MOLECULAR BIOLOGY - NZYTech · of Carbohydrate Active Enzymes (CAZymes), Molecular Biology and Food...

60
MOLECULAR BIOLOGY MOLECULAR BIOLOGY 20 15

Transcript of MOLECULAR BIOLOGY - NZYTech · of Carbohydrate Active Enzymes (CAZymes), Molecular Biology and Food...

MOLECULARBIOLOGYMOLECULARBIOLOGY

2015

| 2

NZYTech’s Profile

Customers are NZYTech first priority. Our mission is to provide the scientific community and industry with a wide range of first class quality products & services at very competitive prices. Our strong commitment and investment in science is directed to develop, manufacture and market solutions that simplify, accelerate and improve life sciences research. NZYTech aims to keep a reputation in the fields of Molecular Biology, Carbohydrate-Active Enzymes (CAZymes) and Food and Feed Analysis, through the provision of Analytical Test Kits and Enzymes. We work passionately to achieve our goals. Individually or in collaboration with research groups in both academia and industry, we are continuously developing innovative products and services in our main areas of expertise, aiming to meet the highest standards for laboratory research and industrial analysis. We intend to serve diligently the scientific community and to provide satisfying solutions to customers worldwide. NZYTech is an ISO 9001:2008 certified company and one of the world’s few producers of CAZymes and enzymatic test kits.

In this catalogue, you will find a wide range of highly robust and proved quality reagents for Molecular Biology. These were developed to help you implementing the most demanding Recombinant DNA Technology protocols. Our products are designed to work in a diverse number of fields. From biotechnology, biomedicine, forensic & biological sciences and biology, NZYTech has proven to be a reliable partner that ensures highest performance at affordable prices.

Online Store Enjoy the convenience of online ordering.Log in to your account and place your order now.All the information you need, always updated.

Online Product SupportProduct Brochures, MSDS and our latest cataloguesare available to download online.

NewsCheck out for our new releases, the latest promotions or offers.See where you can meet us in fairs/congresses.

www.facebook.com/NZYTech

www.linkedin.com/company/NZYTechin

3 |

DNA Amplification 0513RNA/cDNA

17DNA/RNA Purification

23Competent Cells

37DNA Markers

27DNA Cloning

39Protein Science

33Restriction Enzymes

43Staining & Loading

47Reagents

53Services

31DNA Mutagenesis

58Terms & Conditions

@ a glance

| 4

Ever since its foundation, in 2008, NZYTech has been viewed as a reliable partner in research, development and production of Carbohydrate Active Enzymes (CAZymes), Molecular Biology and Food Analytical Products. Alongside the increase of our products portfolio, we are responding to an increased demand for OEM and Bulk quantities directed to special clients requiring larger amounts of products.

Our productive capability allows us to offer clients specific requirements on product presentation. Private labelling and packaging arrangements are also possible.

NZYTech has a facility has a quality management system certified by ISO 9001:2008. We are continuously improving the excellence of our operational and quality systems. All stages of our production lines are closely monitored and controlled using the highest quality standards.

Quality Management

OEM & Bulk solutions

DNA AmplificationPCR Enzymes

PCR Components/Supplements

PCR Master Mixes

5

| 6

DNA AmplificationNZYTech DNA Polymerases & Buffers

NZYTaq DNA polymerase

NZYTaq with 5× Gel Load

Reaction Buffer

NZYTaq 5× Optimizer Solution

NZYTaq 2× GC-Enhancer

Solution

NZYSpeedy DNA

polymerase

Supreme NZYTaq DNA polymerase

NZYLong DNA

polymerase

NZYProof DNA

polymerase

NZYSpeedy Proof DNA polymerase

Features

TemplateLength 0-3 kb 0-3 kb 0-3 kb 0-3 kb 0-3 kb 0-3 kb 0-15 kb 0-10 kb 0-3 kb

Proofreading Activity • •Hot-start like Capacity •Available as Mixes • • •Speed 1

min/kb1

min/kb n/a n/a 5sec/kb

1min/kb

1.3min/kb

1 min/kb

15 sec/kb

Blunt or 3’-A Ends 3´-A 3´-A n/a n/a 3´-A 3´-A Mixed Blunt Blunt

Applications

Low-Copy Templates • •GC-Rich Templates •Difficult Templates • •Long-Range PCR •Routine PCR • • •High-Fidelity PCR • •Site-Directed Mutagenesis •Fast PCR • •Direct Gel Load •Blunt-End cloning • •TA Cloning • • • • •

7 |

NZYTech PCR Master MixesNZYTaq 2x

Colourless Master Mix(*)NZYTaq 2x

Green Master Mix(*)Supreme NZYTaq 2x Green Master Mix(*)

NZYLong 2x Green Master Mix

Features

Template Length 0-3 kb 0-3 kb 0-3 kb 0-15 kb

Hot-start like Capacity •Speed 1

min/kb1

min/kb1

min/kb1.3

min/kb

Blunt or 3’-A Ends 3´-A 3´-A 3´-A Mixed

Applications

Low-Copy Templates •GC-Rich Templates • •Long-Range PCR •Routine PCR • • • •Colony PCR • • • •Direct Gel Load • • •TA Cloning • • • •

(*) also available with separate MgCl2

| 8

!

> Fast amplification (5 sec/kb)

> Leaves an A overhang

Speedy Polymerase

> Ideal for routine use

DNA Amplification

Conventional Polymerase

NZYTaq DNA polymerase is a recombinant modified form of Taq DNA polymerase purified from Escherichia coli suitable to amplify target DNA sequences up to 3 kb in size. NZYTaq can be provided with 5× Gel Load Reaction Buffer that allows reactions to be loaded directly onto agarose gels. NZYSpeedy DNA polymerase is a recombinant thermostable enzyme displaying a faster polymerization reaction than any other conventional non-proofreading enzyme. It is suitable to amplify target DNA sequences up to 3 kb in size and very useful for fast routine DNA amplifications or genotyping.

PCR Enzymes

NZYTaq DNA Polymerase

MB00101 500 U 31.00 €

MB00102 1000 U 58.00 €

MB00103 2500 U 140.00 €

M 20 5 2.5 1.25 0.63 (Units)

Purity of NZYTaq DNA polymerase.

NZYTaq with 5x Gel Load Reaction BufferMB03801 500 U 41.00 €

MB03802 1000 U 77.00 €

MB03803 2500 U 187.00 €

NZYSpeedy DNA Polymerase MB10801 125 U 16.00 €

MB10802 500 U 62.00 €

Speedy Polymerase

M - NZYDNA Ladder III - MB0441-4 - Amplification of a 1 kb fragment, using 5-fold E. coli genomic DNA dilution ranging from 20 to 0.16 ng/μL, with NZYTaq DNA polymerase and 5x Gel Load Reaction Buffer.

M 1 2 3 4

9 |

! > Hot-start-like activity

> High specificity amplification

Hot-start-likeactivity

Supreme NZYTaq DNA polymerase is a recombinant modified form of Taq DNA polymerase with a hot-start-like PCR capacity. The enzyme is inactive at room temperature, avoiding extension of non-specifically annealed primers or primer-dimers and therefore providing a higher specificity for DNA amplification.NZYLong DNA polymerase is an optimized polymerase designed to successfully amplify target DNA sequences up to 15 kb in size. This polymerase has higher fidelity than Taq and the PCR products have an A overhang so it is suitable for TA cloning.

Supreme NZYTaq DNA polymerase

MB07901 500 U 69.00 €

MB07902 1000 U 131.00 €

MB07903 2500 U 317.00 €

PCR Enzymes

M - NZYDNA Ladder I - MB0411 - 200 pg Sheep genomic DNA2 - 100 pg Sheep genomic DNA3 - 50 pg Sheep genomic DNA4 - 25 pg Sheep genomic DNA5 - No template control

M M1 12 23 34 45

Supreme NZYTaq DNA polymerase

Competitor hot-start-like enzyme

Long-range

NZYLong DNA polymerase

MB00301 125 U 36.00 €

MB00302 500 U 132.00 €

MB00303 1000 U 250.00 €

M 1 2 3M - NZYDNA Ladder III (MB044)1 - 5 kb DNA fragment 2 - 10 kb DNA fragment 3 - 15 kb DNA fragment

| 10

> Suitable for site-directed mutagenesis!

Speedy Proof

> Fast amplifications (15 sec/kb)

> Proofreading activity

!

