1

Molecular Cell, Volume 50

Supplemental Information

Mutations in the Intellectual Disability

Gene Ube2a Cause Neuronal Dysfunction

and Impair Parkin-Dependent Mitophagy

Dominik M. Haddad, Sven Vilain, Melissa Vos, Giovanni Esposito, Samer Matta, Vera M. Kalscheuer, Katleen Craessaerts, Maarten Leyssen, Rafaella M. P. Nascimento, Angela M. Vianna-Morgante, Bart De Strooper, Hilde Van Esch, Vanessa A. Morais, and Patrik Verstreken

2

3

Figure S1. Nervous System-Specific RNAi Screen in Drosophila of Neurological Disease Genes

Identifies Synaptic and Mitochondrial Defects upon dRad6 Knockdown, Related to Figure 1

Functional profiling of 47 genes across 5 different assays upon neuronal (nSyb-Gal4) expression of

RNAi to neuronal disease genes, Related to Table S2. First column: NMJ length (total summed NMJ

branch length per muscle area); second column: NMJ bouton number (total type1b boutons/ muscle

area); third column: synaptic vesicle trafficking of exo-endo cycling vesicles (FM 1-43 labeling

intensity following a 1 min 90 mM KCl stimulation protocol); fourth column: synaptic vesicle trafficking

of reserve pool vesicles (FM 1-43 labeling intensity following 10 min of 10Hz nerve stimulation in the

presence of FM 1-43 dye and 5 min of 90 mM KCl stimulation in the absence of dye) and fifth column:

mitochondrial membrane potential (the ratio of red to green JC-1 fluorescence). Each row is a

different gene that was knocked down. Decrease or increase in quantified phenotypic values

compared to control is shown in shades of green (decrease) to red (increase), black denotes no

difference. The dendrogram on the left is generated by hierarchical clustering using pairwise

Euclidean distances. The arrow highlights dRad6.

4

5

Figure S2. Identification of Rad6 Mutants, Related to Figure 2

(A, B) Western blot of Drosophila larval extracts of mutants dRad6∆1 and dRad6EY and mutants that

express wild type dRAD6 animals probed with anti-RAD6 and anti-actin (A) and quantification of

labeling intensity normalized to control (B). Data are mean ± SEM, N=2 independent experiments,

ANOVA, post hoc Dunnett’s test: **: p <0.01.

(C) IEF/SDS-PAGE of control, mRad6a, mRad6b null MEF cells probed with anti-RAD6. ‘A’ and ‘B’

denote the location of mRAD6A and mRAD6B protein spots, respectively (Two independent

experiments).

(D) Imaging of mitochondrial membrane potential using TMRE in control MEFs with and without an

FCCP a mitochondrial uncoupler, indicating FCCP labelling is specific to polarized mitochondria

(Scale bar: 40 µm).

(E) Western blots of control and mRad6a null MEFs and Rad6a-DDK-Myc expressing control and

mRad6a null MEFs probed with anti-Myc and anti-Actin antibodies.

6

7

Figure S3. RAD6A Facilitates CCCP-Induced Mitophagy, Related to Figure 5

(A) Images of the mitochondrial mass in control MEFs subjected to 24h DMSO, CCCP, CCCP

+bafilomycin, and CCCP +3-MA treatment that are labeled with anti-Hsp60, a mitochondrial marker

and with TOTO-3, a nuclear marker. Scale bar: 40 µm.

(B) Schematic of mitochondrial morphological changes and clearance upon CCCP treatment of MEFs

(first column) and images of the mitochondrial mass in control MEFs (second column), mRad6a null

MEFs (third column), control MEFs (fourth column) and parkin knock out MEFs (fifth column)

subjected to 24h DMSO treatment, 3h, 8h or 24h CCCP treatment, that are labeled with anti-Hsp60, a

mitochondrial marker and with TOTO-3, a nuclear marker. Scale bar: 8 µm.

(C) Reverse Transciptase-PCR performed on RNA from control and mRad6a null MEFs and control

and Parkin null MEFs followed by PCR analysis using specific primers for Parkin and HPRT (house-

keeping gene) cDNA.

(D) Immunostaining of the mitochondrial mass in control and mRad6a null MEFs expressing Parkin-

GFP subjected to DMSO treatment or 3h, 8h and 24h CCCP treatment probed with anti-Hsp60 and

with TOTO-3. Scale bar: 8 µm.

