Molecular Characterization of the Iron Signaling Pathway ...
Transcript of Molecular Characterization of the Iron Signaling Pathway ...
Molecular Characterization of the Iron Signaling Pathway by Plant Growth
Promoting Rhizobacteria GBO3
by
Gardiyawasam Kalpana, B.S.
A Thesis
In
Chemistry
Submitted to the Graduate Faculty
of Texas Tech University in
Partial Fulfillment of
the Requirement for
the Degree of
MASTER OF SCIENCE
Approved
Dr. Paul W Pare
Chair of Committee
Dr. David B Knaff
Mark Sheridan
Dean of the Graduate School
August, 2014
Texas Tech University, Gardiyawasam Kalpana, August 2014
ii
ACKNOWLEDGEMENTS
I would like to express my sincere gratitude towards my advisor Dr. Paul W.
Paré for his generous support, thoughtful advice and patience throughout my time at
Texas Tech University. His words and actions not only guided me to successfully
complete this thesis work, also to achieve many goals in life. Thank you sir for all the
time and words you generously spent on me.
I would like to express appreciation to my graduate committee member Dr.
David B. Knaff for his kind support throughout my stay here. During my research
exam and thesis defense, his kind attitude was greatly appreciated.
I would like to recognize all the current and past members of the lab, Mina
Aziz, Rangith Nadipalli, May Chou, Shirley Xin Shen and Wael Elmasri for their
support and encouragements during my stay in the lab. They have been a great relief
during bitter times in the graduate life. My special gratitude goes to Mina Aziz for
teaching me basic fundamentals in the lab and helping me to stabilize and survive in
the lab.
My heartiest gratitude goes to my parents back in Sri Lanka for being
supportive and encouraging during my stay in USA. They are the two great pillars in
my life that bear all my ups and downs and this achievement would not have been
possible without their hard work and dedication.
Texas Tech University, Gardiyawasam Kalpana, August 2014
iii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ii
ABSTRACT v
LIST OF FIGURES vi
I INTRODUCTION 1
1.1 Soil iron uptake strategies by plants 1
1.2 Plant growth promoting rhizobacteria (PGPR) in plant iron uptake 3
1.2.1 Bacillus subtilis GBO3 4
1.3 Forward genetics and map based cloning 5
1.3.1 EMS mutagenesis 6
1.3.2 Mutant screening 6
1.3.3 Map-based cloning 8
II MATERIALS AND METHODS 9
2.1 Plant materials 9
2.2 Bacterial cultures and treatments 9
2.3 Plant growth medium preparation 10
2.4 Iron content measurement 10
2.5 Chlorophyll level measurement 11
2.6 Reverse transcriptase PCR 11
2.6.1 RNA isolation 11
2.6.2 Complementary DNA (cDNA) synthesis 12
2.6.3 Polymerase chain reaction (PCR) analysis 12
Texas Tech University, Gardiyawasam Kalpana, August 2014
iv
2.7 Luciferase bioluminescence imaging and screening 12
2.8 Mutant identification 13
2.9 Statistical analysis 13
III RESULTS AND DISCUSSION 14
3.1 GBO3 induce growth promotion in cpl1-6/Col-0 line 14
3.2 GBO3 induce iron deficiency response in plants 14
3.3 GBO3 induced FIT1-LUC expression in FIT1::LUC/cpl1-6 line 15
3.4 False positive mutant as a control for true mutant identification 15
3.5 1M14, a preliminary positive mutant 16
IV FUTURE STUDIES 28
REFERENCES 29
Texas Tech University, Gardiyawasam Kalpana, August 2014
v
ABSTRACT
Bacillus subtilis GBO3 is a soil bacterium that regulates several plant responses
related to growth and development. GBO3 emits an array of volatile organic
compounds capable of affecting signal pathways including iron deficiency induced
responses. GBO3 has been shown to increase iron accumulation by overexpressing the
plant’s own iron uptake machinery, however the GBO3-activated signaling pathway
operative in Arabidopsis has yet to be characterized. The aim of this work was to
establish an experimental procedure to identify and characterize signaling
intermediates in the inducible-iron signaling pathway via a forward genetics approach.
A transgenic Arabidopsis line capable of GBO3-induced growth promotion and other
iron related responses similar to Col-0, FIT1-LUC/cpl1-6, was utilized. An EMS
mutagenized population of 3500 seeds was screened via luciferase bioluminescence to
identify mutants with compromised GBO3-induced iron signaling. After several
confirmation re-screens, a preliminary positive mutant, 1M14 that displayed a reduced
luciferase bioluminescence phenotype was identified. Future studies will map the
mutation location for gene identification.
Texas Tech University, Gardiyawasam Kalpana, August 2014
vi
LIST OF FIGURES
1.1 Process of generating the FIT-LUC/cpl1-6 background 7
3.1 GBO3 VOCs trigger growth promotion in Arabidopsis 17
3.2 GBO3 VOCs increase chlorophyll content 18
3.3 Time course of elevated IRT1 gene expression ratio in Arabidopsis 19
3.4 Elevated FRO2 gene expression in Arabidopsis cpl1-6 line 20
3.5 GBO3 VOCs increase the shoot iron content in cpl1-6 line 21
3.6 GBO3 VOCs induce the FIT1-LUC bioluminescence in FIT1-LUC/cpl1-6
line 22
3.7 The FIT1-LUC bioluminescence intensity of 2M9E and
FIT1::LUC/cpl1-6 23
3.8 The functional characterization of 2M9E 24
3.9 The FIT1-LUC bioluminescence intensity of 1M14 mutant with GBO3 25
3.10 The functional characterization of 1M14 mutant 27
Texas Tech University, Gardiyawasam Kalpana, August 2014
1
CHAPTER I
INTRODUCTION
Being one of the seven micronutrients required for plant growth, iron is an
essential element for plants (Curie and Briat, 2003). It is a cofactor in many cellular
enzymes required for chlorophyll production, photosynthesis and electron transport.