High-fidelity

qPCR

NZYProof DNA polymerase

MB14601 125 U 56.00 €

MB14602 500 U 207.00 €

MB14603 1000 U 393.00 €

NZYSpeedy Proof DNA polymeraseMB10901 125 U 73.00 €

MB10902 500 U 271.00 €

PCR Enzymes

NZY qPCR 2x Master Mixes

MB18401 2 mL (200 x 20 µL reactions) 90.00€

MB18402 5 mL (500 x 20 µL reactions) 226.00€

MB18403 20 mL (2000 x 20 µL reactions) 760.00€

NZYTech qPCR Master Mixes have been developed for fast, reproducible real-time PCR, and validated for the most part of the known real-time apparatus. These mixes are specially designed to be used with probe-detection technology and molecular beacons probes. The combination of an optimized formulation of the reaction buffer together with a hot-start-like polymerase ensures that these mixes provide fast, specific and sensitive DNA amplifications.

High-fidelity DNA polymerases are important for applications in which the DNA sequence needs to be amplified with a reduced number of errors. High-fidelity DNA polymerases from NZYTech offer increased yield in DNA amplification. NZYProof DNA polymerase is suitable for site-directed mutagenesis. NZYSpeedy Proof DNA polymerase combines high proofreading with high-speed.

NZY qPCR mixes

> 20 μL reactions

> Heat-activated polymerase

!

M - NZYDNA Ladder III - MB0441 - 350 bp sheep genomic DNA, 120 ng2 - 1 kb E. coli genomic DNA, 100 ng3 - 2 kb plasmid DNA, 10 ng

M 1 2 3

11 |

> Extended shelf-life!

PCR Enhancers

> Helps amplifying difficult templates

> Decreases template Tm in high GC content

!Enhancers

NZYTech dNTPs are supplied as lithium salts in purified water and are available as a set of separate ready-to-use dNTPs at 100 mM or as mixes at 10 mM or 25 mM concentrations.We also provide supplements to optimize PCR conditions with NZYTaq DNA polymerase: NZYTaq 5× Optimizer Solution, a stabilizer to increase amplification yield, and NZYTaq 2× GC-Enhancer Solution, developed to overcome difficulties in the amplification of GC-rich DNA templates.

NZYTaq 5x Optimizer Solution

MB06001 1 mL 51.00 €

MB06002 3 x 1 mL 143.00 €

NZYTaq 2x GC-Enhancer Solution

MB14301 1 mL 51.00 €

MB14302 5 x 1 mL 143.00 €

PCR Components/Supplements

dNTPs dNTPs NZYSet

MB08701 100 mM (4 x 0.25 mL) 69.00 €

dNTPs NZYMix

MB08601 25 mM, 1 mL 67.00 €

MB08602 25 mM, 5 mL 328.00 €

MB08603 10 mM, 0.2 mL 10.00 €

MB08604 10 mM, 1 mL 38.00 €

MB08605 10 mM, 5 mL 169.00 €

M - NZYDNA Ladder I - MB0411 - Human genomic DNA fragment with 77.2% of GC content2 - Human genomic DNA fragment with 66.4% of GC content3 - Human genomic DNA fragment with 68.7% of GC content4 - Human genomic DNA fragment with 72.9% of GC content5 - Human genomic DNA fragment with 77.6% of GC content6 - Human genomic DNA fragment with 65.7% of GC content

1 M2 13 24 35 46 5 6

NZYTaq DNA polymerase

NZYTaq DNA polymerase plus 2x GC-Enhancer Solution

| 12

Supreme Master Mixes

> Hot-start-like activity

> Difficult templates

> Direct gel loading after PCR

!

NZYTech presents a variety of master mixes containing all PCR components (except primers and template) at optimal concentrations, for efficient DNA amplification. All mixes are formulated in 2x concentrated solutions. Green Master Mixes allow amplification reactions to be loaded directly onto agarose gels. NZYTech also offers Mixes with separate MgCl2, thus allowing PCR optimization in a variety of protocols.

PCR Master Mixes

Hot-start-like activity

Supreme NZYTaq 2x Green Master Mix

MB05402 500 U (100 x 50 µL reactions) 84.00 €

MB05403 1000 U (200 x 50 µL reactions) 157.00 €

MB05405 5000 U (1000 x 50 µL reactions) 684.00 €

Supreme NZYTaq 2x Green Master Mix, separate MgCl2

MB05502 500 U (100 x 50 µL reactions) 84.00 €

MB05503 1000 U (200 x 50 µL reactions) 157.00 €

MB05504 5000 U (1000 x 50 µL reactions) 684.00 €

Long-range NZYLong 2x Green Master Mix

MB13901 100 U (20 x 50 µL reactions) 43.00 €

MB13902 500 U (100 x 50 µL reactions) 196.00 €

MB13903 1000 U (200 x 50 µL reactions) 360.00 €

Colony PCR using NZYLong 2x Green Master Mix. The assay was performed for 96 single colonies obtained from 96 cloning reactions. Colonies were picked directly into the PCR reactions of 25 μL. An initial denaturing step of 20 min at 95 °C was included in the PCR cycling program.

Conventional NZYTaq Master Mixes

NZYTaq 2x Colourless Master Mix

MB04002 500 U (100 x 50 µL reactions) 47.00 €

MB04003 1000 U (200 x 50 µL reactions) 86.00 €

MB04004 5000 U (1000 x 50 µL reactions) 375.00 €

NZYTaq 2x Colourless Master Mix, separate MgCl2

MB04902 500 U (100 x 50 µL reactions) 47.00 €

MB04903 1000 U (200 x 50 µL reactions) 86.00 €

MB04904 5000 U (1000 x 50 µL reactions) 375.00 €

NZYTaq 2x Green Master Mix

MB03902 500 U (100 x 50 µL reactions) 47.00 €

MB03903 1000 U (200 x 50 µL reactions) 86.00 €

MB03905 5000 U (1000 x 50 µL reactions) 375.00 €

NZYTaq 2x Green Master Mix,separate MgCl2

MB04802 500 U (100 x 50 µL reactions) 47.00 €

MB04803 1000 U (200 x 50 µL reactions) 86.00 €

MB04804 5000 U (1000 x 50 µL reactions) 375.00 €

RNA/cDNARNA Products

cDNA Synthesis

cDNA Synthesis kits

13

| 14

> T7 RNA polymerase ca-talyses the 5’-3’ synthesis of RNA from ribonucleoside triphosphates on single or double stranded DNA down-stream from a T7 promoter

! > Inhibitor of RNases A, B and C

> Protects RNA at temperatures up to 55 °C

RNA/cDNANZYTech presents a diverse range of products dedicated to RNA analysis. Since RNA is very susceptible to degradation, a correct handling and storage of this nucleic acid is essential. NZYTech offers innovative reagents that will help our clients to correctly handle RNA preparations. A reagent to maintain a cleaned work area and an inhibitor of RNases, both are included in our portfolio.

RNA Products

RNase cleaning

RNase Cleaner

MB16001 500 mL 75.00 €

RNA extraction

NZYol

MB18501 100 mL 89.00 €

Ribonuclease inhibitor

NZY Ribonuclease Inhibitor

MB08401 2500 U 43.00 €

MB08402 5 x 2500 U 196.00 €

RNA polymerase

T7 RNA polymerase

MB08001 10000 U (20 U/µL) 43.00 €

MB08002 30000 U (20 U/µL) 119.00 €

MB08003 10000 U (200 U/µL) 43.00 €

MB08004 30000 U (200 U/µL) 119.00 €

15 |

cDNA Synthesis

cDNA primers

> Oligo (dT)18 is frequently used when cDNA is used for cloning or RT-PCR

> Random hexamers are normally used in cDNA for RT-PCR, especially when PCR primers targets a RNA region at 5’-end

> Optimal activity at 37 ºC

NZY Reverse Transcriptase

> Thermostable, working temperature range 50-60 ºC

> Synthesizes cDNA from RNA or ssDNA in 30 minutes

> Ideal for high GC content templates

!

!