(E, F) Western blots (E) and quantification of labeling intensity (F) of control and mRad6a null MEFs

expressing Parkin-GFP treated for 8h with CCCP or DMSO, probed with p62 (compare arrowheads in

‘-CCCP’), anti-LC3 (compare arrowheads in ‘+CCCP’), and anti-Actin antibodies. Data are mean ±

SEM, N=3 independent experiments, ANOVA, post hoc Dunnett’s test: **: p <0.01.

8

9

Figure S4. RAD6A E3 Nuclear Ligases Do Not Facilitate Mitophagy, Related to Figures 6 and 7

(A) mRNA levels of RNAi control, Parkin and Bre1 ubiquitously expressed (Tubulin-Gal4). Data are

mean ± SEM for three independent experiments, ANOVA, post hoc Dunnett’s test: **: p<0.01.

(B, C) Imaging of mitochondrial membrane potential at third instar larval boutons of RNAi control,

Parkin and Bre1 ubiquitously expressed (Tubulin-Gal4) using JC-1 (red are JC-1 aggregates at

negative mitochondrial membrane potential and green are JC-1 monomers; Scale bar: 4.5 µm) (B)

and quantification of red to green JC-1 fluorescence intensity in synaptic mitochondria normalized to

control (C). Data are mean ± SEM, N=6, ANOVA, post hoc Dunnett’s test: *: p<0.05.

(D-G) Western blots of control MEFs transiently expressing GFP-labeled shRNA against scrambled

GFP (control), Ubr1, Rad18 or Bre1 and probed anti-UBR1, anti-RAD18, anti-BRE1 and anti-actin (D)

and quantification of labeling intensity normalized to control (E). Data are mean ± SEM, two

independent experiments, ANOVA, post hoc Dunnett’s test: *: p <0.05, **: p <0.01. Images of the

mitochondrial mass of control MEFs transiently expressing GFP-labeled shRNA against scrambled

GFP (control), Ubr1, Rad18 or Bre1 and labeled with anti-TOM20, a mitochondrial marker, anti-GFP

and TOTO-3, a nuclear marker (F) (Scale bar: 8 µm). Quantification of mitochondrial mass normalized

over cell area (G). Data are mean ± SEM, N=30 transfected cells for two independent experiments, t-

test.

(H) Images of the mitochondrial mass of controls, mutant parkin, mutant dRad6∆1 and dRad6∆1 mutant

that express wild type dRAD6 labeled with anti-CV, a mitochondrial marker and TOTO-3, a nuclear

marker (Scale bar: 2 µm) (Three independent experiments).

10

11

Figure S5. RAD6A Is an E2 Ubiquitin-Conjugating Enzyme for Parkin, Related to Figure 7

(A) Coomassie brilliant blue staining of an SDS PAGE loaded with the E1, Parkin, Rad6a and

ubiquitin protein used in the in vitro ubiquitination assays (1 µg total protein loaded).

(B) Western Blot of control and mRad6a null MEFs and control and mRad6a null MEFs expressing

Parkin-GFP probed with anti-GFP and anti-Actin antibodies (Two independent experiments).

(C) Immunostaining of control and mRad6a null MEFs and control and mRad6a null MEFs expressing

Parkin-GFP probed with the mitochondrial marker anti-Hsp60 and with anti-GFP (green, labeling

Parkin-GFP) and the nuclear marker TOTO3 (Scale bar: 40 µm). (Two independent experiments).

(D) Quantification of the parkin signal in CCCP treated versus DMSO treated cells from control or

mRad6a knock out MEFs expressing Parkin-GFP and probed with anti-Parkin. Data are mean ± SEM

for three independent experiments, t-test: *: p<0.05.

(E) 6h DMSO or CCCP treated control and mRad6a knock out MEFs expressing Parkin-GFP

immunostained with anti-Hsp60 (mitochondrial marker) and anti-GFP (Parkin staining) antibodies

(Scale bar: 40 µm). (Three independent experiments).

