Molecular Characterization and optimization of ... -...

Current Trends in Biotechnology and PharmacyVol. 12 (3) 230-244 July 2018, ISSN 0973-8916 (Print), 2230-7303 (Online)

230

AbstractThe study was designed to investigate the

effect of growth culture conditions, namely: Mediacomposition, incubation period, temperature andpH on the production of antimicrobial compoundsfrom three selected actinomycetes isolated fromwaste dump soil in Western Uganda. Molecularcharacterizations of these selected isolates werealso carried out. Optimization processes wereassessed using shake-flask cultures on eightdifferent media, Portion of filtered fermentationbroths were assayed using agar well diffusionmethod. The remaining portions were extractedusing water, ethanol, ethyl acetate and methanolsolvents. The extracts were dried and re-dissolvedin 2.5% dimethyl sulphoxide to concentration of2.5mg/ml and tested for antimicrobial activity usingagar well diffusion method. Three selected isolateswere characterized using conventional PCR andsequenced using Sanger methods. The resultsshowed that, Modified Nutrient brothsupplemented with carbon sources (solublestarch and Glycerol at half each) at 12-18g/l, 08-16g/l and 10-18g/l for BRWDc (SP), KBMWDSb6(M6) and KBRWDSa3 (RF) respectively producedoptimum concentration of bioactive compounds.NaCl at concentration of 17-19g/l was found to be

suitable for optimum bioactive compoundproduction. The best optimized results were foundwhen cultures were grown under the followingconditions: temperature (30-35oC), pH (7.0-7.5)and incubation period (168h). Aqueous and ethanolextracts gave optimum bioactive activity for all thethree organisms. The identification of 16SrDNAgene showed that, the three isolates belong tophylum actinobacteria into the genusStreptomycetes. This study showed that mediacompositions, cultural conditions and solvents forextraction play role in bioactive compoundproduction in these actinomycetes isolates.

Keywords: Optimization, Actinomycetes spp,Bioactive Compound, Molecular characterization,Waste dump soil, Western Uganda.

IntroductionOver the years, there has been increasing

reports of infections with resistant micro-organisms and opportunistic pathogenicinfections. This increase has been stated to beamong immunocom promised patients withdiseases such as HIV, organ transplant, cancerand other conditions (1, 2). In African countriesfor example in Uganda, there is growing concernon the increasing burden of infectious diseases

Molecular Characterization and optimization of BioactiveCompounds Production of three Actinomycetes spp

Isolated from Waste Dump Soil from Western UgandaAdamu Almustapha Aliero1, 2, Abubakar Sunusi Adam1, Ibrahim Ntulume1, Ahmad Ibrahim Bagudo2,

Aminu Ado B/Kudu3, Miruka Conrad Ondieki4 Sanusi Ahmad Jega4, John Odda3, Matilda AngelaOkech5

1. Department of Microbiology and Immunology, Kampala International University Western campus, Uganda2. Department Biological Sciences Kebbi State University of Science and Technology, Aliero, Nigeria

3. Department of Pharmacology, Kampala International University-Western Campus, Uganda.4. Department of Biochemistry, Kampala International University-Western Campus, Uganda.

5. College of Health, Medicine and Life Sciences, Department of Microbiology,St. Augustine International University Uganda.

*Corresponding author: Email : [email protected] and [email protected]

Molecular Characterization and optimization of Bioactive Compounds


231

among immunocompromised patients and drugresistant pathogens. Literature have shown that,among 35 million populations of Ugandans, 1.14%had HIV and an estimated 9.2% (101,000) have aCD4 count 55mol %) withadequate transcription factors which regulates thegene expression which acts in tune of specificenvironmental requirements (5). Literatures haveshown that productions of these compoundsdepends on genus, species, strains ofactinobacteria and could be decreased orincreased by using different nutritional, growthconditions and time (6). Extraction solvents couldalso affect the amount of bioactive compounds(7). Taxonomy of antibiotics producingactinomycetes plays an important role indiscovering new antimicrobial compounds (8).Isolation and identifications of actinomycetesusing phenotypic methods remain the goldstandard but in recent years the process seemsto be more accurate using molecular methods(8). The later methods contributed greatly incharacterizing novel actinomycetes species andstrains from both terrestrial and aquaticenvironments (9).

This research studied actinomycetesisolated from waste dump soil from WesternUganda and found three isolates ((KBMWDSb6(M6), BRWDSc (SP) and KBRWDSa3 (RF)) withability to produce bioactive compounds. The threeisolates were tested on bacteria and fungi includingdrug resistant clinical bacterial isolates (10, 11).This study optimized nutritional requirements,

fermentation conditions; extracted fermentedbroths using different solvents and characterisedthe selected actinomycetes isolates usingmolecular methods.

MATERIALS AND METHODSIsolation of Actinomycetes : The threeactinomycetes spp were isolated using twodifferent media: Starch casein nitrate agar (12)and yeast extract starch casein agar (YSCA) (13).The pure cultures were maintained on starchcasein nitrate agar slants at 4oC for short storageand 30% glycerol at -80oC for long storage (14,15).

Phenotypic identification of Actinomycetes :The active actinomycetes spp were screened usingthe API 20A kit (Biomerieux, France) (16) asdescribed in manufacturer’s guide and incubatedfor 48 hours at 37°C in an anaerobic jar after whichthe results were recorded. The identification wasdone using the apiwebTM software (V4.0). Othermethods used for identification were macroscopicmorphology of the colonies, microscopic andconventional biochemical methods (17, 18).