RNase H NZY RNase H (E. coli)

MB08501 250 U 43.00 €

MB08502 1250 U 196.00 €

Oligo dT & random hexamers

Oligo (dT)18 primer mix

MB12801 27 µg (100 µL) 57.00 €

Random hexamer mix

MB12901 25 µg (500 µL) 33.00 €

NZY Reverse Transcriptase

MB12401 20000 U 88.00 €

MB12402 100000 U 401.00 €

Reversetranscriptases

NZY M-MuLV Reverse Transcriptase

MB08301 20000 U 66.00 €

MB08302 100000 U 301.00 €

NZY Reverse Transcriptase1 - PCR product using 50 ng cDNA2 - PCR product using 10 ng cDNA 3 - PCR product using 2 ng cDNA4 - PCR product using 0.4 ng cDNA5 - PCR product using 0.08 ng cDNA 6 - PCR product using 0.016 ng cDNA

1 42 53 6 1 42 53 6

Competitor

NZYTech offers a comprehensive set of products for the reverse transcription of RNA to cDNA. NZY M-MuLV Reverse Transcriptase and NZY Reverse Transcriptase (with no intrinsic RNase H activity) both synthesize cDNA from RNA or ssDNA and give high yields of first-strand cDNA up to 7 kb. All these products are manufactured and packaged under rigorous conditions to ensure that they are RNase and DNase free.

| 16

! > Ideal for high GC-rich tem-plates due to the optimum ac-tivity at 50 ºC

> Starting material can range from 1 ng up to 5 µg of RNA

> High yields of full-length cDNA product

! > Cost-effective, convenient and reliable

NZYTech offers convenient, reliable and cost-effective kits to generate high quality cDNA for any downstream application, such as standard PCR, cDNA library construction, or RT-qPCR and two-step RT-PCR assays. The NZY First-Strand cDNA Synthesis Kit contains all the components required to synthesize first-strand cDNA, except the template RNA. It includes a mixture of the NZY Ribonuclease Inhibitor and the thermostable enzyme NZY Reverse Transcriptase. Since the working temperature range of NZY Reverse Transcriptase is 50-60 °C, the kit is ideal for high GC-content templates. The NZY M-MuLV First-Strand cDNA Synthesis Kit is a cost-effective kit providing equal yields of full-length cDNA product at a low reaction temperature, 37 ºC. NZYTech provides three versions of each kit: - Primers mix included. Oligo (dT)18 and random hexamers included in NZYRT 2x Master Mix.- Separate primers. The Oligo (dT)18 and random hexamers are provided in separate tubes.- Without primers. This allows a bigger flexibility since it is mainly to be used with gene-specific primers (GSPs).

cDNA Synthesis kits

NZY First-Strand cDNA Synthesis Kit

NZY First-Strand cDNA Synthesis Kit

MB12501 50 reactions 165.00 €

MB12502 250 reactions 755.00 €

NZY First-Strand cDNA Synthesis Kit, separate oligos

MB17001 50 reactions 165.00 €

MB17002 250 reactions 755.00 €

NZY First-Strand cDNA Synthesis Kit, no oligos

MB17101 50 reactions 148.00 €

MB17102 250 reactions 679.00 €

NZY cDNA synthesis kit

NZY M-MuLV First-Strand cDNA Synthesis Kit

NZY M-MuLV First-Strand cDNA Synthesis Kit

MB17201 50 reactions 125.00 €

MB17202 250 reactions 572.00 €

NZY M-MuLV First-Strand cDNA Synthesis Kit, separate oligos

MB17301 50 reactions 125.00 €

MB17302 250 reactions 572.00 €

NZY M-MuLV First-Strand cDNA Synthesis Kit, no oligos

MB17401 50 reactions 112.00 €

MB17402 250 reactions 498.00 €

NZY M-MuLV cDNA synthesis kit

1 - PCR product of 50 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit2 - PCR product of 10 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit3 - PCR product of 2 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit4 - PCR product of 0.4 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit5 - PCR product of 0.08 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit6 - PCR product of 0.016 ng of cDNA synthesized with NZY-RT 1st-strand cDNA kit 7 - No template control

1 2 3 4 5 6 7

DNA/RNA PurificationPlasmid purification

Genomic DNA purification

DNA clean-up

RNA purification

17

| 18

NZYTech provides eight DNA/RNA Purification kits to cover nucleic acid extraction from a wide range of starting materials. Our kits are designed for fast, simple and efficient isolation of DNA and RNA molecules from a wide range of biological materials and before downstream analysis.Most kits are based on a filter membrane spin column technology which allows an easy protocol for nucleic acid purification. NZYTech provides versions of NZY Tissue and NZY Blood gDNA Isolation kits which include the RNase A for an efficient removal of RNA contaminants.NZY Total RNA Isolation kit includes optimized wash buffers for higher RNA quality (A260/A230 ratio) and the removal of genomic DNA is also improved for best results in your downstream applications.

DNA/RNA Purification

NZYTech DNA/RNA Purification Kits

Ani

mal

Tis

sue

Rod

ent T

ail

Par

affin

Em

bedd

ed

Tiss

ue

Cul

ture

d ce

lls

Buc

cal S

wab

s

Bac

teria

l cel

ls

Feca

l mat

eria

l

Who

le b

lood

, ser

um,

plas

ma,

bod

y flu

ids

Pla

nt/F

ungi

Tis

sue

TAE

/TB

E g

el

PC

R p

rodu

cts

Enz

ymat

ic re

actio

ns

DNA Kits

NZYMiniprep plasmid •NZYMidiprep plasmid •NZYMaxiprep plasmid •NZYGelpure • • •NZY Tissue gDNA • • • • • • •NZY Blood gDNA •NZY Plant/Fungi gDNA •RNA Kits

NZY Total RNA • • •

19 |

Purified DNA usable in

> In vitro transcription

> DNA sequencing

> Hybridization

!

NZYTech provides kits for the rapid preparation of highly pure plasmid DNA from recombinant Escherichia coli strains at different scales (NZYMiniprep, NZYMidiprep and NZYMaxiprep). The purified plasmid DNA is suitable for use in the most demanding molecular biology applications. A new version of NZYMiniprep in 96-well format is available for high-throughput demands.Buffers for plasmid purification kits, columns and RNase A are also sold in separate for your convenience. Regarding NZYMidiprep and NZYMaxiprep, NZYTech provides a format only with the buffers (no columns).

Plasmid purification

NZYMiniprep

MB01001 50 columns 56.00 €

MB01009 2 x 50 columns 105.00 €

MB01002 200 columns 195.00 €

MB01008 5 x 200 columns 891.00 €

NZYMiniprep 96 well plate

MB01012 1 plate 149.00 €

MB01013 4 plates 548.00 €

Miniprep

Midiprep NZYMidiprep

MB05003 5 columns 35.00 €

MB05004 20 columns 125.00 €

MB05005 3 x 20 columns 354.00 €

Maxiprep NZYMaxiprep

MB05101 5 columns 60.00 €

MB05102 2 x 5 columns 111.00 €

MB05103 5 x 5 columns 263.00 €

NZY RNase A

MB18701 100 mg 20.00 €

RNase A

Kit components

Buffers+ MB14201 5 preps 30.00 €

Columns* MB05104 5 units 52.00 €

Columns* MB05105 4x5 units 190.00 €

Kit components

Buffers+ MB14101 20 preps 63.00 €

Columns* MB05006 5 units 24.00 €

Columns* MB05007 4x5 units 88.00 €

Kit components

Buffer A1 MB01003 60 mL 20.00 €

Buffer A2 MB01004 60 mL 37.00 €

Buffer A3 MB01005 80 mL 41.00 €

Buffer AY MB01006 120 mL 51.00 €

Buffer A4 MB01007 25 mL 37.00 €

Columns* MB01010 50 units 40.00 €

Columns* MB01011 4x50 units 138.00 €

*NZYTech Spin Columns & Collection Tubes

+NZYMidiprep, no columns*NZYTech Plasmid Midi Columns

+NZYMaxiprep, no columns*NZYTech Plasmid Maxi Columns

M - NZYDNA Ladder III (MB044)

NZYTech Midiprep

Competitor Midiprep

M

| 20

> RNase A included!

Benefits

> Different sources: animal tissue, cul-tured cells, bacteria cells, mouse tails, yeast, stool, forensic and clinic samples

> Yields up to 35 µg/column

> RNase A included

!

Benefits

> Ready-to-use DNA in less than 30 min

> Yields up to 4-6 μg/column

> RNase A included

!NZY Blood gDNA Isolation kit

MB13602 50 columns 104.00 €

MB13603 200 columns 384.00 €

NZY Plant/Fungi gDNA Isolation kit

MB17701 50 columns 118.00 €

MB17702 4 x 50 columns 436.00 €

Blood

Plant/Fungi

NZY Tissue gDNA Isolation kit, NZY Blood gDNA Isolation kit and NZY Plant/Fungi gDNA Isolation kit are three spin column silica-based systems designed for the simple and rapid small-scale purification of genomic DNA from various sources. Purified DNA is of the highest quality and integrity and is suitable for use in the most sensitive downstream applications.

Genomic DNA purification

NZY Tissue gDNA Isolation kit

MB13502 50 columns 104.00 €

MB13503 200 columns 384.00 €

Tissue

Lysozyme from Chicken Egg White, Salt Free

MB16201 1 g 52.00 €

21 |

> Includes a pH indicator, allow-ing evaluation of optimal pH for DNA binding

Benefits

> Complete removal of gDNA

> Rapid procedure

> High purity RNA

> Yields up to 70 µg depending on the sample

!