12

Table S1. Related to Figure 1 and Supplemental Experimental Procedures

Patient IV‐1 III‐4 III‐5 III‐6 III‐7

Age at last examination 15y 33y 13y 9y 13y

Head circumference (centile) 50th 97th 90th 90th 90th

Neurodevelopment

Intellectual disability P P P P P

degree moderate moderate severe severe moderate

Age walking 3y 2y 26m 2y 30m

Speech impairment P P P P P

Hypotonia childhood P P P P P

Seizures A A A A A

Behavioural problems P A A P P

Brain imaging N NA NA N

discrete

periventricular white

matter lesions

Facial dysmorphism

Synophrys P P A A A

Large mouth with downturned corners P A P P P

Broad neck P P A A A

Depressed nasal bridge P A A P A

Up‐slanted palpebral fissures A A A A A

Midface hypplasia P P A A A

Urogenital

Small penis A A A P P

Cryptorchidism / small testes A A A P P

Skin

Generalised hirsutism P P A A A

Dry skin A A P P A

Dorsal swelling feet P A A A A

Other

Digital anomalies short thumbs short fingers slender fingers

Other diseases/anomalies VSD ataxia

Family a Family b

P: present; A: absent, VSD: ventricular septum defect; N: normal, NA: not available, y: years, m: months

Clinical findings related to XLID patients in the two newly identified families that transmit

hRad6a/Ube2a mutations. P= present; A= absent; VSD= ventricular septum defect; N= normal; NA=

not available; y= years; m= months.

13

Supplemental Experimental Procedures

Human Genetics

Family ‘a’ is of Belgian origin. The index patient, patient (a-IV.1), was born after a normal pregnancy

to healthy parents at 37 weeks of gestation. He was referred to the hospital at the age of 15 months

because of hypotonia and absence of crawling. He could sit alone at the age of 10 months. There

were no feeding problems, his weight was above the 90th centile. Obstipation was a major problem

during infancy. He started walking at the age of 3, but showed mild spastic paresis with equinus

position of the feet, necessitating surgical correction. During childhood his developmental delay

became more obvious. Now at the age of 20 he functions at the level of moderate intellectual

disability. He uses single words and two-word sentences. He still tiptoes but there are no other

neurological symptoms. His behavior is calm, he never developed seizures. He is no longer obese

because of presence of severe colitis ulcerosa since the age of 15. Head circumference and height

are within the normal range. His maternal uncle, individual (a-III.4), has a very similar clinical history.

This 33 year old man has a severe intellectual disability with IQ of 36 (Terman test). He also

developed a mild spastic paraparesis and is obese. He never showed seizures and has no other

neurological problems. Both men have the same dysmorphic characteristics: heavy eyebrows with

synophris, flat forehead and flat and broad nasal bridge, low posterior hair line and hirsutism. By

means of chromosome X exome sequencing, a frame shift mutation c.260_261del leading to

p.Ile87MetfsX14 in Ube2a was identified in the affected men and their carrier mothers (Kalscheuer et

al., submitted). The mutation was absent in the non- affected males. The carrier mothers are

intellectually normal and do not present any neurological symptoms.

Family ‘b’ is of mixed Dutch-Belgian origin and consists of 3 affected men. The index patient, (b-III.7),

is now 14 years old and has a moderate intellectual disability with autism spectrum disorder. He

shows stereotypies, avoids eye contact and has an unclear and limited speech. He has a slender

build with normal growth parameters. On neurological examination a broad gait and mild ataxia is

present. His two maternal cousins, individuals (b-III.5) and (b-III.6), aged 10 and 13 years

14

respectively, have a severe intellectual disability with autism and difficult behavior. Both brothers have

normal growth parameters and mild dysmorphism (high front, deep-set eyes, high palate). No epilepsy

or other neurological features are present upon examination. By means of chromosome X exome

sequencing, a missense mutation p.Arg7Trp (R7W) affecting a highly conserved amino acid in exon 1

of the Ube2a gene was identified in the 3 affected boys and their carrier mothers (Kalscheuer et al.,

submitted). Both mothers show complete skewing of X-inactivation in blood (ratio 1/99) and do not

show any symptoms. An overview of the clinical features is presented in Table S1.

Fly Genetics

Flies were kept on standard corn meal and molasses medium. For the RNAi screen, 295 transgenic

UAS-RNAi lines were expressed using w1118 UAS-DCR2; nSyb-GAL4 at 28°C (VDRC); where

possible, we used different RNAi lines per gene (Table S2) (Dietzl et al., 2007). The following RNAi

lines were used to knock down bre1 and ubr1: GD108206 GD108902 respectively (VDRC). Controls

were w1118 UAS-DCR2/w1118; nSyb-GAL4/+ at 28°C.

