Molecular diagnosis of Haemorrhagic Septicaemia - A Review1 1 1 2Rajeev Ranjan *, S.K. Panda , A.P. Acharya , A.P. Singhand M.K. Gupta1. Department of Pathology, Orissa Veterinary College, OUAT, Bhubaneswar- 751003, Orissa.2. Department of Bacteriology and Mycology, IVRI, Izatnagar, Bareilly-243122, UP, India.3. Department of Veterinary Pathology, Ranchi Veterinary College, BAU, Ranchi- 834006* Corresponding authorVeterinary World, 2011, Vol.4(4):189-192 REVIEWAbstractPasteurella multocida is associated with hemorrhagic septicaemia in cattle and buffaloes, pneumonic pasteurellosis in sheep and goats, fowl cholera in poultry, atrophic rhinitis in pigs and snuffles in rabbits. Haemorrhagic septicaemia is caused by Pasteurella multocida type B:2, B:2,5 and B:5 in Asian countries and type E:2 in African countries. Pasteurella multocida have five types of capsular serotype i.e. type A, B, D, E and F. Diagnosis of the disease is mainly based on the clinical sign and symptom, post mortem findings. Confirmatory diagnosis is done by isolation and identification of causative agent. A variety of laboratory diagnostic techniques have been developed over the years for pasteurellosis and used routinely in the laboratory. Among these techniques molecular techniques of diagnosis is most important. This technique not only gives diagnosis but it also provides information regarding capsular type of Pasteurella multocida. Techniques which are used for molecular diagnosis of haemorrhagic septicaemia are PCR based diagnosis, Restriction endonuclease analysis (REA), Ribotyping, Colony hybridization assay, Filled alternation gel electrophoresis (FAGE), Detection of Pasteurella multocida by Real Time PCR. Among these techniques real time PCR is most sensitive and specific.Keywords: Haemorrhagic septicaemia, Molecular diagnosis, Laboratory diagnostic technique, Real time PCR.Introduction Twotypingsystemsforserotypingof Pasteurella multocida isolates are adopted. One for Pasteurellosis is a major disease of cattle and capsulartypingbyCartersIHAsystemandother buffalo occurring as catastrophic epizootics in many somatic typing by the method of Namioka and Murata AsianandAfricancountriesresultingintohigh orHeddleston.Diagnosisofthediseaseismainly mortality and morbidity (AHIS, 1997; Mustafa et al., based on the clinical sign and symptom, post mortem 1978; Singh et al., 1996). The disease has been also findings.Confirmatorydiagnosisisdonebythe recordedinpoultry,rabbit,pigandwildmammals isolationandidentificationofcausativeagent.A (Cariganetal.,1991;Rosen,1981).Pasteurella variety of laboratory diagnostic techniques have been multocida is associated with hemorrhagic septicaemia developed over the years for pasteurellosis and used in cattle and buffaloes, pneumonic pasteurellosis in routinely in the laboratory. The organism is identified sheepandgoats,fowlcholerainpoultry,atrophic directlythroughexaminationofbloodsmearfrom rhinitisinpigsandsnufflesinrabbits(DeAlwis, affected animal and can be isolated in suitable culture 1996).AnannualeconomiclossinIndiadueto medium in the laboratory. Various biochemical and Pasteurella multocida is Rs. 225/- millions (Singh, serological tests are used for the identification and 2008).Fowlcholerahasbeenrecognizedasan serotyping of the organism. Rapid slide agglutination important disease in domestic poultry for more than test is performed on slide for rapid diagnosis; in which 200 years that causes devastating economic losses to floccular agglutination appear within 30 seconds in poultry industry worldwide (Aye et al, 2001).the positive cases. Indirect haemagglutination test is Haemorrhagicsepticaemiaiscausedby carried out for the determination of capsular types of PasteurellamultocidatypeB:2,B:2,5andB:5in Pasteurella multocida.AsiancountriesandtypeE:2in Africancountries. With development in biotechnological techniques Pasteurellamultocidahavefivetypesofcapsular for the detection of nucleic acid, the identification