NZYGelpure kit is designed for the purification of DNA from TAE/TBE agarose gels and for the direct purification of PCR products. The kit can be used to purify DNA fragments from 100 bp to 10 kb. NZYGelpure purification kit utilizes a silica-gel based membrane which selectively adsorbs up to 20 µg of DNA fragments in the presence of specialized binding buffers. Soluble agarose, nucleotides, oligos (<30-mer), enzymes, mineral oil and other impurities do not bind to the membrane and are washed away. DNA fragments are then eluted off the column and can be used for downstream protocols without further processing. A new version of NZYGelpure in 96-well format is available for high-throughput demands.

DNA Clean-Up

NZYGelpure

MB01101 50 columns 58.00 €

MB01104 2 x 50 columns 109.00 €

MB01102 200 columns 198.00 €

MB01103 5 x 200 columns 948.00 €

Clean-Up

NZY Total RNA Isolation kit

MB13402 50 columns 168.00 €

NZYGelpure 96 well plate

MB01105 1 plate 92.00 €

MB01106 4 plates 337.00 €

RNA Isolation

NZY Total RNA Isolation kit is designed for the easy and fast purification of total RNA of highest integrity from a variety of sources such as animal tissues, cultured cells and bacterial cells. NZY Total RNA Isolation kit has been recently improved for more efficient total RNA isolation. The kit includes optimized wash buffers for higher RNA quality (A260/A230 ratio) and the removal of genomic DNA is also improved for the best results in your downstream applications.

RNA Purification

NZYol

MB18501 100 mL 89.00 €

M - NZYDNA Ladder III - MB0441, 2 - 2 kb DNA fragment purification using NZYGelpure3, 4 - 2 kb DNA fragment using a competitor kit5, 6 - 3 kb DNA fragment purification using NZYGelpure7, 8 - 3 kb DNA fragment using a competitor kit

M 1 52 63 74 8

NZYTech Competitor CompetitorNZYTech

NZY DNase I

MB19901 200 U/vial 40.00€DNase A

Competent cellsNZY5α

NZYStar

BL21(DE3)

23

| 24

NZY5α properties

> ≥ 109 cfu/µg of pNZY28

> Blue/White screening

> Routine cloning

> Hosting M13mp cloning vectors

!NZY5α

NZYStar

Efficient DNA transformation of competent cells is essential for successful Cloning and Protein Expression applications. NZYTech offers competent E. coli host strains for high-efficiency transformation.

DescriptionNZY5α Competent Cells have similar properties as DH5α, which are suitable for high efficiency transformation in a wide variety of applications. The φ80dlacZΔM15 marker provides α-complementation of the β-galactosidase gene from pNZY28 or pUC-like vectors or similar vectors and, therefore, can be used for blue/white screening of colonies on bacterial plates containing Blue-gal or X-GAL. The recA1 marker avoids recombination between similar or identical sequences, improving insert stability. The endA1 phenotype allows production of high-quality plasmid DNA. NZY5α can also serve as a host for the M13mp cloning vectors.

GenotypefhuA2Δ(argF-lacZ)U169 phoA glnV44 φ80 Δ(lacZ)M15 gyrA96recA1 relA1 endA1 thi-1hsdR17

DescriptionNZYStar Competent Cells are suitable for general cloning protocols and for the construction of gene banks or the generation of cDNA libraries using plasmid-derived vectors. Tetracycline ensures that the selectable F’ containing lac Z Δ M15 is maintained and thus eliminates the background of non-recombinant white colonies which have lost the F’. NZYStar Competent Cells are lacI and require IPTG to induce expression from the lac promoter. The recA1 and endA1 markers minimize recombination and enhance the quality of plasmid DNA.

GenotypeendA1 hsdR17(rk-, mk+) supE44 thi -1 recA1 gyrA96 relA1 lac[F´proA+B+ lacIqZΔM15 :Tn10(TcR)]

Cloning strains

Competent cells

NZY5αMB00401 20 transformations 66.00 €

MB00402 40 transformations 125.00 €

NZYStar

MB00501 20 transformations 73.00 €

MB00502 40 transformations 140.00 € NZYStar properties

> ≥ 109 cfu/µg of pNZY28

> Construction of cDNA libraries/gene banks

> Blue/White screening

> High quality plasmid preparation

!

25 |

BL21(DE3) properties

> ≥ 106 cfu/µg of pNZY28

> High level protein expression

> Expression system based on T7 promoter

> Deficient in peptidases Lon and OmpT

!

BL21(DE3)

Preparation buffer

NZYCompetent Cells Preparation Buffer is designed for the preparation of super competent Escherichia coli cells. The method is compatible with the classical heat shock transformation procedure and the transformation efficiencies are typically on the order of 108-109 transformants/μg plasmid DNA with the most common E. coli strains.

DescriptionBL21(DE3) Competent Cells are chemically competent Escherichia coli cells used for protein expression in T7 RNA polymerase-based systems. These cells are resistant to the lytic bacteriophages T1 and T5. The BL21(DE3) strain is a E. coli B derivative. It is deficient in both lon and ompT proteases genes resulting in superior isolation of intact recombinant proteins. The host is a lysogen of DE3 and, therefore, carries a chromosomal copy of the T7 RNA polymerase gene that is controlled by the lacUV5 promoter. The strain utilizes the T7 RNA promoter to control protein expression. IPTG is used to induce expression of the T7 RNA polymerase.

GenotypeF¯ ompT gal dcm lon hsdSB(rB- mB-) λ(DE3 [lacI lacUV5-T7 gene1 ind1 sam7 nin5])

Expression strain

Competent cells preparation

BL21(DE3)

MB00601 20 transformations 70.00 €

MB00602 40 transformations 133.00 €

NZYCompetent Cells Preparation Buffer

MB12001 100 mL 90.00 €

M - Low Molecular Weight Protein Marker (MB082)1 to 6 - Expression project using BL21(DE3) as host strain for recombinant protein expression. High levels of recombinant protein were obtained.

M M1 2 3 4 5 6M M

DNA CloningCloning enzymes

DNA cloning kits

27

| 28

T4 DNA Ligase

SpeedyLigase

Phosphatase

Klenow

Kinase

NZYTech offers cloning enzymes for several purposes. Speedy Ligase is a T4 DNA Ligase derivative developed to carry out fast (less than 15 minutes) and efficient ligation of sticky or blunt-end DNA at room temperature.

Cloning enzymes

T4 DNA Ligase

MB00703 500 U 36.00 €

MB00704 2500 U 163.00 €

Speedy Ligase

MB13001 50 ligations 63.00 €

MB13002 100 ligations 119.00 €

Alkaline Phosphatase (E. coli)

MB01801 200 U 82.00 €

Klenow Fragment of DNA Polymerase I

MB00901 300 U 69.00 €

T4 Polynucleotide Kinase (T4 PNK)

MB00801 500 U 69.00 €

DNA Cloning

29 |

TA cloning kits

> High efficiency cloning (> 95% positive clones)

> Blue/White screening

> 5 minutes cloning in NZY-A Speedy cloning kit

!

Blunt-end

A-overhang

NZYTech’s DNA cloning kits are optimized to provide high-efficiency cloning based on easy protocols with no requirement for time-consuming restriction digests. To clone PCR-amplified fragments take into account the type of DNA polymerase that was used and choose the appropriate cloning kit: NZY-blunt PCR cloning kit or NZY-A PCR cloning kit. For a fast DNA cloning choose the speedy version of NZY-A PCR cloning kit (NZY-A Speedy PCR cloning kit).

NZY-blunt PCR cloning kit was designed by NZYTech to allow the direct cloning of PCR products with blunt ends which result from amplifications using proofreading DNA polymerases such as NZYProof DNA polymerase.

NZY-A PCR cloning kits are designed to clone PCR products produced by non-proofreading DNA polymerases such as NZYTaq DNA polymerase. They take advantage of the terminal transferase activity of these polymerases which add a single 3’-A overhang to each end of the PCR product. For a fast DNA cloning, NZYTech provides the NZY-A Speedy PCR cloning kit which allows direct cloning of PCR products with 3´-A overhangs in only 5 minutes at room temperature. Blunt-ended PCR fragments generated by amplification with proofreading polymerases can also be cloned using NZY-A PCR cloning kits after conducting an A-tailing procedure.