The P element insertion in dRad6 is y1 w67c23; PEPgy2UbcD6EY04634 (Bloomington Drosophila Stock

Center) and dRad6∆1 is an imprecise excision of PEPgy2UbcD6EY04634. Excisions that fail to

complement Df(3R)BSC175 were screened using forward primer: 5‘-GCA AGG ACG AAA GAA AGG

G-3’ and reverse primer: 5’-CTT CGT CTC TTT CGC GTG AG–3’ and PCR products were

sequenced. In dRad6∆1 we find that 8 nucleotides (GCCCAGGC, in wild type controls located

between -50 and -58 nucleotides from the ATG start of dRad6) are duplicated and border a remaining

piece of 42 nucleotides from the P-element (5’-CAT GAT GAA ATA ACA TTA ATG TTA AGA TGT

TAT TTC ATC ATG-3’). Both dRad6 alleles were backcrossed to y1 w67c23 for several generations. We

have also sequenced the genomic DNA surrounding the P element insertion site in

PEPgy2UbcD6EY04634 and in dRad6∆1 but did not detect nonsynonymous mutations. y1 w67c23 was

used as a control unless otherwise indicated.

15

RNAi Screen

Different motor performance assays (ability to fly, negative geotaxis and startle induced stress

response) enabled us to identify 47 genes that when knocked down in the nervous system show

consistent phenotypes (Table S2). These were retrained and screened using five additional assays at

the third instar larval NMJ. NMJ morphology was quantified by labeling synapses using anti-HRP and

anti-DLG both synaptic markers and manually quantifying synaptic features including total synaptic

length and number of boutons normalized to muscle surface area (Khuong et al., 2010). Synaptic

vesicle trafficking was assessed using FM 1-43 labeling. We quantified both exo-endo cycling pool

mobilization and reserve pool mobilization as described (Verstreken et al., 2008) (see also below).

Finally, mitochondrial membrane potential was measured using JC-1 labeling (see below). For each

assay in the screen, data from at least 4 larvae was quantified and normalized to control values. To

calculate dissimilarity between phenotypic profiles (the combination of phenotypes for each given

gene), we averaged at least 4 replications per assay and calculated the pairwise Euclidean distances

between them. Distance calculations and average-linkage clustering was performed in (TM4

microarray software suite).

Cell Lines and Plasmids

Age matched control human fibroblasts, and control human lymphocytes as well as lymphocytes

derived from patients harboring a hRad6a mutation were obtained according to standard protocols

after informed patient consent.

Control and mRad6a null MEFs stably expressing Rad6a-DDK-Myc and Parkin-GFP were obtained by

transducing with a replication-defective recombinant retroviral expression system (Clontech) and

where selected based on their acquired hygromycin resistance. The DDK-Myc-tagged mouse Rad6a

and GFP-tagged mouse Parkin expression vectors were from Origene.

Control and mRad6a null MEFs were transiently electroporated with GFP-tagged shRNA plasmids of

scrambled-control, Ubr1, Bre1 (from Origene) or Rad18 (Qiagen). mRad6a null MEFs were transiently

electroporated with GFP-tagged human Rad6a wild-type (Origene) or with Rad6a clinical mutants.

16

Electroporation was performed according to the NEON (Invitrogen) manufacturer’s instructions. The

experiments were performed 24 h after transfections. hRad6a clinical mutants were constructed using

the multisite-directed mutagenesis kit as described by supplier’s protocol (Stratagene). Primers used

for the clinical mutant hRad6a-Q128X: forward 5'-GCA AAC AGC CAG GCT GCT AGC TGT ACC

AGG AGA AC-3' and reverse 5'-GTT CTC CTG GTA CAG CTA AGC AGC CTG GCT GTT TGC-3'.

