylobacter spp. is identified as the major cause of acute bacterial

gastroenteritis in developed as well as developing countries (Allos, 2001; Coker et al.,

2002; Moore et al, 2005). Diarrhea starts acutely following the ingestion of contaminated

food, with a mean incubation period of 3.2 days (range: 18 hrs - 8 days), which is longer

than other intestinal infections such as Salmonella spp. Diarrhea is usually self-limiting

with a median duration of 4.6 days in most healthy patients and hospitalization rates of 5-

Introduction

3

10%, but the organism can be defecated in the stool for several weeks (Blaser and Engberg,

2008).

1. History of Campylobacter jejuni

In 1886, Theodor Escherich noticed some organisms in stool samples of children with

diarrhea who died of then named disease called ‘cholera infantum’, these organisms

resembled Campylobacters (Altekruse et al., 1999). However, his work remained

unrecognized. Later in 1985, Kist revealed findings of Escherich at Third International

Campylobacter Workshop that was held in Ottawa (Butzler, 2004). In 1909, two

veterinarians, McFadyean and Stockman did research on abortion in ewes and identified

an unknown bacterium that was isolated frequently from aborted fetuses and that showed

resembelance to vibrio (McFadyean and Stockman, 1913). In 1919, Smith isolated a

bacterium from infectious abortions of bovines in USA. He described it a spirillum and

proposed its name as ‘Vibrio fetus’ (Smith, 1919). Meanwhile, winter dysentery in calves

was attributed to infection by ‘vibrio’ (Jones et al., 1931) that was called as Vibrio jejuni,

and swine dysentery was also said to be associated with similar organism (Doyle, 1944).

Later on, King (1957) blood samples of children affected with diarrhea were found to be

positive for the presence of related Vibrio. Eventually Veron and Sebald in 1963 introduced

a new genus Campylobacter to differentiate them from Vibrio.

In 1972, Campylobacter jejuni was isolated for the first time from clinical diarrheal stool

samples by a microbiologist of Belgium using the filtration technique that had been

previously used in veterinary medicine (Altekruse et al., 1999). This was not possible until

in the later 1970s, development of selective media for growth and identification of

optimum temperature and reduced oxygen requirements, that finally Campylobacter was

proposed to be a significant causative agent of bacterial gastroenteritis (Kist, 1986). Later

studies during 1970s and 1980s enhanced the knowledge and understanding of not only C.

jejuni but also other species of Campylobacter, including their environment and sources,

role in causing disease, and pathogenicity and virulence mechanisms. Due to its

requirement of unusual temperature and oxygen for growth, organism was remained

Introduction

4

unnoticed for many years as a human pathogen, meanwhile it was causing gastroenteritis

that remain undiagnosed.

2. Morphology and Physiology

Campylobacter jejuni is spiral, motile Gram negative bacterium with width ranging from

0.2 to 0.8 μm and length from 0.5 to 5 μm (Nachamkin et al., 2008). These bacteria have

polar flagellum at each end of a cell. In late stationary phase, cultures a coccoid cell form

predominates. The coccoid forms tend to be difficult to subculture and lose motility (Ng et

al., 1985). These changes may allow Campylobacters to survive in environmentally

challenging environments in “viable but non culturable” (VBNC) form (Oliver, 2005;

Rollins and Colwell, 1986). However with strain-to-strain variation conflicting evidence

exists as to the importance of coccoid forms, injured bacterial cells and the VBNC form

(Jones et al., 1991). Campylobacter spp. is characteristic fastidious pathogen requiring

stringent growth requirements. They have a rather narrow temperature range for growth

that lies between 30 °C and 45°C (Hazeleger et al., 1998; Park 2002) but temperature

optimal growth is 42°C (Park, 2002). In addition to that, they are considered capnophilic

and microaerophilic, requiring an atmosphere with carbon dioxide and containing low

oxygen concentrations. The optimal atmosphere for cultivation of C. jejuni consists of 5%-

10% O2 and 1-10% CO2 (Luechtefeld et al., 1982; Bolton and Coates 1983). They are slow-

growing organisms and require selective media containing charcoal and various antibiotics,

such as cephalothin, to suppress competing fecal microflora. Salinity also affects the

survival of Campylobacters as they cannot multiply in concentrations of 2% or greater

sodium chloride (Doyle and Roman, 1982). Furthermore, they do not thrive well on

surfaces nor are they resistant to dessication (Fernandez et al., 1985). On the contrary,

biofilms and aquatic environment favors their growth.

3. Identification and Characterization

The ability to sequence bacterial genomes has revolutionized the taxonomy,

characterization, and diagnostic tests for Campylobacters. In 2000, Parkhill et al. published

the first sequenced genome of C. jejuni that was named as NCTC 11168 (Parkhill et al.,

Introduction

5

2000). Strain variability is an important characteristic of Campylobacters. Hypervariable

regions have been identified using genomic sequencing and DNA microarray technology,

and some strains like C. jejuni 81-176 contain plasmids (Parkhill et al., 2000; Larsen and

Guerry 2005; Hofreuter et al., 2006). Strain variability may influence persistence in

environmental extremes, virulence, antimicrobial resistance patterns, ability to infect or

induction of sequelae e.g. GBS (Guillian Barre’ Syndrome) and MFS (Miller Fischer

Syndrome) in humans, and more importantly survival of Campylobacters in water, faeces,

or food (Fitzgerald et al., 2005; Park, 2005). At the same time, C. jejuni 81116 has been

found to be genetically stable for over 20 years in different environments (Manning et al.,

2001). Microbial populations consisting of both Campylobacters that are genetically stable

and those able to adapt to external environment may explain, to some extent, the continued

success of campylobacters as human and foodborne pathogens. Traditionally, selective

culture media have been used to isolate Campylobacter spp. More recently, a combination

of techniques including selective enrichment, culture isolation from selective agar, and then

biochemical, serological or genotypic methods have been used to fully describe isolates

(Nachamkin and Blaser, 2000; Yu et al., 2001; Miller et al., 2005). Different varieties of

tools of identification and typing of phenotypes and genotypes of C. jejuni are developed.

But the choice of molecular typing tool may be based on implementation costs, labor

required, access to specialized equipment or software, portability and standardization,

discriminatory ability and resolution of the technique, flexibility of experimental design,

and the time frame required for data acquisition (long-term research project compared to

outbreak investigation). The choice of available techniques, lack of consensus within the

research community and the ongoing development of molecular typing tools illustrate that

currently no one method is optimal for all circumstances.

4. Host

Animals

C. jejuni and C. coli are frequently presented in common intestinal flora of various animals

including fowl (Blaser, 1982). Most of the studies have not distinguished between the two

Campylobacter species. Both species have been isolated from intestinal contents of

Introduction

6

turkeys, chickens, ducks as well as also wild birds. It has been reported that poultry is

contaminated to a substantial extent with Campylobacter spp. Even eggs have been

reported to be contaminated with Campylobacter due to material from infected chickens

(Shane et al., 1986; Messelhausser et al., 2011). Infection from C. jejuni in humans are

mostly attributed to the livestock handling and consumption of livestock associated

products specially poultry related products (Skirrow, 1977; Skirrow et al., 1981; Harris et

al., 1986; Wilson et al., 2008; Tam et al., 2009). Moreover, C. jejuni have also been

detected from diversified non-livestock animals that include flies, wild-birds, rodents,

hares, badger, squirrels, deer, foxes, hedgehogs, bank voles and seals (Rosef et al., 1983;

Rosef et al., 1985; Petersen et al., 2001; Ronquist and Huelsenbeck, 2003; French et al.,

2009).

Humans

Campylobacter spp. are causative agent of bacterial gastroenteritis in developed as well as

developing countries (Oberhelman and Taylor, 2000). In humans, disease incubation is

approximately 1-8 days (mean 3 days) after ingestion, (Skirrow and Blaser, 2000).

Infectious dose is reported to be as low as 500 cells in contaminated food (Robinson, 1981).

Symptoms in people include fever, headache, muscle pain and vomiting, although diarrhea

(watery and often progressing to bloody) and abdominal cramping are the most common

clinical signs (Skirrow and Blaser, 1995). After the onset, clinical signs usually last

approximately a week, although prolonged illness and relapse may occur. Rarely

extraintestinal sequelae may occur including rash, hepatitis, cholecystitis, pancreatitis,

cystitis, septic abortion, reactive arthritis, hemorrhagic uremic syndrome and bacteremia.

(Walker et al., 1986; Skirrow and Blaser, 2000). People of any age may be infected,

although children under two years of age (developed and developing countries) and young

adults (developed countries) may have higher incidence rates (Blaser, 1997; Friedman et

al., 2000). Severity of clinical signs can be strain dependent and it is possible for people to

be infected by several strains at the same time (Black et al., 1988, Richardson et al., 2001).

Due to under reporting, unidentification via lab tests, treatment without determining

etiology etc. particularly from developing countries, it is difficult to completely estimate

human campylobacteriosis prevalence rates.

Introduction

7

5. Epidemiology

Campylobacter jejuni infections are termed as campylobacteriosis, or Campylobacter

jejuni gastroenteritis. Infection in industrialized countries is frequent among people of all

age groups; however children below four years of age are more vulnerable to

Campylobacter spp. (Butzler, 2004). Moreover, immunocompromised individuals such as

those infected with HIV at greater risk of catching the bacterial infection which maybe

more severe. In the developing world children become immune within the first 2 years or

so due to much greater exposure to infection; therefore so far disease is not reported in

children of older ages and elders (Skirrow, 1991).

Campylobacteriosis results in diarrhea which is frequently watery or bloody. Patients

having symptoms like abdominal pain, fever, malaise, nausea and rarely, vomiting. The

infection is reported to have an incubation time of 1–10 days while most patients showing

symptoms on 4th day (Humphrey et al., 2007). Complications associated with

campylobacteriosis are rare. On the contrary, rheumatologic disorders like arthritis and

neuropathies like Guillain-Barré syndrome (GBS), are linked with post Campylobacter

jejuni gastroenteritis infections (Murray et al., 2007).

C. jejuni show wide variations in their usual habitat, that include poultry, birds, livestock

animals, domestic pets, wild animals and marine vertebrates. Nevertheless only a few

Campylobacter species are able to cause human gastroenteritis. Campylobacter disease is

particularly caused by Campylobacter jejuni (responsible for 95% of infections),

Campylobacter coli (responsible for 4% of infections). C. upsaliensis or C. lari (1%) are

among the less known species that also cause the infection. C. jejuni lives as a commensal

in the gut of poultry, cattle and other wild animals, but it is pathogenic in only humans,

therefore it is speculated that the organism expresses certain factors involved in virulence

after specific interaction with the human cells.

Developing countries are highly burdened by diarrheal illness, responsible for both

morbidity (6 to 7 episodes of diarrhea each child every year as compared with 1 or 2 in

developed countries) and mortality. In developed countries, deaths due to diarrheal disease,

are quite rare and the effects of these diseases are usually measured in financial terms

(Thapar and Sanderson, 2004).

Introduction

8

Several studies have also verified a strong correlation of the disease occurrence with

seasonality. In fact, seasonality is the distinguishing characteristic of epidemiology of

Campylobacter spp. In regions with temperate climates, the incidence peaks are seen in

late spring or early summer season. The exact reason for such a variation is not known but,

it is hypothesised that related factors such as climate, poultry animals, migratory wild birds,

companion animals and flies may influence disease incidence (Humphrey et al., 2007).

Campylobacteriosis is prominently a food-borne illness which involve foods of livestock

origin, especially poultry have an important role in causing disease. Raw meat is equally

contaminated by Campylobacter spp. Most frequently carcasses of poultry, whether freshly

cut or frozen are contaminated with C. jejuni (Blaser et al., 1984). Hamburgers, clams,

sausages and raw or undercooked beef are also involved in causing outbreaks of

campylobacteriosis. Improperly cooked barbecues and similar stuff pose important hazards

for infection, as these allow easy transmission of bacteria from raw meat to other foods and

hands, and from these sources to the gut of humans. Raw, unpasteurized or improperly-

treated milk and improper treated water are also implicated as sources of infection

outbreaks (Butzler, 2004). Campylobacter spp. can either be transmitted directly or

indirectly. In the direct route, occupation usually brings humans closer to such infections.

Slaughterhouse workers, veterinarians, poultry processors, farmers and butchers are at a

greater risk of Campylobacteriosis. Human population can be infected by contact with the

infected pets, like puppy, kitten, hamster, and turtle with Campylobacter diarrhea (Skirrow,

1991). Hence, general route taken in the indirect transmission by animals is by two

potential vehicles including poultry and red meat.

Campylobacteriosis is rampant in Pakistan, along with other developing countries.

According to a study conducted in Rawalpindi, Pakistan (2002) the isolation rate of C.

jejuni from diarrheal cases was 18% which was slightly higher than the previous study

conducted in Lahore, Pakistan from 1983-1989 (Ali et al., 2003). Surveillance in

impoverished areas of Karachi also found relatively high rates of Campylobacter infection

(Soofi et al., 2010). The bacterial pathogen was found to be prevalent in the two extreme

age groups, that is, among the infants and the elderly; this pattern of the incidence rate can

be related with the immune status of the individuals (Ibrahim et al., 2004). 72.22% of

Introduction

9

patients positive for C. jejuni infection suffered from abdominal cramps, 61% had fever,

and 39% individuals exhibited a combination of symptoms including loose motions,

vomiting and pain in the abdomen (Ali et al., 2003). The study in Rawalpindi also indicated

that majority of the children infected with C. jejuni had blood, mucous and pus in their

stools. In addition to this, another study carried out in Pakistan from January 2002 to

December 2004 pointed out the high prevalence of C. jejuni in food commodities especially

in raw or undercooked chicken (Hussain et al., 2007).

6. Environmental Prevalence

Poultry and undercooked meat are some of the main factors involved in transmission.

However, it has been reported that water and soil may be contaminated with

Campylobacter spp., possibly reflecting contamination of the environment with animal

excreta. Therefore, environment also can play an important role in disease spread. C. jejuni,

C. coli, and C. laridis were most prevalent campylobacters detected from the environment

(Bolton et al., 1987; Carter et al., 1987). Furthermore, C. jejuni can be found in sources of

natural water (Kemp et al., 2005) and soil (Jensen et al., 2006). Studies show that these

organisms can survive in feces, or those in water, soil, or milk, may survive for several

weeks when ambient temperatures are low (Blaser, 1982; Rollins and Colwell, 1986).

Moreover, C. jejuni may be found in diverse ecological niches and are able to survive and

replicate in harsh conditions of environment (Moen et al., 2005; Murphy et al., 2005).

Water is a likely major reservoir of campylobacters and is a proven medium for the

transmission of these organisms to humans and livestock. Water-related outbreaks of

campylobacteriosis have been reported from various regions of the world (Bolton et al.,

1987). Campylobacters were detected in 21 % or 43% of samples depending on isolation

method, from a river crossing rural and urban areas of England. The bacterial load was

highest in water adjacent to sewage works. Highest isolation rates were observed in autumn

and winter and lowest in spring and summer. However, Campylobacter number did not

demonstrate any significant correlation with microbiological (plate counts of fecal and total

coliforms, fecal streptococci, and heterotrophic bacteria) or physical (water temperature,

pH, and conductivity) parameters (Carter et al., 1987).

Introduction

10

Viable nonculturable form is an important factor when considering isolation and culturing

of C. jejuni from environmental sources, as the viability of culture decline after exposure

of bacteria to environmental stresses. It was described by Rollins and Colwell (1986) that

microcosms with aerated shaking, showed logarithmic reduction in revivable C. jejuni,

otherwise stationary cultures underwent an average rate of reduction to the nonculturable

state. Nonculturable state of Campylobacter spp. bears serious important epidemiological

consequences.

Introduction

11

Figure 1. Pathways of Campylobacter jejuni to human infection (Perko-Makela, 2011).

(a) Poultry is considered to be the main environmental reservoir of C. jejuni. The bacterium

efficiently colonizes chicken gastrointestinal tract, reaching high numbers and is spread via

the oral-fecal route in chicken flocks. (b) When C. jejuni enters a water supply, it can use

protozoans as vectors or more likely form biofilms that aid in its survival especially for

longer time periods. Humans can get infected through consumption of contaminated

products such as (c) poultry meat or (d) unpasteurized milk. In addition, infection can be

transmitted through the (e) environment via pets and wild animals or (f) travelling. Once

C. jejuni reaches the human gastrointestinal tract, it invades the epithelial layer and causes

inflammation and diarrhea.

Introduction

12

7. Treatment and Antimicrobial Resistance

Campylobacter infections particularly are the source of self-limited gastrointestinal

disease. Hence the principal therapy is to avoid dehydration. Antibiotic therapy is required

only in the acute and lasting infections. Additionally, some groups of infected people,

including young children, elderly patients, pregnant women and immunocompromised

patients should also be given treatment with antibiotics (Allos, 2001; Pacanowski et al.,

2008). In spite of the suggestions for the start of antibiotic therapy in previously healthy

individuals with chronic infections only; early clinical studies show that the best treatment

strategy involves antimicrobial therapy that is administered as soon as symptoms appear

(Anders et al., 1982). Fluoroquinolones including ciprofloxacin and levofloxacin, are

recommended for the treatment of acute gastroenteritis patients. In spite of the source of

the acquired infection, macrolides for example azithromycin are suggested for the therapy

of Campylobacter induced gastroenteritis in regions of the world where there is prevailing

fluoroquinolone resistance (Hakanen et al., 2003; Hill et al., 2006). Other antimicrobials

which are recommended for the treatment include tetracycline and amoxicillin (Moore et

al., 2005). In cases of severe infection the preferred antibiotic is carbapenem (Kerstens et

al., 1992; Lau et al., 2002; Fernandez-Cruz et al., 2010).

Campylobacters are inherently sensitive to various antibiotic agents comprising

fluoroquinolones, macrolides, aminoglycosides, tetracyclines, clindamycin and

nitrofurans. While campylobacters are reported to be moderately susceptibile to

cefotaxime, ceftazidime, cefpirome and chloramphenicol. C. jejuni and C. coli are reported

to be inherently resistant to most of the cephalosporins, penicillins and rifampicin,

sulfamethoxazole, trimethoprim and vancomycin. (Walder 1979; Vanhoof et al., 1982;

Fliegelman et al., 1985; McNulty 1987; Fitzgerald et al., 2008). Campylobacter spp. have

shown resistance to a high number of beta lactam antibiotic agents. However, the

susceptibility of others, for example ampicillin and some of the expanded-spectrum

cephalosporin antibiotics, have shown variations and are not apparently explained

(Wieczorek and Osek, 2013).

Introduction

13

8. Factors of Pathogenicity and Virulence of Campylobacter jejuni

For Campylobacter jejuni to establish a successful infection inside the host the presence of

certain virulence factors is crucial. Moreover, these virulence factors are essential for the

survival of the pathogen during the course of infection. Disease severity has also been

proven to be linked with the existence of certain virulence genes in C. jejuni (González-

Hein et al., 2013). These virulence factors such as adhesion and invasion factors, flagella

and cell adherence, lipooligosaccharide, lipopolysaccharide, enterotoxins, cytotoxins and

secretion systems are briefly discussed below.

8.1 Adhesion and Invasion Factors

Although C. jejuni lacks fimbriae, it may possess other adhesion factors. Bacterial adhesion

has been demonstrated by using cell lines such as HEp-2, HeLa and INT 407 cells

(McSweegan and Walker, 1986; McSweegan et al., 1987). The adhesion is disrupted by L-

fucose, asparagus pea lectin (which recognizes L-fucose determinants on cells), or partially

inhibited by other carbohydrates such as galactose, glucose, mannose, N-

acetylgalactosamine, N-acetylglucosamine, and non-sugar carbohydrate sorbitol, etc.

Adherence can also be inhibited partially by treating the bacterial cells with proteases or

glutaraldehyde (McSweegan and Walker, 1986).

The surface structure, such as outer membrane protein, lipopolysaccharide (LPS), and

glycocalyx materials, may be important components of adhesins (Walker et al., 1986). LPS

bound particularly to epithelial cells, and this occurrence was restricted by periodate

oxidation of LPS or fixation of the epithelial cells by glutaraldehyde. Besides, unlike

flagella, LPS was found to be sensitive to fucose and inhibits attachment of full bacterial

cells to the INT 407 cells. LPS has also got the ability of binding to intestinal mucus

(McSweegan and Walker, 1986). LPS of Campylobacter spp. are immunologically related

to members of Enterobacteriaceae, Vibrio cholerae and Pseudomonas aeruginosa, and.

This is due to the fact that antisera to the Campylobacter strains recognize core

determinants of some LPS preparations from these bacteria (Perez-Perez et al., 1986).

Introduction

14

8.1.1 Flagella

Most Campylobacter species have amphitrichous (bipolar) flagella to promote infection, a

unique flagellar pattern amongst bacteria with polar flagella. Flagellar movement of C.

jejuni is a major factor for colonization and virulence factor which is considered to be

needed for causing human infection resulting in diarrheal illness and in many host animals

it assists in commensalism (Black et al., 1988; Nachamkin et al., 1993; Hendrixon and

DiRita, 2004). The components of flagellum of C. jejuni are basal body, hook and filament.

Two proteins i.e. FlaA and FlaB constitute flagellar filament (Konkel et al., 2004).

Presence of certain adhesins for epithelial cells has been reported in flagellum of C. jejuni,

since non-flagellated variant adhered poorly to cells. However, non-flagellated organisms

still attach to host cells to some extent, suggesting the possibility of involvement of

multiple adhesins (Walker et al., 1986). Bacterial adhesion is reduced by the shearing of

bacterial cells for the removal of flagella, whereas adhesion is increased by immobilization

with Potassium Cyanide (KCN) of the flagellum. Purified flagella have been shown to

specifically, fucose-resistant binding to the epithelial cells but not in the case of intestinal

mucus (McSweegan and Walker, 1986). Some adhesions are stable after heating at 100oC

for 30 min.

Flagellum has been proposed to be crucially involved in adhesion to the epithelial cells. C.

jejuni flagellin acts as an adhesin and helps in the binding to the epithelial cells and

colonization of the intestinal tract. Typing studies based on FlaA gene have been widely

performed for the identification of C. jejuni and C. coli strains isolated from environment

(Bhavsar and Kapadnis, 2007). Champion and coworkers demonstrated that a non-

livestock clade comprised of 55.7% C. jejuni isolates from clinical cases that showed

absence of the flagellin O-glycosylation locus encoding cj1321-cj1326 genes. Moreover,

such cj1321-cj1326-deficient strains tracked to be mostly from the environment and

asymptomatic carriers (Champion et al., 2005). Hence, flagellin O-glycosylation may be

involved in the cell invasion, and hence increases virulence potential (Zautner et al., 2012).

Introduction

15

8.1.2 Cell Adherence

An outer membrane protein that serves the role of an adhesin is known as CadF which

binds with fibronectin present in the extracellular matrix of mammalian cells, thereby

helping C. jejuni in attachment to intestinal epithelial cells (Konkel et al., 1999).

Capsule of C. jejuni serves as an adherence factor. Heptose residues found in some cell

surface-located glycoconjugates are found to be required for adhesion hence heptose

residues in the capsule are significant virulence factors (Karlyshev et al., 2005).

jlpA, is a surface-exposed species-specific lipoprotein A which also serves as an adhesion

factor that promotes adhesion to the epithelial cells (Scott et al., 2009). porA of C. jejuni

is a major outer membrane protein. It is putative porin and a surface protein with various

functions, also plays significant role in adhesion (Zhang et al., 2000). An

aspartate/glutamate-binding protein, Peb1 of an ABC transporter in C. jejuni enhances

bacterial adhesion and invasion of host cells, therefore serves as a cell-binding factor

(Leon-Kempis et al., 2006). Adhesin, fibronectin-like protein A (FlpA), has been lately

identified that is important for complete binding ability and colonization to the chicken

epithelial cells (Flanagan et al., 2009).

8.2 Lipooligosaccharide (LOS)

The cell wall of C. jejuni, being a Gram-negative bacterium, has three layers, an outer layer

of lipoprotein, a middle layer of lippolysaccharide (LPS) and an inner layer of

mucopeptide (Bhavsar and Kapadnis, 2007). Lipooligosaccharide (LOS) is homologous

to lipopolysaccharide (LPS) found in some Gram-negative bacteria. LOS have similar

structures of lipid A as well as similar functional activities like LPS. LOS is marked by the

absence of O-antigen units as LOS oligosaccharide structures have upto 10 saccharide

units. One unique feature of LOS is the striking similarity, in structure and antigenic

properties, with the human glycolipids (Preston et al., 1996). It was indicated that a

sialylated lipooligosaccharide (LOS) of the cell wall of Campylobacter spp. is linked to

intensified development of bloody diarrhea and prolonged symptoms (Zautner et al., 2012).

An important role in the pathogenesis of GBS is played by the molecular mimicry between

Introduction

16

lipooligosaccharides (LOS) in the cell wall of C. jejuni and gangliosides in the peripheral

nerves (Godschalk et al., 2004). Van Belkum et al. (2001) showed that a sialyltransferase

encoded by the cst-II gene in C. jejuni is linked with a higher risk of developing GBS, and

it had been confirmed by later studies (Nachamkin et al., 2002; Koga et al., 2006).

8.3 Lipopolysaccharide (LPS)

Lipopolysaccharide (LPS) is a large component of the surface of outer membrane of gram-

negative bacteria. LPS consists of three distinct sections; 1) lipid A moiety attached to the

outer membrane, the endotoxic part of LPS; 2) core is the second part, binded to the lipid

and 3) last part is the O antigen, connected to the outer core. LPS molecule

of Campylobacter spp. is involved in the adhesion process and play an important role in

antigenic differentiations, as Campylobacter spp. has the potential to rearrange the LPS

antigenic constitution. Surprisingly core oligosaccharide is marked by the presence of N-

acetyl neuraminic acid (sialic acid), which is not commonly found in the prokaryotes.

These sialic acid residues when attached to the D- galactosidase appear structurally like

gangliosides. This molecular mimicry is implicated in autoimmune neuropathological

diseases like Miller-Fisher Syndrome and Guillains Barre' Syndrome which consequently

may result in the death of patient. The galE gene is associated with the synthesis of LPS

and thereby contributes to bacterial virulence (Fry et al., 2000).

8.4 Enterotoxins

Enterotoxins are known to be produced by diarrheal bacterial pathogens like Vibrio

cholera, Escherichia coli, Shigella dysentriae. The question of whether C. jejuni produces

enterotoxin has been controversial. Cytotonic efficacy of Campylobacter cultures have

been demonstrated in CHO and Vero cells, GM1 ELISA, and accumulation of cyclic AMP

in the cells on exposure to filtrates of bacterial culture. Limited neutralization of

enterotoxin of C. jejuni has been demonstrated by treatment with antitoxins to cholera toxin

and heat-labile enterotoxin of E. coli (Honda et al., 1986; Johnson and Lior, 1986;

Lindblom et al., 1989). According to a study, 32% Campylobacter strains from both

humans with symptoms of acute enteritis and healthy laying hens were enterotoxigenic and

Introduction

17

there was no significant correlation between enterotoxin production and the presence of

heat-stable and heat-labile antigens (Lindblom et al., 1989).

C. jejuni produces enterotoxins which is related to the heat-labile enterotoxins of E. coli.

The B subunits of C. jejuni enterotoxin is active and its immunological characteristics and

show resemblance to B subunits of cholera toxin and heat-labile toxin (LT) of E. coli. It

exhibits partial homology to the B subunits of cholera toxin and LT in the gel

immunodiffusion assay and appears to be more proximally immunologically related to the

B subunit of LT than to the B subunit of cholera toxin. Studies have shown that rat

immunization with B subunit of LT show significant protection against challenge with

either semipurified toxin of C. jejuni or viable enterotoxigenic C. jejuni strain. The B

subunit of C. jejuni toxin reacts with the GM1 ganglioside in ELISA, but lacks the

cytotonic effect of holotoxin in CHO tissue culture and failed in the triggering fluid

secretion in the rat ileal ligated loops (Klipstein and Engert, 1984).

The enterotoxin of C. jejuni may have cytotoxic effect as well and cytotoxicity was

detected in 48% of human isolates as assayed by the cytopathic effect on HeLa cells. The

cytotoxin producing C. jejuni strains developed bacteremia and diarrhea associated with

severe watery mucus in the removed intestinal tie adult rabbit diarrhea assay (Pang et al.,

1987). Some studies have demonstrated the production of enterotoxin from C. jejuni strains

(Florin and Antillon, 1992) and some failed to demonstrate enterotoxin production (Perez-

Perez et al., 1989; McFarland and Neill, 1992). Although much work was carried out to

isolate and characterize the enterotoxic protein(s) and to correlate its activity with

pathogenicity, a number of investigators questioned the expression of a CT/LT-like

enterotoxin by C. jejuni and C. coli (Wassenaar, 1997).

8.5 Cytotoxins

In order to induce enterocolitis C. jejuni needs invasion of the epithelial cells and produce

a toxin called cytolethal distending toxin (CDT). Three subunits constitute CDT: CdtB,

catalytic subunit, which is encoded by the cdtB gene, and exhibits DNase I-like activity,

while CdtA and CdtC serve as binding proteins for the transport of CdtB into the target

cells. Both CdtA and CdtC bind with specificity to the surface of HeLa cells, whereas CdtB

do not bind specifically (Lee et al., 2003). Genotoxic effects on the host DNA are induced

Introduction

18

by the translocation of the CdtB to nucleus, which causes a rapid and apparently

irreversible block in G2 phase of cell cycle and eventual cell death (Whitehouse et al.,

1998). C. jejuni has ability to extensively replicate in human monocytic cell vacuoles and

induction of apoptotic cell death by cytolethal distending toxin (Hickey et al., 2005). In

addition it has also recently been suggested that CDT may play an important role in

adhesion and invasion potential of C. jejuni (González-Hein et al., 2013).

9. Bacterial Secretion System

Protein synthesis and transport across various cell membranes are very crucial for the

survival of all types of cells and this process in prokaryotes is referred to as protein

secretion (Coulthurst, 2013). Gram negative bacteria have established at least six different

protein secretory systems for translocation of the proteins into the periplasm or outside of

the cell (Bleumink-Pluym et al., 2013). A particular bacterium will have one or more forms

of one or more types of system, subjecting to its niche and condition. Up till now there are

reports of T3SS, T4SS and more recently T6SS in C. jejuni.

9.1 Type III Secretion System

C. jejuni is marked by the absence of a specialized T3SS and flagellar apparatus is the only

T3SS in this pathogen (Parkhill et al., 2000) which is required for the secretion of proteins

involved in infection process which are known as Campylobacter invasion antigens (Cia).

Acute infection requires Cia protein-mediated maximum invasion of the host

gastrointestinal epithelial cells by C. jejuni (Konkel and Cieplak, 1992; Konkel et al.,

2004). A schematic representation of T3SS is shown in Figure 2 (Sato and Frank, 2011).