DNA Cloning kits

NZY-blunt PCR cloning kit

MB12101 24 ligations + comp. cells 180.00 €

MB12102 24 ligations 112.00 €

NZY-A PCR cloning kit

MB05301 24 ligations + comp. cells 182.00 €

MB05302 24 ligations 100.00 €

NZY-A Speedy PCR cloning kit

MB13701 24 ligations + comp. cells 19900 €

MB13702 24 ligations 142.00 €

| 30

PCR with proofreading polymerase

PCR with proofreading polymerase

A AG C T TG A AT TCC TG C AG G TCG AC TC TAG AG G ATCC AC TAG TC ATATG G ATATC G G ATCCCCG G G TACCG AG C TCG A AT TC

Hind III EcoR I Pst I Sal I Xba I BamH I Spe I Nde I EcoR V BamH I Sma I Kpn I Sac I EcoR I

T7 promoter sequencing primer5’ TAATACGACTCACTATAGGG 3’

M13/pUC U19-mer sequencing primer5’ GTTTTCCCAGTCACGACGT 3’

M13pUC reverse sequencing primer5’ GAGCGGATAACAATTTCACACAGG 3’

DNA Template

A-overhang Blunt-end

NZY-A PCR cloning kitNZY-A Speedy PCR cloning kit

NZY- blunt PCR cloning kit

PCR with non-proofreading

polymerase

PCR with non-proofreading

polymerase

Tailing reactionTailing reaction

Cloning scheme

pNZY28Vector map

Kit selection guide

DNA MutagenesisNZYMutagenesis kit

31

| 32

> Efficient mutagenesis in plasmids up to 15 kb!

> Primers should have a GC content of 40% and should terminate in one or more C or G bases

1. Mutated primer design

2. PCR using a proofreading polymerase

3. Parental DNA digestion with Dpn I

Parental DNA Mutated DNA

New Plasmid

Mutagenesis kit

NZYMutagenesis kit provides a simple and highly efficient method to generate point mutations and delete or insert single (or multiple) nucleotides in any type of plasmid DNA using PCR. This kit contains NZYProof DNA polymerase for PCR amplification of dsDNA plasmid to be mutated. NZYProof DNA polymerase ensures high fidelity for the exponential PCR amplification, thus reducing the unwanted secondary mutations and enabling amplification of large plasmids up to 15 kb. The system requires the provision of two synthetic oligonucleotide primers containing the desired mutation. The mutagenesis protocol includes only three steps: 1. Mutated primer design - Primers should have between 25 and 45 bases in length, with a melting temperature (Tm) of ≥78 ºC;

2. PCR amplification - Incorporation of the oligonucleotide primers with NZYProof DNA polymerase which generates a mutated plasmid containing staggered nicks;

3. Digestion with Dpn I – Digestion of PCR product with Dpn I endonuclease for elimination of the parental methylated and hemi-methylated DNA template and selection of the mutation-containing synthetic DNA (not methylated).

NZYTech provides convenient versions of the kit which include highly efficient competent cells for recovering of the mutated plasmid.

DNA Mutagenesis

NZYMutagenesis kit

MB01201 10 mutations 98.00 €

MB01202 10 mut. + comp. cells 120.00 €

MB01203 24 mutations 221.00 €

MB01204 24 mut. + comp. cells 271.00 €

RestrictionenzymesConventional

Fast digestion

Packs

33

| 34

Conventional

NZYTech offers a portfolio of the most common restriction endonucleases purified from Escherichia coli strains. We present two different types of enzymes: Conventional and Fast Digestion. Each conventional restriction enzyme is provided with a specific reaction buffer in which the enzyme is 100% active. For double digestions we recommend the use of 10x NZYBuffer U (sold separately). Fast digestion enzymes are a new generation of DNA modifying enzymes that were developed for rapid DNA digestion and are all 100% active in the 10x NZYSpeedy Buffers Colourless or Orange.Our portfolio also includes the NZYTech Restriction Enzymes Speedy Pack which is a collection of 10 Fast Digestion Enzymes supplied with 10x NZYSpeedy Buffer Orange.

Restriction Enzymes

Conventional restriction enzymes

Apa I(5’ - GGGCC’C - 3’)

MB06201 1000 U 10.00 €

MB06202 5000 U 47.00 €

BamH I(5’ - G’GATCC - 3’)

MB06401 2000 U 10.00 €

MB06402 10000 U 47.00 €

Bgl II(5’ - A’GATCT - 3’)

MB06501 1000 U 26.00 €

MB06502 5000 U 116.00 €

Dpn I(5’ - G(mA)’TC - 3’)

MB07801 100 U 10.00 €

MB07802 1000 U 66.00 €

EcoR I(5’ - G’AATTC - 3’)

MB06701 5000 U 10.00 €

MB06702 25000 U 47.00 €

EcoR V(5’ - GAT’ATC - 3’)

MB06801 2000 U 39.00 €

MB06802 10000 U 136.00 €

Hind III(5’ - A’AGCTT - 3’)

MB07001 5000 U 20.00 €

MB07002 25000 U 93.00 €

Hpa I(5’ - GTT’AAC - 3’)

MB07101 500 U 33.00 €

MB07102 2500 U 149.00 €

Kpn I(5’ - GGTAC’C - 3’)

MB07201 2000 U 27.00 €

MB07202 10000 U 127.00 €

Nco I(5’ - C’CATGG - 3’)

MB06601 500 U 26.00 €

MB06602 2500 U 116.00 €

Nde I(5’ - CA’TATG - 3’)

MB06901 500 U 10.00 €

MB06902 2500 U 47.00 €

Nhe I(5’ - G’CTAGC - 3’)

MB06301 500 U 23.00 €

MB06302 2500 U 107.00 €

CciN I (Not I)(5’ - GC’GGCCGC - 3’)

MB15301 500 U 39.00 €

MB15302 2500 U 179.00 €

Nt. BbvCl, Nicking Endonuclease(5’ - CC’TCAGC - 3’)

MB09401 1000 U 56.00 €

MB09402 5000 U 194.00 €

Pst I(5’ - CTGCA’G - 3’)

MB07301 4000 U 21.00 €

MB07302 20000 U 98.00 €

Sal I(5’ - G’TCGAC - 3’)

MB07701 2000 U 41.00 €

MB07702 10000 U 187.00 €

Sfi I(5’ - GGCCNNNN’NGGCC - 3’)

MB14901 1000 U 39.00 €

Xho I(5’ - C’TCGAC - 3’)

MB07401 2000 U 26.00 €

MB07402 10000 U 116.00 €

35 |

Speedy Fast digestion restriction enzymes

Speedy Apa I(5’ - GGGCC’C - 3’)

MB09101 100 reactions 12.00 €

MB09102 500 reactions 56.00 €

Speedy BamH I(5’ - G’GATCC - 3’)

MB09201 200 reactions 12.00 €

MB09202 1000 reactions 56.00 €

Speedy Bgl II(5’ - A’GATCT - 3’)

MB09301 100 reactions 31.00 €

MB09302 500 reactions 140.00 €

Speedy EcoR I(5’ - G’AATTC - 3’)

MB09501 500 reactions 12.00 €

MB09502 2500 reactions 56.00 €

Speedy EcoR V(5’ - GAT’ATC - 3’)

MB09601 100 reactions 47.00 €

MB09602 500 reactions 163.00 €

Speedy Hind III(5’ - A’AGCTT - 3’)

MB09701 500 reactions 24.00 €

MB09702 2500 reactions 112.00 €

Speedy Hpa I(5’ - GTT’AAC - 3’)

MB09801 50 reactions 39.00 €

MB09802 250 reactions 179.00 €

Speedy Kpn I(5’ - GGTAC’C - 3’)

MB09901 100 reactions 33.00 €

MB09902 500 reactions 153.00 €

Speedy Nco I(5’ - C’CATGG - 3’)

MB10001 50 reactions 47.00 €

MB10002 250 reactions 215.00 €

Speedy Nde I(5’ - CA’TATG - 3’)

MB10101 50 reactions 12.00 €

MB10102 250 reactions 56.00 €

Speedy Nhe I(5’ - G’CTAGC - 3’)

MB10201 50 reactions 29.00 €

MB10202 250 reactions 129.00 €

Speedy CciN I (Not I)(5’ - GC’GGCCGC - 3’)

MB15401 50 reactions 31.00 €

MB15402 250 reactions 139.00 €

Speedy Pst I(5’ - CTGCA’G - 3’)

MB10301 400 reactions 26.00 €

MB10302 2000 reactions 117.00 €

Speedy Sal I(5’ - G’TCGAC - 3’)

MB10401 200 reactions 49.00 €

MB10402 1000 reactions 223.00 €

Speedy Sfi I(5’ - GGCCNNNN’NGGCC - 3’)

MB15001 100 reactions 47.00 €

Speedy Xho I(5’ - C’TCGAG - 3’)

MB10701 200 reactions 31.00 €

MB10702 1000 reactions 140.00 €

| 36

NZYTech Restriction Enzymes Speedy Pack is a collection of 10 enzymes supplied with 10x NZYSpeedy Buffer Orange. NZYTech’s Speedy restriction enzymes are a new generation of DNA modifying enzymes developed for rapid DNA digestion. All Speedy enzymes are 100% active in the NZYSpeedy Buffer Orange and are able to digest DNA in 5-15 minutes. This buffer is universal and enables any combination of NZY Speedy restriction enzymes to work simultaneously. It’s ideal for double or multiple digestions, eliminating the need for sequential digestions. The buffer also allows ready gel load after digestion.

