Molecular Cloning of Partial Phytase Gene from Bacillus subtilis...

Current Trends in Biotechnology and PharmacyVol. 11 (1) 91-98 January 2017, ISSN 0973-8916 (Print), 2230-7303 (Online)

91

AbstractPhytase (myo-inositolhexakisphosphate

phosphohydrolase) catalyzes the hydrolysis ofmyo-inositol hexakisphosphate (phytic acid) toinorganic monophosphate and lower myo-inositolphosphates, and in some cases to free myo-inositol. Bacillus species are known to producea thermostable phytase. The Bacillus subtilisstrain ATCC 6633 was chosen for cloning of phygene. Primers were designed for phy geneamplification using the phy gene sequence of B.subtilis (AF298179). A sequence of 904 bpcharacteristic of phy gene was obtained throughPCR amplification. Sequencing of PCR amplifiedfragments and further analysis using NCBI-BLAST online homology search programrevealed that phy gene of B.subtilis (ATCC 6633)and phy gene of B. subtilis are 94% similar. Thephylogenetic analysis indicated that B. subtilis(ATCC 6633) had high similarities with thephytases from AF292103.1 Bacillus subtilis strainYMN2f phytase (phy) gene and HQ730912.1Bacillus sp. B5 phytase PhyC1 gene. It was alsofound that B. subtilis (ATCC 6633) had relativehigh similarities with Bacillus sp. BAB- 1 Phy(phy) gene and FJ541287.1 Bacillus subtilisstrain spizizenii strain phytase gene. Further 904bp fragment was cloned in Insta T/A cloningvector and E. coli was successfully transformedand confirmed by colony PCR.

Key words: Phytase, PCR, phy gene, MolecularCloning

IntroductionPhytase, or myo-inositol hexakisphosphate

phosphohydrolase (EC 3.1.3.8), was firstdiscovered by (8). The principal end products ofphytase action are phosphoric acid and myo-inositol, but the phosphatidylinositolsrepresenting various degrees of dephosphory-lation from inositol hexakisphosphate to inositolare generated as intermediates. Phytate, aninhibitor of iron absorption, can be degraded byphytase. Phytase is a ester-hydrolyzing enzymewith an estimated molecular mass of 35–700 kDadepending upon the sources of origin. Phytasegenes have been isolated from plants (4),bacteria (5) and fungi (3).

Fig.1. Hydrolysis of phytic acid by phytaseenzyme

Although phytase shows a potential to beutilized for phytate bioconversion, the enzymeactivities and yields need to be increased to makethem possible for industrial application.Therefore, it is important to isolate a variety ofdifferent microorganisms and their enzymes forphytate degradation (1).

Molecular Cloning of Partial Phytase Gene from Bacillussubtilis ATCC 6633 (GenBank: KT385665.1).

Chaitanya Mogal*, Diwakar Singh, Amit Mehta and Taslim Ahmad.Department of Plant Molecular Biology and Biotechnology, Navsari Agricultural University,

Navsari- 396450. Gujarat, India.*For Correspondence - [email protected]

Molecular Cloning of Phytase Gene


92

Phytic acid can be reduced throughsupplementing phytase enzyme in animal feedsas it is capable of hydrolyzing phytic acid to less-phosphorylated myo-inositol derivates (2).Phytases also reduce the antinutritional effect offood having high phytate content. Phytase iswidely present in nature, occurring inmicroorganisms, plants as well as in some animaltissues. Several phytases have been identifiedand cloned from Pseudomonas sp., Escherichiacoli, Klebsiella sp. Phytase appA from E. coli isknown to have the greatest specific activity but itlacks desired thermostability. In order to producea more stable enzyme based on the E. coliphytase, it is necessary to have a set of homologyto E. coli phytase sequence. However, this proteinhas only a few homologies with low sequenceidentity not exceeding beyond 30% to otherknown phytases. The phytase (phyC) fromBacillus sp. are â-propeller phytase which exhibitan optimum pH from 6.0-9.0, suitable for neutralanimal tracts such as trout and cyprinids withmore thermostability.