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2764114/#b36




Introduction

19

Figure 2. Schematic diagram of the T3SS apparatus (Sato and Frank, 2011)

Introduction

20

9.2 Type IV Secretion System

C. jejuni contains pVir, a 37-kb plasmid possessing 54 predicted ORFs, which contain

genes for the homologs of Com and Vir proteins of type IV secretion system. It is

implicated in the microtubule (MT)-dependent invasion pathway of C. jejuni (Bacon et al.,

2000; Kienesberger et al., 2011).

9.3 Type VI Secretion System

Type VI secretion system (T6SS), which has been most recently identified in Gram

negative bacteria, aids in the survival of the pathogen in many different ways, that is, it

plays a role in pathogenicity, symbiotic relationship, confers selective advantage over other

competing microbes, and protects from environmental stress (Lertpiriyapong et al., 2012).

As a result of this, T6SS positive bacteria are able to occupy a wider range of habitat. The

T6SS has also been involved in adaptation to low temperature and high osmolarity, stress

and quorum sensing, motility and bacterial growth, biofilm formation (Aubert et al., 2008),

and killing of competetive bacteria and protozoa via secretion of the effector toxic proteins

(Russell et al., 2011; Zheng et al., 2011). Depiction of T6SS in the intestine during

infection is shown in Figure 3 (Russell et al., 2014).

Introduction

21

Figure 3. Role of bacteria harboring T6SS in the mammalian intestines (Russell et

al., 2014). T6SS might be utilized by the invading pathogens (left, intestinal close-up) or

blocking the invading pathogens by commensals (right, intestinal close-up,).

Introduction

22

9.3.1 T6SS Gene Cluster

T6SS is a nanomachine consisting of at least thirteen constituents developing injectisomes

that resemble structurally to an inverted Escherichia coli bacteriophage T4 (Boyer et al.,

2009). These core components have been given name of TssA-TssM, however other names

such as Hcp, are used commonly. Schematic depiction of the general model of T6SS

assembly as shown in Figure 4 (Shneider et al., 2013). Gene clusters of T6SS are simply

recognizable on the rationale that all of them have 13 conserved genes, which are thought

to encode the proteins constituting the key secretion machinery (Coulthurst, 2013). The 13

core components i.e. TssA-TssM form a large molecular apparatus stretching from

cytoplasm of bacteria, through the inner membrane, periplasm and outer membrane and

subsequently into the target cell. Arrangement of the T6SS genes in Campylobacter jejuni

strain 414 (Accession number: ADGM01000000) is shown in Figure 5 (Harrison et al.,

2014). A considerable increase in the number of identified T6SS effector proteins has been

led by the latest studies and a more comprehensive and subtle perspective of the adaptive

significance of this system (Basler et al., 2013; Decoin et al., 2014; Russell et al., 2014;

Whitney et al., 2014).

9.3.2 T6SS Association with Virulence

Recently the presence of T6SS has been reported in C. jejuni (Lertpiriyapong et al., 2012)

and has proved to be associated with survival capacity in the bile salts along with cell

adherence, virulence, cytotoxicity of red blood cells and colonization of mouse

(Lertpiriyapong et al., 2012; Bleumink-Pluym et al., 2013). C. jejuni 108 strain (Accession

number: JX436460) harbors a 17-kb gene cluster of T6SS comprising of 13 T6SS

conserved genes, adding the hallmark genes hcp and vgrG of T6SS (Bleumink-Pluym et

al., 2013). Additionally, C. jejuni 414 strain (Accession number: ADGM01000000) and C.

jejuni ATCC 33560 strain (Accession number: NZ_AIOL00000000) have also been found

to be positive for the presence of T6SS. The presence of such a system in these bacteria

has resulted in the formation of hypervirulent strains which are also referred as the T6SS

positive strains (Harrison et al., 2014).

Introduction

23

Figure 4. Schematic representation of the general model of T6SS assembly (Shneider

et al., 2013)

Introduction

24

Figure 5. Gene arrangement of T6SS cluster in Campylobacter jejuni 414 (Harrison et

al., 2014). Genes are plotted as arrows in order of their genomic positions. Arrow

orientation specifies the strand; forward arrows specifying genes on the positive strand and

reverse arrows specifying genes on the negative strand.

Introduction

25

10. Aims and Objectives

Fewer studies have been reported on Campylobacter jejuni from Pakistan and more

importantly on group clustering and presence of T6SS in C. jejuni worldwide. Therefore,

aim was to determine isolation frequency of C. jejuni strains from human diarrheal, cattle,

poultry and waste-water sources, isolated from main cities of Pakistan i.e. Lahore, Karachi,

Islamabad, Peshawar and Gilgit; their antibiotic resistance profiling; strain grouping and

screening of novel virulence factor T6SS among this C. jejuni isolates collection.

The study would be helpful for determining the potential reservoir sources of C. jejuni,

their antibiotic resistance, their association with T6SS and ultimately its role in public

health.

Chapter 1

26

Chapter 1

Chapter 1

27

Chapter 1

Isolation Frequency and Antibiotic Susceptibility Profiles of

Campylobacter jejuni Isolates from Diverse Sources in Pakistan

1.1 Abstract

Campylobacter jejuni is the main causative agent of campylobacteriosis in humans. It can

be isolated from poultry (its major source), cattle and waste water. The goal of this

investigation was to assess the frequency of contamination by C. jejuni and to

characterize the antibiotic resistance of C. jejuni strains isolated from human diarrheal

specimens, poultry (chicken), cattle and wastewater sources in Pakistan. The samples

were collected from five different cities i.e. Islamabad, Karachi, Lahore, Peshawar and

Gilgit. Overall 250 clinical diarrheal samples, 340 poultry samples, 570 cattle samples

and 145 wastewater samples were collected, then analyzed according to growth on

selective media for Campylobacter spp., biochemical confirmation and PCR confirmation

of 16S RNA and hipO genes of C. jejuni. Susceptibility to antibiotics was determined

according to the guidelines of the CLSI 2010 by disc diffusion method. Beta lactamase

activity was determined by Nitrocefin method. C. jejuni strains were isolated from 13.6

% clinical diarrheal samples, 46.47 % poultry samples, 21.40 % cattle samples, and 22.06

% wastewater samples. In clinical isolates, highest rates of resistance were noticed for

nalidixic acid (98 %), ceftriaxone (87 %) and erythromycin (78 %). In poultry isolates,

100 % resistance rates were noticed for nalidixic acid, ceftriaxone and erythromycin. In

cattle isolates, highest antibiotic resistance rates were noted for ceftriaxone (75 %),

nalidixic acid (70 %) and erythromycin (65 %). In wastewater isolates, 100 % resistance

rates were noticed for nalidixic acid, ceftriaxone and sulphmethoxazole+trimethopterim.

Most sensitive antibiotics were found to be chloramphenicol and spectinomycin. Beta

lactamase activity was detected in 35 % clinical isolates, 57 % poultry isolates, 39 %

cattle isolates and 32 % wastewater isolates. Our results showed a high isolation

frequency of C. jejuni with multidrug resistance profiles in clinical diarrheal, poultry,

cattle and wastewater sources of Pakistan. The results stress that the risk of human

contamination throughout the food chain is very high, which may generate (1) a danger

of food poisoning by ingestion of contaminated chicken and cattle meat and meat

Chapter 1

28

products and exposure to wastewater sources and (2) cross resistance to antibiotics

between humans and poultry or cattle or wastewater strains.

1.2 Introduction

The studied occurrence of Campylobacter infections has greatly heightened in the

developed world within the period of last 20 years (WHO, 2009). Under-reporting of

Campylobacter infections is a problem in various countries and the occurrence rates only

indicate the number of cases that have been confirmed by laboratory. The actual rate of

infection is believed to be higher than the number of cases reported (from 7.6 to 100

times higher) (Mead et al., 1999; Samuel et al., 2004). Cases are reported to be caused by

Campylobacter jejuni and to a lower degree by Campylobacter coli (Anon, 2006).

Majority of Campylobacter infections are categorized as sporadic infections. The true of

load of human Campylobacter infection is not investigated for majority of the developing

countries, as the national surveillance is restricted in these countries. Although, it is

predicted that the rate of Campylobacter infections is highest among children below age

of 5 years (Coker et al., 2002), which cause marked morbidity and a lower mortality rate.

Campylobacter jejuni is now the major cause of zoonotic enteric infections in many

developed and developing countries (WHO, 2000). Most human Campylobacter cases are

categorized as single sporadic cases or as a part of minor outbreaks. Laboratory based

surveillance studies have given estimates for the incidence in developing world i.e. from

5 to 20% for the general population (Coker et al., 2002). Case control community based

studies have yielded estimates of 40,000 - 60,000 /100,000 population of children under

age of 5 years of age, thus establishing campylobacteriosis a pediatric disease in the

developing world (Coker et al., 2002). Incidence is much higher in the developing

nations due to poor water and sanitary conditions and mishandling of food. In developed

world, Campylobacter infections are predominantly sporadic and noticed during the

warm months of the summer and in autumn, and propose a seasonal variation. In

developing countries, knowledge is sparse on the seasonal pattern of campylobacteriosis.

There is insufficient population based information about the frequency of Campylobacter

infections in Pakistan. Campylobacteriosis is rampant in Pakistan, along with other

developing countries. According to a study conducted in Rawalpindi, Pakistan (2003) the

Chapter 1

29

isolation rate of C. jejuni was 18% which was slightly higher than the previous study

conducted in Lahore, Pakistan from 1983-1989 (Ali et al., 2003). 72.22% of patients

positive for C. jejuni infection suffered from abdominal cramps, 61% had fever, and 39%

individuals showed a mixture of symptoms of vomiting, loose motions and abdominal

pain (Ali et al., 2003). The study in Rawalpindi also indicated that majority of the

children with C. jejuni had blood, mucous and pus in their stools. The bacterial pathogen

was found to be prevalent in the two extreme age groups, that is, among the infants and

the elderly; this pattern of the incidence rate can be related with the immune status of the

individuals (Ibrahim et al., 2004). Surveillance in impoverished areas of Karachi also

found prevalence rate of Campylobacter infection i.e. 29/1000 year in children under 5

years (Soofi et al., 2011). In addition to this, another study carried out in Pakistan from

January 2002 to December 2004 pointed out the high incidence of C. jejuni in food

commodities especially in raw or undercooked chicken (Hussain et al., 2006).

C. jejuni is primarily linked with the poultry (Anon, 2006), but it has also been isolated

from sheep, cattle, goats, cats and dogs (Anon, 1999; Anon, 2006). The chief reservoir of

pathogenic Campylobacter spp. is the gastrointestinal tract of wild and livestock animals

and birds. Campylobacter jejuni is frequently found in broilers, sheep, cattle, pigs, wild

animals, birds and dogs (Anon, 2006). Water plays an important role in the ecology of

Campylobacter jejuni. Campylobacter jejuni has been detected in rivers, lakes and

surface water, at incidence rate of approximately 50% (Kapperud et al., 2003).

Campylobacter jejuni is injected into water bodies by faeces and sewage from

nonlivestock mammals and birds.

Resistance to antimicrobials may increase the public health burden of

campylobacteriosis. Since, Campylobacter jejuni can be transferred from food animals to

human beings, there are increased chances of antibiotic resistant organism in normal

community. The commonly used antimicrobials against Campylobacter infection include

fluoroquinolones, macrolides and tetracycline. Patients with Campylobacter jejuni

isolates resistant to quinolones have been shown to have a longer duration of diarrhea

(Engberg et al., 2004; Nelson et al., 2004) and quinolone resistant Campylobacter

infections have been associated with high frequency of hospitalization and an increased

risk of adverse health events and death (Helms et al., 2005; Nelson et al., 2007). As

Chapter 1

30

chicken is the likely source of campylobacteriosis for humans, it is plausible that isolates

resistant to antimicrobials originating in poultry could pass through the food chain to

humans (Endtz et al., 1991; Aarestrup et al., 1999; Saenz et al., 2000). Both agricultural

and human antimicrobial use may be risk factors for human infection with resistant

strains. Prevalence rates of antibiotic resistance in Campylobacter species have

augmented over the past fifteen years around the globe, particularly to fluoroquinolones,

which are important for the therapy of campylobacteriosis (Endtz et al., 1991; Engberg et

al., 2001; Moore et al., 2006; Smith and Fratamico, 2010). There are significant

evidences in the last ten years of macrolide resistance among Campylobacter isolates

from poultry, human and environment (Gibreel and Taylor, 2006). Other than

flouroquinolones and macrolides, commonly used antibiotics such as tertracycline,

aminoglycoside, chloramphenicol and beta-lactam antibiotics also become useless for the

treatment of this organism, which has made the organism MDR (Lehtopolku et al., 2010;

Pollett et al., 2012). Resistance to ampicillin and other β-lactam agents has been widely

reported among Campylobacter spp. particularly isolated from poultry and humans. β-

Lactamase-producing C. jejuni isolated from humans have been shown to be

significantly less susceptible to ampicillin, amoxicillin (amoxicillin), and ticarcillin than

β-lactamase-negative strains. Other workers have shown that β-lactamase production

in C. jejuni is associated with resistance to ampicillin and amoxicillin (Griggs et al.,

2009). In general, the majority of thermotolerant Campylobacter spp. are resistant to a

large number of β -lactam antimicrobial agents. However, the behaviors of others, such as

ampicillin and some of the expanded-spectrum cephalosporins, are variable and not very

clearly defined (Tajada et al., 1996). Antibiotic susceptibility patterns and beta-lactamase

production of campylobacters vary from one country to another.

In Pakistan, use of antibiotics particularly quinolones in agriculture and livestock sectors

is common which not only results in high resistance rate in poultry but also in human

isolates. An 11 year study from Pakistan reported gradual increase in resistance rates

against ampicillin, ofloxacin and tetracycline in human Campylobacter isolates (Ibrahim

et al., 2004). To circumvent the increased rate of antibiotic resistance, it is important to

limit and control the factors involved in the transmission of organism as well as

prevention of unnecessary use of antimicrobials in clinical and veterinary fields.

http://www.ncbi.nlm.nih.gov/pubmed?term=Lehtopolku%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20038624

Chapter 1

31

This chapter reports the results of the frequency of isolation of C. jejuni in different

sources from Pakistan. Additionally antibiotic resistance patterns were determined among

C. jejuni isolated from diverse sources.

The goals were 1) to determine isolation frequency of C. jejuni strains from human

diarrheal, cattle, poultry and waste-water sources, isolated from main cities of Pakistan

including Lahore, Karachi, Islamabad, Peshawar and Gilgit 2) to determine the trends in

antibiotic resistances and beta-lactams among diverse C. jejuni isolates.

1.3 Materials and Methods

1.3.1 Sample Collection

This study was carried out from October 2010 to October 2013. The samples were

randomly collected from poultry farms and chicken retail shops, cattle farms, wastewater

sources and human clinical diarrheal cases from Islamabad, Peshawar, Lahore and

Karachi. A total of 1325 samples collected consisting of 340 poultry fecal samples, 570

cattle fecal samples, 145 wastewater samples and 250 human diarrheal fecal samples.

Human fecal samples were collected from suspected cases of gastroenteritis that included

both bloody and non-bloody diarrhea cases. The study was approved by Ethical Review

Committee of COMSATS Institute of Information Technology, Islamabad. Fecal samples

were collected in sterile cotton swabs carrying Carry-Blair medium and delivered to

Microbiology Laboratory of COMSATS Institute of Information Technology, Islamabad.

All samples were stored at 4ºC till being analyzed in no more than 24 hrs of collection.

1.3.2 Culturing Method for Detection of Campylobacter jejuni

The fecal samples collected were streaked on modified charcoal cefoperazone

deoxycholate agar (mCCDA) (Oxoid, CM0739) containing CCDA selective supplement

(Oxoid, SR0155). Samples were incubated in 2.5 liters airtight jar along with campygen

sachets (Oxoid, CN025A) to generate microaerophilic condition at 42 °C for 48-72 hours.

Suspected watery, translucent Campylobacter spp. colonies were further sub cultured on

muller hinton agar (Oxoid, CM0337) accompanied by addition of 5% sheep blood

Chapter 1

32

(Aydon et al., 2001). Strains were stored at -80ºC in brain heart infusion broth (Oxoid,

CM11035) including 20% glycerol.

1.3.3 Biochemical Identification

Positive growth of Campylobacter jejuni isolates was further subjected to standard

biochemical tests consisting of oxidase, catalase, indoxyl acetate and hippurate

hydrolysis. In the case of Indoxyl-acetate test, change of colour from colourless to blue

green indicated that Campylobacter spp. is present and in case of hippurate hydrolysis,

development of blue/purple colour in hippurate solution indicated positive reaction for

presence of Campylobacter jejuni with the production of hippuricase enzyme and clear or

grey coloration indicate negative reaction for its presence. A positive test for all the four

reactions is indicative of C. jejuni (Chaban et al., 2010).

1.3.4 PCR Technique for the Detection of Campylobacter jejuni

1.3.4.1 DNA Isolation

DNA was extracted using phenol-chloroform method. The steps of DNA extraction are

described below.

Colonies from fresh C. jejuni growth were picked with sterile cotton swab and dissolved

in 1 mL PBS in 1.5 mL eppendorf tube and centrifuged for 2 minutes at 4659 x g.

Supernatant was removed, 400 µL of NaCl+Tris+EDTA (STE) added, pipetted for proper

mixing and centrifuged again at 4659 x g for 2 minutes. This step of addition of STE to

supernatant and centrifugation was repeated twice. The supernatant was removed, 200 µL

of TE added, vortexed and 100 µL of Tris saturated phenol added vortexed for 1 min to

mix properly. The reaction mixture was centrifuged at 12,300 x g for 5 minutes and 100

µL of chloroform was added. Centrifugation was performed at 12,300 x g for 5 minutes

at 4 ºC. Upper phase was carefully aspirated with pipette, without disturbing the lower

phase. 50 µL TE+ 100 µL chloroform was added and centrifuged at 12,300 x g for 5

minutes. Step of washing of the upper phase with TE and choloroform was performed

thrice. Upper phase was transferred to sterile eppendorff tube. Purified gDNA was stored

at -20 ºC.

Chapter 1

33

1.3.4.2 PCR Technique and Amplification

Campylobacter jejuni was detected in the samples based on the amplification of 16S

rRNA gene and hippurate hydrolysis gene utilizing two different sets of oligonucleotide

primers (Cardarelli et al., 1996)

The set of primers used for detection of 16S rRNA gene:

MDS-F 5`-ATCTAATGGCTTAACCATTAAC-3`

MDS-R 5`-GGACGGTAACTAGTTTAGTATT-3`

The set of primer used for detection of hippurate hydrolysis gene (Persson et al., 2005)

are:

hipO –F 5`-GACTTCGTGCAGATATGGATGCTT-3`

hipO -R 5`-GCTATAACTATCCGAAGAAGCCATCA-3`

All primers were manufactured by Alpha DNA (Montreal, Quebec). The PCR conditions

were followed as described by Cardarelli et al., 1996 and Persson et al., 2005). Briefly,

the PCR amplification reaction was performed in 25 μL reaction volumes comprising 5

μL of the DNA, 4 μL PCR buffer (Fermentas, Lithuania, UAB), 0.5 μL of dNTPs mix

(200 µM of each of dNTPs) (Fermentas, Lithuania, UAB), 3 μL (2.5mM) of MgCl2

(Invitrogen), 2.5 μL (50 pmol/µL) of each primer, 0.25 U of Taq DNA polymerase

(Fermentas, Lithuania, UAB), rest of the volume was made with nuclease free water. The

PCR was carried out in a MJ MiniTM Thermocycler (Bio-Rad, PTC-200; MJ Research

Inc., Watertown, MA, USA). Conditions of amplification were initial denaturation of

94ºC for 5 min, proceeded by 30 cycles of denaturation at 94ºC for 1 min, annealing at

(55ºC for 16S rRNA); (59 ºC for hipO) for 45 sec, and elongation step at 72ºC for 1 min,

followed by final extension at 72ºC for 10 mins. Strain Campylobacter jejuni 11168 was

employed as a positive control in the PCR assays and nuclease free water was utilized as

a no template control. PCR products along with the positive and negative controls were

resolved by loading onto 1.5% agarose gel containing 0.05 % ethidium bromide. Agarose

gels were given a run at 100V for 40 mins. 5 µL of PCR product along with 2 µL of 6X

loading gel buffer (Fermentas, Lithuania, UAB) was loaded into each well. 100 bp DNA

ladder (Fermentas, Lithuania, UAB) was used to determine the sizes of the PCR products

and BDA digital gel documentation system (Core Life Sciences, CA) was used for

visualizing the gels and gels were photographed under UV light.

Chapter 1

34

1.3.5 Antibiotic Sensitivity Analysis

Antibiotic sensitivity profiles of C. jejuni isolated from diverse sources were assessed by

Kirby-Bauer disc diffusion method. Beta lactamase detection in C. jejuni isolates was

detected by nitrocefin method. Details of these methods are described below.

1.3.5.1 Kirby-Bauer Disc Diffusion Assay

The rational to carry out antibiotic susceptibility was to determie the occurrence and

current status of antibiotic resistance among C. jejuni strains isolated from poultry,

human gastroenteritis cases, cattle isolates and waste water isolates from the surrounding

environments. Antibiotic susceptibility of characterized C. jejuni isolates (n= 351) to

commonly prescribed antibiotics in gastroenteritis cases and antibiotics used in poultry

and veterinary settings was checked by Kirby–Bauer disc diffusion method. Escherichia

coli ATCC 25922, with known antimicrobial susceptibility, was used as the positive

control for each of the antibiotics used. Tested antibiotics included C-chloramphenicol

(30 µg), TE-tetracycline (30 µg), S-streptomycin (10 µg), CIP-ciprofloxacin (5 µg),

AMP-ampicillin (30 µg), NA-nalidixic acid (30 µg), ERY-erythromycin (30 µg), CN-

gentamycin (10 µg), SXT-sulphomethoxazole + trimethoprim (25 µg), CTX,-cefotaxime

(30 µg) and CRO-ceftriaxone (30 µg). The assay was performed using 48 hrs grown

culture on muller hinton agar containing 5% sheep blood. Briefly, bacterial suspension

made in sterile PBS solution with the density standardized to the 0.5 McFarland turbidity

standards was coated with the help of sterile cotton swab over the surface of agar plate to

set up an even bacterial lawn. Antibiotic discs were set down over bacterial lawn and

plates were set for incubation subjected to microaerophilic conditions as described above

for 48 hours. Antibiotic susceptibility was determined by measuring the growth inhibition

zone around each disc. A zone of inhibition with diameter > 13 mm was considered

breakpoint for susceptibility whereas diameter between 10 and 13 mm as an intermediate

and less than and equal to 10 mm as the resistant. Confirmation of the breakpoints for

sensitivity was conducted as per guidelines of CLSI 2010.

Chapter 1

35

1.3.5.2 Nitrocefin Method

Beta lactamases in C. jejuni isolates were detected by modified nitrocefin method

(Lachance et al., 1993). Briefly, strains were analyzed in micro wells which contained

0.05 ml of the bacterial cell suspension, adjusted to approximately 0.5 McFarland

turbidity standard, in phosphate buffer (0.05 M; pH 7.0) was added to 0.05 ml of

nitrocefin (Glaxo Research, 87/312) (Oxoid, SR0112). A positive test was indicated when

a red color was developed within 30 min. Lack of development of a red color after 30

minutes was regarded as a negative test.

1.4 Results

1.4.1 Confirmation of Isolates as Campylobacter jejuni

Samples from different sources positive for catalase, oxidase, indoxyl acetate and

hippurate hydrolysis test were presumptively regarded as C. jejuni. Further confirmation

was inferred on the presence of 16S rRNA and hipO genes in these isolates. On the basis

of these confirmatory PCRs, 34 human diarrheal including 14 bloody diarrheal cases, 158

chicken, 122 cattle and 32 wastewater samples were regarded positive for the presence of

C. jejuni. Figure 1.1 shows amplified products of 16S rRNA and hipO genes.

Chapter 1

36

A

B

Figure 1.1 (A) Isolates positive for 16s rRNA (B) for hipO gene. PCR of 16S RNA and

hipO for genus and species confirmation. Lane 1- 1 kb ladder, Lane 2- 9, Isolates positive

for 16s rRNA and hipO genes; Lane 10- Positive control (NCTC 11168); Lane 11- No

template control.

Chapter 1

37

1.4.2 Isolation Frequency of C. jejuni in Different Sources

Among 1325 tested samples from diverse sources, 346 were found to be positive for the

presence of Campylobacter jejuni, which represent an overall prevalence rate of 26.11 %.

C. jejuni were isolated in 13.6 % (n = 34) of clinical diarrheal samples, 46.47 % (n = 158)

of poultry samples, 21.40 % (n = 122) of cattle samples and 22.06 % (n = 32) of waste

water samples (Table 1.1). Occurrence of C. jejuni among human diarrheal samples was

relatively higher in Gilgit (20 %) as compared to Islamabad (17.64 %), Lahore (16.66 %),

Karachi (10 %) and Peshawar (10 %). Highest isolation rates of C. jejuni were observed

in poultry samples. The isolation rates from Islamabad, Karachi, Lahore, Peshawar and

Gilgit were 56.66 %, 41.66 %, 41.66 %, 36 % and 25 % respectively. This indicates

highest isolation frequency among poultry samples from Islamabad and similar

prevalence rates from Lahore and Karachi. Isolation frequency of C. jejuni in cattle

samples was highest in Lahore (25 %) followed by Peshawar (20.83 %), Karachi (20.68

%) and Islamabad (20 %) and Gilgit (16.66 %). Among wastewater samples, highest

prevalence of C. jejuni was observed in samples from Islamabad (25 %) followed by

Lahore (24%), Peshawar (23.33%), Karachi (20 %) and Gilgit (15%).

Poultry being the most potential reservoir for C. jejuni, as expected, highest isolation rate

of C. jejuni was observed in poultry samples followed by wastewater, cattle and clinical

samples from different cities (Figure 1.2).

Chapter 1

38

Table 1.1 Isolation rates of Campylobacter jejuni in investigated different sources.

Sources Humans Poultry Cattle Wastewater

City No. of

positive/total

no. of samples

(%)

No. of

positive/total

no. of samples

(%)

No. of

positive/total

no. of samples

(%)

No. of

positive/total no.

of samples

(%)

Islamabad 15/58

(17.64)

85/150

(56.66)

27/135

(20)

10/40

(25)

Karachi 6/60

(10)

25/60

(41.66)

30/145

(20.68)

6/30

(20)

Lahore 10/60

(16.66)

25/60

(41.66)

35/140

(25)

6/25

(24)

Peshawar 5/50

(10)

18/50

(36)

25/120

(20.83)

7/30

(23.33)

Gilgit 3/15

(20)

5/20

(25)

5/30

(16.66)

3/20

(15)

Total 34/250

(13.6)

158/340

(46.47)

122/570

(21.40)

32/145

(22.06)

Chapter 1

39

Figure 1.2 Isolation frequency of C. jejuni from Islamabad, Karachi, Lahore,

Peshawar and Gilgit. Highest isolation frequency was observed for poultry followed by

wastewater, cattle and human diarrheal samples from different cities.

Chapter 1

40

1.4.3 Antibiotic Susceptibility of C. jejuni Isolates

All isolates confirmed as C. jejuni from different sources were subjected to antibiotic

susceptibility profiling by disc diffusion assay. Picture of disc diffusion assay of one of

the isolate is shown Figure 1.3. Antibiotic susceptibility patterns of C. jejuni isolates

included in this study are provided in Appendix I. Figure 1.4 (A) shows patterns of

antibiotic susceptibilities from human diarrheal isolates. High resistance rates to nalidixic

acid (90 %), ceftriaxone (87 %), erythromycin (78 %), cefotaxime (75 %),

sulphmethoxazole+trimethopterim (75 %) and tetracycline (75 %) were observed in

clinical isolates. While the most sensitive antibiotics were found to be spectinomycin (80

%) and chloramphenicol (60 %). Alarmingly, all C. jejuni isolates from poultry showed

100 % resistance to nalidixic acid, erythromycin and ceftriaxone (Figure 1.4 (B)) while

the most sensitive antibiotics were found to be spectinomycin (90 %) and

chloramphenicol (85 %). Figure 1.4 (C) shows trends of antibiotic susceptibilities of C.

jejuni isolates from cattle. High rates of resistance were noticed for nalidixic acid (70 %),

cefotaxime (75 %) and erythromycin (65 %). Chloramphenicol and spectinomycin were

found to be most sensitive antibiotics as sensitivity rates of 100% and 60 % respectively

were observed. Among wastewater isolates antibiotic resistance trends were alarming as

100 % resistance rates were observed for nalidixic acid, ceftriaxone and

sulphmethoxazole+trimethopterim (Figure 1.4 (D)). Resistance rates of 80% were

observed for erythromycin and cefotaxime while most sensitive antibiotics were found to

be spectinomycin (60 %) and chloramphenicol (60 %).

Higher resistance rates to erythromycin and tetracycline is quite alarming during our

study as these are considered as the preferred drug for the therapy of Campylobacter spp.

Data shows the presence of multidrug resistant strains particularly in poultry and

wastewater sources which may serve as a niche to carry resistance among humans.

Resistance rates in humans were comparable to poultry isolates with particularly higher

levels of resistance to nalidixic acid, erythromycin and ceftriaxone.

Additionally, all C. jejuni isolates from different sources were screened for their beta

lactamase activity by nitrocefin method. 57 % of poultry, 39 % of cattle, 35 % of human

diarrheal and 32 % of wastewater isolates were found to be positive for beta-lactamase

activity (Figure 1.5).

Chapter 1

41

Overall, the results of antibiotic resistance rates from different sources are presented in

Table 1.2.

Figure 1.3 Mueller-hinton plate of C. jejuni isolate showing antibiotic discs with

zones of inhibition. Sulphmethoxazole+trimethopterim, spectinomycin and cefotaxime

are resistant with no zones of inhibition while cloramphenicol, ciprofloxacin and

gentamicin are sensitive for this isolate.

Chapter 1

42

A

B

C

D

Figure 1.4 Antibiotic susceptibility patterns of C. jejuni isolated from (A) human

diarrheal, (B) poultry, (C) cattle, (D) wastewater samples. Abbreviations: nalidixic acid

(NA); ciprofloxacin (CIP); erythromycin (ERY); cefotaxime (CTX); ceftriaxone (CRO);

gentamicin (CN); spectinomicin (SPC); sulphmethoxazole+trimethopterim (SXT);

chloramphenicol (C); tetracycline (TE); ampicillin (AMP)

Chapter 1

43

Figure 1.5 Beta lactamase producing C. jejuni isolates from different sources.

