Molecular Biology-2017 1 - University of Ottawa · Molecular Biology-2017 6 WRITTEN EXAMS All exams...
Transcript of Molecular Biology-2017 1 - University of Ottawa · Molecular Biology-2017 6 WRITTEN EXAMS All exams...
Molecular Biology-2017 1
http://mysite.science.uottawa.ca/jbasso/molecular/home.htm
Molecular Biology-2017 2
GENERAL DIRECTIVES
1. Attendance is mandatory. Please be on time.
2. Shoes and appropriate dress must be worn at all times.
3. Leave outerwear, backpacks, and any other extraneous materials in the lockers outside of the lab.
It is strongly recommended that you have a lock. We are not responsible for lost or stolen items.
4. Wear a lab coat and gloves at all times while working in the lab.
5. Remove your gloves anytime you walk out of the lab.
6. Remove your gloves when using either our or your own computers.
7. Always dispose of used pipettes, tips, microcentrifuge tubes, and other materials in the biohazard
bags provided so that they can be disposed of properly. Do NOT throw trash in the autoclave bag.
8. Never lick your fingers, or put your fingers in your mouth.
9. No eating or drinking in the lab.
10. No radios, MP3 players, or CD players in the lab.
11. No use of cell phones or texting in the lab.
12. Notify the T.A. or instructor of any accident, no matter how minor.
13. Notify the T.A. or instructor of any breakage or malfunction of the equipment supplied.
Material you MUST have to work in the molecular biology lab:
A lab coat
A thin tipped permanent, preferably black, marker for labelling.
A note book to record your results. Any type is acceptable. Do not waste your money.
A USB key to save your pictures
A calculator. The use of cell phone calculators is not allowed
Optional but strongly recommended:
Notify the instructor of any safety or medical concerns so that appropriate accommodations can be
taken. For example, allergies, diabetes, hypoglycemia, epilepsy, exposed wounds, color blindness,
etc..
Notify the instructor of any special needs you may require so that appropriate accommodations can
be taken. For example, if you write your exams with SASS.
Molecular Biology-2017 3
Schedule
Introduction to the molecular biology lab Jan 9-13
Exercise 1 Jan. 16-20 Concentrations and Dilutions
Plasmid DNA isolation by alkaline lysis
Restriction digests & agarose gel electrophoresis
Exercise 2 Jan. 23-27 Restriction mapping of a recombinant plasmid
Plasmid DNA isolation with Qiagen
Restriction digests
Gel electrophoresis
Restriction mapping of a yeast gene – Southern analysis
Genomic DNA isolation
Restriction digests of genomic DNA
Gel electrophoresis
Exercise 3 Jan. 30-Feb. 3 Site directed mutagenesis and cloning of GFP
PCR amplification and mutagenesis of GFP
Purification of PCR reactions with QIAQUICK
Digestion of GFP PCR amplicons and pUC19 vector
Ligation of GFP amplicons
Exercise 4 Feb. 6-10 Mutagenesis and cloning of GFP - Analysis of transformations
Colony counts
Colony PCR
Restriction digests of colony PCR products
MIDTERM EXAM (Exercises 1-4) Feb. 13-17
STUDY BREAK Feb. 20-24
Molecular Biology-2017 4
Exercise 5 Feb. 27- Mar. 3 Gene expression - Transcription
Yeast RNA isolation
RNA electrophoresis
Principals of RT-PCR
Exercise 6 Mar. 6-10 Transcriptional control of yeast CTT1 gene
RT-PCR
Northern analysis
Exercise 7 Mar. 13-17 Genomic fingerprinting
Isolation of human genomic DNA from cheek cells
PCR amplification of ApoC2 VNTR
PCR amplification of ApoB RFLP
Stringency – DNA melting curves
Exercise 8 Mar. 20-24 Protein expression
Preparation of protein extracts
Protein quantification – Bradford assay
Protein gel electrophoresis
THEORETICAL FINAL EXAM FINAL EXAM PERIOD
Molecular Biology-2017 5
Grading scheme
Option I Option II
Quizzes 5% + *Bonus 2% 5% + *Bonus 2%
Assignments (X5) 15% 15%
Lab performance 10% 10%
Midterm 25% 15%
Final 45% 55%
Total 102% 102%
*You need to obtain 100% on at least 4 out of 8 quizzes to obtain the bonus
QUIZ
Each week, starting on week 2, a quiz will be available on Blackboard on the Saturday before the
following week’s lab which will be available between 9AM and 9PM. You will have 30 minutes to
complete the quiz. These quizzes will contribute towards 5% of your final grade. Additionally, a 2%
bonus will be added to the final grade of students who obtained 100% on at least 4 of the 8 quizzes.