As the primary sequence is emerging,gene cloning would be the next step to redesignthis enzyme for novel substrate specificity; thus,genetic manipulation for this enzyme would leadto better catalytic performance with higherturnover rates and this would be industriallyimportant. Bacterial phytase has been cloned andcharacterized from B. subtilis as well as E.coli.A.niger phytase has been well characterized andthe gene encoding it, phyA, has been cloned andsequenced.

Hence, in the present investigation, theBacillus subtilis ATCC 6633 strain was chosento isolate and clone phy gene with a view to itsoverexpression in future endeavours.

Materials and MethodsStrains and growth media : Bacillus subtilisATCC 6633 strain was procured from HiMedia.It was grown on the nutrient agar media andincubated at 37 °C for 16 h. A single colony wasinoculated in the nutrient broth medium andincubated at 37o C for 16 h at 180 rpm.

Amplification of phy gene using PCR:Genomic DNA extraction from bacterial strainwas carried out according to the standardprotocol (6). A set of forward and reverse primerto amplify the phy gene was designed by primerexpress software using the published phy genesequence (AF298179). These primers weresynthesized from Eurofins scientific laboratory,India. The primers were dissolved in TE to makea final working concentration of 20 pmol. ThePCR amplification was carried out in 20 ìl of totalreaction volume using programmable thermalcycler (Eppendorf, Germany). PCR wasoptimized by testing various components of thereaction mixture in different concentrations viz.,MgCl

2 (1.5 mM), forward and reverse primers

PhyF (5’CTGTCTGATCCTTATCATTT3’) andPhyR (5’TCCGCTTCTGTCGGTCA 3’) (10pmols) and annealing temperature (40-55°C).Amplification of the phy gene region wassuccessfully achieved with initial denaturation at95°C for 5 min followed by 40 cycles ofdenaturation, annealing and extension for 1 minat 95°C, 55°C and 72°C, respectively and thefinal extension was carried out at 72°C for 8 min.The PCR product was visualized on 1.0% (w/v)agarose gel.

Ligation of phy gene in cloning vector andtransformation: The ligation of amplified phygene was carried out in InsT/A cloning vector(pTZ57R/T) (Fermentas, USA) which is aconvenient system for direct one step cloning ofPCR amplified DNA fragment. The ligationreaction mix was prepared as follows: 10.0 ìl ofpurified PCR product, 1.5 μìl of InsT/A cloningvector, 2.5 μl of ligase buffer, 1.0 ìl of T4 ligaseenzyme and 2.5 μl of PEG. The final volume wasmade to 25 μl with nuclease free water. Ligationreaction was carried out at 22 °C for 12 h inthermomixer (Eppendorf, Germany) and theligation mix was subsequently used fortransformation. Transformation was carried outby mixing 10 μl of ligation product to 200 ìl of theE. coli DH5α competent cells. The mixture waskept on ice for 1 h. Heat-shock was given for 45s at 42 °C and rapidly chilled on ice for 10 min.

Chaitanya Mogal et al


93

Upon transformation, 20 μl glucose and 10 μlMgCl

2 were added in to it and incubated at 37 °C

for 2 h with 180 rpm shaking. The transformedcells were spread on ampicillin (75 μg ml-1)containing LB agar plate and incubated at 37 °Cfor 18 h (10).

Screening of recombinant (InsT/A) cloneshaving phy gene: The colonies growing on LBplates containing ampicillin (75ìg ml-1) were usedto isolate plasmid DNA. The plasmid DNA wasextracted adopting miniprep plasmid isolationmethod. The confirmation of positive

recombinant clones was carried out by colonyPCR.