NZYBuffer U is a universal buffer compatible with all NZYTech’s conventional Restriction Enzymes, ideal for using in double or multiple digestions. Eliminates the need for sequential digestions, thus saving time in the laboratory. NZYBuffer U is also a ready-to-load buffer containing orange G, which allows the direct load of restriction digests onto agarose gels.

Restriction enzymes pack

NZYTech Restriction Enzymes Speedy Pack

MB15101 Starter Pack 58.00 €

MB15102 Advanced Pack 242.00 €

nº of reactionsStarter Advanced

Speedy BamH I 10 200

Speedy Bgl II 10 100

Speedy EcoR I 10 500

Speedy Hind III 10 500

Speedy Hpa I 10 50

Speedy Nco I 10 50

Speedy Nhe I 10 50

Speedy Pst I 10 400

Speedy Sal I 10 200

Speedy Xho I 10 200

10x NZYBuffer U

MB11001 500 µL 10.00 €

MB11002 1000 µL 19.00 €

Universal buffer

DNA Markers

37

| 38

NZYDNA Ladder VI5 µL in 2% agarose

NZYTech offers a ready-to-use set of DNA ladders that enable users to accurately determine the molecular weight of their nucleic acids molecules. These DNA ladders are suitable for standard gel electrophoresis applications and can be used to quantify the acid nucleic concentration based on band intensity.

DNA Markers

1800 - 90

bp - ng/band

1000 - 100800 - 80600 - 90

400 - 60

200 - 30

NZYDNA Ladder I5 µL in 1% agarose

bp - ng/band

10000 - 1007500 - 756000 - 605000 - 504000 - 403000 - 302500 - 252000 - 20

1400 - 14

1000 - 100800 - 80

600 - 60

400 - 40

200 - 20

NZYDNA Ladder III5 µL in 1% agarose

bp - ng/band

10000 - 1007500 - 756000 - 605000 - 504000 - 40

3000 - 30

2500 - 25

2000 - 20

1400 - 14

NZYDNA Ladder II5 µL in 1% agarose

bp

200

500

20

40

6080100

NZYDNA Ladder IV5 µL in 4% agarose

bp - ng/band

1000 - 100 3000 - 60 5000 - 100

2000 - 403000 - 60

2000 - 40

1600 - 85

1000 - 100

1400 - 116

1200 - 65

1000 - 100

800 - 80

900 - 90800 - 80

600 - 110

700 - 70600 - 60

400 - 106

500 - 50400 - 40

200 - 36

300 - 30

200 - 60

100 - 20

900 - 90800 - 80700 - 70600 - 60

500 - 50

400 - 40

300 - 30

200 - 60

100 - 20

NZYDNA Ladder V5 µL in 1.5% agarose

bp - ng/band bp - ng/band bp - ng/band1500 - 401200 - 351000 - 33900 - 30800 - 27700 - 23600 - 20500 - 67450 - 23400 - 27350 - 18300 - 20250 - 25200 - 67

150 - 30

100 - 27

50 - 30

NZYDNA Ladder VIII5 µL in 1% agarose

NZYDNA Ladder VII5 µL in 1.5% agarose

DNA Molecular weight markers

NZYDNALadder I

MB04101 200 lanes (90 µg) 45.00 €

MB04102 500 lanes (225 µg) 105.00 €

NZYDNALadder II

MB04301 200 lanes (83 µg) 48.00 €

MB04302 500 lanes (207 µg) 112.00 €

NZYDNALadder III

MB04401 200 lanes (143 µg) 63.00 €

MB04402 500 lanes (357 µg) 149.00 €

NZYDNALadder IV

MB05801 50 lanes 62.00 €

MB05802 150 lanes 172.00 €

NZYDNALadder V

MB06101 200 lanes (120 µg) 46.00 €

MB06102 500 lanes (300 µg) 108.00 €

NZYDNALadder VI

MB08901 200 lanes (100 µg) 71.00 €

MB08902 500 lanes (250 µg) 168.00 €

NZYDNALadder VII

MB14701 200 lanes (170 µg) 53.00 €

MB14702 500 lanes (425 µg) 122.00 €

NZYDNALadder VIII

MB17501 200 lanes (150 µg) 46.00 €

MB17502 500 lanes (375 µg) 108.00 €

Protein Science

Markers

Western blotting

Reagents

39

| 40

> Ready-to-use solutions

> Comprehensive portfolio for the common western-blot needs

!

> Accurate molecular weight determination for gel filtration

Protein ScienceMarkers

Western blotting

Protein Molecular Weight Markers

Low Molecular Weight (LMW) Protein Marker

MB08201 300 lanes (3 x 0.5 mL) 94.00 €

MB08202 600 lanes (6 x 0.5 mL) 176.00 €

NZYColour Protein Marker IIMB09002 125 lanes (0.5 mL) 151.00 €

MB09003 4 x 125 lanes (4 x 0.5 mL) 548.00 €

NZYBlue Protein MarkerMB17601 125 lanes (0.5 mL) 118.00 €

MB17602 4 x 125 lanes (4 x 0.5 mL) 436.00 €

Membrane Stripping solution, 4x

MB19101 1000 mL 65.00 €

Gel Filtration LMW Protein Marker

MB18801 5 proteins in individual vials 165.00 €

Ponceau S staining solution

MB19201 500 mL 59.00 €

NZY Supreme ECL HRP Substrate

MB19301 100 mL 125.00 €

Albumin Bovine Fraction V (BSA)

MB04601 10 g 12.00 €

MB04602 100 g 96.00 €

MB04603 1000 g 814.00 €

Size (kDa)96

66

4840

32

26

18.5

Low Molecular Weight Protein Marker

Size (kDa)24518013510075

63

48

35

252017

11

NZYColour Protein Marker II

Size (kDa)

45

6072100140180

10

15

2025

35

NZYBlue Protein Marker

NZYTech western blotting reagents cover the standard needs for a successful determination. NZYTech offers not only the dye and the stripping solutions but also the chemiluminescent reagent for the detection. Furthermore, we have in our portfolio the buffers for the SDS-PAGE run and also for the membrane transfer (see next page).

NZYTech provides different protein molecular weight markers: Low Molecular Weight (LMW) Protein Marker (unstained marker), NZYColour Protein Marker II and NZYBlue Protein Marker (prestained markers). All of them are ready-to-use solutions of highly purified proteins for use inmolecular weight estimation in the presence of sodium dodecyl sulphate (SDS) detergent. All markers are supplied in a loading buffer for direct application on gels. A new release is the Gel Filtration LMW Protein Marker, which contains highly purified and well-characterized proteins in a lyophilized format for protein molecular weight determination by gel filtration chromatography.

41 |

NZYBradford reagent

> Ready-to-use solution

> Suitable for micro (1-10 mg/mL) and standard (100-1400 mg/mL) assays

!

Reagents

Running & transfer

Quantification

NZYBradford reagent

MB19801 500 mL 110.00 €

Chemical components

Acrylamide/bis-Acrylamide (29:1 solution) MB04501 500 mL 61.00 €

Acrylamide/bis-Acrylamide (19:1 solution) MB15501 500 mL 61.00 €

Acrylamide/bis-Acrylamide (37.5:1 solution) MB15601 500 mL 61.00 €

Ammonium Persulphate MB03403 100 g 46.00 €

TEMED MB03501 25 mL 22.00 €

SDS (micropellets) MB01501 500 g 86.00 €

SDS (powder) MB18101 500 g 72.00 €

SDS solution 20% MB11601 500 mL 58.00 €

Glycine MB01401 1000 g 36.00 €

Tris base MB01601 1000 g 62.00 €

Running & Transfer components

Tris-Glycine buffer MB19401 1000 mL, 10x 23.00 €

Tris-Glycine-SDS buffer MB19501 1000 mL, 10x 23.00 €

PBS buffer MB18201 for 1000 mL, 10x 25.00 €

CAPS MB19601 100 g 45.00 €

Here you will find easy-to-use products for your standard protein downstream applications such as SDS-PAGE running buffer as well as transfer buffer. Tris-Glycine based buffers and PBS are ready-to-use.