ASSIGNMENTS
Assignments covering the procedures and the data you have obtained as well as associated
bioinformatics exercises. Assignments must be type written. All assignments may be submitted
individually or in groups of two (you and your teammate). A 10%/day penalty will be imposed on
late assignments. (Weekends will be considered as one day) Some parts of the assignment are to be
submitted on Blackboard and some parts are to be submitted as hard copies during your lab session.
In both cases, submission must be done by 5 pm the day of your lab.
ASSIGNMENT DUE DATES (Date of your section)
ASSIGNMENT 1: WEEK OF JANUARY 23-27
ASSIGNMENT 2: WEEK OF JANUARY 30-FEBRUARY 3
ASSIGNMENT 3: WEEK OF FEBRUARY 13-17
ASSIGNMENT 4: WEEK OF MARCH 13-17
ASSIGNMENT 5: WEEK OF MARCH 27-31
Molecular Biology-2017 6
WRITTEN EXAMS
All exams are open book. Access to the internet will be allowed during both the final and
midterm exams. NO LAPTOPS are allowed. You must use the lab computers.
The breakdown of the midterm exam (2 hours) will be as follows:
8 calculation problems (12 points)
4 bioinfo exercises (4 points)
4 theoretical questions on bioinfo and molecular procedures (4 points)
2 out of 3 problems with an emphasis on data analysis and experimental design (10 points)
The breakdown of the final exam (3 hours), which is cumulative, will be as follows:
5 calculation problems (10 points)
10 bioinfo exercises (10 points)
5 theoretical questions on bioinfo and molecular procedures (5 points)
3 out of 4 problems with an emphasis on data analysis and experimental design (15 points)
Molecular Biology-2017 7
Exercise 1
What are we doing today!
Concentrations and dilutions
Plasmid DNA isolation by alkaline lysis
Restriction digests & agarose gel electrophoresis
Molecular Biology-2017 8
Introduction to concentrations One very important property of solutions that must be addressed is concentration. Concentration
generally refers to the amount of solute contained in a certain amount of solution. To deal with
concentration you must keep in mind the distinctions between solute, solvent and solution. Because
varying amounts of solute can be dissolved in a solution, concentration is a variable property and we
often need to have a numerical way of indicating how concentrated a solution happens to be. Over
the years a variety of ways have been developed for calculating and expressing the concentration of
solutions.
That can be done with percentages using measurements of weight (mass) or volume or both. It can
also be done using measurements that more closely relate to ways that chemicals react with one
another (moles).
In the pages that follow, several concentration types will be presented. They include volume
percent, weight percent, weight/volume percent, molarity (the workhorse of chemical
concentrations), and weight/volume.
You will get experience with more than one way of establishing the concentration of solutions. You
can prepare a solution from scratch and measure each of the components that go into the solution.
You can prepare a solution by diluting an existing solution. If an existing solution is colored, you can
determine its concentration by measuring the color intensity using colorimetry.
PERCENTAGE
The use of percentages is a common way of expressing the concentration of a solution. It is a
straightforward approach that refers to the amount of a component per 100. Percentages can be
calculated using volumes as well as weights, or even both together. One way of expressing
concentrations, with which you might be familiar, is by volume percent. Another is by weight
percent. Still another is a hybrid called weight/volume percent.
Volume percent is usually used when the solution is made by mixing two liquids.