Although it is the fourth most abundant element on the earth’s crust, the absorption
can be limited by root systems since most of the iron in soil exits as iron phosphates or
hydroxides that are insoluble under alkaline conditions (Kim and Guerinot, 2007).
Iron deficiency causes leaf chlorosis since iron is essential for chlorophyll
synthesis. Plants respond to this by overexpressing proteins involved in root iron
uptake thus, facilitating its absorption (Curie and Briat, 2003). This iron deficiency
response is also inducible by the beneficial soil bacterium Bacillus subtilis GBO3
(Huiming et al., 2009). GBO3 induces expression of iron uptake machinery although
signal perception, and downstream transduction pathway components have yet to be
characterized. The aim of this project is to establish an experimental procedure to
identify and characterize signaling intermediates in the inducible iron signaling
pathway activated by GB03 via a forward genetics approach.
1.1 Soil iron uptake strategies by plants
Under iron deficient conditions, plants have evolved two strategies for iron uptake
from soil. In dicotyledonous and non-graminaceous plant species like Arabidopsis,
tomato and sunflower, iron absorption takes place by a reduction-based strategy I
which consists of three steps, and in graminaceous plants like rice, maize, barley and
corn, a chelation-based strategy II is used for iron uptake (Curie and Briat, 2003).
Strategy II will not be detailed here, as this work has focused on Arabidopsis where
strategy I is functional (Curie and Briat, 2003).
Texas Tech University, Gardiyawasam Kalpana, August 2014
2
In strategy I, a plasma membrane bound H+-ATPase excretes protons into the
rhizosphere thus lowering the pH of the root vicinity and increasing the solubility of
Fe3+-chelates in the soil. The exact H+-ATPase involved has not yet been characterized
but several members of the Arabidopsis AHA (Arabidopsis H+-ATPase) family have
been suggested to be involved in this process (Colangelo and Guerinot, 2004).
A plasma membrane bound reductase reduces Fe3+ into a more soluble Fe2+
form as the second step, facilitating iron transport via a root iron transporter system.
This step is considered the rate limiting step in strategy I process (Kim and Guerinot,
2007). The reductase involved in this process, FRO2 (ferric chelate reductase oxidase
2), has been extensively studied in plants. It is 725 amino acids in length with 6
putative hydrophobic domains and has conserved binding sites for FAD and NADPH
cofactors (Connolly et al., 2003). It is expressed in root epidermal cells under iron
deficient conditions and was initially identified using the Arabidopsis mutant frd1
(ferric chelate reductase defective I) which lacks inducible chelate reductase activity
and develops chlorosis with limited iron conditions. This FRO2 reductase belongs to
an eight member FRO family in Arabidopsis. The different cellular positioning of
FRO members including, FRO2, FRO3 and FRO5 localized in roots and FRO6, FRO7
and FRO8 in shoots, implicate the involvement of FRO reductases in iron uptake and
endogenous distribution in plants (Kim and Guerinot, 2007).
Once iron is reduced by FRO2, it is transported into the roots. The main iron
transporter responsible for root iron uptake is IRT1 (iron-regulated transporter 1); a
347 amino acid polypeptide with eight putative transmembrane domains. The protein
is localized to the plasma membrane of root epidermal cells (Curie and Briat, 2003).
The IRT1 null mutant is lethal under iron deficient conditions implicating its function
as the major root iron transporter in Arabidopsis (Vert et al., 2002). In addition to Fe2+,
IRT1 has broad substrate specificity for Zn, Mn, Cd and Co (Curie and Briat, 2003). It
is the founding member of a large metal transporter family in Arabidopsis, ZIP (ZRT,
IRT-like proteins), which includes 14 other members, IRT2, IRT3, ZIP1 through
ZIP12. IRT2 also expressed in the root epidermis under Fe deficiency
Texas Tech University, Gardiyawasam Kalpana, August 2014
3
conditions has remarkable molecular and functional similarities to IRT1, but it is
unable to complement the chlorotic symptoms exhibited in the Arabidopsis irt1
mutant, suggesting a secondary function in iron uptake and homeostasis (Curie and
Briat, 2003).
FRO2 and IRT1 are transcriptionally and post-transcriptionally regulated by an
upstream basic helix-loop-helix transcription factor, Fe deficiency-induced
transcription factor 1 (FIT1) (Vert et al., 2003; Colangelo and Guerinot, 2004; Yuan et
al., 2005). The FIT1 was initially identified in a tomato fer mutant, where strategy I
iron uptake under iron deficient conditions was not observed (Brown et al., 1971). In
Arabidopsis, the possible bHLH transcription factor was identified by microarray
analysis and named FIT1. The bHLH family is the second largest transcription-factor
family in plants and regulates important physiological processes. FIT1 plays an
important role in plant iron uptake by regulating more than 70 iron-related genes
including IRT1, FRO2, AHA7 and nicotianamine synthase (NAS) (Colangelo and
Guerinot, 2004). Iron signaling upstream of FIT1 remains unknown although
dimerization of FIT1 with other bHLH factors such as AtbHLH38 and AtbHLH39
have been proposed (Yuan et al., 2008).
Several iron assimilation components including the iron reductase, FRO2 and
iron transporter, IRT1 are induced by the beneficial soil microbe GBO3. Indeed,
GBO3 and several other soil bacteria are capable of regulating plant responses
associated with growth and defense are generally termed as plant growth promoting
rhizobacteria (PGPR).