Molecular characterization of actinomycetesDNA extraction : DNA was extracted from seven(7) day old actinomycetes cultures by suspendingthe isolates into 3ml of 1XPBS. The suspensionwas boiled at 90oC for 40 mins and then centrifugedfor 5mins at 13000rpm. Five hundred microliter(500μl) of the centrifuged suspension wastransferred in to a sterile eppendorf after which 5μl of RNAase enzyme was added and incubatedat room temperature for 10 mins. One millilitre(1mL) of absolute ice cold ethanol was added tothe solution and incubated at -80oC for 30 mins.The solution was then centrifuged at 13000 rpmfor 10 mins and washed by adding 1ml of 70%ethanol and centrifuged again at 13000 rpm for 10mins. The solution was then inverted on tissue todry and after drying, it was eluted in 50 μl of elutionbuffer.

Amplification of extracted DNA andsequencing : The 16S rDNA gene of threeselected actinomycetes was amplified accordingto the method (19). The following primers 27F

Adamu Almustapha Aliero et al


232

(5’AGAGTTTGATCCTGGCTCAG3’) and 1492R(5’ACGGCTACC TTGTTACGACTT 3’) were usedto amplify the extracted DNA. All PCR reactionswere performed in a Perkin Elmer DNA thermalcycler (Perkin Elmer 480).

PCR products were washed by precipitationbefore sequencing and quantified using NanoDropND-1000 (Wilmington, DE, USA).Sequencingreactions were carried out using final volume of7 μl solution containing 5.5μl of nuclease-freewater, 0.5μl of (40 ng/μl) primer and 1μl of (100ng/μl) of DNA template, BD terminator (ABI). Thereaction products were analysed using ABI3500XL Genetic Analyser, POP7™, BigDye® 3.1.Amplification and sequencing reactions were doneat Inqab Biotechnological (Africa’s GenomicCompany) South Africa. The 16S rDNA sequencegene data of the potent actinomycetes werecompared to the nucleotide sequences in Genebank data base in National Centre forBiotechnology Information (NCBI) website (http://www.ncbi.nih.gov ) using Basic Local AlignmentSearch Tool (BLAST).

Phylogenetic analysis : The Phylogenetic andmolecular evolutionary analyses were conductedusing MEGA software (version 6) (20).

Optimization for antimicrobial production bythree selected actinomycetes

Effect of different media and fermentationperiod on antimicrobial production :Fermentation was carried out using eight differentmedia in shake-flask culture method (6) inErlenmeyer flask (500ml). The media usedincluded: 1. Modified Nutrient broth (MNB) Thermoscientific oxoid (g/l: Lab-lemoco powder 1, Yeastextract 2, peptone 5, Soluble starch 8, Glycerol3, K2HPO2 0.5, NaCl 5, CaCO3 0.75, MgSo4.7H2O0.5 and pH 7.0±4), 2. Yeast extract starch broth(YESB) (Composition in media g/l: yeast extract3, peptone 3, casein 3, starch 8, Glycerol 3,K2HPO4 0.5, MgSO4.7H2O 0.5, NaCl 12CaCO30.75, and pH 7.0±4), 3. Modified PotatoDextrose broth (MNB) HiMedia-MO96-500G (g/lPotatoes infusion 200, Dextrose 20, Glycerol 3,

CaCO3 0.75, NaCl 4.8, MgSO4.7H2O 0.5, K2HPO40.5 and pH adjusted 7.0± 2), 4. Starch caseinnitrate broth (SCNB) (Composition in media g/l:Starch 10, Casein 0.3, KNO3 2, NaCl 2, K2HPO42, MgSO4.7H2O 0.5, CaCO3 0.02, FeSO4.7H2O0.01 and pH adjusted 7.0 ± 2), 5. Starch Caseinbroth (SCB) (the composition in g/l: Soluble starch10.0; casein 0.3; NaNO3, 2.5; K2HP04 1.0; KH2PO41.0; MgSo4.7H2O, 0.5; KCl, 0.5; trace salt solution1.0 ml : CuSO45H2O 0.64; FeSO4.7H2O, 0.11;MnCl2.4H2O 0.79, ZnSO4.7H2O 0.15 and pHadjusted 7.0±2), 6. Starch nitrate broth (SNB)(Composition in media g/l: Starch 20, KNO3 1,NaCl 0.5, K2HPO4 0.5, MgSO4.7H2O 0.5,FeSO4.7H2O 0.1 and pH adjusted 7.0± 2), 7.Glycerol Casein broth (GCB) (the composition ing/l: Glycerol 10.0; casein 0.3; NaNO3, 2.5; K2HP041.0; KH2PO4 1.0; MgSo4.7H2O, 0.5; KCl, 0.5;trace salt solution 1.0 ml : CuSO45H2O 0.64;FeSO4.7H2O, 0.11; MnCl2.4H2O 0.79, ZnSO4.7H2O0.15 and pH adjusted 7.0 ±4) and 8. Glycerolarginine broth (GAB) (the composition in g/l:Glycerol 12; arginine 1; NaCl 1, K2HP04 1.0,MgSo4.7H2O, 0.5; CuSO45H2O 0.001;FeSO4.7H2O, 0.001; MnCl2.4H2O 0.001,ZnSO4.7H2O 0.001 and pH adjusted 7.0 ±2). Sevendays old culture of actinomycete sp wasinoculated and incubated in a digital gas baththermostats oscillator (THZ-82B) at 28oC and 200± 5 rpm. Aliquots of broth were obtained andchecked for the antimicrobial activity at intervals:24, 48, 72, 96, 120, 144 and 168h of incubation tostudy the effects of incubation period onantimicrobial production.