For example, rubbing alcohol is generally 70% by
volume isopropyl alcohol. That means that
100mL of solution contains 70mL of isopropyl
alcohol. That also means that a litre (or 1000mL)
of this solution has 700mL of isopropyl alcohol
plus enough water to bring it up a total volume of
1 litre, or 1000mL.
Volume percent = volume of solute
volume of solution x 100
Molecular Biology-2017 9
Mass percent is a way of expressing the concentration of a solution as the mass of solute/mass of
solution.
To calculate the mass percent of a solution, you must divide the mass of the solute by the mass of the
solution (both the solute and the solvent together) and then multiply by 100 to change it into percent.
Mass/volume percent
Another variation on percentage concentration is mass/volume percent. This variation measures the
amount of solute in grams but measures the amount of solution in millilitres. An example would be a
5% (m/v) NaCl solution. It contains 5g of NaCl for every 100mL of solution.
Volume percent = mass of solute (in g)
volume of solution (in mL) x 100
This is the most common way that percentage solutions are expressed in this lab course.
Mass percent = mass of solute
mass of solution x 100
As an example, let's consider a 12% by
weight sodium chloride solution. Such a
solution would have 12 grams of sodium
chloride for every 100 grams of solution. To
make such a solution, you could weigh out 12
grams of sodium chloride, and then add 88
grams of water, so that the total mass for the
solution is 100 grams. Since mass is
conserved, the masses of the components of
the solution, the solute and the solvent, will
add up to the total mass of the solution.
12 % NaCl solution = 12 g NaCl
100 g solution
12 g NaCl
(12 g NaCl + 88 g water) = 12% NaCl solution
Molecular Biology-2017 10
MOLARITY
Another way of expressing a concentration is
called molarity. Molarity is the number of moles
of solute dissolved in one litre of solution. The
units, therefore are moles per litre, specifically
it's moles of solute per litre of solution.
Molarity = moles of solute
litre of solution
Rather than writing out moles per litre, these units are abbreviated as M. So when you see M it
stands for molarity, and it means moles per litre (not just moles). You must be very careful to
distinguish between moles and molarity. "Moles" measures the amount or quantity of material you
have; "molarity" measures the concentration of that material. So when you're given a problem or
some information that says the concentration of the solution is 0.1M that means that it has 0.1 moles
for every litre of solution; it does not mean that it is 0.1 moles.
WEIGHT/VOLUME
This means of expressing concentrations is very similar to that of percentages and is one of the most
popular ways used by molecular biologists. In contrast to percent, the concentration is expressed as a
mass per any volume the user wishes to use. Most commonly, these concentrations are expressed per
one measuring unit. For example, per 1mL, 1µL or 1L, etc. Essentially these expressions represent
the mass of solute present in a given amount of solution. For example a solution at a concentration of
1mg/mL contains 1 mg of solute in 1 mL of solution.
RATIOS
All the ways described above to express concentrations are done as a function of the total volume of
the solution which is the volume of the solvent and that of the solute. A common method used by
many molecular biologists and chemists is to express concentrations as ratios. In this case, the
relationship between the solvent and the solute is expressed independently of one another. For
example, we could say that the ratio between a solute and its solvent is 2 to 1. This indicates that for
two parts of the solute there is one part of solvent. Thus three parts total of solution.
Molecular Biology-2017 11
Dilutions and the use of micropipettors
Dilutions: Being able to prepare dilutions is essential for the preparation of several reagents, reaction mixes,
and solutions used in a molecular biology lab. Basically, dilutions serve to reduce the initial
concentration of a compound in order to reach a new desired concentration. Solutions prepared by
the formulation of dilutions may be composed of one or more ingredients. The number of ingredients
within the solution does not in any way influence the formulation of dilutions. A brief overview of
the formulation of dilutions is presented below. Make sure that you fully understand their
preparation, since you will be called upon to prepare them throughout the semester as well as on the
final exam.
To comprehend how dilutions are prepared, you must grasp the following three concepts:
Concentration, dilution factor, and the dilution.
A concentration is defined as the quantity of a given element for a total volume of solution. Since a
quantity may be expressed in several different ways, concentrations are expressed as the unit of
measure of the quantity of the element/total final volume.