Highest beta lactamase producing isolates were observed from poultry followed by cattle,

human diarrheal and wastewater samples.

Chapter 1

44

Table 1.2 Antimicrobial resistance rates of Campylobacter jejuni isolates from

different sources

Resistant

Strains from

Sources

NA

(%)

CIP

(%)

ERY

(%)

CTX

(%)

CRO

(%)

CN

(%)

SPC

(%)

SXT

(%)

C

(%)

TE

(%)

AMP

(%)

Humans 98 25 78 75 87 40 15 75 30 75 35

Poultry 100 55 100 90 100 30 5 65 15 55 57

Cattle 70 10 65 75 60 25 40 60 0 35 39

Wastewater 100 40 80 80 100 20 40 100 40 60 32

Abbreviations: nalidixic acid (NA); ciprofloxacin (CIP); erythromycin (ERY); cefotaxime

(CTX); ceftriaxone (CRO); gentamicin (CN); spectinomicin (SPC);

sulphmethoxazole+trimethopterim (SXT); chloramphenicol (C); tetracycline (TE); ampicillin

(AMP)

Chapter 1

45

1.4.3.1 Multidrug Resistance in C. jejuni Isolates

Additionally, 80.9 % (n = 280) of C. jejuni isolates exhibited multidrug resistance to

antibiotics (resistance to three or more antibiotics), 6.42 % (n = 18) isolates resistant to

three antibiotics, 9.28 % (n = 26) resistant to four antibiotics, 14.28 % (n = 40) resistant

to five antibiotics, 25 % (n = 70) resistant to six antibiotics, 31.07 % (n= 87) resistant to

seven antibiotics, 11.07 % (n= 31) resistant to eight antibiotics, 2.5 % (n= 7) resistant to

nine antibiotics and 0.35% (n = 1) to ten antibiotics (Figure 1.6). Exceptionally, ninety

eight different antibiotic resistance profiles were recorded, with “nalidixic acid,

erythromycin, cefotaxime, ceftriaxone, cotrimoxazole tetracycline, ampicillin”

combination as the most common resistance profile determined for 9.53 % (n = 33) of

isolated C. jejuni strains (Appendix 2).

Figure 1.6 C. jejuni isolates resistant to multiantibiotics. 80.9 % of all C. jejuni

isolates were resistant to multiantibiotics. Highest proportion (31 %) of isolates were

resistant to combination of six antibiotics.

Chapter 1

46

1.5 Discussion

Since diarrhea has been declared as the second major cause of deaths (under 5 years of

age) globally, it is obvious that the microbes responsible for triggering the diarrheal

infections are ubiquitous. C. jejuni is one of those bacterial pathogens most prevalent in

nature despite the fact that it needs a microaerophilic environment and a narrow range of

temperature in order to survive and propagate. The study provides a comprehensive

overview about the isolation frequency and antibiotic resistance profiles of C. jejuni

isolates from different sources. In Pakistan, like many other developing countries

Campylobacter spp. is still not a part of diagnostics. Campylobacter jejuni is transmitted

by fecal oral route, however seasonal variability, eating habits and lifestyle contribute in

prevalence of infection. Fork to farm control measures are important to control the

infection but farm based factors directly affect the rate of infection and minimizes public

health risk. Ecologically, C. jejuni survives in wildlife and nonagricultural sources

however their tendency to colonize poultry is directly linked with transmission of

infections to humans.

Overall, the isolation rate of C. jejuni from poultry in our study was 46.47 % which is

similar to report from Belgium with 46.9 % isolation rate (Ghafir et al., 2007). The

prevalence rate of C. jejuni in poultry is higher in European countries like, in Bulgaria

where the prevalence of C. jejuni in poultry was found to be 49% (Daskalov and

Maramski, 2011) while the prevalence of C. jejuni in Asian countries like Iran was found

to be 42% (Ghane et al., 2012). Prevalence rates in poultry are slightly lower in our

region as compared to European and other Asian countries. Prevalence rates of C. jejuni

in poultry vary among different countries (Cloak et al., 2001, Lynch et al., 2011,

Jorgensen et al., 2011; Messad et al., 2014). Fecal excretion is probably an important

factor in spread of microbes in poultry flocks (Usha et al., 2010). This result can also be

related to high animal density, which promotes contact between animals especially those

carrying Campylobacter jejuni (Megraud and Bultel, 2004). In addition to sources such as

soiled litter, untreated water, other farm animals, wild birds, insects, as well as the human

waste, viable non-cultivable forms were associated to Campylobacter jejuni transmission

in broilers, which would in turn be responsible for transmission of these microorganisms

to the environment (Humphrey et al., 2007).

Chapter 1

47

During the current study, among clinical isolates the overall isolation rate of C. jejuni was

found to be 13.6 % whereas isolation in Islamabad was 17.64 % which is in agreement

with a previous report i.e. 18 % from Rawalpindi, Pakistan (Ali et al., 2003). The

isolation rate of C. jejuni in humans in Karachi (10 %) was reportedly lower in relatively

recent study (Khan et al., 2010) than the prevalence patterns studied in previous report

from Karachi i.e. 29.5% (Kazmi et al., 1987). The percentage of occurrence rate in Gilgit

was 20 %, Lahore 16.66 % and Peshawar 10 %, indicating that seasonal variation and

exposure to different risk factors may play an important role in different rates among

these cities during the current study. The isolation of C. jejuni in Asian countries is also

higher as compared to prevalence of C. jejuni in Pakistan (13.6 %) i.e. in Thailand the

isolation was noted to be 22% (Wardak et al., 2007). However, low prevalence of 8%

was noted in Iran (Feizabadi et al., 2007). The isolation rates of C. jejuni in European

countries is also higher. Spain showed a prevalence of 25% (Wardak et al., 2007). The

prevalence of C. jejuni in Finalnd was found to be 49% that shows high incidence rates of

C. jejuni over there (Hakanen et al., 2003).

The isolation of C. jejuni in cattle was found to be low (9.8%) in Iran (Rahimi et al.,

2010) as compared to our study where the overall prevalence of C. jejuni in cattle from

different cities is found to be 21.40 %. While our prevalence rates are somewhat

comparable to a study in Finland (19.5 %) (Hakkinen et al., 2007). More recently, study

from Lithuania reported a much higher prevalence i.e. 78.5 % of C. jejuni from cattle

(Ramonaite et al., 2013). Results from different countries have shown that C. jejuni is

prevalent in wastewater and that animal and human waste, animal treatment plants and

poultry farms are the main sources. However, isolation in wastewater samples in our

region is 22.06 % which is somewhat lower than rest of the countries which have

reported up to 63% prevalence rates (Lauria - Filgueiras and Hofer, 1998;

Rodriguez and Araujo, 2010; Khan et al., 2013).

Studies from other countries show variation in the isolation rate of C. jejuni, this may be

due to the different methods of sample collection, microbiological protocols employed,

seasonal variation and can be due to the fact that studies in different countries performed

in different time of the year. Human infections are linked to the increased amounts of C.

Chapter 1

48

jejuni in the environment, which are in turn assessed by the changes in number of C.

jejuni within livestock animals and poultry.

Campylobacteriosis is self-limiting disease and antibiotic treatment is required only in

critical cases. Available treatment regime for Campylobacteriosis in humans consists of

erythromycin, tetracycline and ciprofloxacin. Current antibiotic resistance trends have

seriously affected the susceptibility pattern of Campylobacter jejuni. In our study higher

resistance was observed particularly in humans and poultry isolates to nalidixic acid,

ceftriaxone, erythromycin, cefotaxime and sulphmethoxazole+trimethopterim. High

levels of resistance towards antibiotics, widely used in farms including nalidixic acid,

ciprofloxacin, tetracycline and ampicillin, shows similar trends compared to previous

reports (EFSA, 2010; Messad et al., 2014). High susceptibility to chloramphenicol and

gentamicin could be explained by none or moderate use of these antibiotics. Several

authors agree that the use of antibiotics in livestock animals as therapeutic agents or as

growth promotion factors can select for resistance and reduce the effectiveness of these

products in veterinary and human medicine, because of emergence of resistant strains,

which may occur during or post antimicrobial treatment (Avrain et al., 2003; Rahimi et

al., 2010; Usha et al., 2010; WHO, 2008). Despite that, the use of disinfectants or other

biocides (Russell, 2002; EFSA 2010), and the environmental stresses encountered by

bacteria during the slaughter process (McMahon et al., 2007) may also play an important

role in the phenomenon of antibiotic resistance. Erythromycin resistant strains are

frequently observed in developing countries, including Thailand (50%) and Zimbabwe

(14%) (WHO, 2003) but in our study resistance up to 100 % has been observed. This can

be explained by the previous study (Lin et al., 2007) suggesting erythromycin used in low

doses over a long period (which corresponds to their use as a growth factor) selects for

resistant strains of Campylobacter jejuni. Resistance rates up to 55 % to ciprofloxacin in

poultry isolates have been observed during the current study which is quite lower than

recently reported rate of 83.7 % from chickens (Messad et al., 2014). Various studies

have showed the rapid development of mutants resistant to fluoroquinolones in chickens

initially infected with fluoroquinolones sensetive Campylobacter spp., following

treatment with enrofloxacin. In fact treatment of chickens with enrofloxacin do not

eradicate Campylobacter spp. but convert susceptible population to fluoroquinolones

Chapter 1

49

resistant population which emerges as soon as 24 hrs from the start of treatment

(McDermott et al., 2002; Farnell et al., 2005; Han et al., 2008). Overall, 56.25 %

tetracycline resistance has been found in this current study. Many authors have reported

frequent resistance (up to 83.7 %) to tetracycline (Bester and Essack, 2008; Tambur et

al., 2010; Mansouri-najand et al., 2012).

A Malaysian study has reported very high resistance rates; 86% was recorded to

ampicillin, 82% to ciprofloxacin, 92% to tetracycline and 99% to erythromycin and 35%

to gentamicin (35%) (Tang et al., 2009). Our reported overall resistance to ampicillin

(40.75 %), ciprofloxacin (32. 5 %) and tetracycline (56. 25 %) are considerably lower

than this Malaysian report. Reports of resistance to erythromycin and gentamicin are

comparable to this study. According to Vandeplas et al. (2008) various veterinary

practices in antimicrobial use for treatment, prevention and control are responsible for

changes in rates of antimicrobial resistance between countries.

In the current study overall occurrence of beta lactamase positive isolates was found to be

40.25 % and they were all resistant to ampicillin. This is coherent with a previous study,

which reported 40% of their strains resistant to this antibiotic (Tajada et al., 1996). The

percentage of ampicillin resistant strains is varying and ranges from 0% to 51.8% of C.

jejuni strains. The differences in the susceptibilities of the thermophilic Campylobacter

spp. to ampicillin and amoxicillin make these organisms a noteworthy exception to the

large majority of clinically significant bacteria, against which these two compounds show

almost analogous behaviors. But Griggs et al. (2009) postulated that the production of β-

lactamase was not always related with resistance to β-lactam agents and isolates that

show resistance to ampicillin produce more enzyme than the ampicillin-susceptible

isolates do. Although, it may propose that β-lactamases have some other function besides

mediating β-lactam resistance in Campylobacter spp. Mechanisms

of Campylobacter resistance to some betalactams like ampicillin and some of the

expanded-spectrum cephalosporins are varying and not explicitly explained (Lachance et

al., 1991; Tajada et al., 1996). Usually, with the exception of some carbapenems,

majority of Campylobacter strains are regarded as resistant to the betalactam antibiotics,

especially the penicillins and narrow-spectrum cephalosporins (Wieczorek and Osek,

2013).

http://www.hindawi.com/59027246/


Chapter 1

50

Unlike other foodborne pathogens, C. jejuni is very susceptible to many environmental

conditions, as concluded in this study, our results confirm that C. jejuni can survive well

in different environments and therefore are of public health concern. To our knowledge

this is the first study in Pakistan on assessment of incidence of C. jejuni from diverse

sources. Seasonal variation may play a role in different isolation rates from different

cities. In the warmest months (May to September) average temperatures in the North

(Gilgit) do not exceed 15°C, whilst in the South (Karachi) they can reach up to 35° C and

more. In the coolest months (November to February) are well below zero in the highest

altitudes, and 20‐25°C in the low‐lying south. Rainfall up to 200mm is received through

July to September (McSweeney et al., 2013). In our study, maximum isolation rates from

all sources were observed during June to August. Additional studies are required on the

seasonal prevalence patterns of C. jejuni from different sources. Surveillance data from

this current study will be useful in identifying risk factors implicated in the spread of C.

jejuni in Pakistan. This study revealed that antibiotic resistant C. jejuni is common among

chickens and cattle which can find their way into the food chain. Multi drug resistant C.

jejuni depicts the widespread use of antibiotics in poultry farming and livestock. As

major source of human campylobacteriosis, preventive measures should be focused on

reducing Campylobacter infection at all stages of poultry production chain, as well as for

the controlled use of antimicrobials in veterinary medicine. Our results also emphasize

the need for a surveillance and monitoring system in developing countries like Pakistan,

for the monitoring of the spread of antimicrobial resistance among Campylobacter jejuni

in broiler, poultry and other food animals.

Chapter 2

51

Chapter 2

Chapter 2

52

Chapter 2

Source Attribution and Strain Clustering of C. jejuni Isolates from

Diverse Sources

2.1 Abstract

Globally, Campylobacter jejuni is the major cause of bacterial human gastroenteritis.

However, source tracking of this bacterium is quite difficult. Formerly DNA microarrays

and Multi Locus Sequence Typing (MLST) have been widely used for source attribution

but these techniques are quite expensive and not feasible in many of the developing

countries. In the current study, C. jejuni isolates from clinical diarrheal, poultry, cattle and

wastewater sources were analyzed for their source attribution and distribution into clusters

by recently proposed two triplex predictive PCRs. These PCRs were based on

amplification of six coding DNA sequences of hypervariable region of C. jejuni. On the

basis of the presence or absence of amplified products of these coding DNA sequences,

PCR profiles were generated. These PCR profiles were then used for the prediction of

clusters of C. jejuni isolates. All C. jejuni isolates were grouped by means of genotypes

into nine clusters i.e. C1–C9. Results revealed that not any of the C. jejuni isolates of our

study were assigned to C1/C2/C3 cluster. 45.01 % of isolates were predicted to be in C4/C6

group and 4.27 % were predicted in C5 group, which are livestock associated groups. 35.89

% of the isolates were speculated to be in C7/C8 and 14.81 % in C9 groups, which are non-

livestock associated groups. 41.17 % of clinical diarrheal isolates were predicted in C4/C6

(livestock) group. The rest of them were predicted in non-livestock associated groups i.e.

23.52 % of the clinical diarrheal isolates were predicted in the C7/C8 groups and 35.29 %

in C9 group. The predictive mPCR assay can be used to demonstrate if a diarrheal clinical

case has its origin from domesticated or nondomesticated sources. Majority of diarrheal

clinical isolates were tracked to be from the nonlivestock sources, so nonlivestock sources

are equally important in causing human infection. Water contamination seems to be

common source for C. jejuni. Cj1720 (coding for Leucin), a CDS of hypervariable region

of C. jejuni seems to be conserved feature of the non-livestocks with the livestocks.

Surveillance strategies should be intended to lessen the burden of C. jejuni infections by

limiting transmission from livestock as well as nonlivetock sources.

Chapter 2

53

2.2 Introduction

Campylobacter spp. has been identified as the most widespread bacterial causative agent

of intestinal infectious disease (IID), as a report of 2009 showed 9.3 cases per 1000 person

annually that account for more than 500,000 cases of IID (Tam et al., 2012). According to

WHO technical report, source attribution is the assessment of the comparative

contributions of various sources to the human disease burden (WHO, 2013). Handling of

livestock animals and consumption of products derived from livestock specially poultry

related products are largely responsible for C. jejuni infections (Skirrow, 1977; Skirrow et

al., 1981; Harris et al., 1986; Wilson et al., 2008; Tam et al., 2009). Though, it is becoming

evident that the bacterium is usually adaptable to varied ecological niches and has different

survival strategies like biofilm formation in diverse environments (Joshua et al., 2006).

Previous reports have demonstrated that C. jejuni can be found in diverse ecological niches

and is capable of surviving and multiplying in these harsh environmental habitats (Moen

et al., 2005; Murphy et al., 2005). Several reports have mentioned that C. jejuni has been

detected from various non-livestock animals including rodents, hares, flies, wild-birds,

deer, squirrels, hedgehogs, badger, foxes, bank voles and seals (Rosef et al., 1983; Rosef

et al., 1985; Petersen et al., 2001; French et al., 2009). Wild animals and birds have been

found to be as potential reservoirs for Campylobacter transmission to livestock animals

(Kwan et al., 2008; Horrocks et al., 2009). Knowledge on the Campylobacter ecology in

wildlife is insufficient; Campylobacter spp. is not thought to cause illness in wildlife and

the contribution of wildlife as Campylobacter reservoirs remains to be ascertained (Sippy

et al., 2012). C. jejuni has also been detected in natural water sources and soil (Kemp et

al., 2005; Jensen et al., 2006). Vegetable material has also been reported to have C. jejuni

contamination and can supplement its survival (Park and Sanders, 1992; Brandl et al.,

2004). Additionally, a surveillance in rural areas reported that exposure to animals and

their surroundings was a source for sporadic Campylobacter cases (Ethelberg et al., 2005).

Previously studies have employed MLST to assess the existence of particular clones in

particular host environments and their ability to adapt to that environment (Dingle et al.,

2001; Manning et al., 2003; Sails et al., 2003; McCarthy et al., 2007). Similarly, whole

genome microarray analysis has provided a vigorous method for determining the genetic

relevance of bacterial communities (Champion et al., 2005; Dorrell et al., 2005; Howard

Chapter 2

54

et al., 2006; Stabler et al., 2006). Champion et al. (2005) had determined two distinct

groups which were assigned as ‘livestock group’ and ‘nonlivestock group’. In their study

clinical diarrheal isolates were almost uniformly allocated between these two groups.

Different genetic profiles can be suggested for the occurrence of livestock associated

isolates in one group and wildlife and water (WW) associated isolates in the separate group.

In a study seven hyper variable plasticity regions (PR) were identified in C. jejuni isolates

from various sources by Comparative Genomic Hybridization (CGH) assay, which were

proposed to be because of adaptation to the ecological niche (Pearson et al., 2003). Later

study used a combinatorial method involving MLST and CGH for analysis of C. jejuni

isolated from badgers, rabbits, wild birds and environmental water and proved that CGH

information gathered strains in groups that corresponded the MLST Clonal Complexes

(CC) data (Hepworth et al., 2011). In that study WW isolates grouped into one group that

show genetic similarity between C. jejuni and C. coli (Hepworth et al., 2011). In the MLST

database, chicken isolates had shown the absence of the WW STs except for a single

exclusion from a sporadic infection. In addition in that study genome sequence of a bank

vole isolate and WW isolate was determined which showed significant deletions in genome

including cytolethal distending toxin (cdt) and genes implicated in the colonisation

(Hepworth et al., 2011). More recently, Stabler et al., investigated 284 C. jejuni isolates

that included 122 isolates from a case control study by microarray interpretation (Tam et

al., 2012) and combined with the details from Champion et al., study to further resolve

adjustment to specific ecological niches (Stabler et al., 2013). Stabler et al., grouped C.

jejuni isolates into nine clusters, depending upon presence and absence of the predicted

1574 coding DNA sequences (CDSs) from the NCTC strain C. jejuni 11168. These clusters

were then used to analyse hypervariable plasticity regions that could be associated with a

specific source and niche adaptation. They developed an instant multiplex PCR (mPCR)

based methodolgy for assigning cluster and determining potential source attribution of

particular C. jejuni isolate.

This chapter reports the findings of the grouping of C. jejuni isolates from different sources

into clusters based upon the presence and absence of CDSs in the hypervariable region of

C. jejuni. The goals were 1) to assign the cluster groups of C. jejuni isolates from human

diarrheal, cattle, poultry and waste-water sources, isolated from main cities of Pakistan

Chapter 2

55

including Karachi, Lahore, Islamabad, Peshawar and Gilgit 2) to determine livestock and

non-livestock association of respective C. jejuni isolates.


2.3.1 Growth of Bacterial Strains

Analysis for source attribution was performed on 34 human diarrheal including 14 bloody

diarrheal cases and 20 non-bloody diarrheal cases, 158 chicken, 122 cattle, 32 wastewater

positive C. jejuni isolates were. C. jejuni strains were grown on modified Charcoal

Cefoperazone Deoxycholate Agar (mCCDA) (Oxoid, Basingstoke, UK, CM0739)

supplemented with Campylobacter Selective Supplement (Skirrow) (Oxoid, Basingstoke,

UK, SR0155) under microaerobic conditions (6% O2, 12% CO2) using 2.5 litres airtight

jar along with Campygen sachets (Oxoid, Basingstoke, UK, CN025A) for 48 hours at 42°C.

Cells were then harvested and genomic DNA extraction was performed as mentioned

previously in Chapter 1.

2.3.2 DNA Extraction

DNA was extracted using phenol-chloroform method. The steps of DNA extraction are

described below.

Colonies from fresh C. jejuni growth were picked with sterile cotton swab and dissolved

in 1 mL PBS in 1.5 mL eppendorf tube. Centrifugation for 2 minutes at 4659 x g.

Supernatant was removed, 400 µL of NaCl+Tris+EDTA (STE) added, pipetted for proper

mixing. Centrifugation at 4659 x g for 2 minutess. This step of addition of STE and

centrifugation was repeated twice. The supernatant was removed, 200 µL of TE added,

vortexed and 100 µL of Tris saturated phenol added. Vortexed for 1 minute to mix properly.

Centrifugation at 12,300 x g for 5 minutes. 100 µL of Chloroform was added.

Centrifugation was performed at 12,300 x g for 5 minutes at 4 ºC. Upper phase was

carefully aspirated with pipette, without disturbing the lower phase. 50 µL TE+ 100 µL

chloroform was added. Centrifugation at 12,300 x g for 5 minutes. Step of washing of the

upper phase with TE and choloroform was performed thrice. Upper phase was transferred

to sterile eppendorff tube. Purified gDNA was stored at -20 ºC.

Chapter 2

56

2.3.3 Distribution of C. jejuni Isolates from Diverse Sources in Strain Clusters

Strain clusters of C. jejuni isolates from various sources were predicted by two triplex PCR

mixes as described by Stabler et al. (2013). M1 mPCR was used to amplify Cj0056c (415

bp), Cj1139c (703 bp) and Cj1422c (900 bp) while M2 mPCR was used to amplify Cj0485

(406 bp), Cj1324 (765 bp) and Cj1720 (595 bp). NCTC strain C. jejuni 11168 was

employed as the positive control for this this two triplex PCR. Primers used in predictive

multiplex PCR are mentioned in Table 2.1. All primers were synthesized by alpha DNA

(Montreal, Quebec). Thermo cycling for both the triplex PCRs was performed in MJ

MiniTM Thermocycler ( Bio-Rad, PTC-200; MJ Research Inc., Watertown, MA, USA)

under the following conditions: 5 min at 94°C followed by 35 cycles of 30 sec at 94°C, 60

sec at 56°C and 2 min at 72°C followed by 10 min at 72°C. The PCR amplicons were

resolved by loading onto 1.5% agarose gel containing 0.05 % ethidium bromide, staining

dye. The gels were given a run at 100V for 40 minutes. 5 µL of amplified product with 2

µL of 6X loading gel buffer (Fermentas, Lithuania, UAB) was loaded into each well. 100

bp DNA ladder (Fermentas, Lithuania, UAB) was utilized to determine the sizes of the

PCR amplicons. The gels were visualized using UV transilluminator and photographed

under UV light.

Binary data of PCR profiles of C. jejuni isolates obtained from predictive PCR for

assigning their respective cluster groups was used as a rationale for the construction of

dendrogram. Dendrogram was constructed using DendroUPGMA

(genomes.urv.cat/UPGMA).

Chapter 2

57

Table 2.1 Primers for strain cluster attribution of C. jejuni isolates. The mPCR1

included primers for CDSs Cj1422 (900 bps), Cj1139 (703 bp) and Cj0056 (415 bps). The

mPCR2 included primers for CDSs Cj1324 (765 bps), Cj1720 (595 bp) and Cj0485 (406

bps).

Primers Primer Sequence (5’- 3’) PCR

product

size

(bps)

Tm

(°C)

Reference

mPCR1

Cj0056-cl-F GAAAGAAGTGAAGGGTGGGT 415 56 Stabler et

al. 2013 Cj0056-cl-R TTATTCAAAGACAGGACTTGA 56

Cj1139-cl-F ATGAGTCAAATTTCCATCAT 703 56 Stabler et

al. 2013 Cj1139-cl-R GTTCTTGAATATTAGCTTCT 52

Cj1422-cl-F ATGCTCAACCCAAATTCAGC 900 58 Stabler et

al. 2013 Cj1422-cl-R GGCAAATTTTAAATCATTGCATG 60

mPCR2

Cj0485-cl-F GATCTATGCCTAAAGAGCACG 406 62 Stabler et

al. 2013 Cj0485-cl-R TCCTTAGCAAAAGCACAAGCC 62

Cj1324-cl-F GTGATCACTGCGTGATGCCA 765 62 Stabler et

al. 2013 Cj1324-cl-R CAGTAAAACCACGACTTTTAGC 62

Cj1720-cl-F AAATGGAACCTGTTATCCAC 595 60 Stabler et

al. 2013 Cj1720-cl-R TCAACCTCCACCGATAAAGT 58

Chapter 2

58

2.4 Results

2.4.1 Cluster Prediction by Predictive Multiplex PCR

For assigning clusters and identification of potential reservoirs of C. jejuni isolates from

diverse isolates of this study, they were subjected to two triplex PCR with MI PCR based

on Cj0056c (415 bp), Cj1139c (703 bp) and Cj1422c (900 bp) while M2 mPCR based on

Cj0485 (406 bp), Cj1324 (765 bp) and Cj1720 (595 bp) (Figure 2.1). Presence or absence

of these CDS in a particular isolate marked its strain cluster location. PCR profiles of all

C. jejuni isolates and their respective strains clusters are shown in Appendix 2.

2.4.2 Distribution of C. jejuni Isolates in Strain Clusters and Source Attribution

C. jejuni isolates analyzed in the current study are presented in the dendrogram of strain

clusters (Figure 2.1). Phylogram location of each isolate was predicted using multiplex

predictive PCR data. Branches were differently colored in all strain groups, which is

indicating their source attribution that whether they are human diarrheal isolates with black

branches, wildlife isolates with green branches, livestock associated (cattle related) with

blue branches, livestock associated (chicken and poultry related) with red branches. None

of the C. jejuni isolates of our study were assigned to C1/C2/C3 cluster. Additionally, five

isolates of this study including one poultry, two cameline and two waste water isolates

were with distinct PCR profiles (i.e. 010000) (yellow branches) that could not be allocated

to any of the existing strain clusters C1-C9. The waste water isolates can be livestock

(chicken, poultry or cattle related) or non-livestock (wild life related) associated depending

upon location of collection of the water sample.

Clinical C. jejuni isolates were present in all clusters. Interestingly, 14/34 (41.17 %) human

diarrheal isolates were predicted to be in C4/C6. C4/C6 group was found to be exclusively

livestock associated group as according to our isolate distribution in groups, C4/C6

contained all livestock associated isolates including poultry and cattle related isolates. 8/34

(23.52 %) of the clinical diarrheal isolates were predicted to be in C7/C8 groups and 12/34

(35.29 %) in C9 groups, which are nonlivestock associated groups.

Distribution of C. jejuni isolates from diverse sources on the basis of PCR profiles into

strain groups indicated highest percentage of isolates in C4/C6 group with 158/351 isolates

Chapter 2

59

(45.01 %) followed by C7/C8 with 126/351 (35.89 %), C9 with 52/351 (14.81 %) and C5

with 15/351 (4.27 %) (Figure 2.3).

A

B

Figure 2.1 Prediction of strain cluster groups by multiplex PCR. Lane 1- 1 kb ladder,

Lane 2 – 5 tested C. jejuni isolates - presence and absence of CDSs, 6- Positive control, 7-

No template control. (A) M1 mPCR1 involved amplicons based on CDSs Cj0056c (415

bp), Cj1139c (703 bp) and Cj1422c (900 bp), and. (B) M2 mPCR2 involved amplicons

based on CDSs Cj0485 (405 bp), Cj1720 (595 bp) and Cj1324 (765 bp).

Chapter 2

60

Figure 2.2 Dendrogram showing distribution of C. jejuni isolates from diverse sources

in strain cluster groups (C1-C9). Black branches = human diarrheal isolates, green

branches = wildlife isolates, blue branches = livestock associated (bovine, ovine, camleine

related), red branches = livestock associated (chicken and poultry related), ? yellow

branches = unknown/intermediate strain group (i.e. neither falling in livestock nor in non-

livestock identified groups).

Chapter 2

61

Figure 2.3 Distribution of C. jejuni isolates from diverse sources in strain cluster

groups. None of the isolates were predicted to be in C1/C2/C3. Majority (43.58 %) of the

isolates were in C4/C6 (livestock associated group), followed by C7/C8 (35.89 %), C9

(14.81 %) (non-livestock associated group). Rest of the isolates were in C5 (4.27%) and

only 1.42 % isolates could not be categorized into livestock or non-livestock associated

groups.

Livestock Groups Non-livestock Groups Unknown

Group

Chapter 2

62

2.5 Discussion

Identification of sources of infection from a clinical isolate and other cases from the

identical source can be effectively predicted by studies on epidemiology of C. jejuni. An

MLST database for C. jejuni was initially proposed by Dingle et al., 2001. Later studies

have used MLST for studying epidemiology (Sails et al., 2003), identification of source

linkage with specific clonal complexes (CC) (Manning et al., 2003; McCarthy et al., 2007).

According to a study MLST investigation of human C. jejuni isolates reported that

livestock sources were accountable for 97% sporadic infections, while 3% of sporadic

cases were attributable to wild life and environmental sources (Wilson et al., 2008). On the

basis of these studies it was inferred that C. jejuni isolated from environmental sources

were a negligible source of infection. But on the other hand several studies have proposed

that water borne and wildlife sources were involved in the C. jejuni infections (Schonberg-

Norio et al., 2004; Ethelberg et al., 2005; Kemp et al., 2005; Karenlampi et al., 2007).

Genotyping by MLST has been widely employed for the identification of epidemiological

profiles for C. jejuni but this method cannot describe the genetics behind adaptation to

specific environment/niche and their virulence. Comparative whole genome analysis for

the first time was used to analyse the presence or absence of 1574 CDSs (Stabler et al.,

2013). It provided information on the genetic elements which can be used for the

identification of isolates with similar genotypes. Adaptive genotypes can probably be

determined, as the recombination processes are only possible between the strains that have

the same environmental source. Comparative phylogenomics study by microarray on C.

jejuni isolates proved that the livestock associated isolates were principally grouped with

each other and water and wildlife isolates were clustered in a separate portion of the

dendrogram (Champion et al., 2005). Within this group, the phylogenetic tree could be

further subdivided into nine clusters, which provided information for niche adaptation by

isolate that possess a same set of absent or highly diversified genes.