1.2 Plant growth promoting rhizobacteria (PGPR) in plant iron uptake
The thin zone of soil around roots are generally referred as the rhizosphere and this
area is highly enriched in nutrients due to the synthesis and secretion of root exudates
by plants. These chemicals can act as either attractants for beneficial soil bacteria or
repellants for pathogenic bacteria or other competent plant species. As a result, the
Texas Tech University, Gardiyawasam Kalpana, August 2014
4
rhizosphere is an enriched ecosystem for diverse bacterial communities. In 1981,
Kloepper and Schroth termed these beneficial rhizobacteria which are competent to
colonize root environments and enhance plant growth as plant growth promoting
rhizobacteria (PGPR) (Kloepper and Schroth, 1981). PGPR most often have the
following characteristics; an ability to compete and colonize the rhizosphere and the
ability to promote plant growth.
Certain rhizobacteria induce root iron uptake by secreting bacterial
siderophores. They are low molecular weight, water soluble iron chelators that have a
high affinities for iron, thus they are capable of solubilizing iron from insoluble ferric
hydroxides, the abundant form of iron in soil. Plants as well as bacteria are able to
bind these siderophores and internalize iron. Once the metal is released, siderophores
can be reused or are destroyed (Mani et al., 2010). Bacillus subtilis GBO3 is a
rhizobacteria with the ability of inducing iron uptake by siderophores production as
well as inducing iron-uptake mechanisms by the plant.
1.2.1 Bacillus subtilis GBO3
Bacillus subtilis GBO3, a variant of Bacillus subtilis A13 was first discovered in
Australia in the 1930s and it was the first commercialized biopesticide in US under the
trade name of Kodiak (Gustafson, Dallas, USA). This PGPR strain has been reported
to emit a complex blend of volatile organic compounds, which promote growth in
Arabidopsis without a direct physical contact with the plant (Farag et al., 2006). In
addition to promoting growth, the GBO3 volatile exposure results in differential
expression of approximately 600 gene transcripts involved in cell wall modifications,
primary and secondary metabolism, plant stress responses, hormone regulation and
expression of other proteins (Zhang et al., 2007).
GBO3 has the ability to increase endogenous iron content in plant,
Arabidopsis, under the absence of direct physical contact with the plant (Zhang et al.,
2009). When Arabidopsis is exposed to GBO3, induced iron deficiency like responses
Texas Tech University, Gardiyawasam Kalpana, August 2014
5
and enhanced endogenous iron levels are observed. GBO3 exposure results in elevated
strategy I iron uptake components including elevated gene expression of IRT1 and
FRO2 at the transcription level and increased acidification of the rhizosphere resulting
in increased iron mobilization and uptake into the plant. As a result of this enhanced
iron acquisition, GBO3 exposed plants show increased accumulation of iron in shoots
and whole plant levels (Zhang et al., 2009). Even though iron content is elevated,
GBO3 induced plants do not exhibit iron toxicity, suggesting that GBO3 has the
ability to regulate transport and compartmentalization so as to maintain appropriate
iron homeostasis within the plant.
As iron is a building block of chlorophyll biosynthesis, perhaps it is not
surprising that GBO3 induced plants have elevated chlorophyll levels accompanying
increased iron accumulation. Moreover, enhanced photosynthetic capacity is observed
in GBO3 activated plants.
This GBO3 induced iron accumulation is compromised in the fit1-2 mutant
indicating that GBO3 activation of iron uptake is FIT1 mediated. Other signaling
components operative upstream of FIT1 are yet to be reported. There are different
approaches can be followed to characterize this iron signaling pathway. Forward
genetics approach is one such method to identify genes corresponds to a particular
interesting phenotype.
1.3 Forward genetics and map based cloning
Forward genetics is a well-established genetic tool that has been effectively employed
to characterize many fundamental developmental processes in plants including
circadian systems, hormone signaling pathways and stress responses (Millar et al.,
1995; Meier et al., 2001). In fact, FRO2 was identified via a forward genetic approach.
As mentioned previously, the actual protein responsible for iron reduction was isolated
and characterized in an Arabidopsis ferric chelate reductase defective mutant frd1
where iron uptake was greatly compromised under iron deficient conditions with only
Texas Tech University, Gardiyawasam Kalpana, August 2014
6
oxidized iron present (Yi and Guerinot, 1996). A forward genetics approach is also
being employed in this project to elucidate upstream components of FIT1 in GBO3-
inducible iron uptake.
A typical forward genetic experiment consists of three phases, mutagenesis,
mutant screening and map-based cloning. These steps are briefly outlined below.
1.3.1 EMS mutagenesis
Mutagenesis, a tool used in forward and reverse genetic approaches, is the process of
generating heritable changes in a genome. Mutagen can be of three main groups
chemical, physical and biological (Maple and Møller, 2007). Ethyl methanesulfornate
(EMS) is the most common mutagen used in plants. It is a chemical reagent that
induces nucleotide-base alkylation. Specifically EMS induced G/C to A/T transitions
by alkylating guanine to O6-ethylguanine, which base pairs with thymine instead of
cytosine (Kim et al., 2006). Due to high mutagenicity and low mortality, EMS permits
a mutagenesis saturation with ca. 50,000 M1 plants with point mutations every 200-
300 kb (Greene et al., 2003; Jander et al., 2003). These point mutations can have
different degree of expressions rather than a loss of function allowing the analysis of
essential genes (Maple and Møller, 2007).
1.3.2 Mutant screening
The genetic background is important for a successful screening process. Generally,
Col-0 background is used for mutant identification in Arabidopsis. Modified genetic
backgrounds are required when screening for mutants in redundant genes, suppresser
or enhancer screening, or for gene mutations that does not cause a phenotypical or
biochemical response (Page and Grossniklaus, 2002). The mutant identification
process should be simple and tight in order to avoid false positives and to screen a
large M1 populations.
Texas Tech University, Gardiyawasam Kalpana, August 2014
7
Since assaying for functional GBO3 induced iron signaling is laborious in Col-
0, a modified background, FIT1-LUC/cpl1-6, which was generated by Dr. Hisashi
Koiwa (Texas A and M University) was used in this work (Figure 1.1).