Ex. Grams/Litre
Molecules/Litre
Moles/Litre
Etc.
The dilution factor represents the multiple by which an initial concentration must be divided by in
order to obtain the desired final concentration. For example, if a solution contains 30g of caffeine per
litre of solution and you wish to reduce the caffeine concentration to 0.3 g/L, then you will have to
divide the initial concentration by 100, which represents the dilution factor. You can use the
following formula in order to determine a dilution factor.
The dilution represents the fraction of the component being investigated. For example, in the
previous problem a dilution of 1/100 was prepared. The dilution is expressed as a fraction of 1 over
the dilution factor. That is to say that the initial solution is represented as a fraction of the original
over the total. For example if you determined that a 1/100 dilution has to be prepared, this means that
one hundredth of the new solution must be represented by the original solution. Therefore for a total
volume of let’s say 2mL, 0.02mL must be represented by the original solution.
Dilution factor = Initial concentration
Final Concentration OR
What I have
What I want
Molecular Biology-2017 12
Preparing a solution that requires the dilution of more than one ingredient:
The basis for the formulation of a solution that requires the dilution of more than one ingredient is
the same as that of a solution with only one ingredient. The only difference is the volume of solvent
that must be added.
Let’s take as an example that we wish to prepare 10mL of a 0.1M solution from a stock solution of
2M.
To calculate the dilution factor:
Thus the required dilution is 1/20, which means that one twentieth of the total must be represented by
the original solution.
Therefore to prepare 10mL we must add 0.5mL of the stock solution and make up the volume with
9.5mL of solvent.
If the solution to be prepared includes a second ingredient; let’s say that the final concentration of
this one must be 0.5M and that the stock solution is 3M.
Once again to calculate the dilution:
Thus the required dilution is 1/6, which means that one sixth of the total volume must be represented
by the original solution.
Therefore, to prepare 10mL one must add 0.5mL of the first solution, 1.7mL of the second solution
and complete to the total volume with 7.8mL of solvent.
If the above explanations are not sufficient you can always consult the following web site:
http://www.wellesley.edu/Biology/Concepts/Html/dilutions.html
What I have
What I want =
2M
0.1M = 20
What I have
What I want =
3M
0.5M = 6
Molecular Biology-2017 13
Use of micropipettors
Micropipettes are indispensable tools in modern biology laboratories. How accurate are yours? How
precise are yours? What is the difference between accuracy and precision?
Accuracy refers to performance with respect to a standard value. Precision refers to the reliability or
repeatability of performance and doesn’t necessarily depend on a standard at all. These two features
are independent of each other. It is possible to have an instrument that is precisely inaccurate (or
accurately imprecise)!
Target analogy to illustrate accuracy and precision
Here, the bull’s-eye represents the "standard" against which accuracy is judged. To simultaneously
evaluate the accuracy and precision of your pipettes you must conduct multiple measurements and
compute the % Error of the Mean and Standard Deviation of the measurements for each pipette.
Directions for use of Gilson micropipettors
You have 3 sizes of micropipette. The P-1000, the P-200 and the P-20. The model numbers refer to
the maximum volume in microliters. Initially you will need to determine which pipette to use in a
given circumstance. For example, if you need to transfer 0.18ml you would probably need to use the
P-200 because 0.18ml = 180µL and because the P-200 will measure this volume with greater
accuracy and precision than the P-1000 will.
Rules:
Always use a disposable tip. The P-20 and P-200 use the smaller tips and the P-1000 uses the
bigger ones.
Never draw any fluid into the white barrel of the pipette itself.
Never lay a pipette down while there is fluid in the tip. The fluid may accidentally find its
way into the barrel.
Never turn the adjustment scale below or above the full range settings.
To maximize precision, Always use the smallest volume pipette for a given total volume.
1. Set the desired volume:
Turn the volume up just a bit past the desired setting, then back down.
2. Attach a tip:
Press it on firmly, with a slight twisting motion. The tip must make an air-tight seal
with the pipette barrel.