NZYTech offers a ready-to-use Bradford reagent suitable for the accurate determination of protein concentration. The NZYBradford reagent requires no dilution and is suitable for micro, multiwell plate, and standard assays.

Staining & LoadingDNA Staining & Loading

Protein Staining & Loading

43

1% Agarose gel withGreenSafe Premium

1% Agarose gel with GreenSafe Direct Load

| 44

> Works as a sample loading buffer

GreenSafe products

> Non-toxic

> Convenient and ready-to-use

!

NZYTech offers two DNA stains that can be used as a safer alternative to the traditional ethidium bromide (EtBr): GreenSafe Premium and GreenSafe Direct Load. Both have similar sensitivity to EtBr. GreenSafe Premium can be either incorporated in the agarose gels or used as post-staining. GreenSafe Direct Load is designed to be applied directly in the sample(s). It includes a loading dye that allows the sample(s) to be promptly run in an agarose gel.6x NZYDNA loading dye is a convenient ready-to-use buffer to load DNA samples on agarose gels.

GreenSafe Premium

MB13201 1 mL 87.00 €

6x NZYDNA loading dye

MB13101 5 x 1 mL 26.00 €

GreenSafe Direct Load

MB13301 1 mL 78.00 €

For DNA applications

DNA staining

DNA loading

Staining & Loading

Xylene cyanol

Bromophenol blue

Orange G

45 |

> Ready-to-use sample loading buffer

> Contains bromophenol blue dye to mark the front of the gel

BlueSafe

> Non-toxic

> No destaining needed

!

NZYTech recently released BlueSafe, a very sensitive and safe single step protein stain. After running your SDS-PAGE, simply add the stain and watch your bands to appear in a few minutes. There is no need to wash or destain and the background is crystal clear. The product is much safer than Coomassie Blue staining because does not contain any methanol or acetic acid. 5x SDS-PAGE sample loading buffer is ready-to-use in SDS-PAGE and Western blots. The buffer contains bromophenol blue dye to mark the front of the gel.

For protein applications

Proteinstaining

Proteinloading

5x SDS-PAGE sample loading buffer

MB11701 5 x 1 mL 26.00 €

BlueSafe

MB15201 1000 mL 79.00 €

Reagents

Agaroses

Antibiotics

Biochemicals

Buffers

Culture media

Cell lysis buffer

47

| 48

Applications

> Immunodiffusion

> Electrophoresis

> Supports for biocatalysis

> Growth of protein crystals

!

NZYTech offers a range of reagents, mainly for molecular biology applications. These reagents are used in most of molecular biology routines. In these reagents you will find different presentations and even different variations of the same product to better meet the needs of your work.

Reagents

Agarose (routine grade)

MB14401 100 g 35.00 €

MB14402 500 g 148.00 €

MB14403 1000 g 282.00 €

Ampicilin (sodium salt)

MB02101 5 g 19.00 €

MB02102 25 g 48.00 €

MB02103 50 g 85.00 €

Kanamycin (monosulphate)

MB02001 5 g 42.00 €

MB02002 25 g 190.00 €

Agarose (electrophoresis grade)

MB02702 100 g 49.00 €

MB02703 500 g 199.00 €

MB02704 1000 g 389.00 €

Agarose (ultrapure grade)

MB05201 100 g 68.00 €

MB05202 500 g 258.00 €

Agarose (LM-ultrapure grade)

MB12301 100 g 168.00 €

MB12302 500 g 767.00 €

Agarose (pulse-field grade)

MB12201 500 g 289.00 €

Chloramphenicol

MB02402 25 g 51.00 €

Neomycin (sulphate)

MB02302 25 g 42.00 €

Tetracycline (hydrochloride)

MB02202 25 g 40.00 €

Rifampicin

MB16901 1 g 51.00 €

Gentamicin

MB16601 5 g 26.00 €

Carbenicillin

MB16501 5 g 45.00 €

Agaroses

Antibiotics

49 |

Glycine

MB01401 1000 g 36.00 €

Proteinase K

MB01902 500 mg 248.00 €

Acrylamide/bis-Acrylamide (29:1 solution)

MB04501 500 mL 61.00 €

TEMED

MB03501 25 mL 22.00 €

Tris base

MB01601 1000 g 62.00 €

Water for Molecular Biology

MB11101 1000 mL 41.00 €

Ammonium Persulphate

MB03403 100 g 46.00 €

DTT

MB03101 5 g 26.00 €

SDS (micropellets)

MB01501 500 g 86.00 €

SDS solution 20%

MB11601 500 mL 58.00 €

Albumin Bovine Fraction V (BSA)

MB04601 10 g 12.00 €

MB04602 100 g 96.00 €

MB04603 1000 g 814.00 €

X-Gal

MB02501 1 g 32.00 €

MB02502 5 g 148.00 €

IPTG

MB02602 5 g 29.00 €

MB02603 25 g 98.00 €

Biochemicals

Acrylamide/bis-Acrylamide (19:1 solution)

MB15501 500 mL 61.00 €

Acrylamide/bis-Acrylamide (37.5:1 solution)

MB15601 500 mL 61.00 €

SDS (powder)

MB18101 500 g 72.00 €

Sodium Chloride (NaCl)

MB15901 1000 g 12.00 €

D-Glucose Anhydrous

MB16801 1000 g 27.00 €

Sucrose

MB18601 1000 g 85.00 €

Glycerol

MB16101 1000 mL 55.00 €

Urea

MB19701 1000 g 22.00 €

Tween 20 (10% solution)

MB15801 5 vials of 5 mL 65.00 €

Lysozyme from Chicken Egg White, Salt Free

MB16201 1 g 52.00 €

M - Low Molecular Weight (LMW) Protein Marker (MB082)1 - NZY Bacterial Cell Lysis Buffer2 - Sonication3 - Competitor product

M 1 2 3

| 50

Bacterial lysis buffer

> Disrupt cells without mechanical procedures

> Ready-to-use formulation

> Ideal for High-Throughput (HTP) methods

> DNase I and Lysozyme provided separately

!

TE Buffer 10x, pH 7.4

MB11301 1 pouch (1x1000 mL) 29.00 €

EDTA Buffer 0.5 M, pH 8.0

MB11201 1 pouch (1x500 mL) 67.00 €

CAPS

MB19601 100 g 45.00 €

TAE Buffer 50x, pH 8.3

MB11401 1 pouch (1x1000 mL) 195.00 €

TBE Buffer 10x, pH 8.3

MB11501 1 pouch (1x1000 mL) 37.00 €

Buffers

Cell lysisbuffer

HEPES

MB15701 250 g 73.00 €

MB15702 1000 g 193.00 €

MOPS

MB16301 250 g 75.00 €

MB16302 1000 g 241.00 €

PBS

MB18201 for 1000 mL, 10x 25.00 €

Tris-Glycine-SDS Buffer

MB19501 1000 mL, 10x 23.00 €

Tris-Glycine Buffer

MB19401 1000 mL, 10x 23.00 €

NZY Bacterial Cell Lysis Buffer

MB17801 250 mL 70.00 €

MB17802 2 x 250 mL 125.00 €

NZY Bacterial Cell Lysis Buffer is an innovative product for the gentle disruption of E. coli cell wall, generating a homogeneous cell-free extract. It provides a rapid and cost effective alternative to mechanical methods such as French Press or sonication for releasing recombinant and native proteins. This extraction reagent is a Tris buffered formulation (pH 7.5) with Lysozyme and DNase I provided separately.

51 |

Auto-Induction

> No need for IPTG induction

> No need to monitor cell growth

> Ideal for High-Throughput (HTP) methods

> In the auto-induction kit, we provide two solutions that are used to supplement your E. coli growth medium

!

Culture media

Auto-induction media

Agar Granulated

MB02902 500 g 105.00 €

MB02903 1000 g 173.00 €

LB Agar

MB11801 250 g 42.00 €

MB11802 1000 g 116.00 €

SOB Broth

MB04201 100 g 19.00 €

MB04202 500 g 86.00 €

SOC Broth

MB11901 250 g 41.00 €

Liquid SOC Medium

MB13801 5 x 10 mL 44.00 €

LB Broth (granulated)

MB02802 500 g 52.00 €

MB02803 1000 g 93.00 €

MB02804 5000 g 398.00 €

LB Broth (powder)

MB14501 500 g 35.00 €

MB14502 1000 g 59.00 €

MB14503 5000 g 289.00 €

Tryptone

MB16701 1000 g 152.00 €

Yeast Extract, Micro Granulated

MB16401 1000 g 77.00 €

Sodium Chloride (NaCl)

MB15901 1000 g 12.00 €

NZY Auto-Induction kit

MB18001 Kit for 1000 mL 48.00 €

MB18002 Kit for 5000 mL 210.00 €

NZY Auto-Induction LB medium (powder)

MB17901 100 g 26.00 €

MB17902 500 g 155.00 €

MB17903 1000 g 230.00 €

Services

Oligos

Site-directed mutagenesis

Custom gene synthesis & cloning

Protein expression

High-throughput services

53

| 54

NZY Oligos

> High quality oligos

> Oligos up to 300 using alternative protocols

!