In this study multiplex predictive PCR used by Stabler et al. (2013) was employed to

cluster C. jejuni isolates from various sources. On the basis of the PCR profiles obtained,

besides the predicted environmental associated isolates, groups C7-C9 predominantly

consisted of 68.85% cattle isolates, 58.82 % of clinical isolates and 46.83 % chicken

isolates. This percentage is high in relation to previously reported 17% livestock isolates

Chapter 2

63

in these groups while percentage of clinical isolates is comparatively low as previously

reported i.e. 97% in C7-C9 groups (Stabler et al., 2013). As, C7-C9 groups are associated

with non-livestock associated isolates, presence of chicken and cattle isolates in these

clusters indicate their possible mixing with wildlife and sharing of non-livestock

environment. Particularly the presence of greater percentage of clinical isolates in these

groups as compared to livestock associated groups indicate that more clinical cases are

attributable to non-livestock because of the exposure of humans to non-livestock

environment. In a previous study, group C7 contained majority of C. jejuni isolates which

had been earlier isolated from indoor raised chickens (Jorgensen et al., 2011) besides

human sporadic cases. So there is a possibility of mixing of indoor chickens with wild

chickens and contamination of indoor raised chickens by wild chickens. The presence of

the livestock isolates in C7-C9 groups could also demonstrate that these cattle and chicken

isolates have been transitory contaminated by these groups of C. jejuni. It is also a

possibility that some reservoirs may be frequently contaminated by other reservoirs,

definitely serving as an intermediate host in a direct contact passage (i.e. not an actual

supporting host).1.42 % isolates with distinct PCR profile i.e. 010000 could not be

categorized into identified livestock and non-livestock clusters.

Analysis of the cluster/group genotypes showed that hypervariable regions are restricted to

certain clusters (Stabler et al., 2013). Absence or presence of these regions in livestock,

non-livestock and clinical isolates does not provide adaptive benefit over other bacteria but

shows adaptation to a particular niche or environment and hence can track their source. It

is unclear that how the possible loss of function in these regions bestows benefit for

adaptation under these particular environments (Stabler et al., 2013).

Overall, the predictive multiplex PCR assay can be employed to demonstrate whether a

particular clinical isolate has originated from livestock or non-livestock sources. Prediction

of the majority of clinical isolates seemed to be from nonlivestock or nonagricultural

sources. So, non-livestock associated sources are equally important in causing human

infection. Water contamination seems to be common source for C. jejuni. Current strategies

involve reduction of the burden of C. jejuni infection through limiting transmission from

chicken flocks and cattle. In light of the knowledge obtained from this study, more potential

sources, especially within the nonlivestock environment, should be probed as probable

Chapter 2

64

reservoirs for C. jejuni infections. The possible maintenance by wildlife populations of

pathogenic Campylobacter could have important implications for public health. In view of

the complicated epidemiology of C, jejuni, a multifarious approach to control is required,

which takes into account the attribution of various reservoirs, pathways, comparative

exposures or risk assessment and risk factor modelling.

Chapter 3

65

Chapter 3

Chapter 3

66

Chapter 3

Molecular Detection and Surveillance of Type Six Secretion System of

Campylobacter jeuni in Pakistan

3.1 Abstract

The newly discovered type VI secretion system (T6SS) of proteobacteria is bacterial

protein injection machinery and has its role in virulence, symbiosis, bacterial interactions

and environmental stress responses. Therefore, presence of this secretion system confers

hyper virulence to its host and has been recently discovered in Campylobacter jejuni.

During the current study multiplex PCR based on T6SS conserved genetic markers was

employed to screen 366 Pakistani C. jejuni isolates from human diarrheal, poultry, cattle,

wildlife and waste water sources. Prevalence rate of T6SS in Pakistani isolates was found

to be 4.64 %. Gene expression of T6SS conserved markers was determined by reverse

transcriptase PCR (RT-PCR). T6SS positive strains were further characterized by source

tracking markers for their source attribution and strain cluster accreditation linked with

livestock and non-livestock association. C. jejuni isolates harbouring T6SS markers genes

were identified in livestock and non-livestock sources but in this study T6SS was not

identified in human diarrhoeal isolates. Gene expression analysis demonstrated down-

regulation of T6SS in an acidic environment. This study questions the role of the T6SS in

human diarrhoeal disease. Our study highlights the need to establish the role of the T6SS

in environmental survival or virulence.

3.2 Introduction

Gram-negative bacteria have a process which involves transportation of selected proteins

across the cell membrane from their synthesis site to the outside surface of the cell

generally known as protein secretion. Up till now six types of machineries in bacteria are

known that are implicated in the process of protein secretion, which are recognized as Type

I secretion system –Type VI secretion system (Holland, 2010). Type VI secretion system

(T6SS) is the most recently discovered in the protein secretion systems of Gram negative

bacteria, which is a complicated secretion system but occurs in a single-step. This term was

Chapter 3

67

first devised in 2006, with the identification of this secretion system in Vibrio cholera

(Pukatzki et al., 2006). Since from the finding of T6SSs, there has been a great deal of

interest in this newly discovered area. Not only are the T6SSs present in many Gram

negative bacteria, there have been many studies showing their role in the interaction with

host cell and virulence. A contractile phage sheath-like conformation is employed by the

T6SS apparatus that assists in protein secretion between the cells (Basler et al., 2012;

Bonemann et al., 2009; Leiman et al., 2009). About 1/4th of nearly all the sequenced Gram

negative bacteria, comprising bacteria of the genera Vibrio, Pseudomonas, and

Acinetobacter, possess gene clusters of T6SS (Boyer et al., 2009). Large and diverse gene

clusters encode T6SSs (Blondel et al., 2009; Boyer et al., 2009). Gene clusters of T6SS

are conveniently distinguishable on the basis of 13 basic and conserved genes that encode

the proteins which constitute the fundamental secretion assembly. Recent reports have

demonstrated that the type six secretion system (T6SS) plays an important function in

virulence in diverse bacterial pathogens, including Vibrio cholera, Pseudomonas

aeruginosa and Aeromonas hydrophila (Basler et al., 2013; Ishikawa et al., 2012; Mulder

et al., 2012; Sha et al., 2013). In addition, role of T6SS has been documented in its ability

to adapt to low temperature and high osmolarity (Ishikawa et al., 2012), quorum and stress

sensing (Sana et al., 2012; MacIntyre et al., 2010; Weber et al., 2009), bacterial growth

and motility (Das et al., 2002), biofilm formation (Aubert et al., 2008) and killing of other

competitive organisms in environment by the secretion of effector toxic proteins (Russell

et al., 2011; Zheng et al., 2011). These bacteria have diverse colonization niches including

plants, soil, invertebrates, vertebrates, mammals and marine environment implying that

T6SS is associated with different species of bacteria surviving in these ecological niches.

Campylobacter jejuni, a spiral-shaped and gram negative microaerophilic bacterium, is the

predominant cause of food-borne human enterocolitis globally with an estimate of about

400 million diagnosed cases every year (Ruiz-Palacios, 2007). Furthermore, C. jejuni

infection can result in crippling extra-intestinal problems including autoimmune

neuropathies such as Guillain-Barre´ syndrome and Miller Fisher syndrome and immune

mediated polyarthritis (Janssen et al., 2008). Regardless of the worldwide predominance

of C. jejuni as a diarrheal pathogen the mechanisms involved in the pathogenesis of C.

jejuni are not fully understood and a few number of virulence factors have been recognized

Chapter 3

68

including flaA: flagellin gene, cadF: outer membrane protein, ceuE: lipoprotein, cdt:

cytolethal distending toxin, cfrA: ferric receptor gene, pldA: outer membrane

phospholipase A gene; ansB: asparaginase gene; cstII/III: lipooligosaccharide

sialyltransferases II and III genes and fucP: L-fucose permease gene (Bang et al., 2003;

Zautner et al., 2012).

A functional T6SS machinery was recently reported in C. jejuni (Lertpiriyapong et al.,

2012). The T6SS gene assembly is a part of an integration element found to be in the

genomes of a subgroup of C. jejuni strains (Bleumink-Pluym et al., 2013). T6SS of C.

jejuni has diverse roles in virulence including adherence of cells, red blood cells

cytotoxicity and colonization of the mice (Bleumink-Pluym et al., 2013; Lertpiriyapong et

al. 2012). So, the existence of T6SS in C. jejuni isolates can serve as a potential virulence

marker to determine virulence. However, the role of T6SS in colonization or virulence of

natural host species is unknown. Whole-genome sequencing revealed that in C. jejuni, the

presence of a entire T6SS gene apparatus is strongly correlated with the presence of hcp

(hemolysin corregulated protein) gene (Harrison et al., 2014).

This chapter reports the results of the presenceT6SS in C. jejuni isolates from Pakistan.

This is one of the pioneer studies on T6SS in C. jejuni from South Asia particularly in

Pakistan. The goals were 1) to determine occurence of the T6SS among C. jejuni isolates

from human diarrheal, poultry, cattle, wildlife and waste-water sources, isolated from main

cities of Pakistan including Karachi, Lahore, Islamabad, Peshawar and Gilgit, the hcp gene

was used as a proxy for the presence of an intact T6SS in a range of C. jejuni isolates from

humans, chickens, food animals and environmental sources including non-domesticated

ones, 2) to determine the gene expression of conserved T6SS genes at different conditions,

3) strain grouping of C. jejuni harboring T6SS gene cluster.


3.3.1 Growth of Bacterial Strains and DNA Extraction

34 human diarrheal (including 14 bloody diarrheal cases), 158 chicken, 122 cattle, 32

wastewater positive C. jejuni isolates were analyzed for the screening of T6SS.

Chapter 3

69

Additionally, 20 wildlife C. jejuni isolates (2 lion, 11 duck, 4 ox and 3 black deer) from a

wildlife park in Islamabad were also included in the current study to assess whether T6SS

is associated with wildlife isolates or not. The C. jejuni strains were grown on Columbia

Blood Agar (Oxoid, Basingstoke, UK) supplemented with Campylobacter Selective

Supplement (Skirrow) (Oxoid, Basingstoke, UK) under microaerophilic conditions (6%

O2, 12% CO2) for 48 hours at 42°C. Cells were later harvested and genomic DNA

extraction was performed utilising Wizard® Genomic DNA Purification Kit (Promega,

USA, A1125). The steps of DNA extraction are described below.

One mL of an overnight culture was added to the 1.5 mL microcentrifuge tube and

centrifuged for 2 minutes at 13,000–16,000 × g to pellet down the cells. Supernatant was

removed. 600 µL of Nuclei Lysis Solution was added after removal of supernatant.

Solution was gradually pipetted till the cells were resuspended. For lysis of the cells

contents were incubated for 5 minutes at 80°C; later they were cooled at the room

temperature. 3 µL of RNase Solution was added to the cell lysate. Tubes were inverted 2

to 5 times for thorough mixing. After mixing tube was incubated for 15–60 minutes at

37°C. Sample was then cooled at the room temperature. 200 µL of protein precipitation

solution was added to the RNase-treated cell lysate. The contents were vigorously vortexed

for 20 seconds at a high speed. Sample was incubated for 5 minutes on ice. Centrifugation

was performed for 3 minutes at 13,000–16,000 × g. Supernatant containing DNA was

transferred to a clean 1.5 mL microcentrifuge tube containing 600 µL isopropanol at room

temperature. Tube was repeatedly inverted for gentle mixing till a visible mass of thread-

like strands of DNA appear. Centrifugation was performed for 2 minutes at 13,000–16,000

× g. Supernatant was poured off and the tube was drained on an absorbent paper. For

washing the DNA pellet, 600 µL of 70% ethanol at room temperature was added and tube

was gently inverted several times. Centrifugation was performed for 2 minutes at 13,000–

16,000 × g. Ethanol was cautiously aspirated. Tube was drained on an absorbent paper and

pellet was allowed to dry for 10 to15 minutes. 100 µL of DNA Rehydration Solution was

added to the tube and DNA was rehydrated by incubation for 1 hour at 65°C. The tube was

tapped gently for periodical mixing of the solution. Alternatively, DNA was rehydrated by

incubating the solution at 4°C or overnight at room temperature. DNA was stored at 2 to

Chapter 3

70

8°C. Quantification of gDNA sample was done by a Thermo Scientific NanoDrop™ 1000

Spectrophotometer.

3.3.2 Screening PCR Assay for T6SS Conserved Genes

Primers were designed to amplify C. jejuni T6SS component conserved genes icmF; Inner

membrane channel protein, vgrG; valine glycine repeats G and hcp; hemolysin

corregulated protein. Primers amplifying gltA; citrate synthase gene as an internal positive

control to check for the fidelity of PCR (Table 3.1). All primers were synthesized by

Eurofins (Anzinger, Germany). Initially, all C. jejuni isolates were screened for the

presence of hcp gene, that serves as a proxy for the existence of an intact T6SS (Harrison

et al., 2014), and gltA was used as an internal positive control. Isolates positive for hcp

gene were then assessed for the presence of genes of vgrG and icmF. PCR was carried out

in a 25 µL reaction volume with 2 µL DNA, 1X PCR buffer (Bio Labs), 200 µM of each

of the dNTPs (Invitrogen), 2.5mM of MgCl2 (Invitrogen), 0.4 µM of each of the primer,

0.25 U of Taq DNA polymerase (Bio labs), rest of the volume was made with nuclease free

water. gltA was added as internal positive control at a 0.05 µM concentration in each of the

reaction mixtures to check the fidelity of the PCR.

PCR was performed using T professional Trio Thermocycler (Biometra, Göttingen,

Germany). The cycling conditions were: 5 min at 94°C followed by 35 cycles of 1min at

94°C, 45 sec at 57°C and 1 min at 72°C followed by 5 min at 72°C. Amplified PCR

products were resolved on 1.5% agarose gel stained with SYBER Safe DNA stain. 100 bp

DNA molecular size marker (Fermentas, Lithuania, UAB) was used to determine the sizes

of the PCR products.

Chapter 3

71

Table 3.1 Primers for screening conserved T6SS genes (hcp, vgrG, icmF using gltA as

internal control).

Primers Primer Sequence (5’- 3’) Amplicon

size (bps)

Tm

(°C)

Reference

gltA F Cj 1 GCCCAAAGCCCATCAAGCGGA 142 60 Harrison

et al.,

2014

gltA F Cj 2 GCGCTTTGGGGTCATGCACA 58

vgrG F GAGCTCTAGTTTGTATAATGGGGC 834 60 This

Study vgrG R CCACCTTTAACCACAAGTCCA 60

icmF F ACCATGCCCATTCTCCTTTA 803 59 This

Study icmF R TAGAAGTGGGCAAAGGCACT 60

hcp F CAAGCGGTGCATCTACTGAA 463 60 Harrison

et al.,

2014

hcp R TAAGCTTTGCCCTCTCTCCA 60

Chapter 3

72

3.3.3 Preparation of RNA Template

C. jejuni strains harboring T6SS were grown on Columbia blood agar (Oxoid, Basingstoke,

UK) supplemented with Campylobacter selective supplement (Skirrow) (Oxoid,

Basingstoke, UK) under microaerophilic conditions (6% O2, 12% CO2) for 48 hours at

42°C. 2 X 40mL sterile Mueller hinton broth was aliquoted into 2 X 50 mL Falcon tubes.

Lids of the falcon tubes were loosen to allow the broth to equilibrate to microaerophilic

environment. Tape was placed across the lids to secure them. Tubes were placed in a rack

in microaerophilic incubator. C. jejuni culture harvested with the help of sterile cotton swab

and later resuspended in 1mL MH broth in a 1.5mL Eppendorf tube. Measurement of OD

(590 nm). The amount of resuspended bacterial growth that would be required to make a

starting culture of broth at an OD 0.1 was calculated as;

(0.1/overnight OD) x 60 = volume of resuspended bacterial growth to add to 100 mL of

MH broth

Culture plates having 2x 24 wells were taken. 1 mL of sterile MH broth from the

microaerophilic cabinet was placed in one well of each of the 24 well plates. This was the

negative control to ensure that the broth is not contaminated. 60 mL of sterile MH broth

was placed in a sterile conical flask. The calculated volume of resuspended bacterial

growth was added to the broth to constitute OD of 0.1. 1 mL of MH broth containing

bacterial culture at OD 0.1 was carefully dispensed into each of the remaining wells in the

24 well plates. To investigate the effect of growth temperature on transcription of T6SS

genes, one 24 well plate was placed in the microaerobic incubator set to 42 oC. The second

plate was placed in a microaerobic chamber in a 37 oC incubator. Both plates were left for

incubation for 16 hours, after which RNA was harvested. To investigate the effect of pH,

cells grown in MH broth at 37 °C for 16 hours were harvested and exposed to MH adjusted

to pH3 (using Hydrochloric acid) for 10 minutes, after which RNA was harvested. For

acidic stress, pH3 was chosen because pH of stomach lies around 3 and Campylobacter

spp. usually do not survive at this pH.

Chapter 3

73

3.3.4 RNA Isolation

Before starting RNA isolation, bench top, Gilsons (especially barrels) and racks were

sprayed and cleaned with RNAseZap® RNAse decontamination solution (Ambion®

AM9780). DNAse and RNAse free collection tubes and sterile filter tips were used.

RNA was isolated using FastRNA Pro Blue Kit (Qbiogene, Inc, CA). In a 50 mL sterile

tube, 20 mL of bacterial culture was placed and cells were pelleted by centrifugation for

15 minutes at 2,800 rpm (x 1,500 g) at 4 oC. Supernatant was decanted and 1 mL of the

RNAproTM Solution was added to tube. By vigorous pipetting, cells were completely

resuspended. 1 mL of resuspended cells were transferred to blue-cap tube containing

Lysing Matrix B, which is provided with the kit. Tubes were tightly closed to avert spillage.

Sample tube was processed in Precellys® bead mill homogenizer at 6500 rpm for 40

seconds. Sample tubes removed and centrifugation was performed for 5 minutes at 12,000

x g at 4 oC. Liquid was transferred to new microcentrifuge tube. Transferred sample was

incubated for 5 minutes at room temperature to increase RNA yield. 300 µL of chloroform

was added to this sample and vigorously vortexed for 10 seconds. Incubation for 5 minutes

at room temperature to increase RNA purity. Centrifugation of tubes was performed for 5

minutes at 12,000 x g at 4 oC. The upper phase was transferred to new microcentrifuge tube

without disturbing the interphase. 500 µL of 100% chilled ethanol was added to sample,

for mixing tube was inverted 5 times and stored at -20 oC for minimum time period of 30

minutes. Centrifugation was performed for 15 minutes at 12,000 x g at 4 oC and supernate

was removed. After centrifugation, a white pellet of RNA appeared. Washing of pellet was

performed with 500 µL of 75% chilled ethanol (prepared with DEPC-H2O). Ethanol was

removed, pellet was air dried at room temperature for 5 minutes followed by resuspension

in 100 µL of DEPC-H2O. The contents were incubated for 5 minutes at room temperature

to facilitate RNA resuspension. RNA concentration was measured using Thermo Scientific

NanoDrop™ 1000 Spectrophotometer. RNA solution stored at -80 oC.

3.3.5 DNase Treatment of RNA Samples Prior to RT-PCR

For the removal of any DNA template in isolated RNA solution, RQ1 RNAse-Free DNAse

(Promega, USA, M6101) was used. DNase digestion reaction was set up as follows.

Chapter 3

74

To a RNAase and DNAase free microcentrifuge tube, 7 µL of RNA solution, 1 µL of the

RQ1 RNase-Free DNase 10X Reaction Buffer, 1u/ µg RNA of the RQ1 RNase-Free DNase

and Nuclease-free water was added to make a final volume of 10 µL. The reaction mixture

was incubated at 37 oC for 30 minutes. After incubation, 1 µL of the RQ1 DNase Stop

Solution was added to stop the reaction. For inactivation of DNase, reaction was incubated

at 65 oC for 10 minutes. The treated RNA was used in performing the RT-PCR reaction.

3.3.6 RT-PCR (Reverse Transcriptase PCR) for T6SS Conserved Genes

First-strand cDNA synthesis was performed using ThermoScript™ Reverse Transcriptase

(RT) (Invitrogen). The steps are as followed.

To a nuclease free microcentrifuge tube: 1 µL of Oligo (dT)20(50 µM), 5 µL of the total

RNA, 2 µL of 10mM dNTP Mix and volume made up to 12 µL with sterile, distilled water.

The mixture was incubated at 65 oC for 5 minutes and later placed on ice. Contents of the

tube were collected by short centrifugation. It was followed by addition of 4 µL of

5XcDNA Sythesis Buffer, 1 µL of the 0.1 M DTT, 1 µL of RNaseOUTTM , 1 µL sterile,

distilled water and 1 µL ThermoscriptTM RT. Contents of the tube were gently mixed and

incubated at 50 oC for 30 to 60 minutes. The reaction was terminated by incubating at 85

oC for 5 minutes.

PCR was performed for identifying the expression of VgrG, IcmF and Hcp (gltA was used

as a positive control). PCR reaction was performed in 25 µL reaction volume containing 2

µL cDNA from first-stand reaction, 4 µL 10XPCR Buffer, 3 µL 50mM MgCl2, 0.5 µL of

10 mM dNTP Mix, 1.5 µL of each of the primer (10 µM), 0.25 µL of Taq DNA polymerase

(5U/ µL), rest of the volume made with autoclaved, distilled water. Contents were gently

mixed. A negative RT control, containing all the RT-PCR reagents except reverse

transcriptase, for each of the tested gene and a routine PCR using genomic DNA was run

in parallel. Reaction was heated at 94 oC for 2 minutes to denature. PCR was performed

using T professional Trio Thermocycler (Biometra, Göttingen, Germany). The cycling

conditions were: 5 min at 94°C followed by 35 cycles of 1min at 94°C, 45 sec at 57°C and

1 min at 72°C followed by 5 min at 72°C. Amplified PCR products were resolved on 1.5%

agarose gel stained with SYBER Safe DNA stain. 100 bp DNA molecular weight size

marker (Fermentas, Lithuania, UAB) was used to determine the sizes of the PCR products.

Chapter 3

75

3.3.7 Distribution of C. jejuni Isolates harboring T6SS in Strain Clusters

Strain clusters of T6SS-positive C. jejuni isolates were predicted by two triplex PCR mixes

as described by Stabler et al. (2013). The primers used in predictive multiplex PCR are the

same as mentioned in Table 2.1 of Chapter 2. Thermo cycling was carried out in Bio-Rad

MJ mini thermal cycler subjected to the following conditions: 5 min at 94°C followed by

35 cycles of 30 sec at 94°C, 60 sec at 56°C and 2 min at 72°C followed by 10 min at 72°C.

PCR amplicons were resolved on 1.5% agarose gel stained with SYBER Safe DNA stain.

The gels were given a run at 100V for 40 minutes. 5 µL of the PCR product with 2 µL of

6X loading gel buffer (Fermentas, Lithuania, UAB) was loaded into each well.100 bp DNA

size marker (Fermentas, Lithuania, UAB) was employed to determine sizes of the PCR

amplicons. The gels were visualized using UV transilluminator and photographed under

UV light.

3.4 Results

3.4.1 Indication of T6SS in C. jejuni Isolates from Diverse Sources

Samples positive for the presence of C. jejuni included 34 human diarrheal (including 14

bloody diarrheal cases), 158 chicken, 122 cattle, 32 wastewater and 20 wildlife samples (2

lion, 11 duck, 4 ox and 3 black deer). Isolates were confirmed as C. jejuni by biochemical

tests and PCR for MDS and hipO as described in Chapter 1. Positive C. jejuni isolates were

screened for the presence of the T6SS. Figure 3.1 (A) shows hcp detection in C. jejuni

isolates and (B) the amplicons obtained from selected genes in the T6SS cluster (hcp, icmF

and vgrG) and the amplicon obtained from the gltA housekeeping gene. The T6SS positive

strain Cj255 (Harrison et al., 2014) was utilized as the positive control in this study.

Prevalence of the T6SS marker genes in C. jejuni isolates from diverse sources was found

to be 17/366 (4.64%). None of the human isolates tested in our study were positive for the

T6SS marker genes. However, absence of T6SS does not mark the strains as non- virulent,

they are still capable of causing diarrheal disease. T6SS has only been recently identified

as possible virulence factor and has been indicated in some severe bloody diarrheal cases

(Harrison et al., 2014). Isolates harboring T6SS and their respective sources are described

Chapter 3

76

in Table 3.2. Locations of different type of C. jejuni samples collected from different

sources is shown in Figure 3.2.

A

B

Figure 3.1 (A) hcp positive C. jejuni isolates. Lane 1- 1 kb ladder, Lane 2- hcp negative

strain, Lane 3 and 4, hcp positive strains, Lane 5- hcp positive control. B) Strain 255

showing T6SS conserved genes. 1.5% agarose gel showing PCR products of conserved

genes primers of T6SS. Lane 1- 1 Kb ladder, Lane 2- gltA used as an internal positive

control, Lane 3- hcp (463 bps), Lane 4- icmF (803 bps), Lane 5- vgrG (834 bps). C. jejuni

isolates positive for hcp were further screened for the presence of vgrG and icmF.

Chapter 3

77

Table 3.2 T6SS positive C. jejuni strains. T6SS-positive isolates from cattle included one

isolate each from bovine and camel and wildlife included one isolate each from lion, ox and

duck and from.

Sources hcp vgrG icmF Number of T6SS +ve Strains

Chickens + + + 7/158 (4.43 %)

Cattle (bovine, camel) + + + 2/122 (1.64 %)

Wildlife (lion, ox, duck) + + + 3/20 (15 %)

Waste water + + + 5/32 (15.6 %)

Humans - - - 0/34 (0%)

Total 17/366 (4.64 %)

Chapter 3

78

Figure 3.2 Map showing location of C. jejuni samples collected from different sources.

Bar length represents % age isolation rate of C. jejuni from different sources. Colors of the

bars indicate risk of association of the indicated sources with T6SS. Green – no risk

(Humans); yellow- moderate risk (Poultry); blue-low risk (Cattle); red and purple- high

risk (Wastewater and Wildlife).

Chapter 3

79

3.4.2 Gene Expression of T6SS Conserved Genes

Results of RT-PCR indicated that the T6SS genes hcp, icmF and vgrG were all expressed

in cultures grown for 16 hours at 37°C or 42°C, indicating of expression at both avian gut

temperature and human body temperature. In contrast, expression of these genes could not

be detected by RT-PCR when the 37°C cultures were exposed to pH3 conditions, i.e. acidic

envrionment (Figure 3.3).

PCR bands were scanned from the gel images and intensities were measured with

GelQuant.NET. The intensity of the band was related to the level of expression of the

corresponding gene. Relative expression was calculated as the difference in the band

intensity of T6SS gene exposed at particular condition and control gene (Figure 3.4).

Highly significant differences in expression of hcp and vgrG were observed at 37°C and

42°C. While significant difference in expression of icmF were observed at 37°C and 42°C.

Chapter 3

80

Figure 3.3 RT-PCR analysis of hcp, vgrG and icmF expression in strain 255

(a) Transcription of hcp at 37°C and 42°C: lane M, 100-bp ladder; lane 1, at 37°C; lane 2,

hcp -ve RT at 37°C; lane 3, at 42°C; lane 4, hcp -ve RT at 42°C; lane 5, genomic hcp; lane

6, no template control (b) Transcription of vgrG and icmF at 37°C and 42°C: lane M, 100-

bp ladder; lane 1, vgrG at 37°C; lane 2, vgrG -ve RT at 37°C; lane 3, icmF at 37°C; lane 4,

icmF -ve RT at 37°C; lane 5, vgrG at 42°C; lane 6, vgrG -ve RT at 42°C; lane 7, icmF at

42°C; lane 8, icmF -ve RT at 42°C, lane 9, genomic vgrG; lane 10, genomic icmF; lane 11,

no template control (c) Transcription of hcp, vgrG and icmF at 37°C and after exposure to

pH3: lane M, 100-bp ladder; lane 1, vgrG; lane 2, vgrG -ve RT; lane 3, genomic vgrG; lane

4, icmF; lane 5, icmF -ve RT; lane 6, genomic icmF; lane 7, hcp; lane 8, hcp -ve RT; lane

9, genomic hcp; lane 10, no template control.

Chapter 3

81

Figure 3.4 Differential expression of T6SS conserved genes. Transcription of hcp, vgrG

and icmF was observed at 37°C, 42°C and at 37°C after exposure to pH3 by RT-PCR.

0

0.2

0.4

0.6

0.8

1

1.2

hcp vgr icm

Rel

ati

ve

Exp

ress

ion

T6SS Genes

37

42

pH3* ***

*** * p < 0.05

** p < 0.005

*** p < 0.0005

Chapter 3

82

3.4.3 Strain Clusters of T6SS +ve C. jejuni Isolates

T6SS +ve C. jejuni isolates were assigned to strain clusters on the basis of the absence or

presence of PCR products from DNA sequences linked with the source attribution of C.

jejuni. The results of the predictive mPCR assays are shown in Figure 3.3. C. jejuni isolates

harboring the T6SS in our study were present in C4/C6, C7/C8 and C9 strain groups (Table

3.3). The relationship of livestock and non-livestock associated strains which possessed the

T6SS is shown as a phenogram (Figure 3.6).

Figure 3.5 Multiplex PCR for Prediction of Strain Clusters. lane M, 100-bp ladder; lane

1, strain I1 (chicken); lane 2, 83 (buffalo); lane 3, 56 (camel); lane 4, 192 (wastewater);

lane 5, 77(chicken); lane 6, positive control; lane 7, no template control. (a) mPCR1

involved amplicons based on CDSs Cj1422, Cj1139 and Cj0056. (b) mPCR2 involved

amplicons based on CDSs Cj1324, Cj1720 and Cj0485. Strain C. jejuni 11168 was used as

a positive control. The presence or absence of these amplicons was used to predict the

strain cluster location of T6SS positive isolates.

Chapter 3

83

Table 3.3 Strain cluster attribution by predictive PCR. Multiplex PCR for marker CDSs

scored for presence or absence of their respective amplicons. 0 = PCR product negative, 1 = PCR

product positive, ? = with distinct PCR profile not falling in any specified predicted group.