Effect of pH and temperature on antimicrobialproduction : At the end of the optimizationstudies, one media was selected to study theeffect of pH and temperature on the production ofbioactive compound(s). Modified Nutrient brothmedium was selected for this study. The varyingpH and temperature used were as shown pH (5,5.5, 6, 6.5, 7, 7.5, 8, 8.5 and 9) and incubationtemperature (15oC, 20oC, 25oC, 30oC, 35oC, 40oC,45oC and 50oC). Seven days old culture ofactinomycete sp was inoculated and incubatedin a digital gas bath thermostats oscillator (THZ-



233

82B) at 200 ± 5 rpm for 7 days after which thebroth was centrifuged at 3000rpm for 20 minutesand filtered using filter paper (Whatman No. 1)and tested for antimicrobial activity using agar welldiffusion method (21).

Effect of different carbon source onantimicrobial production : Effects of differentcarbon source were studied on Modified Nutrientbroth according to the method (21). The differentcarbon sources used were: (10g/l): Soluble Starch,Glucose, Glycerol, Lactose, and Sucrose. Asecond trial was carried out by combining carbonsources as: (5g/l each): Starch and Glucose,Starch and Glycerol, Lactose and Sucrose wereadded to Nutrient broth medium while all otherparameters were kept constant. The tests mediumwere inoculated with seven days old culture ofactinomycete sp and incubated at 28oC in a digitalgas bath thermostats oscillator (THZ-82B) at 200± 5 rpm for 7 days. After incubation the broth wascentrifuged at 3000rpm for 20 minutes and filteredusing filter paper (Whatman No. 1). The filtratewas tested for antimicrobial activity using agarwell diffusion method.

Effect of different concentration of starch andglycerol combination on antimicrobialproduction : The effect of glycerol on mediacontaining combine carbon were tested at differentconcentrations: soluble starch and glycerol at halfconcentration of each (g/l: 2, 4, 6, 8, 10, 12, 14,16, 18 and 20) were added to Modified Nutrientbroth, other parameters remained constant. Thebroth was inoculated with seven days old cultureof actinomycete sp and incubated at 28oC, 200 ±5 rpm for 7days. After incubation the broth culturewas centrifuged at 3000rpm for 20 minutes andfiltered. The filtrate was tested for antimicrobialactivity using agar well diffusion method (21).

Effect of sodium chloride and nitrogen sourceconcentration on antimicrobial production :Effects of different concentrations of NaCl onproduction of bioactive compound were studiedaccording to the method (22). The differentconcentration of the NaCl and Nitrogen source(Peptone) used were: (g/l: 5, 7, 9, 11, 13, 15, 17,

19, 21 and 23) on Modified Nutrient broth. All otherparameters were kept constant. The broth mediawas inoculated with seven days old culture ofactinomycete sp and incubated at 28oC, 200 ± 5rpm for seven day. The broth cultures werecentrifuged at 3000rpm for 20 minutes and filtered.The filtrate was tested for antimicrobial activityusing agar well diffusion method (21).

Antimicrobial activity of fermented brothsTest organisms : The following test organismswere used to determine the antimicrobial activityof all fermented broths and different solventsextracts: drug (s) resistant clinical bacterialisolates (Escherichia coli 2966, Pseudomonasaeruginosa 2929, and Staphylococcus aureus2876) and Standard drug sensitive fungus Candidaalbicans ATCC1023), (obtained from Departmentof Medical Microbiology Makerere University,Kampala).

Antibacterial and antifungal assay : Cellconcentration of test organisms was adjusted to0.5 McFarland turbidity standards. Bacterialcultures were inoculated on Mueller Hinton agar(HIMEDIA M173-500G), fungal cultures on potatodextrose agar plate. Wells were bored usingsterile 1000 μl micro pipette tip (17). The wellswere filled with 100 μl of supernatant and the plateswere incubated at 37°C for 24 h and 72h at 28oCfor bacteria and fungus respectively. Freshlyprepared broth media was used as negativecontrol. All experiments were performed intriplicates.

Extraction of bioactive compounds usingdifferent solvents : Extraction of bioactivecompounds was carried out according to themethod earlier described by (8, 17). Theremaining centrifuged fermented filtered broth ofeach isolate was divided into four. Three partswere extracted using three solvents by addingequal volume (1:1) of ethanol (95%), ethyl acetate(95%) and Methanol (95%). The solution wasshaken vigorously on a rotatory shaker. Thesolvent phase was collected and evaporated inhot air oven at 40oC. The remaining one part ofthe filtered broth was concentrated to get aqueous



234

extract. The filtrates were dried and stored at 4oCfor further studies.