Figure 1.1 Process of generating the FIT-LUC/cpl1-6 background
A gene family of Arabidopsis c-terminal domain phosphatase-like (CPL) were
identified as negative regulators in stress-responsive gene expression and more than 20
members have been reported thus far (Bang et al., 2008). The plant-specific CPL1
regulates multiple environmental stress responses including osmotic-stress, abscisic
acid (ABA) and iron-deficiency stress. Arabidopsis cpl1 exhibits induced iron-
deficiency responses under sufficient iron conditions (Jeong et al., 2013). To further
enhance iron-deficiency signaling, cp1l was used in the modified background
generated to identify mutants in iron signaling by GBO3.
Texas Tech University, Gardiyawasam Kalpana, August 2014
8
1.3.3 Map-based cloning
Map-based cloning or positional cloning is the process of identifying the physical
location of a gene or mutation by measuring genetic linkage to markers whose
physical location in the genome is known (Jander et al., 2002). As it is a laborious and
time consuming process, alternative yet expensive approaches as next generation
sequencing (whole genome sequencing) and microarrays can be employed (Lukowitz
et al., 2000; Baaj et al., 2008; Gupta et al., 2008; Lister et al., 2009). Main advantage
of positional cloning is that any prior knowledge or assumption is not required. This
can be used to identify new genes or to assign functions to previous genes, or to genes
not previously annotated as is the case for approximately 40% of the genes in
Arabidopsis (The Arabidopsis Genome Initiative, 2000).
Mapping has two consecutive phases, rough and fine (Lukowitz et al., 2000;
Jander, 2006). During rough mapping, a mapping resolution of up to 1250 kb can be
acquired and by fine mapping the resolution can be further increased up to 40 kb.
Theoretically a mutation can be mapped in to a single gene but due to practical
difficulties, a resolution of 40 kb is considered reasonable. Generally 2-10 genes can
reside in this interval in Arabidopsis. DNA sequencing or molecular complementation
of candidate genes in the region is the last step to locate the mutation.
Texas Tech University, Gardiyawasam Kalpana, August 2014
9
CHAPTER II
MATERIALS AND METHODS
2.1 Plant materials
Arabidopsis thaliana seeds were surface sterilized by following protocol. Roughly
100 seeds were taken into a 1.5 ml microcentrifuge tube and mixed with 1 ml of 70%
(v/v) ethanol for 1 min while inverting continuously. Then, the seeds were mixed
with 1 ml of 1% (v/v) sodium hypochlorite (bleach) solution and leave there for 20
min while occasional mixing of the content. After the incubation, seeds were rinsed
with sterile milliQ water for 5-6 times to ensure complete removal of bleach. After
the rinses, seeds were suspended in 1 ml of sterile milliQ water and the tube was
incubated at 4oC for 48 hours in the absence of light for seed vernalization.
2.2 Bacterial cultures and treatments
Bacterial glycerol stock tubes were prepared as follows. Previously prepared B.
subtilis GBO3 glycerol stock tube was used to make a LB streak plate and it was
incubated at 30oC for 48 hours until isolated colonies developed. Then one colony
from this plate was used to inoculate a LB broth and the flask was left overnight in a
shaker with controlled temperature. The absorbance was measured at 600 nm until an
OD of 0.7 was obtained. This culture was used to prepare glycerol stocks (500 µl of
50% glycerol and 500 µl of culture) and stored at -70oC.
Bacterial treatments were prepared according to the type of experiment. For all
the experiments except for luciferase imaging experiment, treatments were prepared
as follows. A volume of 20 µl from B. subtilis GBO3 glycerol stock was placed as
spots on a LB agar plates and they were incubated at a 30oC incubator for 24 hours
until each spot develops into an individual bacterial colony. On the day of treatment,
each colony was cut into small squares and these bacterial LB squares were placed on
the empty side of the I-plate containing half strength MS media. Usually treatment
Texas Tech University, Gardiyawasam Kalpana, August 2014
10
were added after incubating plant plates for 5 days at the growth chamber to ensure
optimum germination and growth.
For luciferase imaging experiment, GBO3 glycerol stock (20 µl) was incubated
on LB agar plates at a 30oC for 24 hours until spots developed into a colony. Colonies
were dissolved in 10 ml of sterile milliQ water and a diluted to an OD of 0.7 at 600
nm wavelength. Diluted bacterial suspension was spotted on a LB agar plates and
they were incubated at a 30oC incubator for 24 hours until each spot develops into an
individual bacterial colony. On the day of treatment, colonies were placed on the
empty side of the I-plate containing half strength MS media. Usually treatment were
added after incubating plant plates for 4 days at the growth chamber to ensure
optimum germination and growth.
2.3 Plant growth medium preparation
Arabidopsis plants were grown on half-strength Murashige and Skoog medium that
contain 0.2215% (w/v) MS medium and 1.5% (w/v) sucrose. In addition 0.8% (w/v)
agar was used as the solidifying agent. For luciferase assay experiment, 1.5% (w/v)
agar was used since plates has to be in a vertical position. The pH of the medium was
adjusted to 5.7-5.8 and it was autoclaved using the liquid cycle.
2.4 Iron content measurement
The iron content in Arabidopsis samples was determined according to Lobreaux et al.
(1991) with some modifications. Initially, a standard curve for iron was obtained
using sodium EDTA iron reagent. Arabidopsis leaves were placed in a 1.5 ml
microcentrifuge tube to get a fresh weight of 1 mg of tissue. Then 150 µl of milliQ
water was added and the sample was ground with a micro pestle to obtain a
homogenous suspension. Then 20 µl of 98% sulfuric acid was added followed by 50
µl of 5% (v/v) thioglycolic acid (mercapto acetic acid). The content was mixed
Texas Tech University, Gardiyawasam Kalpana, August 2014
11
properly and incubated at room temperature for 10 minutes. After the incubation, 400
µl of saturated sodium acetate and 500 µl of 4,7-diphenyl-1,10-phenanthroline, which
was prepared by adding 200 mg of 4,7-diphenyl-1,10-phenanthroline into 250 ml of
isoamyl alcohol, were added and the content was mixed by vortexing vigorously to
extract iron into the upper organic layer. At this stage the organic layer should be
pink or light purple indicating the presence of iron. The content was centrifuged at
3000 rpm for 2 minutes to separate layers and 400 µl of the upper organic layer was
used to measure the absorbance at 535 nm using isoamyl alcohol as the blank. The
iron concentrations were determined using the standard curve and content was
reported as µg of iron per g FW. All the reagents used above were prepared freshly
before experiment.