Accurate & Precise Precise & Inaccurate Imprecise & Inaccurate
Molecular Biology-2017 14
3. Depress the plunger to first stop.
4. Insert the tip in the liquid you want to transfer. Not far, just a bit below the surface.
5. Slowly release plunger.
6. As you withdraw the tip, touch it to the side wall of the tube to remove excess fluid from the
exterior.
7. To dispense, depress plunger slowly to the first stop; then depress all the way.
Never dispense a small volume into thin air. Always dispense into a liquid or onto the
wall of a tube so that adhesion will draw the expelled liquid off the tip.
8. With the plunger still fully depressed, remove tip from the liquid.
REMEMBER THAT YOUR MICROPIPETTORS ARE EXPENSIVE PIECES OF
EQUIPMENT!
Dilutions exercise with micropipettors (Groups of 2)
These exercises are included so that you will be familiar with the basics of solution preparation,
micropipetting, and the use of tips. (ALWAYS LABEL YOUR TUBES!! ).
Materials: Solution I (1% Compound “A” (m/v); M.W. 250g/mole)
Solution II (1.5M Compound “B” M.W. 480g/mole; Density of compound “B”: 1.6g/mL)
Method:
1. Prepare 1mL of each of the following solutions from the above stock solutions.
a. A 0.2mM solution of compound “A”.
b. A 0.72% (m/v) solution of compound “B”.
c. A 5% (v/v) solution of solution I.
d. A solution containing 0.1mg of compound “A” and 0.1% (v/v) of compound “B”.
e. A solution with the following ratio: solution I: solution II : water : 2 : 1 : 247
2. Transfer 150 µL from each of the solutions to the appropriate wells of a 96 well plate as shown
below:
96 well plate layout (one plate/table)
Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 1
Soln. a Soln. b Soln. c Soln. d Soln. e Person 2
Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 2
Soln. a Soln. b Soln. c Soln. d Soln. e Person 2
Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 3
Soln. a Soln. b Soln. c Soln. d Soln. e Person 2
Soln. a Soln. b Soln. c Soln. d Soln. e Person 1 Group 4
Soln. a Soln. b Soln. c Soln. d Soln. e Person 2
Molecular Biology-2017 15
More dilutions: Determining the concentration of DNA (Groups of 2) As with most compounds, the concentration of nucleic acids can be determined
spectrophotometrically. To do so, the absorbance of the compound is determined at the wavelength
for maximal absorption. In the case of nucleic acids, this is in the UV range at a wavelength of
260nm. In the following exercise you will prepare samples at different known concentrations of
DNA and then use the absorbance values obtained to generate a standard curve representing
absorbance Vs DNA concentration (NOT AMOUNT). The standard curve generated will then allow
you to determine the concentration of an unknown DNA sample as well as determining the
relationship between DNA concentration and absorbance at a wavelength of 260nm. Specifically you
want to determine what concentration of DNA (in µg/mL or ng/µL) is equal to an absorbance of 1.0.
Materials
Salmon sperm DNA (200µL at 0.5mg/mL)
Salmon sperm DNA (200µL of unknown concentration)
Method:
1. Prepare 500µL in water of each of the following DNA standard solutions from the DNA sample
of known concentration: 0.0, 0.05, 0.025, 0.01, 0.005 and 0.0025mg/mL.
2. Prepare 500µL samples in water representing 1/4 and 1/10 dilutions of the unknown DNA
sample.
3. Transfer 200µL of each of the standard DNA solutions to a microtiter plate as indicated in the
plan below.
4. Transfer 200µL of each of the unknown DNA solutions to a microtiter plate as indicated in the
plan below.
5. Measure absorbance at 260nm.
DNA assay plate layout
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 1
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 2
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 3
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 4
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 5
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 6
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 7
0.0 0.05 0.025 0.01 0.005 0.0025 Empty UNK
1/4
UNK
1/10 Group 8
Molecular Biology-2017 16
Plasmid DNA isolation (Groups of 2) Most methods used to isolate DNA rely on the disruption of cells in the presence of strong
denaturants. Disruption may be by freezing and fracturing cells by grinding or blending or by
chemical lysis with strong alkali. The denaturants are essential to inactivate exogenous and
endogenous nucleases, which would otherwise degrade the DNA. Examine the components of the
DNA extraction buffers and determine the purpose of each chemical.