andserotypei.e.typeA,B,D,EandF.Pasteurella characterizationofetiologicalagentshasbecomemultocida type A produce chloral in fowl; pneumonia quick, easy and accurate (Dutta et al., 2005). incattle,sheep,andpig.CapsulartypeDof Pasteurella multocida produces atrophic rhinitis in pig1.PCRbaseddiagnosisandtyping:Numerous and snuffles in rabbits.studiesfordiagnosisandcharacterizationof www.veterinaryworld.orgVeterinary World, Vol.4 No.4 April 2011 189Molecular diagnosis of Haemorrhagic Septicaemia - A ReviewPasteurellamultocidahavebeencarriedoutwithalternativetotheconventionalcapsularserotyping variableresults.Thephenotypiccharacterizationsystem and used for capsular types determination. The systems by means of morphology, biochemical typing,serogroupspecificprimersusedinthisassaywere serotypingetc.areverymuchlaboriousandtimedesigned following identification, sequence determi-consuming. Even after capsular and somatic antigennation and analysis of the capsular biosynthetic loci of determination, still few isolates react similarly in botheachcapsulargroup.ThemultiplexcapsularPCR theantigens.ThePCRbasedtechniqueshaveassay is highly specific and its result correlated well provided the alternative methods of characterizationwithconventionalserotypingresultswiththe to overcoming the limitations of phenotyping. exceptionofthoseforsomeserogroupFstrains a. Pasteurella multocida specific PCR assay: The(Townsend et al., 1998, 2001).speciesspecificPCRassaycanbeappliedforThecapsulartypingofalltheisolateswere detection of Pasteurella multocida by using templatedetermined by multiplex PCR using capsular types A, B, D, E and F specific primers as mentioned below: as either genomic DNA or bacterial colony or by using 1.CAP A- F 5- 3 TGCCAAAATCGCAGTCAGthe direct field samples such as nasal swab, morbid 2.CAP A- R 5- 3 TTGCCATCATTGTCAGTGmaterials like spleen, one marrow, and heart blood. 3.CAP B- F 5- 3 CATTTATCCAAGCTCCACCEarlier the PCR needed additional hybridization step 4.CAP B- R 5- 3 GCCCGAGAGTTTCAATCC5.CAP D- F 5- 3 TTACAAAAGAAAGACTAGGAGCCC for increasing the specificity but later with improved 6.CAP D- R 5- 3 CATCTACCCACTCAACCATATCAGPCRtechniqueitbecamepossibletodetectas 7.CAP E- F 5- 3 TCCGCAGAAAATTATTGACTCminimumas10organismsperreaction.The 8.CAP E- R 5- 3GCTTGCTTGATTTTGTCPasteurella multocida can identify all subspecies of 9.CAP F- F 5- 3 AATCGGAGAACGCAGAAATCA10. CAP F- R 5- 3 TTCCGCCGTCAATTACTCTG Pasteurella multocida. The sensitivity and specificity Sizes of the multiplex PCR amplicons are as follows: of this PCR offer the most compelling argument for Amplicon size Capsular type the use of PCR technology in laboratory to investigate 1044 bp A thesuspectedHScasesusingtheprimersetas 760 bp B KMT1T7- 5-ATC CGC TAT TTA CCC AGT GG- 657 bp D3and KMT1SP6 5-GCT GTA AAC GAA CTC GCC 511 bp EAC-3(Townsendetal1998,2000)bytheampli-851 bp Ffication of a 460bp fragment of DNA. This technique e.REP-PCRandERIC-PCR: Recently Repetitice has reduced the time for diagnosis of the disease and ExtragenicPalindromic(REP)andEnterobacterial also it is specific than traditional one.RepetitiveInsertionConsensus(ERIC)PCRhave b. HS causing type B specific PCR assay: The PCR been developed for the characterization of Pasteurella amplification can also detect the serotype B specific multocida isolates. REP elements (33 to 40 base pair PasteurellamultocidadirectlyHScausingtypeB repeats) are present in 500- 1000 copies accounting for specific PCR is 100 % specific for type B serotypes of upto 1% of the genome (Stern et al., 1984) and are Pasteurella multocida isolates. Serotype B cultures present in a wide range of bacteria (Olive and Bean, withtheanycombinationofsomaticantigenare 1999). As the REP elements are distributed widely identified by the amplification of a 620 bp fragment acrossthegenome,itproducesamultiplebanding with the KT SP61: 5- ATC CGC TAA CAC ACT pattern.ERIC-PCRhasbeensuccessfullyusedto CTC- 3 and KTT72: 5- AGG CTC GTT TGG ATT differentiatestrainsofPasteurellamultocida.The ATG