2.5 Chlorophyll level measurement
Arabidopsis plants treated with the GBO3 or water for 7 or 14 days were used to
measure the chlorophyll content in leaves. Leaves were collected in to a 1.5 ml
microcentrifuge tube to get a fresh weight of 20 mg tissues. Then, 1 ml of the
extraction buffer (80% acetone in water) was added and the tissues were ground to
get a homogeneous solution. The content was centrifuged at 13000 rpm for 5 minutes
and the clear supernatant was used to measure the spectrophotometric absorbance at
646.8 nm and 663.2 nm wavelengths. The total chlorophyll was calculated using the
equation; chlorophyll a + b = (7.15 * A663.2 + 18.71 * A646.8) /1000/ fresh weight and
the levels were reported as mg Chl. Per g FW.
2.6 Reverse transcriptase PCR
2.6.1 RNA isolation
According to the experiment, 2 day or 4 day old seedlings or root samples were used
to extract total RNA using the Qiagen RNeasy plant mini kit (Cat. No. 74904). After
Texas Tech University, Gardiyawasam Kalpana, August 2014
12
extraction, RNA samples were quantified by the Nanodrop ND-1000
spectrophotometer (Nyxor Biotech, http://www.nanodrop.com ).
2.6.2 Complementary DNA (cDNA) synthesis
First, 4-6 µg of RNA was taken to a tube and DEPC water was added to get a final
volume of 25 µl. The content was mixed and heated at 67oC for 10 minutes in a water
bath. After the incubation, the tube was transferred immediately to an ice bath and
kept there for 6 minutes. For the first strand cDNA synthesis, the master mixture
without the enzyme was prepared and added to each sample. Then the content was
mixed properly and incubated first at room temperature for 10 minutes and then in ice
for 5 minutes. A volume of 2 µl of MuMLV- RT enzyme was added and the tube was
incubated at 37oC for 1 hour to complete the synthesis.
2.6.3 Polymerase chain reaction (PCR) analysis
The PCR amplification analysis for IRT1, FRO2 and tubulin was performed using
following primers (5’ to 3’): [IRT1], CTCCGGATTTCTCGCTATGT and
AGCGATCCCTAACGCTATTC; [FRO2], TCTTCTTTGTCCTCCACGTC and
TCTCAAGACCGGATAATGGC.
After the PCR, samples were analyzed on 1.2% (w/v) agar gel in TAE (Tris
Acetate-EDTA) buffer. The gel was imaged with a Kodak gel logic 100 imaging
system.
2.7 Luciferase bioluminescence imaging and screening
Luciferin powder (Promega) was dissolved in water to get a stock concentration of
100 mM and this can be stored in -70oC for up to few years. A working solution (1
Texas Tech University, Gardiyawasam Kalpana, August 2014
13
mM) was prepared freshly before the analysis. The bioluminescence was imaged
using a thermoelectrically cooled charge-coupled device camera system.
Luciferase expressed plant lines were grown vertically on half strength MS
media for 7 days and then sprayed evenly with 1 mM luciferin and imaged with
exposure times of 5s, 10s, 15s and 20s. In addition, a light image was taken to
identify the position of the plants on the plate.
2.8 Mutant identification
During the initial screenings of mutagenized M2 seeds, seedlings that displayed
compromised luciferase bioluminescence intensities were selected for propagation on
soil. Once the M3 seeds were generated, each line was re-screened at least 3 times
using the same conditions and parameters to further confirm their deficient luciferase
expression. Lines that displayed deficient bioluminescence signal consistently in all
the screens were selected as plausible positive mutants deficient in GBO3 inducible
iron signaling pathway.
2.9 Statistical analysis
The Microsoft Excel software was used to perform all the statistical analysis.
Significant difference was based on a p values ≤ 0.05 between different treatments.
Texas Tech University, Gardiyawasam Kalpana, August 2014
14
CHAPTER III
RESULTS AND DISCUSSION
3.1 GBO3 induce growth promotion in cpl1-6/Col-0 line
GBO3 emissions induce growth promotion in both Arabidopsis Col-0 and the cpl1-
6/Col-0 mutant line. GBO3-treated plants show statistically significant increases in
both fresh and dry weight with 5 days of treatment compared to water controls (Figure
3.1). GBO3-exposed plants were larger and greener.
3.2 GBO3 induce iron deficiency response in plants
Chlorophyll content was increased during 7- and 14- days of exposure to GBO3 in
cpl1-6 compared to Col-0 (Figure 3.2). Enhanced chlorophyll accumulation and
photosynthetic efficiency was associated with GBO3 growth promotion observed in
Col-0 (Zhang et al 2009). This augmented chlorophyll production in cpl1-6 may
indicate its capability to induce growth with GBO3 better than Col-0.
IRT1 and FRO2 gene expressions are GBO3 induced in both cpl1-6 and Col-0.
IRT1 expression ratio increased 2.0 and 2.5 fold at 48- and 72-hours respectively in
cpl1-6. A bell shaped expression curve was demonstrated by IRT1 with the maximum
expression after 72 hours post GB03 exposure (Figure 3.3). FRO2 gene expression
ratio also increased 1.5 fold after 96 hours exposure in cpl1-6 (Figure 3.4).