Antimicrobial activity of different solvent crudeextracts : The dried crude extracts (0.43g/200ml,0.38g/200ml and 0.40g/200ml) for BRWDc (SP),KBMWDSb6 (M6) and KBRWDSa3 (RF)respectively, were re-dissolved in 2.5% dimethylsulphoxide (DMSO) (THOMAS BAKER) (23, 24)to a concentration of 2.5mg/ml of each extractwhich was used for antibacterial and antifungalactivity (17). Cell concentration of test bacteriaand C. albicans was adjusted to 0.5 McFarlandturbidity standards and inoculated on MuellerHinton agar (HIMEDIA M173-500G) for bacteriaand potato dextrose agar plate for fungus. Thetest organisms were then spread on to respectivemedia plates. Wells were bored using sterile 1000μl micro pipette tip and filled with 100μl of 2.5mg/ml ethanol crude extract, ethyl acetate crudeextract, Methanol crude extract and aqueous crudeextract and 2.5% DMSO was used as negativecontrol. Plates were incubated at 37°C for 24 hand 72 h at 28oC for bacteria and fungusrespectively. At the end of incubation, the zonesof inhibition were measured. All experiments wereperformed in triplicates.

Statistical analysis : The data was analysed usingGraphPad software (Version 5.04). Results ofmean zone of inhibition on the effects of differentmedia used, carbon source, growth temperature,incubation time, pH, nitrogen source, NaClconcentration and different solvents crude extractswere analysed using one way ANAVO usingmultiple comparison and p < 0.05 was consideredto be significant.

Results and discussionThe results of Analytical profile index using

API 20A showed that only actinomycete isolateKBRWDSa3 (RF) can ferment the sugaranaerobically (Table 1). The analysis of thisisolates using APIwabTM showed that it’s belongingto actinomycetes genus. This also showed thatisolate KBRWDSa3 (RF) is a facultative organism.The inability of the isolates BRWDSc (SP) andKBMWDSb6 (M6) to ferment the sugars

anaerobically showed that they are either obligateaerobic organisms or other genus ofactinobacteria. However, this could also be asresult of kit used for the identification which isselective to only actinomycetes genus.

The molecular characterization of the threebroad spectrum active actinomycetes isolateswere determined and PCR amplification ofgenomic extracted DNA using actinomycetesforward and reverse primers produced 1600bp forall the three isolates (Fig. 1). The amplified PCRproducts were also sequenced and produced885bp, 881bp and 860 bp, of sequences forKBMWDSb6 (M6), BRWDSc (SP) andKBRWDSa3 (RF) respectively. The resultantsequences were BLAST using MEGA softwarewith nucleotide BLAST search in NCBI. Thesequences that produced significant alignment

Fig. 1 : Agarose gel showing PCR amplification of16S rDNA of the actinomycetes isolates: 1: DNAmolecular weight ladder, 2: Negative control, 3: MBJ,4: FR: KBRWDSa3 (RF), 5:KBMWDSb6 M6), 6:BRWDSc (SP).

results showed that actinomycetes isolatesKBMWDSb6 (M6) and BRWDSc (SP) were 98%and 97% respectively similar to Streptomycessp AQB.SKKU 20 with accession numberJN836957.1. However, these were also found beto be 97% similar to Streptomyces sp. MSU 2261with accession number AY232829.1. IsolateKBRWDSa3 (RF) was found to be 99% similar toActinomycete TGsR-01-04 with accession numberAB775551.1 and 33 Streptomycetes spp including



235

Uncultured Streptomyces sp. clone 2516FJ429559.1. The sequences were deposited toGenbank with accession numbers: MG594793,MG594794 and MG594795 for KBMWDSb6(M6), KBRWDSa3 (RF) and BRWDSc (SP)respectively. The phylogenetic tree analysis basedon 16S rDNA was constructed using theMaximum Likelihood method (Fig. 2). The tree

result showed that the two isolates (KBMWDSb6(M6), and BRWDSc (SP)) formed cluster withStreptomyces sp. MSU 2261 while KBRWDSa3(RF) isolates occupied new position in the treebut belong to genus Streptomycetes. Base onthe phenotypic and molecular data, the isolateKBRWDSa3 (RF) was suggested to be newStreptomycetes MG594794 sp

The ability of actinomycetes spp to growand produce antimicrobial compounds dependson the media compositions and incubationconditions (6, 21). This research has also shownthat, selection of media and incubation conditionsfor production of antimicrobial compounds isnecessary.

Out of the eight different fermentation media :Modified Nutrient broth(MNB), Yeast extractstarch broth (YESB), Modified Potato Dextrosebroth (MPDB), Starch casein nitrate broth (SCNB),Starch casein broth (SCB ), Starch casein argininebroth (SCAB ), Glycerol casein nitrate broth(GCNB ), Glycerol arginine broth (GAB ), threeactinomycetes spp (BRWDc (SP), KBMWDSb6(M6) and KBRWDSa3 (RF) isolates grown on twomedia MNB and YESB were found to support theproduction of antimicrobial compound (Fig.3).Actinomycete sp KBMWDSb6 (M6) fermented inall the media tested but did not show activity toresistant clinical isolates S. aureus 2876 whileactinomycete spp (BRWDc (SP) and KBRWDSa3(RF) fermented in all media showed no activityagainst two clinical resistant isolate P. aeruginosa2929 and E. coli 2966. It was also observed that,all the three actinomycetes fermented brothsshowed activity to standard test fungus Candida

Fig. 2: A phylogenetic tree was constructed usingMaximum Likelihood method bootstrap test (100replicates). The tree showed the position of isolatesKBMWDSb6 (M6), BRWDSc (SP) and KBRWDSa3(RF) with closely related Streptomycetes species.


albicansATCC1023. The zone of inhibition of thethree actinomycetes spp from all test mediaranged from 02 to 32mm. The results showed thatthe three selected isolates produced low amountof antimicrobial compound in 71.42% of the mediaused. The p values (0.0051, 0.0002, and 0.0003for KBMWDSb6 (M6), KBRWDSa3 (RF) andBRWDc (SP) respectively) of multiple comparisonbetween the different media used for extraction ofantimicrobial compound showed statisticalsignificance at p < 0.05. This confirmed the reportsof (6, 21) who also found out that, differentactinomycetes isolates from differentenvironments do not produce bioactivecompounds in all test media.