At NZYTech we are available to help our customers developing their molecular biology projects. NZYTech provides a comprehensive repertoire of molecular biology services to accelerate your research. These include oligos, primers and probes, synthetic genes, site-directed mutagenesis, gene cloning and sub-cloning, and recombinant protein production in Escherichia coli. NZYTech also provides a variety of high-throughput services, typically from hundreds to thousands of samples, for gene synthesis, gene cloning, protein expression and purification. We ensure you that your experiments will be performed efficiently by a specialized team with state of the art technologies.

NZYTech custom DNA oligos are made to your specifications, with rigorous quality control and quick turnaround. Synthesis is performed under salt free conditions, which avoids the need for additional purification for most basic molecular biology applications, such as PCR, RT-PCR, sequencing, hybridization studies, and antisense studies. Additional purification by HPLC, PAGE or Cartridge is available for more sensitive applications. In addition to our standard oligos, NZYTech offers an extensive series of available modifications. For further information please contact us.

NZYTech offers a site-directed mutagenesis service which includes substitution, deletion or insertion of any base pair into a DNA sequence. The strategy usually involves an oligonucleotide-directed mutagenic approach using the provided DNA sequence. All mutant clones are screened by DNA sequence analysis to ensure that the desired base changes have been made while confirming the integrity of the remainder of the clone. You will receive 2-10 μg of purified plasmid DNA or a stab culture of the strain carrying the plasmid, along with a report of DNA sequence analysis.

NZYTech ServicesFrom gene to protein

Custom DNA Oligos

Site-directed mutagenesis

Standard protocol (up to 79 bp)* Scale Maximum length (bp) Price10 nmol 40 bp 0.25 €

40 nmol 79 bp 0.45 €

200 nmol 79 bp 0.80 €

1000 nmol 79 bp 2.20 €

Site-directed mutagenesis

SE00201 starting at 150 €/mutation

*minimal order of 16 bp

55 |

> Small scale production of target protein!

Custom gene synthesis

> After three months, all the copies of the gene will be destroyed

> Optimized algorithms for gene design

!

NZYTech offers a high quality gene synthesis service at very competitive prices. The minimum order for each gene is 125 €. The targeted delivery time is of 15 to 25 working days. Our codon optimization technology comprehensively optimizes factors critical to transcription, translation, and co-translational protein folding to deliver the highest possible levels of expression in any system. Genes are cloned into our standard vector pNZY28 or pUC57. Discount on long term contracts is available. Absolute confidentiality is guaranteed.

For PCR Cloning, NZYTech will design and supply primers for the amplification of the desired sequence from your DNA source (plasmid, cDNA, genomic DNA, phage or cosmid DNA). The PCR product will be cloned directly into our standard pNZY28 vector or into a vector of your choice. All clones will be sequenced (both DNA strands) to ensure sequence integrity. You will receive 2-10 μg purified plasmid DNA or a stab culture of the strain carrying the plasmid, along with a report of the DNA sequence analysis.

NZYTech offers a protein production service including protein expression in Escherichia coli, subsequent protein purification and, upon request, protein characterization. Please inquire for lead time and price. The protein production service comprises: Gene synthesis or PCR amplification of the gene of interest and/or subcloning it into a bacterial expression vector; Verification of the authenticity of the subcloned gene by res\triction enzyme digestion and sequencing; Transformation of recombinant clone into a battery of protein expression strains; Small scale production of target protein; Test for recombinant protein expression by western blot (customer must provide appropriate antibodies) if desired; Protein purification using an established affinity chromatography protocol, in either native or denatured conditions.

Custom gene synthesis

Custom gene cloning & sub-cloning

Recombinant protein production

Gene size (bp)

Delivery (working days) Price

< 500 15-25 125 €/gene

500-1200 15-25 0.32 €/base

1200-3000 15-25 0.35 €/base

> 3000 Inquire Inquire

Gene cloning & sub-cloning

SE00101 starting at 150 €

Recombinant protein production in E. coli

SE00301 starting at 400 €

High-throughput services

57 |

> Custom codon optimization available!

High-throughput cloning

> Cloning method that does not require the use of restriction enzymes and/or DNA ligases which improves gene cloning

!

High-throughput gene synthesis 1 plate > 5 plates > 10 plates

105 €/gene 98 €/gene 89 €/gene

Clone validation by PCR 1 plate > 5 plates > 10 plates

65 €/gene 62 €/gene 57 €/gene

Clone validation by DNA sequencing 1 plate > 5 plates > 10 plates

96 €/gene 91 €/gene 83 €/gene

NZYTech offers a high-throughput cloning service for large projects, typically involving several hundreds to thousands of genes. A proprietary method developed by NZYTech will be used for cloning into one or more selected vectors. NZYTech has developed an Escherichia coli expression plasmid that can be chosen as the destination vector. Verification of correct plasmids may be performed by sequencing or PCR. NZYTech accepts minimum order of 96 genes (corresponding to a 96-well plate). Absolute confidentiality is guaranteed.

NZYTech offers a high quality high-throughput gene synthesis service that allows you to industrialize the process of DNA synthesis. This protocol applies to genes smaller than 600 bp. Our codon optimization technology can optimize your gene sequences, allowing it to reach the highest possible level of gene expression and protein solubility. Genes are cloned into our standard vector pNZY28 or pUC57. NZYTech accepts minimum orders of 24 genes (corresponding to a 96-well plate). Absolute confidentiality is guaranteed.

NZYTech offers an innovative high-throughput service for recombinant protein expression and purification (typically several hundreds to thousands). Protein purification is ideally performed through IMAC (Immobilized Metal Affinity Chromatography) or in alternative by other affinity chromatography protocol, in an automated platform after expression in E. coli. NZYTech accepts minimum orders of 96 proteins (corresponding to a 96-well plate). Absolute confidentiality is guaranteed.

High-throughput cloning

High-throughput gene synthesis

High-throughput protein production

High-throughput protein production

Call us for pricing

High-throughput

| 58

Terms & ConditionsProduct Shipping and DeliveryAll our products are transported in the appropriated conditions to maintain intact all the properties inherent to its expected output. For most countries the delivery occurs within two to five working days, except in case of stock rupture. Shipping costs may apply. The necessity of dry ice is signalized in the products and extra charge may apply.

Use of ProductsNZYTech’s kits and reagents are for laboratory research and in vitro use only. They should NOT be used as Agricultural or Pesticide Products, Cosmetics, Drugs, Food Additives or Household Chemicals.

WarrantyNZYTech warrants that its products conform to the specifications in the accompanying technical brochure. If a product fails to conform to its specifications, NZYTech may choose to replace it free of charge or refund the purchase price.

PricingPrices are shown in Euro (€). Prices may be subjected to change without notice. We guarantee written quotations for 30 days. When placing your order, please refer our quoted prices or pro-forma invoice number. If you order by phone, we will confirm our current price by them. If you order via our website, we will guarantee the price shown at the website by that time.Prices shown in this catalogue exclude VAT, which might be applied when the invoice is issued. Shipment will be made promptly even if prices have been nominally changed. Price increases and reductions, if any, will be automatically applied to your invoice.

Payment TermsInvoices will be due within 30 days from issue date. Advanced Payment may be required. Banking expenses are fully supported by the client. In case of advanced payment orders will only be processed upon payment validation.

Discontinuation of ProductsWe reserve the right to discontinue the offering of any item without prior notice.

Return PolicyNZYTech’s Customer Service is available to assist you if a problem arises with your order. Please inspect all packages immediately upon receipt and notify us promptly if any damage or discrepancy occurs. If damages occur, please retain the damaged goods, packing material and shipping documents. If the damage requires that you have to send us back the materials please contact our Quality Service Department to obtain shipping instructions and authorizations. If an item is shipped to you incorrectly, as the result of a mistake from our team, we will take a quick and appropriate action to correct the problem. Returns accepted for items that have been ordered by mistake may be subject to a processing fee of 20% to cover costs.

Customer Service Team +351 21 364 35 14www.nzytech.com

NZYTech, Lda.Estrada do Paço do Lumiar,Campus do LumiarEdifício E - R/C1649-038 LISBOAPORTUGAL

Tel.: +351 21 364 35 14Fax: +351 21 715 11 68E-mail: [email protected]