Strains cj0056c

(415 bp)

cj0485c

(406 bp)

cj1139c

(703 bp)

cj1324

(765 bp)

cj1422

(900 bp)

cj1720

(595 bp)

Predicted

Groups

I1 (Chicken) 1 1 0 1 0 1 C4/C6

2PI(Chicken) 0 1 0 1 0 1 C7/C8

19(Chicken) 0 1 0 1 0 1 C7/C8

77(Chicken) 1 1 0 1 0 1 C4/C6

86(Chicken) 1 1 0 1 0 1 C4/C6

152(Chicken) 0 1 0 1 0 1 C7/C8

255(Chicken) 0 1 0 1 0 1 C7/C8

25 (Duck) 0 1 0 0 0 1 C7/C8

75 (Ox) 0 1 0 0 0 1 C7/C8

83(Buffalo) 1 1 0 0 0 1 C9

56(Camel) 0 1 0 0 0 0 ?

72(Lion) 0 1 0 0 0 1 C9

159

(Wastewater)

0 1 0 1 0 1 C7/C8

192

(Wastewater)

0 1 0 0 0 0 ?

203

(Waste water)

1 1 0 0 0 0 C9

226

(Waste water)

0 1 0 0 0 1 C7/C8

236

(Waste water)

0 1 0 1 0 1 C7/C8

Chapter 3

84

Figure 3.6 Phenogram displaying clusters of T6SS possessing C. jejuni strains.

Phylogram generated on binary data of PCR profiles by UPGMA using Pearson coefficient

(r) with distance value (d= (1-r)*100). Red branch – livestock (chicken associated); Green

branch – wild life; Blue branch – livestock (bovine); Dashed branch –

unknown/intermediate strain group (i.e. neither in livestock nor in non-livestock identified

groups).

Chapter 3

85

3.5 Discussion

We have shown the presence of C. jejuni strains harboring T6SS marker genes from diverse

sources in Pakistan, gene expression of T6SS conserved genes and the allocation of T6SS

positive strains to appropriate clusters. Less data is available on the incidence of C. jejuni

in Pakistan and there has been a single report on C. jejuni T6SS positive strains from this

region (Harrison et al., 2014).

351 C. jejuni strains were investigated by screening PCR for the presence of hcp, icmF and

vgrG conserved genes of T6SS. Isolates from human diarrheal, chicken, cattle, wastewater

and wildlife sources from different cities of Pakistan were analyzed. The occurrence of

T6SS in our analysed C. jejuni isolates was approximately 5% which is lower than

previously reported prevalence of T6SS in C. jejuni isolates from different parts of the

world i.e., 10% (Bleumink-Pluym et al., 2013), 26.5% (Harrison et al., 2014) and 14 %

(Ugarte- Ruiz et al., 2014) .

The major reservoirs of C. jejuni are poultry, and C. jejuni isolates harboring the hcp

marker have been shown to be associated with chickens (Harrison et al., 2014). Our results

show that C. jejuni positive T6SS strains could also be isolated from bovines, camels,

ducks, wildlife (lion, ox) and from waste water. Previous reports have indicated that C.

jejuni has multiple survival strategies and can survive and multiply under diverse

environmental conditions (Moen et al., 2005; Joshua et al., 2006; Vegge et al., 2012).

In a previous report hcp is reported to be significantly associated with isolates from patients

who present with a bloody diarrhea (Harrison et al., 2014). However in our study all human

isolates, including 14 bloody diarrheal isolates, we tested were negative for the presence

of hcp, icmF, vgrG suggesting they lacked T6SS. T6SS presence was confirmed by similar

technique as followed by Harrison et al., 2014. It shows that absence of T6SS does not

mark the strains as non-virulent and they are still capable of causing diarrhea. Presence of

T6SS marks the strains as hypervirulent.

Gene expression analysis revealed that T6SS conserved genes are expressed at both human

body temperature (37°C) and avian temperature (42°C). While no expression was observed

at low pH (pH3) implying that T6SS is down regulated in an acidic environment and this

down-regulation of the T6SS may serve as a mechanism for assuring T6SS-harboring C.

jejuni survival in the gut (Lertpiriyapong et al., 2012). The optimum pH for the growth of

Chapter 3

86

Campylobacter spp. ranges from 6.5–7.5 and the pH of gastrointestinal tract ranges from

1.5-3.0 (stomach), 4.0-5.0 (duodenum), 6.5-7.5 (jejunum and ileum) and previous

observations have shown that Campylobacter spp. cannot survive usually below pH of 4.9

or above pH 9.0 (Keener et al., 2004; Curtis, 2007). Currently there is insufficient

understanding of T6SS in C. jejuni and its regulation in gut, but it can be inferred from the

existing studies that T6SS harbouring C. jejuni can possibly survive in low pH conditions

and once the pH restriction is relaxed, expression of T6SS genes is restored.

Strain cluster allocation linked with livestock or non-livestock association of isolates

harboring T6SS by multiplex PCR showed that most of them 6/17 (35.29 %) fell into

cluster C7/C8. The remainder of the strains i.e. 11/17 were equally (17.64 % in each

cluster) distributed in the C4/C6, C7/C8 and C9 clusters with the exception of one camel

and one wastewater isolate with distinct PCR profile that could not be allocated to any of

the existing strain clusters (Table 4). Groups C7/C8-C9 were originally demonstrated as

the non-livestock associated by Champion et al. (2005). It suggests that T6SS may be

involved in bacterial survival and competition in a particular environment. CDS Cj1324,

encoding WbpG (LPS biosynthesis protein) are within O-linked glycosylation locus

(Cj1293-Cj1342) (Stabler et al., 2013). Moreover the flagellin O-glycosylation locus

(Cj1321-Cj1326) serves as a indicator for the livestock (chicken)-associated strains

(Champion et al., 2005), all of the T6SS positive chicken derived isolates and two waste

water isolates were positive for the Cj1324 marker implying their predominant association

with livestock (chicken). In addition to this, previous studies have shown flagellin O-

glycosylation may serve an important role in the cell invasion and consequently for

virulence in humans (Zautner et al., 2012). Our analysis shows that although there is

association of T6SS positive strains with livestock, they can also be linked to non-

agricultural and non-domesticated sources. Further studies are required to investigate

association of T6SS possessing strains with particularly non-livestock sources. According

to Bleumink-Pluym et al. (2013), varied alignment of the T6SS genes within T6SS clusters

of diverse Campylobacter spp. may contribute in the adaptation to particular niches or

hosts. We have not analyzed in our study the arrangement of T6SS genes linked to host or

niche adaptation but we can infer from our results that T6SS positive strains can be linked

Chapter 3

87

to specific source and its adaptation to particular environment by the presence or absence

of specific coding DNA sequences which also confer their strain clusters.

Substantially our study depicts the prevalence of T6SS harboring C. jejuni strains in

livestock as well as in non-livestock sources; gene expression of conserved T6SS genes

and strain cluster attribution of these T6SS possessing strains. As this is one of the pioneer

studies on T6SS from South Asia particularly in Pakistan, the study would assist to explore

through further studies in providing insight into the understanding of survival of C. jejuni

isolates harboring T6SS and more importantly what sources can act as potential reservoir

of T6SS +ve C. jejuni strains and are of public health concern.

Conclusions

88

Conclusions

Conclusions

89

The results of the overall research of this thesis confirm that C. jejuni can survive well in

different environments including wildlife and non-livestock. Therefore, they are of public

health concern. Seasonal variation and climatic conditions may play a role in different rates

of isolation from different cities. Surveillance data from this study will be useful in

identifying risk factors that are involved in the spread of C. jejuni in Pakistan.

Antibiotic susceptibility profiling of C. jejuni isolates of this study revealed that antibiotic

resistant C. jejuni is common among poultry and cattle which can enter the food chain and

thus can pose a threat to public health. Present results emphasize the need for a surveillance

and monitoring system in developing countries like ours, for the monitoring of the spread

of antimicrobial resistance among Campylobacter jejuni in broiler, poultry and other food

animals.

Source tracking and strain clustering of C. jejuni isolates from diverse sources showed that

the recently developed predictive multiplex PCR assay can be employed to demonstrate

whether a particular clinical isolate has originated from livestock or non-livestock sources.

Current results from our region predicted that majority of clinical isolates seemed to be

from non-livestock or nonagricultural sources. Water contamination is common source for

C. jejuni. This is particularly important in case of floods when there are greater chances of

water contamination and diarrheal outbreaks.

Surveillance of T6SS in C. jejuni isolates from this study shows that although there is

association of T6SS positive strains with livestock, they can also be linked to non-

agricultural sources. Further studies are required to investigate association of T6SS

possessing strains with particularly non-livestock sources. Down-regulation of T6SS in an

acidic environment was demonstrated in this study. Results from the present study

questions the role of the T6SS in human diarrhoeal disease. Our study highlights the need

to establish the role of the T6SS in environmental survival or virulence.

Overall, C. jejuni is prevalent in developing countries like Pakistan but due to lack of

national survey programmes and national reference labs for Campylobacter spp. there is

lack of data in our country to assess and compare the severity of the problem with rest of

the world. In view of the complicated epidemiology of C, jejuni, a multifarious approach

to control is required, which takes into account the attribution of various reservoirs,

pathways, comparative exposures or risk assessment and risk factor modelling.

References

90

References

Aarestrup, F.M., and Wegener, H.C. (1999). The effects of antibiotic usage in

food animals on the development of antimicrobial resistance of importance for humans in

Campylobacter and Escherichia coli. Microb. Infect. 1: 639-644.

Adnan, A. (2010). Study of the Mode of Transmission and Control of

Helicobacter and Campylobacter Infections in Karachi, Pakistan. PhD thesis.

Ali, A.M., Qureshi, A.H., Rafi, S., Roshan, E., Khan, I., Malik, A.M., and

Shahid, S.A. (2003). Frequency of Campylobacter jejuni in diarrhea/dysentery in children

in Rawalpindi and Islamabad. J. Pak. Med. Ass. 53: 517.

Allos, B.M. (2001). Campylobacter jejuni infections: update on emerging issues

and trends. Clin. Infect. Dis. 32: 1201-1206.

Altekruse, S.F., Stern, N. J., Fields, P. I., and Swerdlow, D. L. (1999).

Campylobacter jejuni-an emerging foodborne pathogen. Emerg. Infect. Dis. 5: 28–35.

Anders, B.J., Lauer, B.A., Paisley, J.W., and Rely, L.B. (1982). Double blind

placebo controlled trail of erythromycin for treatment of Campylobacter enteritis. Lancet.

1: 131-132.

Anonymous. (2006). The Community summary report on trends and sources of

zoonoses, zoonotic agents, antimicrobial resistance and foodborne outbreaks in the

European Union in 2006. EFSA. J. 130: 106–352.

Atanassova, v. ring ch. (2000). Proof of Campylobacter spp. by RFLP analysis

and PCR amplified fragment for the 16S rRNA. S383-388th in: 41 working session of the

working group on food hygiene dvg, Garmisch-Partenkirchen. Germany.

Aubert, D.F., Flannagan, R.S., Valvano, M.A., (2008). A novel sensor

kinaseresponse regulator hybrid controls biofilm formation and type VI secretion system

activity in Burkholderia cenocepacia. Infect. Immun. 76: 1979-1991.

Aubert, D.F., Flannagan, R.S., Valvano, M.A., (2008). A novel sensor

kinaseresponse regulator hybrid controls biofilm formation and type VI secretion system

activity in Burkholderia cenocepacia. Infect. Immun. 76: 1979-1991.

Avrain, L., Humbert, F., L’Hopsitalier, R., Sanders, P., Vernozy- Rozand, C.,

and Kempf, I. (2003). Antimicrobial resistance in Campylobacter from broilers:

association with production type and antimicrobial use. Veter. Microbiol. 96: 267-276.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Altekruse%20SF%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Stern%20NJ%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Fields%20PI%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Swerdlow%20DL%5Bauth%5D

References

91

Aydon, F., Atabay, H. I., and Akan, M. (2001). The isolation and characterization

of Campylobacter jejuni subsp. jejuni from domestic geese. J. Appl. Microbiol. 90: 637-

642.

Bacon, D.J., Alm, R.A., Burr, D.H., Hu, L., Kopecko, D.J., Ewing, C.P., Trust,

T.J. and Guerry, P. (2000). Involvement of a plasmid in virulence of Campylobacter

jejuni 81-176. Infect. Immun. 68: 4384-4390.

Baker, M.G., Sneyd, E., and Wilson, N.A. (2007). Is the major increase in

notified campylobacteriosis in New Zealand real? Epidemiol. Infect. 135: 163-170.

Bang, D.D., Møller Nielsen, E., Scheutz, F., Pedersen, K., Handberg, K., and

Madsen, M. (2003). PCR detection of seven virulence and toxin genes of Campylobacter

jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal

distending toxin production of the isolates. J. Appl. Microbiol. 94: 1003–1014.

Basler, M., and Mekalanos, J.J. (2012). Type 6 secretion dynamics within and

between bacterial cells. Science 337: 815.

Basler, M., Ho, B. T., and Mekalanos, J. J. (2013). Tit-for-tat: type VI secretion

system counterattack during bacterial cell-cell interactions. Cell 152: 884-94.

Bester, L. A., and Essack, S. Y. (2008). Prevalence of antibiotic resistance in

Campylobacter isolates from commercial poultry suppliers in KwaZulu-Natal, South

Africa. J. Antimicrob. Chemother. 62: 1298-1300.

Bhavsar, S.P., and Kapadnis, B.P. (2007). Virulence factors of Campylobacter.

The Internet. J. Microbiol. 3.

Black, R.E., Levine, M.M., Clements, M.L., Hughes, T.P., and Blaser, M.J.

(1988). Experimental Campylobacter jejuni infection in humans. J. Infect. Dis. 157: 472–

479.

Blaser, M.J. (1982). Campylobacter jejuni and food. Food. Technol. 36: 89-92.

Blaser, M.J. (1984). Campylobacter eneteritis in infectious diarrheal diseases:

Current concepts and laboratory procedures. Eds Ellner PD, Laskin AI and Mateles RI.

NewYork, Marcel Dekker Inc: 1-12.

Blaser, M.J. (1997). Epidemiologic and clinical features

of Campylobacter jejuni infections. J. Infect. Dis. 176 Suppl 2:S103-5.

http://iai.asm.org/search?author1=David+J.+Bacon&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Richard+A.+Alm&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Don+H.+Burr&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Lan+Hu&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Dennis+J.+Kopecko&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Cheryl+P.+Ewing&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Trevor+J.+Trust&sortspec=date&submit=Submit

http://iai.asm.org/search?author1=Patricia+Guerry&sortspec=date&submit=Submit

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=10899834&dopt=Abstract

http://www.ncbi.nlm.nih.gov/pubmed/9396691

References

92

Blaser, M.J. (1998). Campylobacter fetus - emerging infection and model

system for bacterial pathogenesis at mucosal surfaces. Clin. Infect. Dis. 27: 256-258.

Blaser, M.J., and Engberg J. (2008). Clinical aspects of Campylobacter jejuni

and Campylobacter coli infections. In: Nachamkink I, Szymanski CM, Blaser MJ, editors.

Campylobacter. Third ed. Washington, D.C.: ASM Press; 99-121.

Bleumink-Pluym, N. M. C., van Alphen, L. B., Bouwman, L. I., Wösten, M.

M. S. M., and van Putten. J. P. M. (2013). Identification of a Functional Type VI Secretion

System in Campylobacter jejuni Conferring Capsule Polysaccharide Sensitive

Cytotoxicity. PLoS. PATHOG. 9: e1003393.

Blondel, C.J., Jimenez, J.C., Contreras, I., and Santiviago, C.A., (2009).

Comparative genomic analysis uncovers 3 novel loci encoding type six secretion systems

differentially distributed in Salmonella serotypes. BMC. Genom. 10: 354.

Bolton, F.J., and Coates, D. (1983). A comparison of microaerobic systems for

the culture of Campylobacter jejuni and Campylobacter coli. Eur. J. Clin. Microbiol. 2:

105–110.

Bolton, F.J., Coates, D., Hutchinson, D.N., and Godfree, A.F. (1987). Study of

thermophilic Campylobacters in a river system. J. Appl. Microbiol. 62: 167–176.

Bonemann, G., Pietrosiuk, A., Diemand, A., Zentgraf, H., and Mogk, A.

(2009). Remodelling of VipA/VipB tubules by ClpV-mediated threading is crucial for type

VI protein secretion. EMBO. J. 28: 315-325.

Boyer, F., Fichant, G., Berthod, J., Vandenbrouck, Y., and Attree, I. (2009).

Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what

can be learned from available microbial genomic resources? BMC. Genom. 10: 104.

Brandl, M.T., Haxo, A.F., Bates, A.H., and Mandrell, R.E. (2004). Comparison

of survival of Campylobacter jejuni in the phyllosphere with that in the rhizosphere of

spinach and radish plants. Appl. Environ. Microbiol. 70: 1182-1189.

Butzler, J.P. (2004). Campylobacter, from obscurity to celebrity. Clin.

Microbiol. Infect. 10: 868–876.

Cardarelli-Leite, P., Blom, K., Patton, C., Nicholson, M. A., Steingerwalt, A.

G., Hunter, S. B., Brenner, D. J., Barret, T. J., and Swaminathan, B. (1996). Rapid

References

93

identification of Campylobacter species strains by Restriction Fragment Length

Polymorphism analysis of a PCR - amplified fragment of the gene coding for 16S rRNA.

J. Clin. Microbiol. 34: 62-67.

Carter, A.M., Pacha, R.E., Clark, G.W., and Williams, E.A. (1987). Seasonal

occurrence of Campylobacter spp. in surface waters and their correlation with standard

indicator bacteria. Appl. Environ. Microbiol. 53: 523-526.

Cascales, E., and Cambillau, C. (2008). The type VI secretion toolkit. EMBO.

Rep. 9: 735-741.

Champion, O. L., Gaunt, M. W., Gundogdu, O., Elmi, A., Witney, A., Hinds,

J., Dorrell, N., and Wren, B. W. (2005). Comparative phylogenomics of the food borne

pathogen Campylobacter jejuni reveals genetic markers predictive of infection source.

Proc. Natl. Acad. Sci. USA. 160: 43-48.

Cloak, O.M., Duffy, G., Sheridan, J.J., Blair, I.S., and McDowell, D.A. (2001).

A survey on the incidence of Campylobacter spp. and the development of surface adhesion

polymerase chain reaction assay for the detection of Campylobacter jejuni in retail meat

production. Food. Microbiol. 18: 287-298.

Coker, A.O., Isokpehi, R.D., Thomas, B.N., Amisu, K.O., and Obi, C.L.

(2002). Human campylobacteriosis in developing countries. Emerg. Infect. Dis. 8: 237-

244.

Coulthurst, S.J. (2013). The Type VI secretion system - a widespread and

versatile cell targeting system. Res. Microbiol. 164: 640-54.

Curtis, L. (2007). Campylobacter.

http://www.foodsafetywatch.com/public.cfm.

Das. S., Chakrabortty, A., Banerjee, R., and Chaudhuri K. (2002). Involvement

of in vivo induced icmF gene of Vibrio cholerae in motility, adherence to epithelial cells,

and conjugation frequency. Biochem. Biophys. Res. Commun. 295: 922–928.

Daskalov, H., and Maramski, A. (2012). Prevalence and factors affecting the

presence of Campylobacter spp. In broiler carcasses in Bulgaria. Turk. J. Vet. Anim.

Sci. 36: 539-545.


References

94

Dasti, J.I., Tareen, A.M., Lugert, R., Zautner, A.E., and Gross, U. (2010).

Campylobacter jejuni: a brief overview on pathogenicity-associated factors and disease-

mediating mechanisms. Int. J. Med. Microbiol. 300: 205–11.

Debruyne, L., Gevers, D., and Vandamme, P. (2008). Taxonomy of the Family

Campylobacteraceae. In: Nachamkin I, Szymanski CM, Blaser MJ, editors.

Campylobacter. 3rd ed. Washington, DC: ASM Press. 3-25.

Decoin, V., Barbey, C., Bergeau, D., Latour, X., Feuilloley, M.G.J., Orange,

N., Meriaeu, A. (2014). A Type VI Secretion System Is Involved in Pseudomonas

fluorescens Bacterial Competition. PLoS. ONE. 9: e89411.

Dingle, K.E., Colles, F.M., Wareing, D.R., Ure, R., Fox, A.J., Bolton, F.E. et

al. (2001). Multilocus sequence typing system for Campylobacter jejuni. J. Clin.

Microbiol. 39: 14-23.

Doorduyn, Y., Van Den Brandhof, W.E., Van Duynhoven, Y.T., Breukink,

B.J., Wagenaar, J.A., and Van Pelt, W. (2010). Risk factors for indigenous Campylobacter

jejuni and Campylobacter coli infections in the Netherlands: a case–control study.

Epidemiol. Infect. 138: 1391–404.

Dorrell, N., Hinchliffe, S.J., and Wren, B.W. (2005). Comparative

phylogenomics of pathogenic bacteria by microarray analysis. Curr. Opin. Microbiol. 8:

620-626.

Doyle, M.P., and Roman, D.J. (1982). Response of Campylobacter jejuni to

sodium chloride. App. Env. Microbiol. 43: 561–565.

EFSA, European Food Safety Authority. (2010). Scientific report of EFSA.

The Community Summary Report on antimicrobial resistance in zoonotic and indicator

bacteria from animals and food in the European Union in 2004-2007. EFSA. Journ. 8:

1309.

Endtz, H.P., Ruijs, G.J., Vanklingeren, B., Jansen, W.H., Vanderreyden, T.,

and Mouton, R.P. (1991). Quinolone resistance in Campylobacter isolated from man and

poultry following the introduction of fluoroquinolones in veterinary medicine. J.

Antimicrob. Chemother. 27: 199-208.

References

95

Engberg, J., Aarestrup, F.M., Taylor, D.E., Gerner-Smidt, P., and Nachamkin,

I. (2001) Quinolone and macrolide resistance in Campylobacter jejuni and C. coli:

resistance mechanisms and trends in human isolates. Emerg. Infect. Dis. 7: 24-34.

Engberg, J., Neimann, J., Nielsen, E.M., Aerestrup, F.M., and Fussing, V.

(2004). Quinolone-resistant Campylobacter infections: risk factors and clinical

consequences. Emerg. Infect. Dis. 10: 1056-1063.

Ethelberg, S., Simonsen, J., Gerner-Smidt, P., Olsen, K.E., and Molbak, K.

(2005). Spatial distribution and registry-based case-control analysis of Campylobacter

infections in Denmark, 1991-2001. Am. J. Epidemiol. 162: 1008-1015.

Farnell, M. B., Donoghue, A. M., Cole, K., Reyes-Herrera, I., Blore, P. J., and

Donoghue, D. J. (2005). Campylobacter susceptibility to ciprofloxacin and corresponding

fluoroquinolone concentrations within the gastrointestinal tracts of chickens. J. Appl.

Microbiol. 99: 1043-1050.

Feizabadi, M. M., Dolatabadi, S., and Zali, M. R. (2007). Isolation and drug

resistance patterns of Campylobacter strains cultured from Diarrheic children in Tehraan.

Jpn. J. Infect. 60: 217-219.

Fernandez, H., Vergara, M., and Tapia, F. (1985). Desiccation resistance in

thermotolerant Campylobacter species. Infection 13: 197.

Fernández-Cruz, A., Muñoz, P., Mohedano, R., Valerio, M., Marín,

M., Alcalá, L., Rodriguez-Créixems, M., Cercenado, E., and Bouza, E. (2010).

Campylobacter bacteremia: clinical characteristics, incidence, and outcome over 23 years.

Medicine (Baltimore). 89: 319-330.

Fitzgerald, C., and Nachamkin, I. (2007). Campylobacter and Arcobacter. In:

Murray, P.R., Baron, E.J., Jorgensen, J.H., Landry, M.L., Pfaller, M.A., editors. Manual of

Clinical Microbiology. 9th ed. Washington, D.C. ASM Press, 933-946.

Fitzgerald, C., Wichard, J., and Nachamkin, I. (2008). Diagnosis and

antimicrobial susceptibility of Campylobacter species. In: Nachamkin I, Szymanski CM,

Blaser MJ, editors. Campylobacter. 3rd ed. Washington, D.C.: ASM Press, 227-243.

Flanagan, R.C., Neal-McKinney, J.M., Dhillon, A.S., Miller, W.G., Konkel,

M.E. (2009). Examination of Campylobacter jejuni putative adhesins leads to the

http://www.ncbi.nlm.nih.gov/pubmed?term=Valerio%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Mar%C3%ADn%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Mar%C3%ADn%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Alcal%C3%A1%20L%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Rodriguez-Cr%C3%A9ixems%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Cercenado%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

http://www.ncbi.nlm.nih.gov/pubmed?term=Bouza%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20827109

References

96

identification of a new protein, designated FlpA, required for chicken colonization. Infect.

Immun. 77: 2399-2407.

Fliegelman, R.M., Petral, R.M., Goodman, L.J., Segreti, J., Trenholme, G.M.,

and Kaplan, R.L. (1985). Comparative in vitro activities of twelve antimicrobial agents

against Campylobacter species. Antimicrob. Agents. Chemother. 27: 429-430.

Florin, I., and Antillon, F. (1992). Production of enterotoxin and cytotoxin in

Campylobacter jejuni strains isolated in Costa Rica. J. Med. Microbiol. 37:22-9.

French, N.P., Midwinter, A., Holland, B., Collins-Emerson, J., Pattison, R.,

Colles, F., and Carter, P. (2009). Molecular epidemiology of Campylobacter jejuni isolates

from wild-bird fecal material in children's playgrounds. Appl. Environ. Microbiol. 75: 779-

783.

Friedman, C. R., Neimann, J., Wegener, H. C., and Tauxe R. V.

(2000). Epidemiology of Campylobacter jejuni infections in the United States and other

industrialized nations, in Campylobacter, 2nd Edn, eds Nachamkin I., Blaser M. J., editors.

(Washington, DC: American Society for Microbiology), 121–138.

Fry, B.N., Feng, S., Chen, Y., Newell, D.G., Coloe, P.J., and Korolik, V.

(2000). The galE gene of Campylobacter jejuni is involved in Lipopolysaccharide

synthesis and virulence. Infect. Immun. 68: 2594–2601.

Ghafir, Y., China, B., Dierick, K., De Zutter, L., and Daube, G. (2007). A seven-

year survey of Campylobacter contamination in meat at different production stages in

Belgium. Int. J. Food. Microbiol. 116: 111-120.

Ghane, M., Moein, F., and Massoudian, S. (2012). The first isolation of

Campylobacter jejuni from Caspain Sea’s water. Adv. Studies. Biol. 4: 407-418.

Gibreel, A., and Taylor, D.E. (2006). Macrolide resistance in Campylobacter

jejuni and Campylobacter coli. J. Antimicrob. Chemother. 58: 243-255.

Godschalk, P. C., Heikema, A.P., Gilbert, M., Komagamine, T., Ang, C.W.,

Glerum, J., Brochu, D., Li, J., Yuki, N., Jacobs, B.C.,van Belkum, A., and Endtz,

H.P. (2004). The crucial role of Campylobacter jejuni genes in anti-ganglioside antibody

induction in Guillain-Barre syndrome. J. Clin. Investig. 114: 1659-1665.


References

97

González-Hein, G., Huaracán, B., García, P., and Figueroa, G. (2013).

Prevalence of virulence genes in strains of Campylobacter jejuni isolated from human,

bovine and broiler. Brazil. Journ. Microbiol. 44: 1223-1229.

Griggs, D.J., Peake, L., Johnson, M.M., Ghori, S., Mott, A., and Piddock, L.V.

(2009). Β-Lactamase-Mediated β-Lactam Resistance in Campylobacter Species:

Prevalence of Cj0299 (blaOXA-61) and Evidence for a Novel β-Lactamase in C. jejuni.

Antimicrob. Agents. Chemother. 53: 3357-3364.

Hakanen, A., Jousimies-Somer, H., Siitonen, A., Huovinen, P., and Kotilainen,

P. (2003). Fluoroquinolone resistance in Campylobacter jejuni isolates in travelers

returning to Finland: association of ciprofloxacin resistance to travel destination. Emerg.

Infect. Dis. 9: 267-270.

Hakanen, A.J., Lehtopolku, M., Siitonen, A., Huovinen, P., and Kotilainen, P.

(2003). Multidrug resistance in Campylobacter jejuni strains collected from Finnish

patients during 1995-2000. J. Antimicrob. Chemother. 52: 1035-1039.

Hakkinen, M., Nakari, U., and Siitonen, A. (2007). Chickens and Cattle as

Sources of Sporadic Domestically Acquired Campylobacter jejuni Infections in Finland.

Appl. Environ. Microbiol. 75: 5244–5249.

Han, J., Sahin, O., Barton, Y. W., and Zhang, Q. (2008). Key role of Mfd in the

development of fluoroquinolones resistance in Campylobacter jejuni. PLoS. Pathog. 4:

e1000083.

Harris, N.V., Weiss, N.S., and Nolan, C.M. (1986). The role of poultry and meats

in the etiology of Campylobacter jejuni/coli enteritis. Am. J. Public. Health. 76: 407-411.

Harrison, J. W., Dung, T. T. N., Siddiqui, F., Korbrisate, S., Bukhari, H, Tra, M.

P. V., Hoang, N. V. M., Carrique-Mas, J., Bryant, J., Campbell, J. I., Studholme, D. J.,

Wren, B. W., Baker, S., Titball, R.W., and Champion, O. L. (2014). Identification of

possible virulence marker from Campylobacter jejuni isolates. Emerg. Infect. Dis. 20:

1026-1029.

Hazelegar, W.C., Wouters, J.A., Rombouts, F.M., and Abee, T. (1998).

Physiological activity of Campylobacter jejuni far below the minimal growth temperature.

Appl. Environ. Microbiol. 64: 917–3922.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hakkinen%20M%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Nakari%20UM%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Siitonen%20A%5Bauth%5D

References

98

Helms, M., Simonsen, J., Olsen, K.E.P., and Mølbak, K. (2005). Adverse health

events associated with antimicrobial drug resistance in Campylobacter species: a registry-

based cohort study. J. Infect. Dis. 191: 1050-5.

Hendrixson, D.R., and DiRita, V.J. (2004). Identification of Campylobacter

jejuni genes involved in commensal colonization of the chick gastrointestinal tract. Mol.

Microbiol. 52: 471–484.

Hepworth, P.J., Ashelford, K.E., Hinds, J., Gould, K.A., Witney, A.A., Williams,

N.J., Leatherbarrow, H., French, N.P., Birtles, R.J., Mendonca, C., Dorrell, N., Wren,

B.W., Wigley, P., Hall, N., Winstanley, C. (2011). Genomic variations define divergence

of water/wildlife-associated Campylobacter jejuni niche specialists from common clonal

complexes. Environ. Microbiol. 13: 1549-1560.

Hickey, T. E., Majam, G., and Guerry, P. (2005). Intracellular survival

of Campylobacter jejuni in human monocytic cells and induction of apoptotic death by

cytholethal distending toxin. Infect. Immun. 73: 5194–5197.