The results on different incubation periodsshowed that antimicrobial production of the threeisolates started after 72h of incubation butmaximum production was obtained after 168h(Fig. 4). This could be as a result of the depletionthe nutrients from medium after 168h of incubationwhich enhance the production of antimicrobialcompounds by actinomycetes (25). This wascontrary to the findings of (6) who reported that,maximum productions of antimicrobialcompounds by Streptomyces strain ERI-1, ERI-2and ERI-3 were obtained after 96h of incubation.The p values (0.0133, 0.0012, and 0.0006 forKBMWDSb6 (M6), KBRWDSa3 (RF) and BRWDc(SP) respectively) of multiple comparisons on theinfluence of incubation time on antimicrobialproduction showed statistical significance at p <0.05. This showed that different actinomycetesisolates require different growth conditions foroptimum production of bioactive compounds.

Modified Nutrient broth medium was selectedfor study on the effect of different carbon sourceon the production of antimicrobial compounds. Thecombined carbon source (Starch and Glycerol)gave a higher production of antimicrobialcompounds when compared to the other carbonsources used (Fig.5). The p values (0.1026, forKBMWDSb6 (M6) and 0.0001 for KBRWDSa3(RF) and BRWDc (SP)) of multiple comparisonson the effects of different carbon source onantimicrobial production showed statistical

Fig. 3: Media selection for antimicrobial productions.MNB: Modified Nutrient Broth, YESB: Yeast extractstarch broth, MPDB: Modified Potato Dextrose broth,SCNB: Starch casein nitrate broth, SCB: Starchcasein broth, SCAB: Starch casein arginine, GCNB:Glycerol casein nitrate broth and GAB: Glycerolarginine broth. A: BRWDSc(SP), B:KBMWDSb6 (M6),C: KBRWDSa (RF), EC: E. coli 2966, PA: P.aerugenosa 2929, CA: C. albicans ATCC1023, SA:S. aureus 2876. The results of multiplecomparisons showed statistical significance at pvalue < 0.05 using one way ANOVA.


Fig. 4: Effect of incubation time on antimicrobialproduction by three selected actinomycetes spp. onmodified nutrient broth medium, A: BRWDSc (SP),B: KBMWDSb6 (M6); C: KBRWDSa (RF). EC: E. coli2966, PA: P. aerugenosa 2929, CA: C. albicansATCC1023, SA: S. aureus 2876.The results ofmultiple comparisons showed statisticalsignificance at p value < 0.05 using one way ANOVA.

Fig. 5: Effect of different carbon source on productionof antimicrobial compound in modified nutrient brothmedium. A: BRWDSc (SP), B : KBMWDSb6(M6); C: KBRWDSa (RF). EC: E. coli 2966, PA: P.aerugenosa 2929, CA: C. albicans ATCC1023, SA:S. aureus 2876, ST: starch, GL: Glucose, GLY:Glycerol, LC: Lactose, SC: Sucrose, ST+GL: Starchand Glucose, ST+GLY: Starch and Glycerol, LC+SC:Lactose and Sucrose. The results of multiplecomparisons showed statistical significance at pvalue < 0.05 using one way ANOVA.



238

significance at p < 0.05 for KBRWDSa3 (RF) andBRWDc (SP) while statistical insignificance wasobserved on the isolate KBMWDSb6 (M6). Thisresult was similar to those of (26, 27, 28) thoughthey used the two carbons separately. Arasuetal. (6) reported the maximum antimicrobialproduction by Streptomyces spp from medium withglucose and fructose combinations. However,studies by (29, 30) reported that media containingsingle carbon such as Glucose, Sucrose, andLactose supported higher production of bioactivecompounds.

Different concentrations of selected carbonsource (Soluble starch and Glycerol) were alsostudied for their influence on the production ofantimicrobial compounds. The results are shownon (Fig. 6). The influence of combine Starch andGlycerol concentrations on the production ofantimicrobial compounds ranged from 12-18g/l,08-16g/l and 10-18g/l for BRWDc (SP),KBMWDSb6 (M6) and KBRWDSa3 (RF)respectively. These combinations gave betterresults than those of single carbon sources. Thep values (0.0081, 0.0057, and 0.0011forKBMWDSb6 (M6), KBRWDSa3 (RF) and BRWDc(SP) respectively) of multiple comparisons on theeffects of different concentration of combinecarbon source (Starch and Glycerol) onantimicrobial production showed statisticalsignificance at p < 0.05. Similar finding werereported by Sengupta et al.(27). He used, yeastextract medium combined with two carbon source(starch 8g/l and Glycerol 3g/l) though differentconcentration on antimicrobial production was notestablished.