Strategy I iron uptake pathway components are induced by GBO3 thus,
enhancing the iron accumulation. Their ability to induce iron uptake even under iron
sufficient conditions is of utmost importance since this can leads to generate iron
enriched plants without manipulating its genetic makeup.
The shoot-iron accumulation was measured to determine the actual level of
function of endogenous IRT1 and FRO2 in cpl1-6 and, there was a 1.5 fold increment
Texas Tech University, Gardiyawasam Kalpana, August 2014
15
after 7 days of exposure (Figure 3.5). GBO3 does induce the expression and the
stability of the strategy I iron uptake components in cpl1-6, thus enhancing the iron
availability of the plant.
3.3 GBO3 induced FIT1-LUC expression in FIT1::LUC/cpl1-6 line
IRT1, FRO2 and FIT1 are the only known members of plant iron signaling pathway.
The root specific expression intensity of FIT1 can be measured to identify the
upstream components since an uninterrupted signal flow should results in a higher
level of FIT1 expression as opposed to a low level of expression in cases of
interruptions.
GBO3 signal does intensify the bioluminescence signal significantly as shown
in CCD images (Figure 3.6). Since the FIT1-LUC expression intensity was drastically
different with and without the GBO3 signal and the effect was consistent throughout
all the exposure times, this can be used as an indication of the signal flow. Hence, this
method can be used to identify the mutants which are deficient in the inducible iron
signaling between GBO3 and FIT1.
3.4 False positive mutant as a control for true mutant identification
The EMS mutagenesis procedure, used to generate the mutant population may create
some effects on the whole genome level in addition to the induced positional
mutations. In order to alleviate these differences between the EMS-treated and the
non-treated seeds, a false positive mutant identified during the initial screens, 2M9E,
was assayed as a more suitable control than the FIT1::LUC/cpl1-6 non-treated line for
the purpose of true mutant identification.
Similar luciferase bioluminescence intensities were observed with GBO3 for
both 2M9E and FIT1::LUC/cpl1-6 (Figure 3.7). This indicates 2M9E is a false
positive mutant where the inducible GBO3 signal flows without an interruption. A 3.0
Texas Tech University, Gardiyawasam Kalpana, August 2014
16
fold increment in the chlorophyll content, and a 1.5 and 3.0 fold induction in the IRT1
and FRO2 gene expression ratios were observed with GBO3 respectively (Figure 3.8).
These results confirmed that 2M9E is a false positive mutant which behave similar to
FIT1::LUC/cpl1-6 and can be used as a better control in order to identify true mutants.
3.5 1M14, a preliminary positive mutant
Significantly lower bioluminescence intensities were observed for 1M14 mutant
compared to 2M9E control under all exposure times (Figure 3.9) and this was
consistent throughout all the 3 re-screens. Hence, the mutant 1M14 was considered as
a preliminary true mutant deficient in the GBO3 inducible iron signaling pathway.
Functional analysis was performed to further characterize the mutant in regards
to iron signaling. Chlorophyll accumulation was reduced by 70% with GBO3 for
1M14 compared to 2M9E (Figure 3.10). Without GBO3 treatment, both the
accumulations were similar in range. This may indicate that only the GBO3 inducible
signaling is compromised by the mutation while the endogenous iron signaling is
unaffected.
Shoot-iron accumulation in 1M14 was reduced by 37% with GBO3 compared
to water (Figure 3.10). Additionally, a global reduction was observed in IRT1 gene
expression ratios of 1M14 over the 2M9E control with a 57% reduction after 96 hours
of GBO3 exposure. This indicates that, IRT1 gene expression induction by the GBO3
signal is compromised in 1M14.
1M14 was identified as a positive mutant deficient in GBO3 inducible iron
signaling based on the preliminary data presented with Arabidopsis.
Texas Tech University, Gardiyawasam Kalpana, August 2014
17
Figure 3.1 GBO3 VOCs trigger growth promotion in Arabidopsis FIT1::LUC/cpl1-6
line. A representation image showing the growth promotion induced by GBO3
volatiles after exposing for 5 days (left panel). A fresh weight (top right) and dry
weight (bottom right) data collected after exposing the seedlings to GBO3 volatiles
(solid line) or water (dashed line) for 3,5,7,9, or 12 days. The asterisk indicates p-
value ≤ 0.05 between GBO3 and water treatments (n =10, error bars represent standard
error).
Texas Tech University, Gardiyawasam Kalpana, August 2014
18
Figure 3.2 GBO3 VOCs increase chlorophyll content in both cpl1-6 line and Col-0
ecotype when exposed to bacterial volatiles (black bars) compared to water treatment
(white bars) after 7 days (upper) and 14 days (bottom) of exposure. The asterisk
indicates p-value ≤ 0.05 between GBO3 and water treatments (n = 6, error bars
represent standard error).
Texas Tech University, Gardiyawasam Kalpana, August 2014
19
Figure 3.3 Time course of elevated IRT1 gene expression ratio in Arabidopsis cpl1-6
line seedlings exposed to GBO3 bacterial volatiles. Gene expression ratios (GBO3
volatile treated versus water treated, n=3, error bars represent standard error) are
shown above RT-PCR gel images.
Texas Tech University, Gardiyawasam Kalpana, August 2014
20
Figure 3.4 Elevated FRO2 gene expression in Arabidopsis cpl1-6 line seedlings
exposed to GBO3 bacterial volatiles for 96 hours. Gene expression ratios (GBO3
volatile treated versus water treated, n=3, error bars represent standard error) are
shown in left and RT-PCR gel images in right.
Texas Tech University, Gardiyawasam Kalpana, August 2014
21
Figure 3.5 GBO3 VOCs increase the shoot iron content in cpl1-6 line after 7 days of
exposure to bacterial treatment (black bars) compared to the water treatment (white
bars). Iron content reported per gram fresh weight (n=8, error bars represent standard
error), asterisk indicates p values ≤ 0.05 for GBO3 treated versus water control.