Hill, D.R., Ericsson, C.D., Pearsons, R.D., Keystone, J.S., Freedman, D.O.,

Kozarsky, P.E., DuPont, H.L., Bia, F.J., Fischer, P.R., and Ryan, E.T., Infectious Diseases

Society of America. (2006). The practice of travel medicine: guidelines by the Infectious

Diseases Society of America. Clin. Infect. Dis. 43: 1499-1539.

Hofreuter, D., Tsai, J., Watson, R.O., Novik, V., Altman, B., Benitez, M., Clark,

C., Perbost, C., Jarvie, T., Du, L., and Galán, J.E. (2006). Unique features of a highly

pathogenic Campylobacter jejuni strain. Infect. Immun. 74: 4694-707.

Holland, I.B., (2010). The extraordinary diversity of bacterial protein secretion

mechanisms. Methods Mol. Biol. 619: 1-20.

Honda, T., Miwatani, T., Mizuno, S., Maki, S. (1986). Serum antibodies reacting

with Escherichia coli heat-labile enterotoxin in sera of patients suffering from

Campylobacter jejuni infection. FEMS Microbiol. Lett. 36: 53-55.

Horrocks, S.M., Anderson, R.C., Nisbet, D.J., and Ricke, S.C. (2009). Incidence

and ecology of Campylobacter jejuni and coli in animals. Anaerobe 15: 18–25.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hofreuter%20D%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Tsai%20J%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Watson%20RO%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Novik%20V%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Altman%20B%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Benitez%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Clark%20C%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Clark%20C%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Perbost%20C%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Jarvie%20T%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Du%20L%5BAuthor%5D&cauthor=true&cauthor_uid=16861657

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gal%C3%A1n%20JE%5BAuthor%5D&cauthor=true&cauthor_uid=16861657


References

99

Howard, S.L., Gaunt, M.W., Hinds, J., Witney, A.A., Stabler, R., and Wren,

B.W. (2006). Application of comparative phylogenomics to study the evolution of Yersinia

enterocolitica and to identify genetic differences relating to pathogenicity. J. Bacteriol.

188: 3645-3653.

Humphrey, T., O’Brien, S., and Madsen, M. (2007). Campylobacters as zoonotic

pathogens: A food production perspective. Int. J. Food. Microbiol. 117: 237-257.

Hussain, I., Shahid, M. M., Akhtar, M., and Khan, A. (2007). Prevalence

of Campylobacter species in meat, milk and other food commodities in Pakistan. Food

Microbiol. 24: 219–222.

Ibrahim, N.G., Zafar, A., and Hasan, R. (2004). Evaluation of frequency of

isolation and trends in antibiotic resistance among Campylobacter isolates over 11 year

period. J. Pak. Med. Assoc. 54: 291-4.

Ishikawa, T., Sabharwal, D., Bröms, J., Milton, D. L., Sjöstedt, A., Bernt Eric

Uhlin, B. E., and Waiet S. N. (2012). Pathoadaptive conditional regulation of the type VI

secretion system in Vibrio cholerae O1 strains. Infect. Immun. 80: 575–584.

Janssen. R., Krogfelt, K. A., Cawthraw, S. A., van Pelt, W., Wagenaar, J. A., and

Owen, R. J. (2008). Host-pathogen interactions in Campylobacter infections: the host

perspective. Clin. Microbiol. Rev. 21: 505–518.

Jensen, A.N., Dalsgaard, A., Baggesen, D.L., and Nielsen, E.M. (2006). The

occurrence and characterization of Campylobacter jejuni and C. coli in organic pigs and

their outdoor environment. Vet. Microbiol. 11: 96– 105.

Johnson, W.M., Lior, H. (1986). Cytotoxic and cytotonic factors produced by

Campylobacter jejuni, Campylobacter coli, and Campylobacter laridis. J. Clinic.

Microbiol. 24: 275-281.

Jones, D.M., Sutcliffe, E.M., and Curry, A. (1991). Recovery of viable but non-

culturable Campylobacter jejuni. J. Gen. Microbiol. 137: 2477-82.

Jones, F.S., Orcutt, M., and Little, R.B. (1913). Vibrios (vibrio jejuni, n.sp.)

associated with intestinal disorders of cows and calves. J. Exp. Med. 53: 853–863.

Jorgensen, F., Ellis-Iversen, J., Rushton, S., Bull, S.A., Harris, S., Bryan, S.J.,

Gonzalez, A., and Humphrey, T.J. (2011). Influence of season and geography on

http://www.ncbi.nlm.nih.gov/pubmed?term=Ibrahim%20NG%5BAuthor%5D&cauthor=true&cauthor_uid=15366792

http://www.ncbi.nlm.nih.gov/pubmed?term=Zafar%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15366792

http://www.ncbi.nlm.nih.gov/pubmed?term=Hasan%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15366792



References

100

Campylobacter jejuni and C. coli subtypes in housed broiler flocks reared in Great Britain.

Appl. Environ. Microbiol. 77: 3741-3748.

Joshua, G. W., Guthrie-Irons, C., Karlyshev, A. V., and Wren, B. W. (2006).

Biofilm formation in Campylobacter jejuni. Microbiol. 152: 387-396.

Kapperud, G., Espeland, G., Wahl, E., Walde, A., Herikstad, H., Gustavsen, S.,

Tveit, I., Natås, O., Bevanger, L., and Digranes, A. (2003). Factors associated with

increased and decreased risk of Campylobacter infection: a prospective case-control study

in Norway. Am. J. Epidemiol. 158: 234-242.

Karenlampi, R., Rautelin, H., Schonberg-Norio, D., Paulin, L., and Hanninen,

M.L. (2007). Longitudinal study of Finnish Campylobacter jejuni and C. coli isolates from

humans, using multilocus sequence typing, including comparison with epidemiological

data and isolates from poultry and cattle. Appl. Environ. Microbiol. 73: 148-155.

Karlyshev, A.V., Champion, O.L., Churcher, C., Brisson, J., Jarrell, H.C.,

Gilbert, M., Brochu, D., Michael, F., Li, J., Wakarchuk, W.W., Goodhead, I., Sanders,

M., Stevens, K., White, B., Parkhill, J., Wren, B.W., and Szymanski, C.M. (2005).

Analysis of Campylobacter jejuni capsular loci reveals multiple mechanisms for the

generation of structural diversity and the ability to form complex heptoses. Mol.


Kazmi, R., Hafeez, A., and Kazmi, S. (1987). Polymicrobial infection in

Campylobacter jejuni enteritis in Karachi. FEMS. Microbiol. Lett. 41: 153-156.

Keener, K.M., Bashor, M.P., Curtis, P.A., Sheldon, B.W., and Kathariou, S.

(2004). Comprehensive review of Campylobacter and poultry processing. Compr. Rev.

Food. Sci. Food. Saf. 3: 105–116.

Kelly, D.J. (2008). Complexity and versatility in the physiology and metabolism

of Campylobacter jejuni. In: Nachamkin I, Szymanski CM, Blaser MJ, editors.

Campylobacter. 3rd ed. Washington, DC: ASM Press, 41-61.

Kemp, R., Leatherbarrow, A.J., Williams, N.J., Hart, C.A., Clough, H.E., Turner,

J., Wright, E.J., and French, N.P. (2005). Prevalence and genetic diversity of

Campylobacter spp. in environmental water samples from a 100-square-kilometer

predominantly dairy farming area. Appl. Environ. Microbiol. 71: 1876-1882.



References

101

Kerstens, P.J., Endtz, H.P., Meis, J.F., Oyen, W.J., Koopman, R.J., van den

Broek, P.J., and van der Meer, J.W. (1992). Erysipelas-like skin lesions associated with

Campylobacter jejuni septicemia in patients with hypogammaglobulinemia. Eur. J. Clin.

Microbiol. Infect. Dis. 11: 842-827.

Khan, I., Hill, S., Nowak, E., and Edge, T. (2013). Effect of Incubation

Temperature on the Detection of ThermophilicCampylobacter Species from Freshwater

Beaches, Nearby Wastewater Effluents, and Bird Fecal Droppings. Appl. Environ.

Microbiol. 79: 7639–7645.

Kienesberger, S., Trummler, C.S., Fauster, A., Lang, S., Sprenger,

H., Gorkiewicz, G., and Zechner, E.L. (2011). Interbacterial macromolecular transfer by

the Campylobacter fetus subsp. venerealis type IV secretion system. J. Bacteriol. 193:

744-758.

King, Eo. (1957). Human infections with Vibrio fetus and a closely related vibrio.

J. Infect. Dis. 101: 119-128.

Kist, M. (1986). Who discovered Campylobacter jejuni/coli? A review of hitherto

disregarded literature. Zentralbl. Bakteriol. Mikrobiol. Hyg. A. 261: 177-186.

Klipstein, F.A., and Engert, R.F. (1984). Properties of crude Campylobacter jejuni

heat-labile enterotoxin. Infect. Immun. 45: 314-319.

Koga, M., Gilbert, M., Takahashi, M., Li, J., Koike, S., Hirata, K., and Yuki, N.

(2006). Comprehensive analysis of bacterial risk factors for the development of Guillain-

Barre syndrome after Campylobacter jejuni enteritis. J. Infect. Dis. 193: 547-55.

Konkel, M. E., Kim, B. J., Rivera-Amill, V., and Garvis, S. G. (1999). Bacterial

secreted proteins are required for the internalization of Campylobacter jejuni into cultured

mammalian cells. Mol. Microbiol. 32: 691–701.

Konkel, M. E., Klena, J. D., Rivera-Amill, V., Monteville, M. R., Biswas, D.,

Raphael, B., and Mickelson, J. (2004).Secretion of virulence proteins from Campylobacter

jejuni is dependent on a functional flagellar export apparatus. J. Bacteriol. 186: 3296–

3303.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hill%20S%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Nowak%20E%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Edge%20TA%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kienesberger%20S%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Trummler%20CS%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Fauster%20A%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lang%20S%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sprenger%20H%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gorkiewicz%20G%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zechner%20EL%5Bauth%5D



http://www.ncbi.nlm.nih.gov/pubmed?term=KING%20EO%5BAuthor%5D&cauthor=true&cauthor_uid=13475869


http://www.ncbi.nlm.nih.gov/pubmed?term=Kist%20M%5BAuthor%5D&cauthor=true&cauthor_uid=3526758



References

102

Konkel, M.E., and Cieplak, W., Jr. (1992). Altered synthetic response

of Campylobacter jejuni to cocultivation with human epithelial cells is associated with

enhanced internalization. Infect. Immun. 60: 4945–4949.

Kwan, P.S., Barrigas, M., Bolton, F.J., French, N.P., Gowland, P., Kemp, R.,

Leatherbarrow, H., Upton, M., and Fox, A.J. (2008). Molecular epidemiology of

Campylobacter jejuni populations in dairy cattle, wildlife, and the environment in a

farmland area. Appl. Environ. Microbiol. 74: 5130–5138.

Lachance, N., Gaudreau, C., Lamothe, F., and Lariviere, L. A. (1991). Role of

the β-lactamase of Campylobacter jejuni in resistance to β-lactam agents. Antimicrob.

Agents. Chemother. 35: 813–818.

Lachance, N., Gaudreau, C., Lamothe, F., and Turgeon, F. (1993). Susceptibilities

of β-lactamase-positive and -negative strains of Campylobacter coli to β-lactam

agents. Antimicrob. Agents Chemother.37: 1174-1176.

Larsen, J. C., and Guerry, P. (2005). Plasmids of Campylobacter jejuni 81-

176, In J. M. Ketley and M. E. Konkel (ed.), Campylobacter molecular and cellular

biology. Horizon Bioscience, Wymondham, United Kingdom: 181-192.

Lastovica, A.J., and Allos, B.M. (2008). Clinical significance of Campylobacter

and related species other than Campylobacter jejuni and Campylobacter coli. In:

Nachamkin I, Szymanski, C.M., Blaser, M.J., editors. Campylobacter. 3rd ed. Washington,

DC: ASM Press, 123-149.

Lau, S.K., Woo, P.C., Leung, K.W., and Ky, Y. (2002). Emergence of

cotrimoxazole- and quinolone-resistant Campylobacter infections in bone marrow

transplant recipients. Eur. J. Clin. Microbiol. Infect. Dis. 21: 127- 129.

Lauria- Filgueiras, A.L., and Hofer, E. (1998). Diversity of Campylobacter

isolates from three activated sludge systems. Mem. Inst. Oswaldo. Cruz. 93: 295-298.

Lee, R.B., Hassane, D.C., Cottle, D.L., and Pickett, C.L. (2003). Interactions of

Campylobacter jejuni cytolethal distending toxin subunits CdtA and CdtC with HeLa cells.

Infect. Immun. 71: 4883-4890.

References

103

Lehtopolku, .M, Nakari, U., Kotilainen, P., Huovinen, P., Siitonen, A., and

Hakanen A.J. (2010). Antimicrobial susceptibilities of multidrug-resistant Campylobacter

jejuni and C. coli strains: in vitro activities of 20 antimicrobial agents. Antimicrob. Agents.

Chemother. 54: 1232-1236.

Leiman, P.G., Basler, M., Ramagopal, U.A., Bonanno, J.B., Sauder, J.M.,

Pukatzki, S., Burley, S.K., Almo, S.C., and Mekalanos, J.J (2009). Type VI secretion

apparatus and phage tail-associated protein complexes share a common evolutionary

origin. Proc. Natl. Acad. Sci. USA. 106: 4154-4159.

Leon-Kempis, M. R., Guccione, E., Mulholland, F., Williamson, M.P., and Kelly,

D.J. (2006). The Campylobacter jejuni PEB1a adhesin is an aspartate/glutamate-binding

protein of an ABC transporter essential for microaerobic growth on dicarboxylic amino

acids. Mol. Microbiol. 60: 1262-1275.

Lertpiriyapong, K., Gamazon, E. R., Feng, Y., Park, D. S., Pang, J., Botka, 1 G.,

Graffam, M. E., Ge, Z., and Fox, J. G. (2012). Campylobacter jejuni type VI secretion

system: Roles in adaptation to deoxycholic acid, host cell adherence, invasion, and in vivo

colonization. PLoS. ONE. 7: e42842.

Lin, J., Yan, M., Sahin, O., Pereira, S., Chang, Y. J., and Zhang, Q. (2007). Effect

of macrolide usage on emergence of erythromycin-resistant Campylobacter isolates in

chickens. Antimicrob. Agents. Chemother. 51: 1678-1686.

Lindblom, G.B., Kaijser, B., Sj:ogren, E. (1989). Enterotoxin production and

serogroups of Campylobacter jejuni and Campylobacter coli from patients with diarrhea

and from healthy laying hens. J. Clin. Microbiol. 27: 1272-1276.

Luechtefeld, N.W., Reller, L.B., Blaser, M.J., and Wang, W.L. (1982).

Comparison of atmospheres of incubation for primary isolation of Campylobacter fetus

subsp. jejuni from animal specimens: 5% oxygen versus candle jar. J. Clin. Microbiol. 15:

53–57.

Lynch, O.A., Cagney, C., McDowell, D.A., and Duffy, G. (2011). Occurance of

fastidious Campylobacter spp. In fresh meat and poultry using an adapted cultural protocol.

Int. J. Food. Microbiol. 150: 171-177.




References

104

MacIntyre, D.L., Miyata, S.T., Kitaoka, and M., Pukatzki, S (2010). The Vibrio

cholerae type VI secretion system displays antimicrobial properties. Proc. Natl. Acad. Sci.

USA. 107: 19520-19524.

Man, S.M. (2011). The clinical importance of emerging campylobacter species.

Nat. Rev. Gastroenterol. Hepatol. 8: 669–85.

Manning, G., Dowson, C.G., Bagnall, M.C., Ahmed, I.H., West, M., and Newell,

D.G. (2003). Multilocus sequence typing for comparison of veterinary and human isolates

of Campylobacter jejuni. Appl. Environ. Microbiol. 69: 6370-6379.

Manning, G., Duim, B., Wassenaar, T., Wagenaar, J.A., Ridley, A. and Newell,

D.G. (2001). Evidence for a genetically stable strain of Campylobacter jejuni. Appl.

Environ. Microbiol. 67: 1185-1189.

Mansouri-najand, L., Saleha, A. A., and Wai, S. S. (2012). Prevalence of

multidrug resistance Campylobacter jejuni and Campylobacter coli in chickens

slaughtered in selected markets, Malaysia. Trop. Biomed. 29: 231-238.

McCarthy, N.D., Colles, F.M., Dingle, K.E., Bagnall, M.C., Manning, G., Maiden,

M.C., and Falush, D. (2007). Host-associated genetic import in Campylobacter jejuni.

Emerg. Infect. Dis. 13: 267-272.

McDermott, P. F., Bodeis, S. M., and English, L. L. (2002). Ciprofloxacin

resistance in Campylobacter jejuni evolves rapidly in chickens treated with

fluoroquinolones. J. Infect. Dis. 185: 837-840.

McFadyean, J., and Stockman, S. (1913). Report of the Departmental Committee

appointed by the Board of Agriculture and Fisheries to inquire into epizootic abortion. Part

III. Abortion in sheep. London. HMSO.

McFarland, B. A., and Neill, S. D. (1992). Profiles of toxin production by

thermophilic Campylobacter of animal origin. Vet. Microbiol. 30: 257-266.

McMahon, M. A. S., Xu, J., Moore, J. E., Blair, I. S., and McDowell, D. A. (2007).

Environmental stress and antibiotic resistance in food-related pathogens. Appl. Environ.

Microbiol. 73: 211-217.

McNulty, C.A. (1987). The treatment of Campylobacter infections in man. J.

Antimicrob. Chemother. 19: 281- 284.

References

105

McSweegan, E., and Walker, R.I. (1986). Identification and characterization of

two Campylobacter jejuni adhesins for cellular and mucous substrates. Infect. Immun. 53:

141-148.

McSweegan, E., Burr, D.H., and Walker, R.I. (1987). Intestinal mucus gel and

secretory antibody are barriers to Campylobacter jejuni adherence to INT 407 cells. Infect.

Immun. 55: 1431-1435.

McSweeney, C., New, M., and Lizcano, G. (2013). UNDP Climate Change

Country Profiles /Pakistan. http://country-profiles.geog.ox.ac.uk.

Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C.,

Griffin, P.M., and Tauxe, R.V. (1999). Food-related illness and death in the United

States. Emerg. Infect. Dis. 5: 607–625.

Megraud, F., and Bultel, C. (2004). Appréciation des risques alimentaires liés aux

Campylobacters. Rapport de. In Application au couple poulet/Campylobacter jejuni. 2004.

AFSSA, 96 p.

Messad, S., Hamdi, T., Bouhamed, R., Ramdani-Bouguessa, N., and Tazir, M.

(2014). Frequency of contamination and antimicrobial resistance of thermotolerant

Campylobacter isolated from some broiler farms and slaughterhouses in the region of

Algiers. Food. Control. 40: 324-328.

Messelhäusser, U., Thärigen, D., Elmer-Englhard, D., Bauer, H., Schreiner, H.,

and Höller, C. (2011). Occurrence of thermotolerant Campylobacter spp. on eggshells: a

missing link for food-borne infections? Appl Environ Microbiol. 77: 3896–3897.

Miller, W.G., On, S.L., Wang,G., Fontanoz, S., Lastovica, A.J., Mandrell, R.E.

(2005). Extended multilocus sequence typing system for Campylobacter coli, C. lari, C.

upsaliensis, and C. helveticus. J. Clin. Microbiol. 43: 2315-29.

Moen, B., Oust, A., Langsrud, O., Dorrell, N., Marsden, G. L., Hinds, J., Kohler,

A., Wren, B. W., and Rudi, K. (2005). Explorative multifactor approach for investigating

global survival mechanisms of Campylobacter jejuni under environmental conditions.

Appl. Environ. Microbiol. 71: 2086-2094.

Moore, J.E., Barton, M.D., Blair, I.S., Corcoran, D., Dooley, J.S., Fanning, S., et

al. (2006). The epidemiology of antibiotic resistance in Campylobacter. Microbes. Infect.

8: 1955-1966.


http://country-profiles.geog.ox.ac.uk/

http://www.ncbi.nlm.nih.gov/pubmed/?term=Messelh%26%23x000e4%3Busser%20U%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Th%26%23x000e4%3Brigen%20D%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Elmer-Englhard%20D%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Bauer%20H%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Schreiner%20H%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=H%26%23x000f6%3Bller%20C%5Bauth%5D


References

106

Moore, J.E., Corcoran, D., Dooley, J.S.G., Fanning, S., Lucey, B., Matsuda,

M., McDowell, D.A., Mégraud, F., Millar, B.C., O'Mahony, R., O'Riordan, L., O'Rourke,

M., Rao, J.R., Rooney, P.J., Sails, A., and Whyte, P. (2005). Campylobacter. Vet. Res. 36:

351-382.

Mulder, D. T., Cooper, C. A., and Coombes, B. K. (2012). Type VI secretion

system associated gene clusters contribute to pathogenesis of Salmonella enterica serovar

Typhimurium. Infect. Immun. 80: 1996–2007.

Murphy, C., Carroll, C., and Jordan, K.N. (2005). The effect of different media on

the survival and induction of stress responses by Campylobacter jejuni. J. Microbiol.

Methods. 62: 161-166.

Murray, P. R., Baron, E. J., Jorgensen, J.H., Landry, M. L., and Pfaller, M. A.

(2007). Manual of Clinical Microbiology. 9. Ed. Washington.

Nachamkin, I., and Blaser, M.J. (eds) (2000). Campylobacter 2nd ed. ASM Press,

Washington, D.C.

Nachamkin, I., Liu, J., Li,M., Ung, H., Moran, A.P., Prendengast, M.M., and

Sheikh, K. (2002). Campylobacter jejuni from Patients with Guillain-Barré Syndrome

Preferentially Expresses a GD1a-Like Epitope. Infect. Immun. 70: 5299–5303.

Nachamkin, I., Szymanski, M.C., and Blaser, J.M. (2008). Campylobacter. 3rd ed.

ASM Press; Washington DC, USA.

Nachamkin, I., Yang, X.H., and Stern, N.J. (1993). Role of Campylobacter

jejuni flagella as colonization factors for three-day-old chicks: analysis with flagellar

mutants. Appl. Environ. Microbiol. 59: 1269–1273.

Nelson, J.M., Chiller, T.M., Powers, J.H., and Angulo, F.J. (2007).

Fluoroquinolone-resistant Campylobacter species and the withdrawal of fluoroquinolones

from use in poultry: a public health success story. Clin. Infect. Dis. 44: 977-980.

Nelson, J.M., Smith, K.E., Vugia, D.J., Rabatsky-Her, T., Segler, S.D.,

Kassenborg, H.D., Zansky, S.M, Joyce, K., Marano, N., Hoekstra, R.M., and Angulo, F.J.

(2004). Prolonged diarrhea due to ciprofloxacin-resistant Campylobacter infection. J.

Infect. Dis. 190: 1150-1157.

http://www.ncbi.nlm.nih.gov/pubmed?term=McDowell%20DA%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=M%C3%A9graud%20F%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=Millar%20BC%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Mahony%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Riordan%20L%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Rourke%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Rourke%20M%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=Rao%20JR%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=Rooney%20PJ%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=Sails%20A%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

http://www.ncbi.nlm.nih.gov/pubmed?term=Whyte%20P%5BAuthor%5D&cauthor=true&cauthor_uid=15845230

References

107

Ng, L., Sherburne, R., Taylor, D. E., and Stiles, M.E. (1985). Morphological forms

and viability of Campylobacter species studied by electron microscopy. J. Bacteriol. 164:

338-343.

Oliver, J.D. (2005). The viable but nonculturable state in bacteria. J.

Microbiol. 43: 93–100.

On, S.L.W. (2005). Taxonomy, phylogeny, and methods for the identification of

Campylobacter species. In: Ketley JM, Konkel ME, editors. Campylobacter: Molecular

and Cellular Biology Wymondham, UK: Horizon Bioscience. 13-42.

Pacanowski, J., Lalande, V., Lacombe, K., Boudraa, C., Lesprit, P., Legrand,

P., Trystram, D., Kassis, N., Arlet, G., Mainardi, J.L., Doucet-Populaire, F., Girard,

P.M., Meynard, J.L., and CAMPYL Study Group. (2008). Campylobacter bacteremia:

clinical features and factors associated with fatal outcome. Clin. Infect. Dis. 47: 790-796.

Park, C.E., and Sanders, G.W. (1992). Occurrence of thermotolerant

campylobacters in fresh vegetables sold at farmers' outdoor markets and supermarkets.

Can. J. Microbiol. 38: 313-316.

Park, S.F. (2002). The physiology of Campylobacter species and its relevance to

their role as foodborne pathogens. Int. J. Food. Microbiol. 74: 177-188.

Parkhill, J., Wren, B.W., Mungall, K., Ketley, J.M., Churcher, C., Basham, D.,

Chillingworth, T., Davies, R.M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev,

A.V., Moule, S., Pallen, M.J., Penn, C.W., Quail, M.A., Rajandream, M.A., Rutherford,

K.M., van Vliet, A.H., Whitehead, S., and Barrell, B.G. (2000). The genome sequence of

the food-borne pathogen Campylobacter jejuni reveals hypervariable

sequences. Nature. 403: 665–668.

Pearson, B.M., Pin, C., Wright, J., I'Anson, K., Humphrey, T., and Wells, J.M.

(2003). Comparative genome analysis of Campylobacter jejuni using whole genome DNA

microarrays. FEBS. Lett. 554: 224-230.

Perez-Perez, G. I., Cohn, D. L., Guerrant, R. L., Patton, C. M., Reller, L. B., and

Blaser, M. J. (1989). Clinical and immunological significance of cholera-like toxin and

cytotoxin production by Campylobacter species in patients with acute inflammatory

diarrhea in the USA. J. Infect. Dis. 160: 460-468.

http://www.ncbi.nlm.nih.gov/pubmed?term=Pacanowski%20J%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Lalande%20V%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Lacombe%20K%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Boudraa%20C%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Lesprit%20P%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Legrand%20P%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Legrand%20P%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Trystram%20D%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Kassis%20N%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Arlet%20G%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Mainardi%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Doucet-Populaire%20F%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Girard%20PM%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Girard%20PM%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=Meynard%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=18699745

http://www.ncbi.nlm.nih.gov/pubmed?term=CAMPYL%20Study%20Group%5BCorporate%20Author%5D


http://www.ncbi.nlm.nih.gov/pubmed/?term=Jagels%20K%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Karlyshev%20AV%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Karlyshev%20AV%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Moule%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Pallen%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Penn%20CW%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Quail%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rajandream%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rutherford%20KM%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Rutherford%20KM%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=van%20Vliet%20AH%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Whitehead%20S%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

http://www.ncbi.nlm.nih.gov/pubmed/?term=Barrell%20BG%5BAuthor%5D&cauthor=true&cauthor_uid=10688204

References

108

Perko-Mäkelä, P. (2011). Campylobacter jejuni and C. coli in Finnish poultry

production, Evira. Research. Reports.

Petersen, L., Nielsen, E.M., Engberg, J., On, S.L., and Dietz, H.H. (2001).

Comparison of genotypes and serotypes of Campylobacter jejuni isolated from Danish

wild mammals and birds and from broiler flocks and humans. Appl. Environ. Microbiol.

67: 3115-3121.

Pollett, S., Rocha, C., Zerpa, R., Patiño, L., Valencia, A., Camiña, M., Guevara,

J., Lopez, M., Chuquiray, N., Salazar-Lindo, E., Calampa, C., Casapia, M., Meza,

R., Bernal, M., Tilley, D., Gregory, M., Maves, R., Hall, E., Jones, F., Arriola, C.,

Rosenbaum, M., Perez, J., and Kasper, M. (2012). Campylobacter antimicrobial resistance

in Peru: a ten-year observational study. BMC. Infect.Dis. 12: 193.

Preston, A., Mandrell, R.E., Gibson, B.W., and Apicella, M.A. (1996). The

lipooligosaccharides of pathogenic gram-negative bacteria. Crit. Rev. Microbiol. 22: 139-

180.

Pukatzki, S., Ma, A.T., Sturtevant, D., Krastins, B., Sarracino, D., Nelson, W.C.,

Heidelberg, J.F., and Mekalanos, J.J. (2006). Identification of a conserved bacterial protein

secretion system in Vibrio cholerae using the Dictyostelium host model system. Proc. Natl.

Acad. Sci. U.S.A. 103: 1528-1533.

Rahimi, E., Ameri, M., and Kazemeini, H.R. (2010). Prevalence and antimicrobial

resistance of Campylobacter species isolated from raw camel, beef, lamb, and goat meat

in Iran. Foodborne. Pathog. Dis. 7: 443-7.

Ramonaitė, S., Rokaitytė, A., Tamulevičienė, E., Malakauskas, A., Alter,

T., and Malakauskas, M. (2013). Prevalence, quantitative load and genetic diversity of

Campylobacter spp. in dairy cattle herds in Lithuania. Acta. Veterin. Scandinav. 55: 87.

Richardson, J.F., Frost, J.A., Kramer, J.M., Thwaites, R.T., Bolton, F.J., Wareing,

D.R.A., and Gordon, J.A. (2001). Coinfection with Campylobacter species: an

epidemiological problem? J. App. Microbiol. 91: 206–211.

Robinson, D.A. (1981). Campylobacter infection. R. Soc. Health. J. 101: 138–40.

Rodríguez, S., and Araujo, R. (2010). Occurrence of thermotolerant

Campylobacter species in surface waters of a Mediterranean area and in its prevailing

pollution sources. J. Appl. Microbiol. 109: 1027-34.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Preston%20A%5BAuthor%5D&cauthor=true&cauthor_uid=8894399

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mandrell%20RE%5BAuthor%5D&cauthor=true&cauthor_uid=8894399

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gibson%20BW%5BAuthor%5D&cauthor=true&cauthor_uid=8894399

http://www.ncbi.nlm.nih.gov/pubmed/?term=Apicella%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=8894399


http://www.ncbi.nlm.nih.gov/pubmed?term=Rahimi%20E%5BAuthor%5D&cauthor=true&cauthor_uid=20184450

http://www.ncbi.nlm.nih.gov/pubmed?term=Ameri%20M%5BAuthor%5D&cauthor=true&cauthor_uid=20184450

http://www.ncbi.nlm.nih.gov/pubmed?term=Kazemeini%20HR%5BAuthor%5D&cauthor=true&cauthor_uid=20184450


http://www.ncbi.nlm.nih.gov/pubmed?term=Rodr%C3%ADguez%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20408911

http://www.ncbi.nlm.nih.gov/pubmed?term=Araujo%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20408911

References

109

Rollins, D. M., and Colwell, R. R. (1986). Viable but nonculturable stage of

Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl.

Environ. Microbiol. 52: 531–538.