The effects of temperatures on theproduction of antimicrobial compounds are shownon (Fig. 7). The minimum temperature for theantimicrobial production was found to be 25oCwhile the maximum temperature was 35oC. It wasobserved that, higher antimicrobial activity waswhen cultures were grown at 30-35oC. The abilityto produce antimicrobial compounds below roomtemperature (20oC) could be due to theiradaptations to the environments where they wereisolated. The p values (0.0945, 0.0400, and

Fig. 6: Effects of different combine carbonsource(Starch and Glycerol) on antimicrobialproduction from three selected actinomycetes spp.A: BRWDSc (SP), B : KBMWDSb6(M6); C : KBRWDSa(RF). EC: E. coli 2966, PA: P. aerugenosa 2929, CA:C. albicans ATCC1023, SA: S. aureus 2876.Theresults of multiple comparisons showed statisticalsignificance at p value < 0.05 using one way ANOVA.

0.0403for KBMWDSb6 (M6), KBRWDSa3 (RF)and BRWDc (SP) respectively) of multiplecomparisons on the effects of growth temperatureon antimicrobial production showed statisticalsignificance at p < 0.05 for KBRWDSa3 (RF) andBRWDc (SP), but no statistical difference wasobserved from isolate KBMWDSb6 (M6). Other



239

Fig. 7: Effect of temperature on the production ofantimicrobial compound from three selectedactinomycetes ssp. A: BRWDSc (SP), B: KBMWDSb6(M6); C: KBRWDSa (RF). EC: E. coli 2966, PA: P.aerugenosa 2929, CA: C. albicans ATCC1023, SA:S. aureus 2876. The results of multiple comparisonsshowed statistical significance at p value < 0.05using one way ANOVA.

Fig. 8: Effect of pH on the production of antimicrobialcompounds by three selected actinomycetesisolates. A: BRWDSc(SP), B: KBMWDSb6(M6); C:KBRWDSa(RF). EC: E. coli 2966, PA: P. aerugenosa2929, CA: C. albicans ATCC1023, SA: S. aureus2876. The results of multiple comparisons showedstatistical significance at p value < 0.05 using oneway ANOVA.

studies have reported high production ofantimicrobial compounds by most actinomycetesspp when grown at temperature 30 - 35oC (6, 22,28, 30; 31).

Furthermore, this study showed that theproduction of antimicrobial compounds were highwhen the three isolates were grown under pH 6.7to 8.5. Higher zone of inhibitions were observedfrom organisms grown at pH 7.0-pH 7.5 (Fig. 8).



240

The p values (0.0054, 0.0042, and 0.0186 forKBMWDSb6 (M6), KBRWDSa3 (RF) and BRWDc(SP) respectively) of multiple comparisons on theeffects of pH on antimicrobial production showedstatistical significance at p < 0.05. Our findingwas in line with previous results reported in similarstudies (21, 22, and 28). However, other studiesreported high zone of inhibition at neutral to slightlyacidic pH (30, 31).

Figure 9 below showed the results of theeffect of different NaCl concentrations on theproduction of antimicrobial compounds. Thesuitable concentration of NaCl for the productionof antimicrobial compounds ranges 15-21g/l forthe selected actinomycetes spp but highestantimicrobial activity was observed at 17 and 19g/l. The p value (0.0001 each for KBMWDSb6 (M6),KBRWDSa3 (RF) and BRWDc (SP)) of multiplecomparisons on the effects of different NaClconcentration on antimicrobial production showedstatistical significance at p < 0.05. Differentactinomycetes spp produced antimicrobialcompounds at different concentration of NaCl (22).Other studies have shown optimum antimicrobialproduction by actinomycetes spp with NaClconcentration of: (20g/l) Singh et al. (32) and (10g/l): El-Refaiet al. (33). Mangamuriet al. (22) findingsshowed that the optimum NaCl concentration forthe production of bioactive compounds fromStreptomyces tritolerans DAS 165T was equivalentto 50g/l.

Figure 10 showed the effect of differentconcentration of nitrogen source (peptone) onantimicrobial production by three actinomycetesspp. The suitable nitrogen source (peptone) forthe production of antimicrobial compounds rangedfrom 9-21g/l and 11-21g/l for BRWDc (SP) andKBRWDSa3 (RF), andKBMWDSb6 (M6)respectively. The optimum activity was observedat 11-21g/l for all three isolates. The p value(0.0001 each for KBMWDSb6 (M6), KBRWDSa3(RF) and BRWDc (SP)) of multiple comparisonson the effects of different nitrogen source (peptone)on antimicrobial production showed statisticalsignificance at p < 0.05. The concentrationobtained from this study was higher than that of

Fig. 9: Effect of NaCl concentration on the productionof antimicrobial compounds by three selectedactinomycetes isolates. A: BRWDSc (SP), B:KBMWDSb6 (M6); C: KBRWDSa (RF). ). EC: E. coli2966, PA: P. aerugenosa 2929, CA: C. albicansATCC1023, SA: S. aureus 2876. The results ofmultiple comparisons showed statisticalsignificance at p value < 0.05 using one way ANOVA.

Al-Ghazali and Omran (34) who reported 0.05g/100ml as the required concentration for maximumantimicrobial production by Streptomyces sp.LH9.