For clinical mutant hRad6a-R7W forward 5'-GTC CAC CCC GGC TCG GTG GCG GCT CAT GCG

GGA CTT CAA G-3' and reverse 5'-CTT GAA GTC CCG CAT GAG CCG CCA CCG AGC CGG GGT

GGA C-3'. For the clinical mutant hRad6a-I87Mfs the forward 5'-GTC TAT GCA GAT GGT AGT ATG

TCT GGC CAT ACT TCA GAA CCG-3' and the reverse 5'-CGG TTC TGA AGT ATG GCC AGA CAT

ACT ACC ATC TGC ATA GAC-3'. For the clinical mutant hRad6a-R11Q the forward 5'-GGC GGC

GCC TCA TGC AGG ACT TCA AGA GGT TG-3' and the reverse 5'-CAA CCT CTT GAA GTC CTG

CAT GAG GCG CCG CC-3'. For the clinical mutant hRad6a-G23R the forward 5'-GGA GGA TCC

TCC AGC CAG AGT CAG CGG GGC CCC G-3' and the reverse 5'-CGG GGC CCC GCT GAC TCT

GGC TGG AGG ATC CTC C-3'.

For drug treatments, control cells were incubated either in DMSO or in 25 µM CCCP dissolved in

DMSO for the times indicated. We also performed experiments with cells incubated in 15 mM 3-

methyladenine (3-MA), or 150 nM Bafilomycin (for 24 h) as well as with cells incubated in 10 nM

FCCP.

FM1-43 at NMJs

Briefly for Exo-endo cycling pool vesicle labeling larval preparations were incubated for 5 min in 90

mM K+, 1.5 mM Ca2+ HL3 solution, and 4 µM FM 1-43, then washed for 1 min with HL3 before

imaging. For reserve pool vesicle labeling, synapses were stimulated in 4 µM FM 1-43 for 10 min at

10 Hz, 5 min recovery in the same solution, washed for 1 min with HL3 solution, then 90 mM K+, 1.5

mM Ca2+ HL3 solution without FM 1-43 added for 5 min to unload Exo-endo cycling pool vesicles

before imaging the reserve pool vesicles. FM 1-43 was imaged on a Nikon FN1 microscope with a

17

60x NA:1 water immersion lens Images with a DS-2MBWc digital camera. Quantification of boutonic

labeling intensities was performed as described (Verstreken et al., 2008).

Electrophysiology

Larvae were bathed in HL-3 with CaCl2 as indicated and TTX was added when recording mEJCs. For

forward filling of motor neurons with ATP, larvae were bathed in HL-3 with freshly prepared ATP (1

mM) and a recently severed motor nerve was quickly sucked into a suction electrode and left to

equilibrate for 20-30 min before proceeding with the recording (Verstreken et al., 2005). For

stimulation, severed segmental nerves were sucked into a suction electrode and stimulated at 2x

threshold. Care was taken to stimulate both neurons throughout the recording period. For experiments

where different stimulation frequencies were used in sequence, the sequence keys in pClamp were

programmed to seamlessly record the different paradigms 1Hz-7Hz-10Hz-20Hz. Recording/current

passing electrodes had resistances of 5-10 MΩ and were filled with KCl/KAc. For TEVC, muscle cells

were held at -70 mV using an Axoclamp 900A amplifier and input resistances were always > 5MΩ.

For current clamp recordings, resting membrane potentials were between -60 and -70 mV. EJCs and

EJPs were digitized using a Digidata 1440A, and acquired using pCLAMP 10 (Molecular Devices).

Data were analyzed in Clampfit. For quantification of 10 Hz recordings, the average EJP amplitude

recorded over a 30 s period was normalized to the average EJP amplitude measured in the first 15 s

(=100%). For the recordings at different frequencies, averages of individual data points normalized to

the amplitude of the first EJP are shown. For quantal content determination, the average EJC

amplitude was divided by the average mEJC amplitude, and the SEM was determined as described

(Murthy et al., 2003).