Texas Tech University, Gardiyawasam Kalpana, August 2014
22
Figure 3.6 GBO3 VOCs induce the FIT1-LUC bioluminescence expression in
FIT1::LUC/cpl1-6 line seedlings after 3 days of exposure to GBO3 volatiles compared
to water treated, under different CCD camera exposure times. The upper panel show
the water treated seedlings while the bottom panel show the GBO3 treated seedlings.
Texas Tech University, Gardiyawasam Kalpana, August 2014
23
Figure 3.7 The FIT1-LUC bioluminescence intensity of GBO3 exposed 2M9E and
GBO3 exposed FIT1::LUC/cpl1-6 under different camera exposure times. The left
panel show the 2M9E signal while the right panel show the FIT1::LUC/cpl1-6 signal.
Texas Tech University, Gardiyawasam Kalpana, August 2014
24
Figure 3.8 The functional characterization of 2M9E exposed to GBO3 volatiles for
different time periods. The chlorophyll accumulation in 2M9E with GBO3 treatment
for 7 days (top panel). GBO3 treated (black bars) versus water treated (white bars),
n=6, error bars represent standard error. Time course of elevated FRO2 and IRT1 gene
expressions in 2M9E seedlings exposed to GBO3 (bottom panels). Gene expression
ratios (GBO3 volatile treated versus water treated, n=3, error bars represent standard
error) are shown.
Texas Tech University, Gardiyawasam Kalpana, August 2014
25
Figure 3.9 The FIT1-LUC bioluminescence intensity of 1M14 mutant with GBO3
(bottom row) compared to that of 2M9E control with GBO3 (top row) under different
CCD camera exposure times.
Texas Tech University, Gardiyawasam Kalpana, August 2014
27
Figure 3.10 The functional characterization of 1M14 mutant exposed to GBO3.
Chlorophyll accumulation in 1M14 compared to 2M9E control after 7 days of GBO3
treatment (top panel). Asterisk indicates p values ≤ 0.05 for GBO3 treated (black bars)
versus water control (white bars). n=6, error bars represent standard error. Shoot iron
content in 1M14 after 7 days of exposure to bacterial treatment (black bars) or to water
treatment (white bars) (middle panel). Iron content reported per gram fresh weight
(n=8, error bars represent standard error). Time course of elevated IRT1 gene
expression ratios in 2M9E control (blue bars) and the 1M14 mutant (black bars)
exposed to GBO3 (bottom panels). Gene expression ratios (GBO3 volatile treated
versus water treated, n=2) are shown.
Texas Tech University, Gardiyawasam Kalpana, August 2014
28
CHAPTER IV
FUTURE STUDIES
During this project, approximately 3500 of mutagenized M2 seeds of the background
FIT1::LUC/cpl1-6 were screened for the compromised luciferase bioluminescence
using a low light CCD camera system and a one mutant, 1M14, was selected as a
plausible positive mutant deficient in the GBO3 volatile inducible iron signaling
pathway. After initial identification of the mutant, the bioluminescence data were
confirmed with 3 re-screens. Following confirmation, a functional analysis comprised
of iron content measurement, chlorophyll level measurement and the gene expression
measurement of iron related genes were carried out. At the end, 1M14 was declared as
a plausible positive mutant deficient in the GBO3 volatile inducible iron signaling
pathway in Arabidopsis.
Upon completion of the mutant identification, the next step is to identify and
locate the mutation in the genome that is responsible for the observed phenotype. For
this purpose, the map-based cloning will be performed. This procedure is composed of
two main phases, the rough mapping and the fine mapping. During the rough
mapping, a genomic map with the resolution of up to 1250 kb will be generated.
Following this, a fine mapping should be carried out until obtain a resolution of 40 kb.
After the map-based cloning procedure, a genomic fragment with a resolution of 40 kb
should be obtained.
During the next step, this 40 kb DNA fragment will be sequenced to obtain the
full DNA sequence and the candidate genes can be identified based on the available
genetic information of Arabidopsis. Following the identification of the responsible
gene, it should be further confirmed by molecular complementation of the transgene.
After a successful complementation, the gene can be declared and named as a
component in the GBO3 volatile inducible iron signaling pathway in Arabidopsis.
Texas Tech University, Gardiyawasam Kalpana, August 2014
29
REFERENCES
Baaj, Y., Magdelaine, C., Ubertelli, V., Valat, C., Talini, L., Soussaline, F.,
Khomyakova, E., Funalot, B., Vallat, J.-M., and Sturtz, F.G. (2008). A
highly specific microarray method for point mutation detection. Biotechniques
44, 119-126.
Bang, W.Y., Kim, S.W., Jeong, I.S., Koiwa, H., and Bahk, J.D. (2008). The C-
terminal region (640–967) of Arabidopsis CPL1 interacts with the abiotic
stress- and ABA-responsive transcription factors. Biochemical & Biophysical
Research Communications 372, 907-912.
Brown, J.C., Chaney, R.L., and Ambler, J.E. (1971). A new tomato mutant
inefficient in the transport of iron. Physiologia Plantarum 25, 48-53.
Colangelo, E.P., and Guerinot, M.L. (2004). The essential basic helix-loop-helix
protein FIT1 is required for the iron deficiency response. The Plant Cell 16,
3400-3412.
Connolly, E.L., Campbell, N.H., Grotz, N., Prichard, C.L., and Guerinot, M.L.
(2003). Overexpression of the FRO2 ferric chelate reductase confers tolerance
to growth on low iron and uncovers postranscriptional control. Plant
Physiology 133, 1102-1110.
Curie, C., and Briat, J.-F. (2003). Iron transport and signaling in plants. Annual
Review of Plant Biology 54, 183.
Farag, M.A., Ryu, C., Sumner, L.W., and Paré, P.W. (2006). GC-MS SPME
profiling of rhizobacterial volatiles reveals prospective inducers of growth
promotion and induced systemic resistance in plants. Phytochemistry 67, 2262-
2268.