AAG- 3 primers (Townsend et al., 1998, 2001).visual analyses of banding pattern were in range of c.PasteurellamultocidatypeAspecificPCR: 100-900bp.ThebandpatternsprovideDNA PrimersfortypingofserogroupAstrainswhich fingerprints which allows distinction between species causing number of infection in livestock and poultry and between strains within species.with several somatic types have been reported to be f. Detection of toxigenic Pasteurella multocida: usefulinspecificidentificationofisolates.The The Pasteurella multocida capsular type D strain has primers RGPMA5: 5- AAT GT TTG CGA TAG YCC been identified as causative agent of atrophic rhinitis GTT AGA- 3 and RGPMA6: 5- ATT TGG CGC CAT inpigsandsnufflesinrabbits.ThetoxAgeneof ATC ACA GTC- 3 gives PCR amplicon size of 564 bp Pasteurellamultocidaencodesthedermanecrotic which confirms the presence of Pasteurella multocida toxin responsible for atrophic rhinitis. The toxA gene serotype A.based PCR can be used for direct analysis of toxigenicd.MultiplexPCRforPasteurellamultocida Pasteurellamultocidawithoutadditionalhybridi- capsular typing: A multiplex PCR assay is a rapid www.veterinaryworld.orgVeterinary World, Vol.4 No.4 April 2011 190Molecular diagnosis of Haemorrhagic Septicaemia - A Reviewzation. The assay appears to be the most sensitive andexpensiveelectrophoresisequipment,whichis effective method for large scale analysis of nasal andgenerallynotavailableinnormaldiagnostic tonsillar swabs (Kamp et al., 1996). laboratories (Dutta et al., 2005).6.DetectionofPasteurellamultocidabyReal2.Restrictionendonucleaseanalysis(REA): TimePCR:Thislatestmethodfordetectionof Restriction endonucleases cleave the DNA at specific Pasteurellamultocidainfieldsample.Thishighly nucleotidesequencesandproduceasetofDNA sensitive and specific test than PM PCR and Multiplex fragments which, upon electrophoresis separate into a PCR.characteristicbandingpatternorfingerprintofthe respective genome. Restriction endonuclease analysis Referenceshas been successfully used as a tool for differentiation 1. Animalhealthinformationservices(1997).Deputy of strains in a variety of bacterial infections including Commissioner (LH). Department of animal Health, Ministry thatcausebyPasteurellamultocida.Several of Agriculture, Govt. of India, New Delhi, India.restriction enzymes (HhaI, HpaII, SmaI BglII, PstI,2. Aye, P.P., Angrick, T.Y., Morishita and Harr, B.S. (2001): Prevalence and characteristics of Pasteurella multocida in EcoRI)havebeentakenintoconsiderationfor commercial turkeys. Avian Dis., 45 (1): 182- 190.characterization the different isolates of Pasteurella 3. Blackall,P.J .andMiflin,J .K.(2000):Identificationand multocida (Zhao et al., 1992). typing of Pasteurella multocida: a review. Avian Pathol., 29: 3. Ribotyping: Ribotyping in conjunction with REA271- 287.4. Blackall, P.J ., Pahoff, J .L., Marks, D., Fegan, N. and Morrow, has been widely used to characterize and differentiate C.J .(1995):CharacterizationofPasteurellamultocida thePasteurellamultocidaisolates(Blackalletal., isolated from fowl cholera outbreaks on turkey farm. Aus. 1995). REA followed by additional hybridization with Vet.J ., 72: 135- 138.5. Carigan, M.J ., Dawkins, H.J .S., Cockram E.A. and Hansena labeled DNA probe made easy to read the banding A.T.(1991):P.multocidasepticaemiainfallowdeer. patternandgivethenecessaryinterpretation.The Aust.Vet.J ., 68: 201- 203.probe may be labeled either by radio active or non 6. DeAlwisM.C.L.(1996).Haemorrhagicsepticaemia: radioactive materials. rRNA probe is widely accepted clinicalandepidemiologicalfeaturesofthedisease. Proceedings of International Workshop on Diagnosis andforhybridizationandsubsequentinterpretation Control of HS Bali, Indonesia, May 28- 30.