Ronquist, F., and Huelsenbeck, J.P. (2003). MrBayes 3: Bayesian phylogenetic

inference under mixed models. Bioinformatics. 19: 1572-1574.

Rosef, O., Gondrosen, B., Kapperud, G., and Underdal, B. (1983). Isolation and

characterization of Campylobacter jejuni and Campylobacter coli from domestic and wild

mammals in Norway. Appl Environ Microbiol. 46: 855–859.

Rosef, O., Kapperud, G., Lauwers, S., and Gondrosen, B. (1985). Serotyping of

Campylobacter jejuni, Campylobacter coli, and Campylobacter laridis from domestic and

wild animals. Appl. Environ. Microbiol. 49: 1507-1510.

Ruiz-Palacios, G. M. (2007). The health burden of Campylobacter infection and

the impact of antimicrobial resistance: playing chicken. Clin. Infect. Dis. 44: 701–703.

Russell, A. D. (2002). Mechanisms of antimicrobial action of antiseptics and

disinfectants: an increasingly important area of investigation. J. Antimicrob. Chemother.

49: 597-599.

Russell, A.B., Hood, R.D., Bui, N.K., LeRoux, M., Vollmer, W., and Mougous,

J.D. (2011). Type VI secretion delivers bacteriolytic effectors to target cells. Nature. 475:

343-347.

Russell, A.B., Peterson, S.B., and Mougous, J.D. (2014). Type VI secretion

system effectors: poisons with a purpose. Nat. Rev. Microbiol. 12: 137-148.

Saenz, Y., Zarazaga, M., Lantero, M., Gastanares, M.J., Baquero, F., and Torres,

C. (2000). Antibiotic resistance in Campylobacter strains isolated from animals, foods, and

humans in Spain in 1997-1998. Antimicrob. Agents. Chemother. 44: 267-271.

Sails, A.D., Swaminathan, B., and Fields, P.I. (2003). Utility of multilocus

sequence typing as an epidemiological tool for investigation of outbreaks of gastroenteritis

caused by Campylobacter jejuni. J. Clin. Microbiol. 41: 4733-4739.

Samuel, M.C., Vugia, D.J., Shallow, S., Marcus, R., Segler, S., McGivern, T.,

Kassenborg, H., Reilly, K., Kennedy, M., Angulo, F., and Tauxe, R.V. (2004).

Epidemiology of sporadic Campylobacter infection in the United States and declining trend

in incidence, FoodNet 1996–1999. Clin. Infect. Dis. 38: S165–S174.

References

110

Sana, T.G., Hachani, A., Bucior, I., Soscia, C., Garvis, S., Termine, E., Engel,

J., Filloux, A., and Bleves, S. (2012). The second type VI secretion system of Pseudomonas

aeruginosa strain PAO1 is regulated by quorum sensing and fur and modulates

internalization in epithelial cells. J. Biol. Chem. 287: 27095-27105.

Sato, H., and Frank, D.W. (2011). Multi-functional characteristics of the

Pseudomonas aeruginosa type III needle-tip protein, PcrV; comparison to orthologs in

other Gram-negative bacteria. Front. Microbiol. 2: 142.

Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy,

S.L., Jones, J.L., and Griffin, P.M. (2011). Foodborne illness acquired in the United States

major pathogens. Emerg. Infect. Dis. 17: 7-15.

Schonberg-Norio, D., Takkinen, J., Hanninen, M.L., Katila, M.L., Kaukoranta,

S.S., Mattila, L., and Rautelin, H. (2004). Swimming and Campylobacter infections.

Emerg. Infect. Dis. 10: 1474-1477.

Scott, N.E., Bogema, D.R., Connolly, A.M., Falconer, L., Djordjevic, S.P., and

Cordwell, S.J. (2009). Mass spectrometric characterization of the surface-associated 42

kDa lipoprotein JlpA as a glycosylated antigen in strains of Campylobacter jejuni. J.

Proteome. Res. 8: 4654-4664.

Sebald, M., and Veron, M. (1963). Base DNA content and classification of

Vibrios. Ann. Inst. Pasteur. (Paris). 105:897-910.

Sha, J., Rosenzweig, J. A., Kozlova, E. V., Wang, S., Erova, T. E., Kirtley, M.

L., van Lier, C. J., and Chopra A. K. (2013). Evaluation of the roles played by Hcp and

VgrG type 6 secretion system effectors in Aeromonas hydrophila SSU pathogenesis.

Microbiol 159: 1120-1135.

Shane, S.M., Gifford, D.H., and Yogasundram, K. (1986). Campylobacter

jejuni contamination of eggs. Vet. Res. Commun. 10: 487-492.

Shneider, M.M., Buth, S.A., Ho, B.T., Basler, M., Mekalanos, J.J., and

Leiman, P.G. (2013). PAAR-repeat proteins sharpen and diversify the type VI secretion

system spike. Nature. 500: 350-353.




http://www.ncbi.nlm.nih.gov/pubmed?term=SEBALD%20M%5BAuthor%5D&cauthor=true&cauthor_uid=14098102

http://www.ncbi.nlm.nih.gov/pubmed?term=VERON%20M%5BAuthor%5D&cauthor=true&cauthor_uid=14098102


http://www.ncbi.nlm.nih.gov/pubmed?term=Shane%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=3798738

http://www.ncbi.nlm.nih.gov/pubmed?term=Gifford%20DH%5BAuthor%5D&cauthor=true&cauthor_uid=3798738

http://www.ncbi.nlm.nih.gov/pubmed?term=Yogasundram%20K%5BAuthor%5D&cauthor=true&cauthor_uid=3798738


http://www.ncbi.nlm.nih.gov/pubmed/?term=Shneider%20MM%5BAuthor%5D&cauthor=true&cauthor_uid=23925114

http://www.ncbi.nlm.nih.gov/pubmed/?term=Buth%20SA%5BAuthor%5D&cauthor=true&cauthor_uid=23925114

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ho%20BT%5BAuthor%5D&cauthor=true&cauthor_uid=23925114

http://www.ncbi.nlm.nih.gov/pubmed/?term=Basler%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23925114

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mekalanos%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=23925114

http://www.ncbi.nlm.nih.gov/pubmed/?term=Leiman%20PG%5BAuthor%5D&cauthor=true&cauthor_uid=23925114


References

111

Silva, J., Leite, D., Fernandes, M., Mena, C., Gibbs, P.A., and Teixeira, P.

(2011). Campylobacter spp. as a Foodborne Pathogen: A Review. Front. Microbial. 2:

200.

Sippy, R., Sandoval-Green, C., Sahin, O., Plummer, P., Fairbanks, W.S.,

Zhang, Q., and Blanchong, J.A. (2012). Occurrence and molecular analysis of

Campylobacter in wildlife on livestock farms. Veterin. Microbiol. 157: 369–375.

Skirrow, M.B. (1977). Campylobacter enteritis: a "new" disease. Br. Med. J. 2:

9-11.

Skirrow, M.B. (1991). Epidemiology of Campylobacter enteritis. Int. J. Food.


Skirrow, M.B., and Blaser, M.J. (1995). Campylobacter jejuni. In: Blaser MJ,

Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, eds. Infections of the gastrointestinal

tract. New York City; Raven Press; 825-48.

Skirrow, M.B. and Blaser, M.J. (2000). Clinical aspects of Campylobacter

infection. In: Campylobacter, Second Edition, Nachamkin I. & M.J. Blaser, eds. ASM

Press, Washington DC, USA, 69–88.

Skirrow, M.B., Fidoe, R.G., and Jones D.M. (1981). An outbreak of

presumptive food-borne campylobacter enteritis. J. Infec. 3: 234-236.

Smith, J.L., and Fratamico, P.M. (2010). Fluoroquinolone resistance in

Campylobacter. J. Food. Prot. 73: 1141-1152.

Smith, T., and Taylor, M.S. (1919). Some morphological and biological

characters of the spirilla (Vibrio fetus, n.sp.) associated with disease of the fetal membranes

in cattle. J. Exp. Med. 30: 299-312.

Soofi, S. B., Habib, M. A., von Seidlein, L., Khan, M. J., Muhammad, S.,

Bhutto, N., Khan, M. I., Rasool, S., Zafar, A., Clemens, J. D., Nizami, Q., and Bhutta, Z.

A. (2011). A comparison of disease caused by Shigella and Campylobacter species: 24

months community based surveillance in 4 slums of Karachi, Pakistan. J. Infect. Public.

Health. 4: 12–2110.

Stabler, R. A., Larsson, J. T., Al-Jaberi, S., Nielsen, E. M., Kay, E., Tam, C.

C., Higgins, C. D., Rodrigues, L. C., Richardson, J. F., O'Brien, S. J., and Wren, B. W.



References

112

(2013). Characterization of water and wildlife strains as a subgroup of Campylobacter

jejuni using DNA microarrays. Environ. Microbiol. 15: 2371-2383.

Stabler, R.A., Gerding, D.N., Songer, J.G., Drudy, D., Brazier, J.S., Trinh,

H.T., Witney, A.A., Hinds, J., and Wren, B.W. (2006). Comparative phylogenomics of

Clostridium difficile reveals clade specificity and microevolution of hypervirulent strains.

J. Bacteriol. 188: 7297-7305.

Tajada, P., Gomez-Garces, J. L., Alós, J.I., Balas, D., and Cogollos, R. (1996).

Antimicrobial susceptibilities of Campylobacter jejuni and Campylobacter coli to 12 β-

lactam agents and combinations with β-lactamase inhibitors. Antimicrob. Agents.

Chemother. 40: 1924–1925.

Tam, C.C., Higgins, C.D., Neal, K.R., Rodrigues, L.C., Millership, S.E., and

O'Brien, S.J. (2009). Chicken consumption and use of acid-suppressing medications as

risk factors for campylobacter enteritis, England. Emerg. Infect. Dis. 15: 1402–1408.

Tam, C.C., Rodrigues, L.C., Viviani, L., Dodds, J.P., Evans, M.R., Hunter,

P.R., Gray, J.J., Letley, L.H., Rait, G., Tompkins, D.S., O’ Brien, S.J., and IID2 Study

executive committee. (2012). Longitudinal study of infectious intestinal disease in the UK

(IID2 Study) incidence in the community and presenting to general practice. Gut 61: 69-

77.

Tambur, Z., Miljkovic-Selimovic, B. , Doder, D., and Kulisic, Z. (2010).

Susceptibility of Campylobacter jejuni and Campylobacter coli isolated from animals and

humans to tetracycline. Afric. J. Microbiol. Res. 4: 1246-1250.

Tang, J. Y. H., Mohamad Ghazali, F., Saleha, A. A., Nishibuchi, M., and Son,

R. (2009). Comparison of thermophilic Campylobacter spp. occurrence in two types of

retail chicken samples. Intern. Food. Res. Journ. 16: 277-288.

Thapar, N., and Sanderson, I.R. (2004). Diarrhoea in children: an interface

between developing and developed countries. Lancet. 363: 641-53.

Tremblay, C., Gaudreau, C., and Lorange, M. (2003). Epidemiology and

antimicrobial susceptibilities of 111 Campylobacter fetus subsp. fetus strains isolated in

Quebec, Canada, from 1983 to 2000. J. Clin. Microbiol. 41: 463-466.

http://www.ncbi.nlm.nih.gov/pubmed/?term=O%27Brien%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=19788807

References

113

Ugarte-Ruiz, M., Stabler, R.A., Domínguez, L., Porrero, M.C., Wren, B.W.,

Dorrell, N., and Gundogdu, O. (2014). Prevalence of Type VI Secretion System in

Spanish Campylobacter jejuni Isolates. Zoonos. Pub. Health. DOI: 10.1111/zph.12176.

Usha, M. R., Fauziah, M., Tunung, R., Chai, L. C., Cheah, Y. K., Farinazleen,

M. G., and Son, R. (2010). Occurrence and antibiotic resistance of Campylobacter jejuni

and Campylobacter coli in retail broiler chicken. Intern. Food. Res. Journ. 17: 247-255.

Van Belkum, A., van den Braak, N., Godschalk, P., Ang, W., Jacobs, B.,

Gilbert, M., Wakarchuk, W., Verbrugh, H., and Endtz, H. A Campylobacter jejuni gene

associated with immune-mediated neuropathy. Nat. Med. 7: 752-753.

Vandeplas, S., Marcq, C., Dubois Dauphin, R., Beckers, Y., Thonart, P., and

Thewis, A. (2008). Contamination of poultry flocks by the human pathogen

Campylobacter spp. and strategies to reduce its prevalence at the farm level.

Biotechnologie Agronomie, Société et Environnement, Biotechnologie, Agronomie, Société

et Environnement, 12: 317-334.

Vanhoof, R., Goossens, H., Coignau, H., Stas, G., and Butzler, J.P. (1982).

Susceptibility pattern of Campylobacler jejuni from human and animal origins to different

antimicrobial agents. Antimicrob. Agents. Chemother. 21: 990-992.

Vegge, C.S., Brondsted, L., Ligowska-Marzeta, M., and Ingmer, I.H. (2012).

Natural transformation of Campylobacter jejuni occurs beyond limits of growth. PLoS.

ONE. 7: e45467.

Walder, M. (1979). Susceptibility of Campylobacter fetus subsp. jejuni

to twenty antimicrobial Agents. Antimicrob. Agents. Chemother. 16: 37-39.

Walker, R.I., Caldwell, M.B., Lee, E.C., Guerry, P., Trust, T.J., and Ruiz-

Palacios, G.M. (1986). Pathophysiology of Campylobacter enteritis. Microbiol. Rev. 50:

81-94.

Wardak, S., Szych, J., Zasada, A., and Gierczynski, R. (2007). Antibiotic

resistance of Campylobacter jejuni and Campylobacter coli clinical isolates from Poland.

Antimicrob. Agents. Chemother. 51: 1123-5.

Wassenaar, T.M. (1997). Toxin production by Campylobacter spp. Clin.

Microbiol. Rev. 10: 466–476.

http://onlinelibrary.wiley.com/doi/10.1111/zph.12176/abstract

http://onlinelibrary.wiley.com/doi/10.1111/zph.12176/abstract


References

114

Weber, B., Hasic, M., Chen, C., Wai, S.N., and Milton, D.L. (2009).

Type VI secretion modulates quorum sensing and stress response in Vibrio

anguillarum. Environ. Microbiol. 11: 3018-3028.

Whitehouse, C.A., Balbo, P.B., Pesci, E.C., Cottle, D.L., Mirabito, P.M., and

Pickett, C.L. (1998). Infect. Immun. 66: 1934-1940.

Whitney, J.C., Beck, C.M., Goo, Y.A., Russell, A.B., Harding, B.N., De

Leon, J.A., Cunningham, D.A., Tran, B.Q., Low, D.A., and Goodlett, D.R. (2014).

Genetically distinct pathways guide effector export through the type VI secretion

system. Mol. Microbiol. 92: 529–542.

WHO and FAO (2009). Risk assessment of Campylobacter spp. in broiler

chickens. Microbiological risk assessment series, Technical report.

WHO. (2003). Programme de surveillance mondiale des Salmonella et de

soutien aux laboratoires. In Techniques de laboratoire: Cours pratique de Niveau 2

Isolement, identification et détermination de la sensibilité aux antibiotiques des

Campylobacter (p. 30).

WHO. (2008). Manuel de standardisation de l’antibiogramme en médecine

vétérinaire à l’échelle nationale selon les recommandations de l’OMS (4th ed.).

Wieczorek, K., and Osek, J. (2013). Antimicrobial Resistance Mechanisms

among Campylobacter. Biomed. Res. Intern. 2013: 340605.

Wilson, D.J., Gabriel, E., Leatherbarrow, A.J., Cheesbrough, J., Gee, S.,

Bolton, E., Fox, A., Fearnhead, P., Hart, C.A., and Diggle, P.J. (2008). Tracing the source

of campylobacteriosis. PLoS Genet. 4: e1000203.

World Health Organization (WHO). (2011). Fact sheet Nº255:

Campylobacter. http://www.who.int/mediacentre/factsheets/fs255.

World Health Organization. (2013). The global view of campylobacteriosis:

Report of an expert consultation, Utrecht, Netherlands.

Yu, L. S., Uknalis, J., and Tu, S.I. (2001). Immunomagnetic separation

methods for the isolation of Campylobacter jejuni from ground poultry meats. J. Immunol.

Methods. 256: 11-8.




http://www.who.int/mediacentre/factsheets/fs255

References

115

Zautner, A. E., Ohk, C., Tareen, A. M., Lugert, R., and Groß, U. (2012).

Epidemiological association of Campylobacter jejuni groups with pathogenicity-

associated genetic markers. BMC. Microbiol. 12: 171.

Zhang, Q., Meitzler, J.C., Huang, S., and Morishita, T. (2000). Sequence

polymorphism, predicted secondary structures, and surface-exposed conformational

epitopes of Campylobacter major outer membrane protein. Infect. Immun. 68: 5679-5689.

Zheng, J., Ho, B., and Mekalanos, J.J. (2011). Genetic analysis of anti-

amoebae and anti-bacterial activities of type VI secretion system in Vibrio cholera.

PLoS ONE. 6: e23876.

116

Appendix 1

Antibiotic Resistance Profiles of C. jejuni Isolates

117

Sample

ID

Source NA CIP ERY CTX CRO CN SPC SXT C TE AMP

1-PI Poultry R S R R R I S R S I R

PI2 Poultry R S R R R I S R S S R

6-PI Poultry R S R R R I S S S R R

7-P-S Poultry R S R R R R S S S R R

8-P-I2 Poultry R S R R R R S S S R S

9-P-S2 Poultry R R R R R R S I S R S

13-P-S3 Poultry R R R R R R S S S R S

14-Fecal Poultry R R R R R R S S S R S

16-Fecal Poultry R R R R R R S S S R S

77-PI Poultry R R R R R R S S S R S

80-PS Poultry R R R R R R S S S R S

86-PF Poultry R R R R R S I R R R S

149-PI Poultry R R R S R S S R R R S

150-PS Poultry R R R S R I S R S R S

AKP-8 Poultry R R R R R I S R S R S

AKP-9 Poultry R R R R R S S R S R S

257PS Poultry R R R R R S S R S R S

153-PI Poultry R R R R R S I R S S S

154-PI Poultry R R R R R S S R S S S

232PI Poultry R R R R R S S R S S S

241PS Poultry R R R R R I S R S S R

267PI Poultry R R R R R I S R S S R

255PI Poultry R R R R R S S I S S R

AKP-12 Poultry R R R S R S S S S R I

AKP-13 Poultry R R R S R R S S S R I

AKP-10 Poultry R R R S R R S S S R I

AKP-15 Poultry R R R S R R S S S R R

AKP-16 Poultry R R R S R R S S R R R

AP3 Poultry R S R R R R S S R R R

AP4 Poultry R S R R R S S S R R R

AP5 Poultry R S R R R S I R R R R

AP6 Poultry R R R R R S S R S R R

AP7 Poultry R R R R R S S R S R R

78-PI Poultry R R R R R S S R S S I

79-PI Poultry R R R R R S R R S S I

33-PI Poultry R R R R R R S R S S I

34-PS Poultry R R R R R R S R S S I

35-PI Poultry R R R R R R S I S S I

36-PS Poultry R R R R R R S I S S R

37-PID Poultry R R R R R R S S R S R

38-PSD Poultry R R R R R R S S S S R

22-PI1 Poultry R R R R R R S S S R R

18-PI Poultry R R R R R S S S S R R

118

I1 Poultry R R R R R S S S S R R

I2 Poultry R R R R R S R S S R R

I1.1 Poultry R R R R R S S S S R R

1-27-C Poultry R R R R R R S S S R I

151-PI Poultry R R R R R R I S R R I

151-PIF Poultry R R R R R R S S S R I

152-PS Poultry R R R R R R S S S R I

242-PI Poultry R R R R R R S S S R I

243-PS Poultry R R R R R S S R S R S

246-PC Poultry R R R R R S S R S R S

256-PI Poultry R R R R R S S R R R R

258-PI Poultry R R R R R S S R S R R

259-P Poultry R R R R R S S R S I R

260-P Poultry R R R R R I S R S I R

261-P Poultry R R R R R I S R S I R

262-P Poultry R R R R R S S S S I R

263-PI Poultry R R R R R S S S R I R

264-P Poultry R S R R R R S S S I R

265-P Poultry R S R R R R I S S R S

266-P Poultry R S R R R R S S S R S

268-P Poultry R S R R R R S S S R S

AP8 Poultry R R R S R R S S S R S

AKP-1 Poultry R R R S R S S I S R R

AKP-2 Poultry R R R S R S S R S R R

AKP-7 Poultry R R R S R S S S S R R

AKP-11 Poultry R R R S R R S R R R R

AKP-14 Poultry R R R S R R S R S R R

LP 3 Poultry R R R R R R S S S R R

LP4 Poultry R R R R R R S I S S R

LP6 Poultry R R R R R R I I S S I

LP8 Poultry R R R R R R S R R S I

LP11 Poultry R R R R R S S R S S I

LP34 Poultry R R R R R S S S S S R

LP9 Poultry R R R R R I S S S S R

LP27 Poultry R R R R R S R S S S R

LP30 Poultry R R R R R S S R S S R

LP21 Poultry R I R R R R S R S R R

LP26 Poultry R I R S R R I R S R R

LP25 Poultry R I R S R S S S S R R

P3 Poultry R I R R R I S I S R R

P1 Poultry R I R R R S S R R R S

P9 Poultry R I R R R R S S S R S

P5 Poultry R R R R R R S S S R R

P7 Poultry R R R R R R S S R R R

P12 Poultry R R R R R R I S R R R

119

P30 Poultry R R R R R R S S R R R

LH9 Human R R R R R S S R S R S

PH21 Human R I R R I I S R I R R 279-HF-

W Human I S R I R S S S S I S

AKH-11 Human R S R R R S S R S R I

AKH15 Human R R R R R I S R S R S AKRH-

31 Human R S I R R R S R I R S

AKRH-

33 Human R I R R I R S S S R S

LH5 Human R S R R R S S R S R S

296-HF Human R R R I R R S R S I R

N8 Human R S I R R I S R S R S

712 Human R I S S I S S S S S S

LH3 Human R R I R R I R S S R S

I1b Poultry R S R R R S S R S R R

I2b Poultry R S R R R S S R R R R

I3 Poultry R S R R R I S R S R R

I4 Poultry R S R R R S S R S R R

I5 Poultry R S R R R S S R S R R

I6 Poultry R R R R R R S R S R R

I7 Poultry R R R R R R S R S R R

I8 Poultry R R R R R R S R R R R

I9 Poultry R R R R R S S R S R R


I11 Poultry R R R R R S S R S S R

112 Poultry R R R R R S S R S S R

I13 Poultry R R R R R S S R R S R

I14 Poultry R I R R R S R R S S R

I15 Poultry R I R R R S S R S S R

I16 Poultry R I R R R S S R S S R

I17 Poultry R I R R R S S R R I R

I18 Poultry R R R R R S S R S I S

I19 Poultry R R R R R I S R S I S



I22 Poultry R R R R R R R R R I S

I23 Poultry R R R R R R S R S I R



I26 Poultry R I R R R S S R S R R


I28 Poultry R I R R R S S R R R R


120

I30 Poultry R I R R R S S S S R R


I32 Poultry R I R R R S R R S R R

AKP-3 Poultry R S R R R S S R S R R

AKP-4 Poultry R S R R R I S R S R R

AKP-5 Poultry R S R R R I S R S I R

LP-1 Poultry R S R R R S S R S I S

LP-2 Poultry R S R R R S S R S I S

LP-5 Poultry R S R R R S S R R R R

LP-7 Poultry R S R R R S S R S R R

LP-10 Poultry R S R R R S S R S R R

LP-22 Poultry R I R R R S S R S R R


LP-24 Poultry R I R R R S S R R R R


LP-29 Poultry R I R R R S S R S I R

LP-31 Poultry R I R R R S S R S I R

LP-32 Poultry R I R R R S R R S I S

LP-33 Poultry R I R R R S S R S I S

P-2 Poultry R S R R R S S R S I S

P-4 Poultry R S R R R S S R S R S

P-6 Poultry R S R R R S S R S R S

P6b Poultry R S R R R S S R S R R

P-8 Poultry R S R R R S S R S I S

P-10 Poultry R I R R R S S R S I S



P-14 Poultry R I R R R S R R S I S



GP-1 Poultry R S R R R S S R S S S

GP-2 Poultry R S R R R S S R S S S

GP-3 Poultry R R R R R I S S S S S

GP-4 Poultry R I R R R S S R S I S

GP-5 Poultry R I R R R S S S S I S

CH1 Humans R S R R R R S R S R S

CH2 Humans R R R R R S S I S S R

CH3 Humans R I I R R R S R R S S

CH4 Humans R S R R R I R S R R R

CH5 Humans R S R R I R S R S R S

CH6 Humans R S R R R R I R S R S

CH7 Humans R R R R R I S I S R S

CH8 Humans R S R I I R S R S R R

CH9 Humans R S R R R R S R S R S

HFH1 Humans R I I R R S S R R R S

121

HFH2 Humans R S R R R R S R S R R

HFH3 Humans R S R R R R S R R R S AKRH2

9 Humans R S S R R I R R I R S

AKRH2

5 Humans R R I R R R S S S R I

LH1 Humans R S R I R S S R S S S

LH2 Humans R R R R R R S R S R R

LH4 Humans R S R R R R S R R R S

LH6 Humans R S R R R R I R R R R

LH7 Humans R S R I R S S R S R R

LH8 Humans R S R R R R S R I R S

LH11 Humans R I R R R R R R S R R

PH1 Humans R S R I R S S R S S S

PH2 Humans R S R R R R S R R R R

PH3 Humans R S R R R R S R S R S

PH4 Humans R I R I R R S R R S S

702 Humans R R R S R S R R S R R

714 Humans R S R R R S S I R R S

701 Humans R S R R R R S R R S S

5R 5M Bovine R R R S R S S I S R S

6D Cow R I R R R R R S S I I

9B 9M Bovine R I R R I S S S S S R

12B Bovine S I

R S R R R R S R S

10B Bovine R I

R R R S S R S S R

DO1 Cow R I R R I R S S S S S

21H1 Bovine I I R S R I S I S R S

BF1 Bovine S R R R R S S S S S R

BF2 24 Bovine R I S R I I S S S R I

297-CF Camel R I R R R S S R S R S

301-CF Camel R I R S R R S R S I I

39B Bovine R I S R R S S S S R I

46B Bovine R I R R R I S R S R S

53-31C Camel I I R R R S R S S I S

54-24C Camel I I R S R S R R S S R

55-23C Camel R I S R R I R R S R R

56-61C Camel R I R R R S R S S R R

59-34C Camel R R R R R R S R S S S

60-0CF Camel I I R S R I S S S I S

83-BM Bovine S I R R I S S S S R S

84-FM Cow R I R R R R S R S I R

122

247 Cow R I R R R S S R S I S

248 Cow I I R S R S R R S I S

249 Cow R I R R R S S S S I R

250 Cow R I R R R S S R S S S

270-BF Bovine S I R R R I R S S S S

271-BF Bovine I I R R R I S R S I R

297-CF Camel R R S S R S S S S R S

301-CF Camel S I R R R S R S S R S

AC1 Camel R S R S R S S R S S S

AC2 Camel R S R R R S S I S S S

AC5 Camel R S R S I I R S S S I

AC6 Camel I S R S R R R R S I R

AC11 Camel S S R S R S R R S S S

AC17 Camel R S R R R S R S S R R

AC18 Camel R S R R R S S R S I R

AC20 Camel R R R R R I S R S R R

ACH-21 Camel R S S R R S R S S I S

ACH-23 Camel S S R R I S R R S S S

ACH-25 Camel S S R R I I R S S R R

ACH-27 Camel R S R R R S S R S S S

ACH-28 Camel R S R S I R S S S R I

AKC-1 Camel R S R R R I R R S S S

AHB-3 Bovine R S R R I S S S S S S

AKC-3 Camel S S R S R I R R S I R

AKC-4 Camel R R R R R S S S S I R

AKC-5 Camel I S I S I S S R S R S

AKC-8 Camel R S R R I S S R S S S

AKC-9 Camel S S S S I R R R S S S

AKC-21 Camel R S R R I I R R S R R

AKC-23 Camel R S R R R S S R S S S

AKB-5 Bovine S S R S I S R R S I S

AKC-15 Camel R S R R R S S I S S S

AKCo-6 Cow R S I S I S R S S S I

AKCo-8 Cow R R R R R I S R S I R AKCo-

11 Cow R S S R I R S S S S S

AKB-10 Bovine S S I R I S R R S S S

LC1 Camel R S R R R S S R S R R

LC3 Camel I I I R R S S R S I S

LC5 Camel R S R S I I R R S R R

LC6 Camel S I I R R R S S S I R

LC7 Camel R R R R I I R R S I S

LC9 Camel I I S R I S R S S I S

LC15 Camel S S I S R S S R S R S

123

LC17 Camel R I I R I R R S S S R

LC21 Camel R S I R R S S S S S I

LC27 Camel I I R R R S R R S S R

LC29 Camel R R I S I R S R S R R

LCo1 Cow R I S R R I S S S S R

LCo3 Cow R S I R I S R I S I R

LCo7 Cow R I R R I S S S S I S

LCo9 Cow R I I S I R R R S R S

LCo11 Cow S S I R R I S R S S S

LCo13 Cow R I R R I S R R S R S

LCo21 Cow R S I R I R S S S S R

LCo17 Cow I R S S R R S R S S R

LCo19 Cow R I R R I I R S S I S

LCo23 Cow R I I R R S S R S I S

LB1 Bovine R S R S R S R R S R R

LB2 Bovine I S R R I S S R S S R

LB5 Bovine R I I R I R R S S R S

LB7 Bovine R S R R R R S R S I S

LB9 Bovine R R S R R S R S S S R

LB11 Bovine R S R R I I S I S I S

LB14 Bovine S I I R R S S S S I S

LB15 Bovine R S R R R R R R S S R

LB17 Bovine I I R R I S R R S R R

LB19 Bovine R S I R I I R S S R R

LB21 Bovine R I R S R S R R S I S

LB23 Bovine R S R R R R R R S S I

LB24 Bovine R R S R I S R S R R

LB25 Bovine R I I R I I R I S S S

LB27 Bovine R S R R R R S R S S S

PC3 Camel R S I R R R S R S S S

PC5 Camel R S R R R S S R S I S

PC6 Camel S I R S R I R R S I R

PC7 Camel R S R R I S S R S R R

PC8 Camel I R S R I R S R S S R

PCo2 Cow R S I S R I S I S R R

PCo4 Cow R I I R R S R R S S S

PCo7 Cow I S R R R I S R S I S

124

PCo9 Cow R S R R I S S R S S S

PCo11 Cow R I R S I S S R S I R

PCo13 Cow R S R R R R R R S R R

PCo15 Cow R S S R R S S I S S I

PCo17 Cow I S R R I S S R S S S

PCo18 Cow R S I R R I S R S S R

PCo20 Cow R I R R R S S R S R R

PCo25 Cow R S R R I S R I S I S

PB2 Bovine R S R R R R S S S R R

PB4 Bovine R I S R R S R R S S I

PB6 Bovine S S R R I I S R S S I

PB7 Bovine R S R R R R R R S R R

PB8 Bovine I I I R R R S R S I R

PB9 Bovine R S R S R S S R S S S

PB10 Bovine R S S R I S S I S R S

PB19 Bovine R I R R R I S R S I R

PB23 Bovine R S R R I S R R S I S

GCo5 Cow S S S S I R S S S S R

GCo9 Cow R I R S I I S I S R R

GCo10 Cow S S R S I I S S S S I

GCo13 Cow I S S R I R S S S S S

GCo19 Cow R I I R I R R R S I S

181 Wastewater R I R R R S R R S R R

188 Wastewater R R R S R S R R S S I

192 Wastewater R I R R R S S R R R S

196 Wastewater R I I R R R S R S I S

203 Wastewater R I R R R S R R S S R

226 Wastewater R R R R R S S R S I S

229 Wastewater R R R R R I S R R R S

230 Wastewater R R I S R S S R R S S

236 Wastewater R R R R R I R R R S R

239 Wastewater R I R S R I R R R R I

285 Wastewater R I R R R I S R S R S

290 Wastewater R I R R R I R R S R R

292 Wastewater R R R R R R R R S R S

286 Wastewater R R R R R S R R S I R

289 Wastewater R I R R R S S R R R S

291 Wastewater R R R S R I S R S R I

LW6 Wastewater R I R R R I S R R R R

LW9 Wastewater R R I R R S S R R S S

125

LW11 Wastewater R I R S R I S R S R S

LW19 Wastewater R I R R R R S R S I S

LW21 Wastewater R R R S R S R R R I I

LW30 Wastewater R I I R R I S R S R S

159 Wastewater R I R R R R R R S R R

PW3 Wastewater R R R R R S S R S R S

PW8 Wastewater R I R R R I R R R R S

PW9 Wastewater R I R R R I S R R S I

PW11 Wastewater R I R R R R S R S R S

PW13 Wastewater R R I S R R S R S R R

PW2 Wastewater R I R R R S R R R R R

GW4 Wastewater R I I R R I S R S I I

GW9 Wastewater R R I R R R R R S I S

GW6 Wastewater R I R R R S S R R S S

LP9 Poultry R I R R R S S R S I S



Abbreviations: I, intermediate; R, resistant; S, sensitive; nalidixic acid (NA); ciprofloxacin (CIP);

erythromycin (ERY); cefotaxime (CTX); ceftriaxone (CRO); gentamicin (CN); spectinomicin