Plasmids are non-obligate, circular, extrachromosomal bacterial replicons. Plasmid DNA isolation
requires separation of this DNA from the chromosomal DNA in the bacterial cell as well as from the
polysaccharides, lipids and proteins that constitute the cell. Subsequent manipulation, especially
enzymatic modification, of the plasmid DNA requires that it be free of these impurities.
Purifying plasmid DNA by alkaline lysis
In this protocol, cells are lysed by strong alkali (NaOH) and the proteins are denatured by a strong
alkali and a strong detergent (SDS). The detergent complexes are then precipitated with a
neutralizing salt (KOAc). The plasmid is separated from the bacterial DNA by virtue of the plasmid's
relative stability in alkali. Leaving the plasmid preparation in alkali for too long will destroy the
plasmid DNA as well. The chromosome is also attached to the membranes and will be precipitated
by the salt and detergent. It is therefore important not to mix the solution too vigorously and release
the chromosomal DNA from it trap. The plasmid is smaller and will remain free in solution. The
plasmid solution is then separated from the cellular debris by centrifugation and further concentrated
by an alcohol precipitation.
Molecular Biology-2017 17
A. Preparing your solutions:
Prepare 1mL of solutions I & II as well as T.E. from the following stock solutions:
10M NaOH
10% (m/v) SDS
0.5M glucose
1M Tris-Cl (pH 8.0)
0.5M EDTA
3M KOAc pH 5.0
Isopropanol
RNase 10mg/mL
Solution I:
50mM Glucose (buffer)
25mM Tris-Cl (pH 8.0) (buffer)
10mM EDTA (pH 8.0) (Chelator)
Solution II:
0.2M NaOH (Alkali)
1% (m/v) SDS (Detergent)
T.E.:
10mM Tris-Cl pH 8.0
1mM EDTA pH 8.0
B. Protocol for isolation of a pUC9 recombinant plasmid:
1. Spin at maximal speed in the microcentrifuge for 1 minute 1.5mL of the plasmid containing
E.coli suspension provided to you.
2. Carefully pour off supernatant without disturbing the cell pellet. Use a micropipettor to remove
any remaining supernatant.
3. Add 200L of Solution I to the pellet and suspend the pellet by vortexing.
4. Add 400L of solution II. Cap the tube and mix by inversion.
5. Add 300L of ice cold KOAc. Mix well and keep on ice for 5 minutes.
6. Spin tube in the microcentrifuge at maximum speed for 5-10 minutes. This pellets the proteins
and chromosomal DNA along the side of the tube.
7. Transfer 700µL of the supernatant to a new microcentrifuge tube. Add an equal volume of
isopropanol. Close cap and mix well by rapidly inverting the tubes.
8. Spin tubes at maximum speed for 5 minutes. Pour off supernatant carefully.
9. The white pellet at the bottom of the tube contains plasmid DNA and RNA.
10. Suspend the pellet in 50L TE pH8.0.
11. Add 1L of an RNAse solution at 10mg/mL and incubate at 37oC 5-10 min.
Molecular Biology-2017 18
Restriction digests & agarose gel electrophoresis (Groups of 2) The use of restriction endonucleases to cleave DNA at specific sites was a key breakthrough in
opening up the field of molecular biology in the mid-1970's. There are now several hundred different
restriction enzymes that are commercially available, and you can find detailed information about
some (including the ones that you will be using in this course) in catalogues from commercial
suppliers. Their specificity makes them very useful for several tasks including but not limited to the
mapping of DNA, cloning and subcloning of DNA, etc. The goal of this exercise is to introduce
you to restriction enzyme mapping and analysis. At the end of this exercise you should be able
to answer the following questions:
Which enzymes cut within the plasmid insert?
Which enzymes do not cut within the plasmid insert?
What is the size of the plasmid insert?
What are the possible positions of the different restriction sites?