241

The results on antimicrobial activity fromdifferent solvents crude extracts showed thataqueous and ethanol crude extracts had thehighest antimicrobial activity (Figure 11). The meanzones of inhibition from all crude extracts rangedfrom 8.33 - 31.67, 3.66 - 22.33 and 9.67-24.16±0.17for BRWDc (SP), KBMWDSb6 (M6) andKBRWDSa3 (RF) respectively. Aqueous crude

extract of actinomycetes isolate KBMWDb6 (M6)did not show activity against S. aureus 2876, buthad activity when ethanol and methanol were usedfor extraction. The p values (0.0001 each forKBMWDSb6 (M6), BRWDc (SP) and 0.0019

Fig. 10: Effect of nitrogen source (Peptone) on theproduction of antimicrobial compounds by threeselected actinomycetes spp. A: BRWDSc (SP), B:KBMWDSb6 (M6); C: KBRWDSa (RF). ). EC: E. coli2966, PA: P. aerugenosa 2929, CA: C. albicansATCC1023, SA: S. aureus 2876. The results ofmultiple comparisons showed statisticalsignificance at p value < 0.05 using one way ANOVA.

Fig. 11: Mean and standard error zone of inhibitionof different solvents crude extracts from threeactinomycetes spp. A: BRWDSc (SP), B: KBMWDSb6(M6); C : KBRWDSa (RF). EC: E. coli 2966, PA: P.aerugenosa 2929, CA: C. albicans ATCC1023, SA:S. aureus 2876. AQE Aqueous extract, EE: Ethanolextract, EAE: Ethyl acetate extracts, ME: Methanolextract, * P value of multiple comparisons using oneway ANOVA.



242

forKBRWDSa3 (RF)) of multiple comparisonsbetween the crude extracts showed statisticalsignificance at (P < 0.05). The ability of ethanolcrude extract to produce higher activity could beas result of universal polarity of the solvent whichmake it to extract both polar and weak polarcompounds (35).

CONCLUSIONProduction of antimicrobial agents by

actinomycetes species is dependants on mediacompositions, growth conditions and extractionmethods. This study revealed that suitablemedium, optimum concentration of combinecarbon sources, growth conditions, and solventare important for optimum production ofantimicrobial compounds by actinomycetes spp.The molecular identification of 16S rDNA geneshowed that all the three isolates belong to phylumActinobacteria into the genus Streptomycetes.

REFERENCES

1. Joint Programming Initiative on AntimicrobialResistance (JPIAMR) “Strategic ResearchAgenda” 2013. Available from https://ec.europa.eu/health/amr/sites/ amr/files/ev_20151022_ co52_en.pdf

2. Uganda National Academy of Sciences(UNAS) “Antibiotic Resistance in Uganda:Situation Analysis and Recommendations,ISBN: 978-9970-424-10-8. A4 Lincoln HouseMakerere University P.O. Box 23911,Kampala, Uganda, 2015.https://cddep.org/wp-content /up loads/2017/08/garp-uganda_sa.pdf

3. Parkes-Ratanshi R, Achan B, Kambugu A,Meya D, Denning D. “Estimated burden offungal disease in Uganda,” 23rdEuropeanCongress of Clinical Microbiology andInfectious Diseases, Berlin, Abstract 3635.2013

4. Jagan Mohan YSYV, Sirisha B, PrathyushaK, Pola SR. Isolation, Screening andCharacterization of Actinomycetes from

Marine Sediments for their Potential toProduce Antifungal Agents. GJBAHS. 2014;3 (4):131-137

5. Chand Basha SK, Sambasiva Rao KRS. AnIntrinsic Assessment of Bioactive Potentialityof Mangroves Actinomycetes, Journal ofEntomology and Zoology Studies. 2017;5(1): 20-26

6. Arasu MVA, Thankappan SR, Naif AA,Veeramuthu D, Savarimuthu I, Paul A, et al.Nutritional requirements for the productionof antimicrobial metabolites fromStreptomyces. AJMR.2014; Vol. 8(8): 750-758.

7. Tara DG, Chringma S, Vishwanath PA, BinodL. Isolation and Characterization ofAntibacterial Actinomycetes from SoilSamples of Kalapatthar, Mount EverestRegion. NJST.2009; 10: 173-182

8. Khanna M, Renu S, Rup L. Selectiveisolation of rare actinomycetes producingnovel antimicrobial compounds. IJABR.2011: (2): 357-375.

9. Mobolaji FA, Olubukola OB. Taxonomy andecology of antibiotic producing Actinomy-cetes. African Journal of AgriculturalResearch. 2012; 7(15):2255-2261.

10. Adamu AA, Ibrahim N, John O, Matilda AO.Production of novel antifungal compoundsfrom actinomycetes isolated from wastedump soil in Western Uganda. AJMR.2017;11(30) :1200-1210

11. Adamu AA, Eilu E, Maniga NJ, Sambo HA,Matilda AO, John O. Antibacterial Activity ofActinomycetes Isolated from Waste DumpSoil from Western Uganda. MRJI. 2017;21(5): 1-14.

12. Sohan S, Arnab P, Abhrjyoti G, Maitree B.Antimicrobial activities of actinomycetiesisolated from un-explored regions ofSundarbans mangrove ecosystem. BMCM.2015; 15:170.



243

13. Mincer TJ, Jensen PR, Kauffman CA,Fenical W. Widespread and persistent ofpopulation of a major actinomycetes taxonin ocean sediments. Appl. Environ.Microbial. 2002; 68:5005-5011.

14. Madigan MT, Martiko JM, Parker J.Antibiotics: Isolation and characterization.In. Brook Biology of Microorganisms, 8thedn. Prentice-Hall International Inc. NewJersey. 1997; 440-442.