(SPC); sulphmethoxazole+trimethopterim (SXT); chloramphenicol (C); tetracycline (TE);

ampicillin (AMP)

126

Appendix 2

Multiantibiotic Resistance Profiles of C. jejuni Isolates

127

Number of Antibiotics Patterns of Antibiotic

Resistance Profiles

No. of Isolates Total No. (%)

Three antibiotics ERY, CTX, TE

ERY, CRO, TE

NA, ERY, SPC

NA, ERY, CTX

CN, SPC, SXT

ERY, SPC, SXT

NA, CTX, CN

CTX, SPC, SXT

CTX, CRO, SXT

CRO, SXT, TE

NA, CTX, CRO

ERY, CTX, SXT

2

1

2

2

1

1

1

1

2

1

2

2

18 (6.42)

Four antibiotics NA, ERY, CRO, SXT

NA, ERY, CTX, AMP

NA, ERY, CTX, CN

ERY, CRO, SPC, SXT

ERY, CTX, CRO, SPC

NA, CIP, CRO, TE

NA, ERY, CTX, CRO

ERY, CTX, SPC, SXT

NA, ERY, CTX, SXT

NA, ERY, CTX, CRO

CTX, CRO, CN, AMP

NA, CTX, CN, AMP

ERY, CTX, SXT, AMP

NA, CRO, TE, AMP

3

2

2

2

1

1

1

2

2

1

2

1

1

1

26 (9.28)

128

ERY, CTX, CRO, SXT

NA, ERY, CTX, SPC

NA, ERY, TE, AMP

NA, CTX, CRO, SXT

1

1

1

1

Five antibiotics NA, CIP, ERY, CRO, TE

NA, ERY, CRO, TE, AMP

NA, ERY, CTX, CN,TE

NA, CTX, CRO, SXT, TE

NA, ERY, CTX, CRO, SXT

NA, CTX, CN, SPC, SXT

NA, ERY, CRO, SPC, SXT

ERY, CRO, SPC, SXT,AMP

CIP, CTX, CN, SXT, AMP

NA, CIP, ERY, CRO, TE

CIP, ERY, CTX, CRO, AMP

NA, ERY, CRO, CN, SXT

ERY, CTX, CRO, SPC, TE

ERY, CTX, SPC, TE, AMP

NA, CN, SPC, SXT, TE

1

1

1

2

21

1

3

1

1

2

2

1

1

1

1

40 (14.28)

Six antibiotics NA, ERY, CTX, CRO, SXT,

AMP

NA, ERY, CTX, CRO, SXT,

C

NA, ERY, CTX, CRO, CN,

TE

NA, CIP, ERY, CRO, SXT,

TE

NA, CIP, ERY, CTX, CRO,

SXT, TE


SXT


17

3

5

2

6

5

70 (25)

129

AMP

NA, CIP, ERY, CRO, CN,

TE


SXT


CN

NA, CIP, ERY, CTX,

CRO,TE

NA, ERY, CTX, CRO, TE,

AMP


TE

NA, CTX, CRO, CN, SXT,

TE

NA, CIP, CTX, CRO, SPC,

TE

NA, ERY, CTX, CRO, SPC,

SXT


TE

5

3

2

2

3

2

4

2

1

3

5

Seven antibiotics NA, ERY, CTX, CRO, SXT,

TE, AMP


TE, AMP


CN, TE


C, TE


SXT, AMP


TE, AMP

NA, ERY, CTX, CRO, C,

TE, AMP


33

6

10

2

7

1

1

87 (31.07)

130

SPC, SXT


CN, SXT


CN, AMP


C, AMP


TE, AMP


SPC, AMP


C, TE


SXT, AMP

NA, ERY, CTX, CRO, PC,

SXT, AMP


C, AMP


TE, AMP

2

2

3

1

1

1

3

1

2

1

10

Eight antibiotics NA, CIP, ERY, CTX, CRO,

SXT, C, TE

NA, ERY,CTX, CRO, CN,

C, TE, AMP


C, TE, AMP


SXT, TE, AMP


CN, C, AMP


CN, TE, AMP


2

1

5

8

1

2

1

31 (11.07)

131

CN, C, TE


CN, SXT, C


SXT, TE, AMP


SXT, C, AMP


CN, SXT, AMP


C, TE, AMP

NA, ERY, CTX, CRO, SPC,

SXT, TE, AMP

1

2

1

1

3

3

Nine antibiotics NA, CIP, ERY, CTX, CRO,

SXT, C, TE, AMP


CN, C, TE, AMP


CN, SXT, TE, AMP


CN, SPC, SXT, C

1

3

2

1

7 (2.5)

Ten antibiotics NA, CIP, ERY, CTX, CRO,

CN, SPC, SXT, C, TE, AMP

1 1 (0.35)

Abbreviations: nalidixic acid (NA); ciprofloxacin (CIP); erythromycin (ERY); cefotaxime

(CTX); ceftriaxone (CRO); gentamicin (CN); spectinomicin (SPC);

sulphmethoxazole+trimethopterim (SXT); chloramphenicol (C); tetracycline (TE); ampicillin

(AMP)

132

Appendix 3

PCR Profiles of C. jejuni Isolates for Prediction of Strain Clusters

133

Sr.

no.

C. jejuni

Isolate

ID

Cj0056c

(415 bp)

Cj0485c

(405 bp)

Cj1139c

(703 bp)

Cj1324

(765 bp)

Cj1422c

(900 bp)

Cj1720

(595 bp)

Predicted

Group

1 IP1 1 1 0 1 0 1

C4/C6

2 PI2 1 1 0 1 0 1 C4/C6

3 6PI 1 1 0 1 0 1 C4/C6

4 7PS 1 1 0 1 0 1 C4/C6

5 8PI2 1 1 0 1 0 1 C4/C6

6 9PS2 1 1 0 1 0 1 C4/C6

7 13PS3 1 1 0 1 0 1 C4/C6

8 14F 1 1 0 1 0 1 C4/C6

9 16F 1 1 0 1 0 1 C4/C6

10 77PI 1 1 0 1 0 1 C4/C6

11 18PS 1 1 0 1 0 1 C4/C6

12 80PF 1 1 0 1 0 1 C4/C6

13 149PI 1 1 0 1 0 1 C4/C6

14 150PS 1 1 0 1 0 1 C4/C6

15 37PID 1 1 0 1 0 1 C4/C6

16 38PSD 1 1 0 1 0 1 C4/C6

17 22PI1 1 1 0 1 0 1 C4/C6

18 18PI 1 1 0 1 0 1 C4/C6

19 I1 1 1 0 1 0 1 C4/C6

20 I2 1 1 0 1 0 1 C4/C6

21 264P 1 1 0 1 0 1 C4/C6

22 265P 1 1 0 1 0 1 C4/C6

23 266P 1 1 0 1 0 1 C4/C6

24 268P 1 1 0 1 0 1 C4/C6

25 AP8 1 1 0 1 0 1 C4/C6

26 AKP1 1 1 0 1 0 1 C4/C6

27 AKP2 1 1 0 1 0 1 C4/C6

28 AKP7 1 1 0 1 0 1 C4/C6

29 AKP11 1 1 0 1 0 1 C4/C6

30 AKP14 1 1 0 1 0 1 C4/C6

31 LP3 1 1 0 1 0 1 C4/C6

32 LP4 1 1 0 1 0 1 C4/C6

33 LP6 1 1 0 1 0 1 C4/C6

34 LP8 1 1 0 1 0 1 C4/C6

35 P1 1 1 0 1 0 1 C4/C6

36 P3 1 1 0 1 0 1 C4/C6

37 P5 1 1 0 1 0 1 C4/C6

38 P7 1 1 0 1 0 1 C4/C6

39 P9 1 1 0 1 0 1 C4/C6

40 279HFW 1 1 0 1 0 1 C4/C6

134

41 AKH11 1 1 0 1 0 1 C4/C6

42 I3 1 1 0 1 0 1 C4/C6

43 I4 1 1 0 1 0 1 C4/C6

44 I5 1 1 0 1 0 1 C4/C6

45 I6 1 1 0 1 0 1 C4/C6

46 I7 1 1 0 1 0 1 C4/C6

47 I8 1 1 0 1 0 1 C4/C6

48 I9 1 1 0 1 0 1 C4/C6

49 I10 1 1 0 1 0 1 C4/C6

50 I11 1 1 0 1 0 1 C4/C6

51 I12 1 1 0 1 0 1 C4/C6

52 I13 1 1 0 1 0 1 C4/C6

53 I14 1 1 0 1 0 1 C4/C6

54 I15 1 1 0 1 0 1 C4/C6

55 I16 1 1 0 1 0 1 C4/C6

56 I17 1 1 0 1 0 1 C4/C6

57 LP22 1 1 0 1 0 1 C4/C6

58 LP23 1 1 0 1 0 1 C4/C6

59 LP24 1 1 0 1 0 1 C4/C6

60 LP28 1 1 0 1 0 1 C4/C6

61 LP29 1 1 0 1 0 1 C4/C6

62 LP31 1 1 0 1 0 1 C4/C6

63 P4 1 1 0 1 0 1 C4/C6

64 P6 1 1 0 1 0 1 C4/C6

65 P6B 1 1 0 1 0 1 C4/C6

66 P8 1 1 0 1 0 1 C4/C6

67 P10 1 1 0 1 0 1 C4/C6

68 GP1 1 1 0 1 0 1 C4/C6

69 GP2 1 1 0 1 0 1 C4/C6

70 CH4 1 1 0 1 0 1 C4/C6

71 CH5 1 1 0 1 0 1 C4/C6

72 HFH3 1 1 0 1 0 1 C4/C6

73 AKRH29 1 1 0 1 0 1 C4/C6

74 LH2 1 1 0 1 0 1 C4/C6

75 LH4 1 1 0 1 0 1 C4/C6

76 712H 1 1 0 1 0 1 C4/C6

77 249C 1 1 0 1 0 1 C4/C6

78 250C 1 1 0 1 0 1 C4/C6

79 AC11 1 1 0 1 0 1 C4/C6

80 AC17 1 1 0 1 0 1 C4/C6

81 AC18 1 1 0 1 0 1 C4/C6

82 AC20 1 1 0 1 0 1 C4/C6

83 ACH21 1 1 0 1 0 1 C4/C6

84 AKB10 1 1 0 1 0 1 C4/C6

85 LC1 1 1 0 1 0 1 C4/C6

135

86 LC3 1 1 0 1 0 1 C4/C6

87 LC5 1 1 0 1 0 1 C4/C6

88 LC6 1 1 0 1 0 1 C4/C6

89 LC7 1 1 0 1 0 1 C4/C6

90 LC9 1 1 0 1 0 1 C4/C6

91 LC11 1 1 0 1 0 1 C4/C6

92 LC17 1 1 0 1 0 1 C4/C6

93 LC21 1 1 0 1 0 1 C4/C6

94 LC27 1 1 0 1 0 1 C4/C6

95 LC29 1 1 0 1 0 1 C4/C6

96 PCO2 1 1 0 1 0 1 C4/C6

97 PCO4 1 1 0 1 0 1 C4/C6

98 PCO7 1 1 0 1 0 1 C4/C6

99 PCO9 1 1 0 1 0 1 C4/C6

100 PCO13 1 1 0 1 0 1 C4/C6

101 PCO15 1 1 0 1 0 1 C4/C6

102 PCO17 1 1 0 1 0 1 C4/C6

103 PCO18 1 1 0 1 0 1 C4/C6

104 PCO20 1 1 0 1 0 1 C4/C6

105 PCO25 1 1 0 1 0 1 C4/C6

106 AKP8 0 1 0 1 0 1 C7/C8

107 AKP9 0 1 0 1 0 1 C7/C8

108 257PS 0 1 0 1 0 1 C7/C8

109 153PI 0 1 0 1 0 1 C7/C8

110 154PI 0 1 0 1 0 1 C7/C8

111 LP1 0 1 0 1 0 1 C7/C8

112 LP2 0 1 0 1 0 1 C7/C8

113 LP5 0 1 0 1 0 1 C7/C8

114 LP7 0 1 0 1 0 1 C7/C8

115 LP10 0 1 0 1 0 1 C7/C8

116 232PI 0 1 0 1 0 1 C7/C8

117 241PS 0 1 0 1 0 1 C7/C8

118 267PI 0 1 0 1 0 1 C7/C8

119 255PI 0 1 0 1 0 1 C7/C8

120 AKP10 0 1 0 1 0 1 C7/C8

121 AKP12 0 1 0 1 0 1 C7/C8

122 AKP13 0 1 0 1 0 1 C7/C8

123 AKP15 0 1 0 1 0 1 C7/C8

124 AKP16 0 1 0 1 0 1 C7/C8

125 AP3 0 1 0 1 0 1 C7/C8

126 AP4 0 1 0 1 0 1 C7/C8

127 AP5 0 1 0 1 0 1 C7/C8

128 AP6 0 1 0 1 0 1 C7/C8

129 AP7 0 1 0 1 0 1 C7/C8

130 I1.01 0 1 0 1 0 1 C7/C8

136

131 1-27-C 0 1 0 1 0 1 C7/C8

132 LP11 0 1 0 1 0 1 C7/C8

133 LP34 0 1 0 1 0 1 C7/C8

134 LP9 0 1 0 1 0 1 C7/C8

135 LP27 0 1 0 1 0 1 C7/C8

136 LP30 0 1 0 1 0 1 C7/C8

137 P12 0 1 0 1 0 1 C7/C8

138 P30 0 1 0 1 0 1 C7/C8

139 LH9 0 1 0 1 0 1 C7/C8

140 PH21 0 1 0 1 0 1 C7/C8

141 AKH15 0 1 0 1 0 1 C7/C8

142 I20 0 1 0 1 0 1 C7/C8

143 I21 0 1 0 1 0 1 C7/C8

144 I22 0 1 0 1 0 1 C7/C8

145 I23 0 1 0 1 0 1 C7/C8

146 I24 0 1 0 1 0 1 C7/C8

147 I25 0 1 0 1 0 1 C7/C8

148 I26 0 1 0 1 0 1 C7/C8

149 I27 0 1 0 1 0 1 C7/C8

150 I28 0 1 0 1 0 1 C7/C8

151 I29 0 1 0 1 0 1 C7/C8

152 I30 0 1 0 1 0 1 C7/C8

153 LP32 0 1 0 1 0 1 C7/C8

154 LP33 0 1 0 1 0 1 C7/C8

155 P2 0 1 0 1 0 1 C7/C8

156 GP3 0 1 0 1 0 1 C7/C8

157 CH6 0 1 0 1 0 1 C7/C8

158 CH7 0 1 0 1 0 1 C7/C8

159 HFH1 0 1 0 1 0 1 C7/C8

160 HFH2 0 1 0 1 0 1 C7/C8

161 AKRH25 0 1 0 1 0 1 C7/C8

162 LH1 0 1 0 1 0 1 C7/C8

163 270-BF 0 1 0 1 0 1 C7/C8

164 271-BF 0 1 0 1 0 1 C7/C8

165 LCO1 0 1 0 1 0 1 C7/C8

166 LCO3 0 1 0 1 0 1 C7/C8

167 LCO7 0 1 0 1 0 1 C7/C8

168 LCO9 0 1 0 1 0 1 C7/C8

169 I19 0 1 0 1 0 1 C7/C8

170 LCO11 0 1 0 1 0 1 C7/C8

171 GCO5 0 1 0 1 0 1 C7/C8

172 GC09 0 1 0 1 0 1 C7/C8

173 GCO10 0 1 0 1 0 1 C7/C8

174 LB19 0 1 0 1 0 1 C7/C8

175 LB21 0 1 0 1 0 1 C7/C8

137

176 P11 0 1 0 1 0 1 C7/C8

177 LB23 0 1 0 1 0 1 C7/C8

178 LB24 0 1 0 1 0 1 C7/C8

179 LB25 0 1 0 1 0 1 C7/C8

180 LB27 0 1 0 1 0 1 C7/C8

181 PC8 0 1 0 1 0 1 C7/C8

182 159W 0 1 0 1 0 1 C7/C8

183 236W 0 1 0 1 0 1 C7/C8

184 78PI 1 1 1 1 0 1 C5

185 79PI 1 1 1 1 0 1 C5

186 33PI 1 1 1 1 0 1 C5

187 34PS 1 1 1 1 0 1 C5

188 AC2 1 1 1 1 0 1 C5

189 36PS 1 1 1 1 0 1 C5

190 LP21 1 1 1 1 0 1 C5

191 LP25 1 1 1 1 0 1 C5

192 LP26 1 1 1 1 0 1 C5

193 117P 1 1 1 1 0 1 C5

194 118P 1 1 1 1 0 1 C5

195 119P 1 1 1 1 0 1 C5

196 120P 1 1 1 1 0 1 C5

197 247C 1 1 1 1 0 1 C5

198 248C 1 1 1 1 0 1 C5

199 151PI 0 1 0 0 0 1 C7/C8

200 151PIF 0 1 0 0 0 1 C7/C8

201 152PS 0 1 0 0 0 1 C7/C8

202 242PI 0 1 0 0 0 1 C7/C8

203 243PS 0 1 0 0 0 1 C7/C8

204 246PC 0 1 0 0 0 1 C7/C8

205 256PI 0 1 0 0 0 1 C7/C8

206 259P 0 1 0 0 0 1 C7/C8

207 260P 0 1 0 0 0 1 C7/C8

208 P13 0 1 0 0 0 1 C7/C8

209 261P 0 1 0 0 0 1 C7/C8

210 262P 0 1 0 0 0 1 C7/C8

211 263PI 0 1 0 0 0 1 C7/C8

212 LH8 0 1 0 0 0 1 C7/C8

213 LH11 0 1 0 0 0 1 C7/C8

214 PH1 0 1 0 0 0 1 C7/C8

215 PH2 0 1 0 0 0 1 C7/C8

216 5R5M 0 1 0 0 0 1 C7/C8

217 6D 0 1 0 0 0 1 C7/C8

218 9B9M 0 1 0 0 0 1 C7/C8

219 10B 0 1 0 0 0 1 C7/C8

220 12B 0 1 0 0 0 1 C7/C8

138

221 DO1 0 1 0 0 0 1 C7/C8

222 ACH23 0 1 0 0 0 1 C7/C8

223 ACH25 0 1 0 0 0 1 C7/C8

224 I18 0 1 0 0 0 1 C7/C8

225 ACH27 0 1 0 0 0 1 C7/C8

226 ACH28 0 1 0 0 0 1 C7/C8

227 AHB3 0 1 0 0 0 1 C7/C8

228 LCO13 0 1 0 0 0 1 C7/C8

229 LCO17 0 1 0 0 0 1 C7/C8

230 LCO21 0 1 0 0 0 1 C7/C8

231 LCO19 0 1 0 0 0 1 C7/C8

232 LCO23 0 1 0 0 0 1 C7/C8

233 LB1 0 1 0 0 0 1 C7/C8

234 LB2 0 1 0 0 0 1 C7/C8

235 LB5 0 1 0 0 0 1 C7/C8

236 LB7 0 1 0 0 0 1 C7/C8

237 LB9 0 1 0 0 0 1 C7/C8

238 LB11 0 1 0 0 0 1 C7/C8

239 LB14 0 1 0 0 0 1 C7/C8

240 LB15 0 1 0 0 0 1 C7/C8

241 LB17 0 1 0 0 0 1 C7/C8

242 226W 0 1 0 0 0 1 C7/C8

243 286W 0 1 0 0 0 1 C7/C8

244 LW6 0 1 0 0 0 1 C7/C8

245 GW4 0 1 0 0 0 1 C7/C8

246 GW6 0 1 0 0 0 1 C7/C8

247 701W 0 0 0 0 0 1 C9

248 I31 0 0 0 0 0 1 C9

249 I32 0 0 0 0 0 1 C9

250 714H 0 0 0 0 0 1 C9

251 AKP3 0 0 0 0 0 1 C9

252 AKP4 0 0 0 0 0 1 C9

253 AKP5 0 0 0 0 0 1 C9

254 AC1 0 0 0 0 0 1 C9

255 P15 0 0 0 0 0 1 C9

256 P16 0 0 0 0 0 1 C9

257 CH8 0 0 0 0 0 1 C9

258 CH9 0 0 0 0 0 1 C9

259 LH6 0 0 0 0 0 1 C9

260 LH7 0 0 0 0 0 1 C9

261 702H 0 0 0 0 0 1 C9

262 PCO11 0 0 0 0 0 1 C9

263 180W 0 0 0 0 0 1 C9

264 188W 0 0 0 0 0 1 C9

265 285W 0 0 0 0 0 1 C9

139

266 12B 0 0 0 0 0 1 C9

267 LP9 0 0 0 0 0 1 C9

268 LW30 0 0 0 0 0 1 C9

269 290W 0 0 0 0 0 1 C9

270 PW11 0 0 0 0 0 1 C9

271 PW13 0 0 0 0 0 1 C9

272 PH3 0 0 0 0 0 1 C9

273 LW9 0 0 0 0 0 1 C9

274 I1B 1 0 0 1 0 1 C9

275 I2B 1 0 0 1 0 1 C9

276 LH3 1 0 0 1 0 1 C9

277 LH5 1 0 0 1 0 1 C9

278 296HF 1 0 0 1 0 1 C9

279 N8 1 0 0 1 0 1 C9

280 AC5 1 0 0 1 0 1 C9

281 AC6 1 0 0 1 0 1 C9

282 292W 1 0 0 1 0 1 C9

283 196W 1 0 0 1 0 1 C9

284 LP12 1 0 0 1 0 1 C9

285 LP19 1 0 0 1 0 1 C9

286 229W 1 0 0 1 0 1 C9

287 230W 1 0 0 1 0 1 C9

288 258PI 1 0 0 0 0 1 C9

289 P14 1 0 0 0 0 1 C9

290 AKH31 1 0 0 0 0 1 C9

291 AKH33 1 0 0 0 0 1 C9

292 289W 1 0 0 0 0 1 C9

293 GP4 1 0 0 0 0 1 C9

294 GP5 1 0 0 0 0 1 C9

295 291W 1 0 0 0 0 1 C9

296 LW11 1 0 0 0 0 1 C9

297 LW19 1 0 0 0 0 1 C9

298 LW21 1 0 0 0 0 1 C9

299 CH1 1 1 0 0 0 0 C4/C6

300 CH2 1 1 0 0 0 0 C4/C6

301 CH3 1 1 0 0 0 0 C4/C6

302 297-CF 1 1 0 0 0 0 C4/C6

303 301-CF 1 1 0 0 0 0 C4/C6

304 PH4 1 1 0 0 0 0 C4/C6

305 AKC21 1 1 0 0 0 0 C4/C6

306 AKC23 1 1 0 0 0 0 C4/C6

307 AKB5 1 1 0 0 0 0 C4/C6

308 AKC15 1 1 0 0 0 0 C4/C6

309 AKCO6 1 1 0 0 0 0 C4/C6

310 AKCO8 1 1 0 0 0 0 C4/C6

140

311 AKCO11 1 1 0 0 0 0 C4/C6

312 PC3 1 1 0 0 0 0 C4/C6

313 PC5 1 1 0 0 0 0 C4/C6

314 PC6 1 1 0 0 0 0 C4/C6

315 PC7 1 1 0 0 0 0 C4/C6

316 21H1 1 1 0 0 0 0 C4/C6

317 10B 1 1 0 0 0 0 C4/C6

318 BF1 1 1 0 0 0 0 C4/C6

319 BF2 24 1 1 0 0 0 0 C4/C6

320 39B 1 1 0 0 0 0 C4/C6

321 46B 1 1 0 0 0 0 C4/C6

322 53-31C 1 1 0 0 0 0 C4/C6

323 54-24C 1 1 0 0 0 0 C4/C6

324 55-23C 1 1 0 0 0 0 C4/C6

325 56-61 C 1 1 0 0 0 0 C4/C6

326 60-0CF 1 1 0 0 0 0 C4/C6

327 83-BM 1 1 0 0 0 0 C4/C6

328 84-FM 1 1 0 0 0 0 C4/C6

329 PB2 1 1 0 0 0 0 C4/C6

330 PB4 1 1 0 0 0 0 C4/C6

331 PB6 1 1 0 0 0 0 C4/C6

332 PB7 1 1 0 0 0 0 C4/C6

333 PB8 1 1 0 0 0 0 C4/C6

334 PB9 1 1 0 0 0 0 C4/C6

335 PB10 1 1 0 0 0 0 C4/C6

336 PB19 1 1 0 0 0 0 C4/C6

337 PB23 1 1 0 0 0 0 C4/C6

338 GCO13 1 1 0 0 0 0 C4/C6

339 GCO19 1 1 0 0 0 0 C4/C6

340 203W 1 1 0 0 0 0 C4/C6

341 239W 1 1 0 0 0 0 C4/C6

342 PW3 1 1 0 0 0 0 C4/C6

343 PW8 1 1 0 0 0 0 C4/C6

344 PW9 1 1 0 0 0 0 C4/C6

345 PW2 1 1 0 0 0 0 C4/C6

346 GW9 1 1 0 0 0 0 C4/C6

347 192W 0 1 0 0 0 0 ?

348 56C 0 1 0 0 0 0 ?

349 35P 0 1 0 0 0 0 ?

350 55C 0 1 0 0 0 0 ?

351 181W 0 1 0 0 0 0 ?

0 = PCR product negative, 1 = PCR product positive, ? = with distinct PCR profile not

falling in any specified predicted group.

141

Publications

1) Identification of Possible Virulence Marker from Campylobacter jejuni Isolates.

James W. Harrison, Tran Thi Ngoc Dung, Fariha Siddiqui, Sunee Korbrisate,

Habib Bukhari, My Phan Vu Tra, Nguyen Van Minh Hoang, Juan Carrique-Mas,

Juliet Bryant, James I. Campbell, David J. Studholme, Brendan W. Wren, Stephen

Baker, Richard W. Titball, and Olivia L. Champion. Emerging Infectious

Diseases Vol. 20, No. 6, June 2014. (Impact Factor 6.751)

2) Antibiotic Susceptibility Profiling and Virulence Potential of Campylobacter

jejuni Isolates from Different Sources in Pakistan. Fariha Masood Siddiqui,

Muhammad Akram, Nighat Noureen, Zobia Noreen, Habib Bokhari. (Accepted –

Asian Pacific Journal of Tropical Medicine Vol. 8, No. 3, March 2015 (Impact

Factor 1.062)

3) Molecular Detection Identified a Type Six Secretion System in Campylobacter

jejuni from Various Sources but not from Human Cases. Fariha Siddiqui, Olivia

Champion, Muhammad Akram, David Studholme, Brendan W. Wren, Richard

Titball, Habib Bokhari. Journal of Applied Microbiology Vol. 118, No. 5, May

2015 (Impact Factor 2.479)

4) Draft Genome Sequence of the Enteropathogenic Bacterium Campylobacter

jejuni Strain cj255. Fariha Masood Siddiqui, Muhammad Ibrahim, Nighat

Noureen, Zobia Noreen, Richard W. Titball, Olivia L. Champion, Brendan W.

Wren, David Studholme, Habib Bokhari. Genome Announcments Vol. 3, No. 5,

September/October 2015

5) Antibiotic Susceptibility and Molecular Characterization of Campylobacter jejuni

Strain Isolated from a Guillain Barre Syndrome Child. Zobia Noreen, Mohammad

Abrar, Fariha Siddiqui, Rani Faryal, Haroon Hamid, Habib Bokhari. Indian

Journal of Pediatrics DOI: 10.1007/s12098-015-1923-z (Impact Factor 0.867)

http://genomea.asm.org/search?author1=Fariha+Masood+Siddiqui&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Muhammad+Ibrahim&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Nighat+Noureen&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Nighat+Noureen&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Zobia+Noreen&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Richard+W.+Titball&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Olivia+L.+Champion&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Brendan+W.+Wren&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Brendan+W.+Wren&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=David+Studholme&sortspec=date&submit=Submit

http://genomea.asm.org/search?author1=Habib+Bokhari&sortspec=date&submit=Submit

Molecular Epidemiology, Virulence Potential and Source...

Documents

Transcript of Molecular Epidemiology, Virulence Potential and Source...