(Blackall, 2000).7. Dutta, T.K., Rajeev Gautam, Senthil Kumar V.S. and S.K. 4. Colony hybridization assay: A colony lift hybri-Kotwal(2005):Diagnosisofhaemorrhagicsepticaemia: dizationassayusingacommerciallyavailable past, present and future. J ournal of Research, SKUAST- J , Vol. 4, No. 1, pp-13- 24.multicolour detection kit was recently developed for 8. Kamp, E.M., Bokken, G.C., Vermeulen, T.M., deJ ong, M.F., rapidandsimultaneousdetectionoftoxigenic Buys, H.E., Reek, F.H. and Smith, M.A. (1996): A specific Pasteurella multocida and Bordetella bronchiseptica and sensitive PCR assay suitable for large scale detection of (Register et al., 1998). The major advantage of thistoxigenicPasteurellamultocidanasalandtonsillarswab specimens of pigs. J . Vet.Diag. Ivest., 8: 304- 309.assay is the ability to screen the suspect colonies in 9. Mustafa A.A., Ghalib H.W. and Shigidi M.T. (1978): Carrier primary isolation plate so, there is no need of pure rate of Pasteurella multocida in a cattle herd associated with culturesanditcananalyzethelargenumberof an outbreak of hemorrhagic septicaemia in the Sudan. Br. Vet. J ., 134: 375- 378. samples in a very short period.10. Register,K.B.,LeeR.M.andThomson,C.(1998):Two 5. Filed alternation gel electrophoresis (FAGE): colourhybridizationassayforsimultaneousdetectionof This technique is also known as Pulsed Field Gel BordetellabronchisepticaandtoxigenicPasteurella Electrophoresis(PAGE)anditisamethodof multocida from swine. J . Clin. Microbiol., 36: 3342- 3346.11. RosenM.N.(1981):Pasteurellosisinfectiousdiseasesoffingerprintingwithhighspecificityandprecision. wild animals, second ed. Davis J .B., Karstak L.H. & Trainer Conventional electrophoresis, which used a constant D.O., eds. Iowa State University Press, Ames, Iowa, USA, currentthatcannotresolvethelargefragments 244- 252.generated by rare cutting restriction enzymes. But in 12. Singh, V.P., Kumar, A.A., Srivastava, S.K. and Rathore, B.S. (1996):SignificanceofHSinAsia:India.InternationalPFGE,wheretheelectricfieldacrossthegelis workshop on diagnosis and control of HS. Bali, Indonesia, changed periodically can effectively separate the large Indonesian Department of Agriculture, 28- 30 May 1999, size DNA fragments on size basis. PFGE analysis has p.16.consistentlyshownthegreaterdiscriminationin 13. Singh, V.P., Sinha, D.K., Gupta, S.K., Chauhan, R.S. (2008): Prevalence of HS in India. Vth Annual Scientist Meet onidentification of bacterial species than ribotyping but, Haemorrhagic Septecaemia at Guahati, 5-6th Sept, 2008.it has limited application in the typing of Pasteurella 14. Stern, M.J ., Ames, G.F., Smith, N.H., Robinson, E.C. and multocida isolates (Townsend et al., 1997a).The major Higgins,C.F.(1984):Repetitiveextragenicpalindromic drawbacks of this technique are the requirements of sequences:amajorcomponentofthebacterialgenome. Cell., 37: 1015- 1026. highlypurifiedintactDNAandspecializedand www.veterinaryworld.orgVeterinary World, Vol.4 No.4 April 2011 191Molecular diagnosis of Haemorrhagic Septicaemia - A Review15. Townsend,K.M.,Dawkins,H.J .andPapadimitrious,PCRdetectionandanalysisofPasteurellamultocida J .M.(1997a):Analysisofhaemorrhagicsepticaemia-fromthetonsilsofslaughteredpigsinVietnam.Vet. causing isolates of Pasteurella multocida by ribotyping andMicrobiol. 72: 69- 78.fieldalternationgelelectrophoresis(FAGE).Vet.18. Townsend, K.M., Boyce, J .D., Chung, J .Y., Frost, A.J . and Microbiol., 57: 383- 395. Adler,B.(2001):GeneticorganizationofPasteurella 16. Townsend,K.M.,Frost, A.J .,Lee,C.W.,Papadimitrious,multocida cap loci and development of a multiplex capsular J .M.andDawkins,H.J .S.(1998):DevelopmentofPCRPCR typing system, J ournal of Clinical Microbiology, 39: assaysforspeciesandtypespecificidentificationof924- 929.Pasteurella multocida isolate. J . Clin. Mirobiol., 36: 1096-19. Zhao,G.,Pihoan,C.,Murtaugh,M.P.andMolitor, T.W. 1100. (1992):Useofrestrictionendonucleaseanalysisand 17. Townsend, K.M., Hanh T.X., OBoyle, D., Wilkie, I., Phan,ribotyping to study edpidemiology of Pasteurella multocida T.T., Wijewardana, T.G., Trung, N.T. and Frost, A.J . (2000):in closed swine herds. Infect. Immunol., 60: 1401- 1405.www.veterinaryworld.orgVeterinary World, Vol.4 No.4 April 2011 192********