Greene, E.A., Codomo, C.A., Taylor, N.E., Henikoff, J.G., Till, B.J., Reynolds,
S.H., Enns, L.C., Burtner, C., Johnson, J.E., Odden, A.R., Comai, L., and
Henikoff, S. (2003). Spectrum of chemically induced mutations from a large-
scale reverse-genetic screen in Arabidopsis. Genetics 164, 731-740.
Texas Tech University, Gardiyawasam Kalpana, August 2014
30
Gupta, P.K., Rustgi, S., and Mir, R.R. (2008). Array-based high-throughput DNA
markers for crop improvement. Heredity 101, 5-18.
Jander, G. (2006). Gene identification and cloning by molecular marker mapping.
Methods In Molecular Biology (Clifton, N.J.) 323, 115-126.
Jander, G., Norris, S.R., Rounsley, S.D., Bush, D.F., Levin, I.M., and Last, R.L.
(2002). Arabidopsis map-based cloning in the post-genome era. Plant
Physiology 129, 440-450.
Jander, G., Gruys, K.J., Last, R.L., Gonzalez, K.A., Baerson, S.R., and Hudak,
J.A. (2003). Ethylmethanesulfonate saturation mutagenesis in Arabidopsis to
determine frequency of herbicide resistance. Plant physiology (Lancaster, Pa.)
Plant physiology 131, 139-146.
Jeong, I.S., Fukudome, A., Aksoy, E., Bang, W.Y., Kim, S., Guan, Q., Bahk, J.D.,
May, K.A., Russell, W.K., Zhu, J., and Koiwa, H. (2013). Regulation of
abiotic stress signalling by Arabidopsis C-terminal domain phosphatase-like 1
requires interaction with a K-homology domain-containing protein. PLoS ONE
8, 1-12.
Kim, S.A., and Guerinot, M.L. (2007). Mining iron: iron uptake and transport in
plants. FEBS Letters 581, 2273-2280.
Kim, Y., Schumaker, K.S., and Zhu, J.-K. (2006). EMS mutagenesis of
Arabidopsis. Methods In Molecular Biology (Clifton, N.J.) 323, 101-103.
Kloepper, J.W., and Schroth, M.N. (1981). Relationship of in vitro antibiosis of
plant growth-promoting Rhizobacteria to plant growth and the displacement of
root microflora. Phytopathology 71, 1020-1024.
Lister, R., Gregory, B.D., and Ecker, J.R. (2009). Next is now: new technologies
for sequencing of genomes, transcriptomes, and beyond. Current Opinion in
Plant Biology 12, 107-118.
Lukowitz, W., Gillmor, C.S., and Scheible, W.R. (2000). Positional cloning in
Arabidopsis. Why it feels good to have a genome initiative working for you.
Plant Physiology 123, 795-805.
Texas Tech University, Gardiyawasam Kalpana, August 2014
31
Mani, R., Ae, N., Prasad, M.N.V., and Freitas, H. (2010). Potential of siderophore-
producing bacteria for improving heavy metal phytoextraction. Trends in
Biotechnology 28, 142-149.
Maple, J., and Møller, S.G. (2007). Mutagenesis in Arabidopsis. Methods In
Molecular Biology (Clifton, N.J.) 362, 197-206.
Meier, C., Bouquin, T., Nielsen, M.E., Raventos, D., Mattsson, O., Rocher, A.,
Schomburg, F., Amasino, R.M., and Mundy, J. (2001). Gibberellin response
mutants identified by luciferase imaging. Plant Journal 25, 509-519.
Millar, A.J., Chua, N.H., Kay, S.A., Carre, I.A., and Strayer, C.A. (1995).
Circadian clock mutants in Arabidopsis identified by luciferase imaging.
Science (Weekly) Science 267, 1161-1163.
Page, D.R., and Grossniklaus, U. (2002). The art and design of genetic screens:
Arabidopsis thaliana. Nature Reviews Genetics 3, 124-136.
Vert, G., Guerinot, M.L., Briat, J.F., Curie, C., Grotz, N., Dedaldechamp, F., and
Gaymard, F. (2002). IRT1, an Arabidopsis transporter essential for iron
uptake from the soil and for plant growth. Plant cell 14, 1223-1233.
Vert, G.A., Briat, J.-F., and Curie, C. (2003). Dual regulation of the Arabidopsis
high-affinity root iron uptake system by local and long-distance signals. Plant
Physiology 132, 796-804.
Yi, Y., and Guerinot, M.L. (1996). Genetic evidence that induction of root Fe(III)
chelate reductase activity is necessary for iron uptake under iron deficiency.
Plant journal : for cell and molecular biology 10, 835-844.
Yuan, Y., Wu, H., Wang, N., Li, J., Zhao, W., Du, J., Wang, D., and Ling, H.-Q.
(2008). FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake
gene expression for iron homeostasis in Arabidopsis. Cell Research 18, 385-
397.
Yuan, Y.X., Zhang, J., Wang, D.W., and Ling, H.Q. (2005). AtbHLH29 of
Arabidopsis thaliana is a functional ortholog of tomato FER involved in
controlling iron acquisition in strategy I plants. Cell Research 15, 613-621.
Texas Tech University, Gardiyawasam Kalpana, August 2014
32
Zhang, H., Kim, M.-S., Krishnamachari, V., Payton, P., Sun, Y., Grimson, M.,
Farag, M.A., Ryu, C.-M., Allen, R., Melo, I.S., and Paré, P.W. (2007).
Rhizobacterial volatile emissions regulate auxin homeostasis and cell
expansion in Arabidopsis. Planta 226, 839-851.
Zhang, H., Yan, S., Xitao, X., Mi-Seong, K., Dowd, S.E., and Paré, P.W. (2009). A
soil bacterium regulates plant acquisition of iron via deficiency-inducible
mechanisms. Plant Journal 58, 568-577.