The DNA fragment was inserted in which restriction site within the MCS?
For more information on restriction enzymes and their use consult the following web site.
http://askabiologist.asu.edu/expstuff/mamajis/restriction/restriction.html
Agarose gel electrophoresis
Agarose gel electrophoresis is the most commonly used technique to answer these questions. This
technique involves the separation of DNA molecules based on their size and conformation through
an agarose gel using an electric current. The electrophoretic migration of a DNA fragment through
agarose is inversely proportional to the logarithm of its molecular weight (for certain size classes
under defined conditions). [Tip! When you are estimating the sizes of restriction fragments, be sure
to keep in mind the accuracy that is warranted - i.e. the number of significant digits.] The
concentration of agarose used depends on the sizes of the DNAs being studied; for separating linear
DNAs in the 0.5 kb to 10 kb range, a 1% agarose gel is commonly used. After electrophoresis the
gels will be viewed under ultraviolet light and a digital picture will be taken. The intensity of
fluorescence is proportional to the amount (and length) of linear DNA and this method can be used
for a rough estimate of the quantity of DNA in the samples.
Agarose gel electrophoresis is performed at voltage levels that are potentially hazardous. The gel
boxes have a safety interlock feature and the leads must be removed before opening the lid.
ALWAYS TURN THE POWER SUPPLY OFF BEFORE DISCONNECTING THE LEADS.
Ethidium bromide, which is used in staining agarose gels to visualize DNA under ultraviolet light, is
a potential carcinogen; so always wear gloves when handling anything containing it. The UV light
source is also extremely hazardous to skin and particularly your eyes, so be sure to use proper
protection (gloves, lab coat, face mask) when viewing your agarose gels.
Molecular Biology-2017 19
Each gel apparatus has two gel casting plates and three combs (8-wells, 10 wells, and 14-wells
holding about 14L, 12L, and 6L respectively). Remember that the 8 and 10-wells gels require
about twice as much DNA as the 14-wells one because of the difference in well size. Also if you
wish to visualize fairly small fragments (<500bp) which are less intensely stained you may consider
using more DNA and perhaps a higher percentage of agarose (e.g. 1.5% instead of the more standard
1%) for a better resolution.
Method:
A. Preparation of an agarose gel (8 well comb)
Materials:
Agarose
10X TBE
1. Prepare 200mL TBE buffer at a final concentration of 1X in your graduated cylinder. Mix well.
2. Mix the appropriate amount of agarose to obtain a final concentration of 1.0% m/v) in 25 mL of
1X TBE.
3. To dissolve the agarose, microwave (25-45 sec.). Loosely cover the mouth of the flask with
plastic to prevent evaporation. Once the agarose is totally dissolved, allow the flask to cool to 50-
60 oC (5 minutes or so).
4. Add 50 L of a stock solution of ethidium bromide at 1mg/mL (CAUTION! CARCINOGEN!)
and mix well.
5. Pour into the gel tray. After pouring the gel, place the 8 well comb (Well capacity approx. 14 L)
and remove any air bubbles (e.g. with a small tip). Allow to solidify at least 15-20 minutes.
6. Once the gel has solidified, remove the dams. Pour a sufficient amount of 1X TBE to cover the
gel by approx. 0.5cm.
7. Carefully remove the comb.
Molecular Biology-2017 20
B. Checking the good operation of your gel
8. Attach electrodes so that the cathode (negative electrode) is at the "origin" end of the gel and the
samples will run through the gel towards the anode (positive electrode). (CAUTION! HIGH
VOLTAGE!)
9. Set the power supply at 100V. Turn on the power supply. Verify that the amperage is in the 40-55
mA range. If it is not there is a problem.