Result and DiscussionAmplification of phytase gene:The genomicDNA was extracted from B. subtilis (ATCC 6633).The data observed by the molecularcharacterization were in accordance with thebiochemical characterization. Primers designedby (10) were used to amplify phy gene specificsequence. Size of amplified product was 904 bp(Fig.1). Amplified products were eluted from thegel and purified followed by sequencing forfurther analysis.

Fig. 1. 1.2% agarose gel electrophoresis showing PCR amplified 904 bp phy gene. M - (Marker),Lane 1, 2, 3,4 - PCR amplified product of phy gene, -ve – Negative control.

GCTCATTATGTGAATGAGGAACATCATTTCAAAGTGACTGCACACACGGAGACAGATCCG 60CGATGACGCAGCAGATGACCCGGCCATATTACAACAAATAAGAAGTCAGGGCTCGTTGTG120TATGATTTAGACGGAAAACAGCTTCATGAGTGTCGATCTGCGCTATGATTTTCCATTGAA 180CGGCGAAATTGCTGCTGCATCCAACCGGTCCGAAGGAAAAAATACAATTGAAGTATATGC 240AATAGACGGGGATAAAGGAAAATTGAAAAGCATTACAGATCCGAAACATCCTATTTCCAC 300CAATATTTCTGAGGTTTATGGATTCGGCCTGTATCACAGCCAGAAAACAGGAGCATTTTA 360CGCATTAGTGACAGGCAAACAAGGGGAATTTGAGCAGTATGAAATTGTTGATGGTGGAAA 420GGGTTATGTAACAGGGAAAAAGGTGCGTGAATTTAAGTTGAATTCTCAGACCGAAGGCCT 480TGTTGCGGATGATGAGTATGGGAACCTATACATAGCAGAGGAAGATGAGGCCATCTGGAA 540ATTTAACGCTGAGCCCGGCGGAGGGTCAAAGGGACAGGTTGTTGACCGTGCGACAGGAGA600TCATTTGACAGCTGATATTGAAGGACTGACAATCTATTATGCACCAAATGGCAAAGGATA 660TCTCATGGCTTCAAGTCAAGGAAATAACAGCTATGCAATGTATGAACGGCAGGGGAAAAA 720TCGCTATGTAGCCAACTTTGAGATTACAGATGGCGAGAAAATAGACGGTACTAGTGACAC 780GGATGGTATTGATGTTCTCGGTTTCGGACTTGGCCCTATCCGTACGGGAGTGGCGCAGGA 840TGGCGAAAATATCGATAACGGACAAACCGTCAATCAAAATTTCTTGTAACGTG 904

Fig. 2. The sequence of B.subtilis (ATCC 6633).



94

Sequencing and phylogenetic analysis:Sequencing of PCR amplified fragments andfurther analysis using NCBI-BLAST onlinehomology search program revealed that phygene of B. subtilis (ATCC 6633) and phy gene ofB. subtilis BC5 was 94% similar. A sequence of904 bp of gene was obtained and the sequenceis shown in fig. 2:

ClustalW analysis: The ClustalW analysisresults of B. subtilis (ATCC 6633) and five otherphyatse genes from AF453255.1 Bacillusamyloliquefaciens phytase (phyB) gene,AF292103.1 Bacillus subtilis phytase (phy) gene,HQ730912.1 Bacillus sp. B13 phytase PhyC1gene, GU143090.1 Bacillus sp. MD2 Phy (phy)gene and FJ541287.1 Bacillus subtilis strain E20phytase gene, are listed in Fig. 3.



95



96

Fig 3. ClustalW analysis of B. subtilis (ATCC 6633) and other five sequences with high similaritieswith B. subtilis (ATCC 6633).



97

Phylogenetic analysis: The phylogeneticanalysis indicated that B. subtilis (ATCC 6633)had high similarities with the phytases fromAF292103.1 Bacillus subtilis strain YMN2fphytase (phy) gene and HQ730912.1 Bacillus sp.