Mitochondrial Membrane Potential

Dissected third instar larvae were incubated for 10 min in 4 uM JC-1 in HL-3. Larvae were then

washed for 1 min with HL3 solution before imaging the red and green fluorescence (using standard

FITC and TRITC optics). The boutonic mitochondria of NMJs on muscle 6 and 7 in segments A2 and

18

A3 were identified by their morphology and the outline of the green JC-1 fluorescence. Images were

captured on a Nikon FN1 microscope with a 60X NA:1 water immersion lens. Data were analyzed in

NIS ELEMENTS 3.0 (Nikon) by measuring red and green JC-1 fluorescence in manually outlined

mitochondrial profiles and calculating the red over green fluorescence ratio. TMRE (Molecular Probes)

labeling was adapted from (Narendra et al., 2009). Briefly MEFs, lymphocytes, and fibroblasts were

incubated with 10 nM TMRE for 10 min, then washed for 1 min with PBS before imaging using a Zeiss

510 META confocal microscope and a 63X NA 1.4 oil lens. Experiments were controlled by also

performing labeling on FCCP treated cells, where mitochondria are depolarized. TMRE fluorescence

was quantified by ImageJ software (NIH, USA).

Immunohistochemistry

Drosophila larval fillets were fixed using 3.7% formaldehyde for 10 min at room temperature, and

processed using standard procedures. MEF cells were treated with the mitochondrial uncoupler

CCCP at 25 μM for the indicated time period (3, 8, and 24 h). Cells were fixed in 4%

paraformaldehyde in PBS for 20 min at room temperature. Cells were permeabilized with 0.1% Triton

X-100 for 10 min, followed by 1h blocking with BSA supplemented with 5% goat serum. Primary

antibodies used: rabbit anti-TurboGFP 1:1000 (Evrogen), mouse anti-CV subunit beta 1:250

(MitoSciences), rabbit anti-Hsp60 1:250 (MitoSciences). Secondary antibodies: Alexa-488 or -555

conjugated antibodies (Invitrogen) were used at 1:1000 and TOTO3 1:500 (Invitrogen). Preparations

were mounted in Vectashield (Vector Laboratories) and visualized with a Leica DMRXA confocal

microscope and a 63X NA 1.4 oil lens. Mitochondrial mass was quantified by thresholding the

mitochondrial labeling (anti-Hsp60) and dividing the mitochondrial surface area by the surface area of

the cell in ImageJ. Labeling intensities were quantified in ImageJ.

Western Blot Analyses

Proteins were separated by SDS-PAGE on 10% NuPAGE Bis-Tris gels (Invitrogen) and

electrophoretically transferred onto nitrocellulose membranes. Membranes were blocked with 5% milk

19

powder (or 5% BSA for anti-ubiquitin antibodies only) in Tris-buffered saline with 0.5% Tween (TBS-T)

for 1 h. Primary antibodies used: rabbit anti-Ubiquitin 1:500 (Dako), rabbit anti-K48-linkage specific

polyubiquitin 1:1000 (Cell Signaling), mouse anti-K63-linkage specific polyubiquitin 1:1000 (Enzo life

sciences), rabbit anti-RAD6 1:1000 (IHC-00078 Bethyl Laboratories), mouse anti-actin 1:1000

(DSHB), rabbit anti-TurboGFP 1:2000 (Evrogen), mouse anti-CV subunit beta 1:500 (MitoSciences),

mouse anti-VDAC 1:1000 (Abcam), rabbit anti-LC3 1:1000 (MBL), gp anti-p62 1:1000 (Progen),

mouse anti-Tubulin 1:5000 (Abcam), mouse anti-UBR1 1:500 (Abcam), rabbit anti-RAD18 1:1000

(Abcam), mouse anti-BRE1 1:500 (Abcam), and mouse anti-Parkin clone PRK8 1:1000 (Millipore).

Secondary antibodies: anti-rabbit HRP conjugated and anti-mouse HRP conjugated (Bio-Rad)

1:10000. Detection was done using the ECL-Plus detection kit (Amersham) and imaged on a FijuFilm

imaging system. Protein levels were quantified by densitometry using ImageJ (NIH, USA).

In Vitro Ubiquitination

For the auto-ubiquitination assay (Hristova et al., 2009) all purified human recombinant proteins used

were purchased from Boston Biochemistry. Briefly, 200 nM of hRAD6A, 90 nM of Parkin, 90 nM of E1

activating enzyme, 0.2 mM of ubiquitin, 0.2 mM ATP and 4 mM MgATP were added to 1X of reaction

buffer (20 mM Tris (pH 7.4), 120 mM NaCl, 1 mM TCEP buffer) and incubated for 2 h at 37 °C.

Reaction was stopped by addition of Laemmli sample buffer and incubating at 70 °C for 10 min then

separated by SDS-PAGE on 10% NuPAGE Bis-Tris gels (Invitrogen) and electrophoretically

transferred onto nitrocellulose membranes.