15. Oskay M, Tamer A, Azeri C. Antibacterialactivity of some actinomycetes isolated fromfarming soils of Turkey. Afr. J. Biotech. 2004;3:441–446.

16. Davies OF, Adeleye IA, Wang PG.Hyoscyamine-producing marineActinomycetesfrom Lagos Lagoonsediment. Asian Pac J Trop Biomed. 2015;5(3): 196-201

17. Hotam SC, Jayprakash Y, Anju RS, SmritiS, Anil KS, Natrajan G. “Antibacterial activityof actinomycetes isolated from different soilsamples of Sheopur (A city of central India)”.J Adv Pharm Technol Res. 2013; 4(2): 118–123.

18. James ON, Wilber L, Daniel M, Rafi H,James KP, Eric et al, Isolation andcharacterization of Streptomyces specieswith antifungal activity from selected nationalparks in Kenya, AJMR. 2010; 4 (9): 856-864.

19. DeviSC, Jemimah NS, Nasimunislam N,Vaishnavi B, Mohanasrinivasan V. Isolationof soil actinomycetes inhabiting amrithiforest for the potential source of bioactivecompounds. Asian J Pharm Clin Res.2012;5(3) :189-192

20. Tamura K, Stecher G, Peterson D, FilipskiA, Kumar S. MEGA6: Molecular EvolutionaryGenetics Analysis version 6.0. MolecularBiology and Evolution. 2013; 30: 2725-2729.

21. Ali AM, Amira A, El G, Hala MR. Influence

of nutrition and culturing conditions onantimicrobial metabolite production byStreptomyces mesioensis isolated fromEgyptian soil. Inter J of Hem TechResearch.2014; 6(4):2552-2557.

22. Mangamuri UK, Vijayalakshmi M, SudhakarP, Dayanand A. Optimization of Processparameters for improved production ofBioactive Metabolites by Streptomycestritolerans DAS 165T. Brit Microb Res J.2014; 4(4): 428-442

23. Kang C, Dae-Sik H, Chung-Hui K, Young-Hwan K, Euikyung K. Jong-Shu K.“Evaluation of Antimicrobial Activity of theMethanol Extracts from 8 TraditionalMedicinal Plants” Official Jl of KoreanSociety of Toxicology. Toxicol. Res.2011;27(1):31-36

24. Junaid S, Dileep N, Rakesh KN, PrashithKTR. Antimicrobial and antioxidant efficacyof Streptomyces species srdp-tk-07 isolatedfrom a soil of Talakaveri, Karnataka, India.IJAPR.2013; 4(4): 736-750

25. Gesheva V, Ivanova V, Gesheva R. Effectsof nutrients on the production of AK-111- 81macrolide antibiotic by Streptomyceshygroscopicus. Microbiol. Res. 2005; 160:243-248.

26. Minambres B, Reglero A, Luego JM.Characterizations of an inducible transportsystem for glycerol in Streptomycetesclavuligerus. J. Antibiot.1992; 45(2):269-277

27. Sengupta S, Poul AK. Nutritional conditionsfor the germination of Strept galbus 5ME-13spores. Acta Biotech. 1992; 12 (3):225-228

28. Maha AH, Moustafa YE, Wafa YS.Physiological factor affecting the productionof antimicrobial substances byStreptomyces violates in batch culture.Proceeding of the first national conference(EBB Sc). Egyptian J of biol. 2001; (2): 1-10



244

29. Chattopadyay D, Sen SK. Optimization ofcultural condition for antifungal antibioticsaccumulation by Streptomyces rocheiG164. Hindustan antibiot. Bull. 1997; 39:64-71

30. Kavitha A, Vijayalakshmi M. Culturalparameters affecting the production ofbioactive metabolites by Nocardia levis MK-VL-113. J of Appl Sci Res. 2009; 5(12):2138-2147

31. Ababutain IM, Zeinab KA, Nijla AA.Optimization of environmental and nutritionalconditions to improve growth and antibioticsproductions by Streptomyces sp., isolatedfrom Saudi Arabia Soil. Intern Res J of Microb(IRJM) 2013; Vol. 4(8) pp. 179-187 ISSN:2141-5463

32. Singh LS, Marzumdar S, Bora TC.Optimization of process parameters forgrowth and bioactive metabolite production

by a salt-tolerant and alkaliphilic actinomycete, Streptomyctes tanshiensis strain A2D.J de Mycol. Medic.2009; 20(1):15-20

33. El-Refai HA, Abdelrahman HY, Abdulla H,Hanna AG, Hashem AH, El-Refaiet al.Studies on the production of Actinomycin,by Nocardio idesluteus, a novel source. CurrTren Biotechnol Pharm. 2014; (3):1282-1297.

34. AL-ghazali L, Omran R. Optimization ofmedium composition for antibacterialmetabolite production from Streptomycessp. Asian J Pharm Clin Res, 2017; 10(9):2017, 381-385

35. Ensieh S, Maryam N. Isolation of biologicallyactive actinomycetes from untouched soils:A case study from Karaj district, Iran. Prog.In Bio. Scs. 2016; 6:65-74.


/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 300 /GrayImageMinResolutionPolicy /OK /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 1200 /MonoImageMinResolutionPolicy /OK /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 1200 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile () /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure true /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles true /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> ]>> setdistillerparams> setpagedevice

Molecular Characterization and optimization of ... -...

Documents

Transcript of Molecular Characterization and optimization of ... -...