B5 phytase PhyC1 gene. It was also found thatB. subtilis (ATCC 6633) had relative highsimilarities with Bacillus sp. BAB- 1 Phy (phy)gene and FJ541287.1 Bacillus subtilis strainspizizenii strain phytase gene.

Cloning of phy gene in InsT/A cloning vector:PCR amplified 904 bp phytase gene was ligatedin InsT/A cloning vector as shown in Fig. 12.Construct was designated as InsT/A-phy. In thepresent study, transformation was done by usingheat-shock method. Initial confirmation of theinsertion of amplified phy gene into the cloningvector was done by colony PCR. The colony PCRwith phy gene specific primers revealed a PCRproduct of 904 bp indicating successfultransformation (Fig. 5).

ConclusionThe identified and confirmed InsT/A-phy

clone with phytase gene of B. subtilis will be

Fig.5. Cloning strategy for inserting PCR amplified phy gene in InsT/A cloning vector [Source: www.fermentas.com]

Fig .4. The phylogenetic tree of B. subtilis(ATCC 6633) phytase gene.



98

helpful for further over-expression for large scaleproduction of cost effective and thermostablephytase enzyme through fermentation and theirutilization in animal feed and other purposes.

Referances

1. Choi, Y.M., Suh, H.J. and Kim J. M. (2001).Purification and properties of extracellularphytase from Bacillus sp. KHU-10. Journalof Protein Chemistry, 20 (4): 287-292.

2. Mittal, A., Singh, G., Goyal, V., Yadav, A.,Aneja, K. and Gautam, S.(2011). Isolationand biochemical characterization of acido-thermophilic extracellular phytaseproducing bacterial strain for potentialapplication in poultry feed. Jundishapur JMicrobiol. 4 : 273-282.

3. Pasamontes, L., Haiker, M., Wyss, M. andVan Loon, A.P. (1997). Gene cloning,purification and characterization of a heat-stable phytase from the fungus Aspergillusfumigates. Appl. Environ. Micorbiol. 63:1696-1700.

4. Reddy, N.R, Pierson, M.D., Sathe, S.K. andSalunkhe, D.K. (1989). Phytates in cerealsand legumes. CRC Press, Boca Raton,29:110-113 .

5. Rodriguez, E., Han, Y. and Lei, X.G. (1999).Cloning, sequencing and expression of an

Escherichia coli acid phosphatase, phytasegene (appA2) isolated from pig colon.Biochem. Biophy. Res. Comm., 257:117-123.

6. Sambrook, J. and Russell, D. (2001).Molecular cloning: A laboratory manual (3rded.) Cold Spring Harbor Laboratory Press.

7. Scott, J. J. (1991). Alkaline phytase activityin nonionic detergent extracts of legumeseeds. Plant Physiol. 95: 1298-1301.

8. Suzuki, U., Yoshimura, K. and Takaishi, M.(1907). Ueberein enzym phytase dasanhydro-oxy-methilen diphos-phorusaurespaltet. Bulletin of the College of Agriculture,Tokyo Imperial University, 7:503–512.

9. Wyss, M., Pasamontes, L., Remy, R.,Kohler, J., Kusznir, E., Gadient, M., Muller,F. and van Loon, A. P. G. M. (1998).Comparison of the thermostabilityproperties of three acid phosphatases frommolds: Aspergillus fumigatus phytase, A.niger phytase, and A. niger pH 2.5 acidphosphatase. Appl. Environ. Microbiol. 64:4446-4451.

10. Yadav, S., Tantwai, K., Rajput, L.P.S.,Kadam-Bedekar, M., Kumar, S. (2011).Molecular cloning of phytase gene fromBacillus subtilis NCIM-2712. Jr. Phytol, 3(7): 35-37.

Fig.6. The agarose gel electropheresis of the colony PCR products showing 904 bp phy geneof B. subtilis (ATCC 6633)


Molecular Cloning of Partial Phytase Gene from Bacillus subtilis...

Documents

Transcript of Molecular Cloning of Partial Phytase Gene from Bacillus subtilis...