For the in-vitro ubiquitination based on ELISA, different concentrations of E2s (hRAD6A or hUBCH7)

0nM-800nM, 60 nM of Parkin, 5 nM of E1 activating enzyme, 9 mM of ubiquitin and 0.2 mM ATP were

added to the coated microtiter 96 well plate of the E2 profiling Kit. Reaction was incubated at room

temperature for 3h using the E2 profiling Kit manual paradigm (Marblestone et al., 2010) in order to

capture newly synthesized polyubiquitin chains using the kit Detection Reagent and streptavidin HRP

allowing for detection by chemiluminescence (Marblestone et al., 2010) were the Relative

Luminescence Units (RLUs) were determined using a luminometer. Data were fit using Prism

20

software to determine apparent Km using Michaelis-Menten equation from the plotted hyperbolic

curve exhibiting typical saturation kinetics as a function of substrate concentration.

.

RT-PCR

For quantitative RT-PCR, total RNA was isolated using TRI Reagent (Sigma-Aldrich) according to the

manufacturer’s protocol. 1 µg of total RNA was used as a template for synthesis of oligodT-primed

double stranded cDNA using the SuperScriptIII First-Strand Synthesis System (Invitrogen). cDNA of

each sample was used in SYBR Green PCR Master mix (Applied Biosystems) and the following

primers were used: For Flies: Park-F (5’-GGAGCGTCTGAATATAACCGATG-3’), Park-R (5’-

GGATCACGATGGACAGTAAAGG-3’), Ubr1-F (5’CGTTGTGCCAGTTGAAATAAGTAG), Ubr1-R (5’-

CCTTTCTCTATCGTCCGTGTG-3’), and for patient derived cells: Rad6a-F (5’-

CCGTTTGAGGATGGAACATT-3’) and Rad6a-R (5’-GGATTGGGTTCATCCAACAG-3’). The data

were normalized utilizing RP-49, a ribosomal gene, using following primers: RP-49-F (5’-

ATCGGTTACGGATCGAACAA-3’) and RP-49-R (5’-GACAATCTCCTTGCGCTTCT-3’) for flies and

GAPDH-F (5’ ), GAPDH-R (5’ ) for patient cells. All experiments were performed in triplicate and run

on a Roche LC480 system.

21

Supplemental References Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser, B., Kinsey, K., Oppel,

S., Scheiblauer, S., et al. (2007). A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151-156.

Hristova, V. A., Beasley, S. A., Rylett, R. J., and Shaw, G. S. (2009). Identification of a novel Zn2+-binding domain in the autosomal recessive juvenile Parkinson-related E3 ligase parkin. J Biol Chem 284, 14978-14986.

Khuong, T. M., Habets, R. L., Slabbaert, J. R., and Verstreken, P. (2010). WASP is activated by phosphatidylinositol-4,5-bisphosphate to restrict synapse growth in a pathway parallel to bone morphogenetic protein signaling. Proc Natl Acad Sci U S A 107, 17379-17384.

Marblestone, J. G., Suresh Kumar, K. G., Eddins, M. J., Leach, C. A., Sterner, D. E., Mattern, M. R., and Nicholson, B. (2010). Novel approach for characterizing ubiquitin E3 ligase function. J Biomol Screen 15, 1220-1228.

Murthy, M., Garza, D., Scheller, R. H., and Schwarz, T. L. (2003). Mutations in the exocyst component Sec5 disrupt neuronal membrane traffic, but neurotransmitter release persists. Neuron 37, 433-447.

Narendra, D., Tanaka, A., Suen, D. F., and Youle, R. J. (2009). Parkin-induced mitophagy in the pathogenesis of Parkinson disease. Autophagy 5, 706-708.

Verstreken, P., Ly, C. V., Venken, K. J., Koh, T. W., Zhou, Y., and Bellen, H. J. (2005). Synaptic mitochondria are critical for mobilization of reserve pool vesicles at Drosophila neuromuscular junctions. Neuron 47, 365-378.

Verstreken, P., Ohyama, T., and Bellen, H. J. (2008). FM 1-43 labeling of synaptic vesicle pools at the Drosophila neuromuscular junction. Methods Mol Biol 440, 349-369.