Possible problems:
The buffer is at the wrong concentration
The buffer in the gel is at the wrong concentration
You forgot to put buffer in the gel
C. Analysis of restriction digests
10. Load the following DNA samples. The unknown is a recombinant of the pUC9 vector:
a. 1Kbp molecular weight markers (5µL)
b. Recombinant pUC9 plasmid DNA you previously purified, 5µL
c. Recombinant pUC9 plasmid cut with BamHI, 5µL
d. Recombinant pUC9 plasmid cut with EcoRI, 5µL
e. Recombinant pUC9 plasmid cut with HindIII, 5µL
f. Recombinant pUC9 plasmid cut with EcoRI + HindIII, 5µL
g. Recombinant pUC9 plasmid cut with PstI, 5µL
h. Vector pUC9 cut with BamHI, 5µL
11. Carry out the electrophoresis at 100V for approx. 45 minutes and ask a teaching assistant to take
a picture.
Molecular Biology-2017 21
DNA Size Markers
Molecular Biology-2017 22
Molecular Biology-2017 23
Exercise 2
What are we doing today!
Restriction mapping of a recombinant plasmid
Plasmid DNA isolation with Qiagen
Restriction digests
Agarose gel electrophoresis
Restriction mapping of a yeast gene – Southern analysis
Genomic DNA isolation
Restriction digest of genomic DNA
Gel electrophoresis
Molecular Biology-2017 24
Restriction enzymes and agarose gel electrophoresis Following most restriction digest reactions it is necessary to answer the following questions:
Was the DNA digested?
Was the digest complete or partial?
Is there partially digested DNA?
Is there partially undigested DNA?
Have the DNA samples completely digested? If there is only partial cleavage of the DNA (for
example - low enzyme activity due to inappropriate reaction conditions or impurities in the DNA that
inhibit the enzyme), the slower migrating species (representing uncleaved fragments containing a site
for the enzyme used) are usually present in sub-stoichiometric amounts. In other words, because the
UV fluorescence intensity is proportional to the amount of ethidium bromide bound (and therefore
the amount/length of DNA), these species are not as intense as they would be if present in equimolar
amounts to the completely digested fragments.
Are the calculated sizes of restriction fragments internally consistent? If you are running different
digests of cloned DNA, it is important to check that the calculated sizes of the fragments add up to
approximately the same value in each of the different lanes (that is, the size of the intact DNA
molecule). Because there are inaccuracies in estimating sizes from the standard markers (and those in
the non-linear part of the curve have greater error), there usually is only approximate agreement
(perhaps 200-300 bp differences for a 5 Kbp recombinant plasmid). If there are greater discrepancies,
consider the following: Might there be co-migrating species? (Clues from relative fluorescence
intensity) Are partial digestion products being included in the calculation? Might there be multiple
low MW fragments (of correspondingly lower intensity that you cannot easily see)? Could you be
using the size of fragments which are the result of a partial digest in your calculation? Are linear size
markers being used to size linear (as opposed to non-linear) DNA molecules? Remember that linear,
relaxed circular and supercoiled double-stranded DNA molecules have different migration properties
under our conditions of agarose gel electrophoresis. Because the size markers that we are using are
linear ones, can they be used to estimate the size of an uncut recombinant plasmid?
Molecular Biology-2017 25
Restriction mapping of a recombinant plasmid (Groups of 2) The goal of this experiment is to give you an understanding of the technique of restriction mapping.
Each group of two will be working with a plasmid that contains an insert representing one of the
genes listed under the heading “sequences” > “Unknown "genes” on this course's web site. These
inserts were all obtained from a genomic library created in the cloning vector pUC19. Briefly,
genomic DNA was isolated from an organism, digested, and the resulting fragments were then
ligated into the vector pUC19 which was linearized with an appropriate restriction enzyme whose
site is within the multiple cloning site. (See figure on next page).
The goals of this project are:
Using an experimental approach to: o Determine the insertion site
o Verify the size of the insert
o Verify the orientation of the insert
o Determine the restriction map
Tips for working with restriction enzymes
Always keep the enzyme stocks on ice when they're out of the -20oC freezer, and plan your setup for
that time to be as short as possible.
The enzyme is always the last component added to a reaction mixture, and it is added directly into
the solution in the bottom of the tube rather than as a drop on the side of the tube.
Make sure the solution is well mixed (e.g. "flicking" the tube with your finger) and if any drops are
along the side of the tube, spin them down using the microcentrifuge. Alternatively, the sample can
be mixed by vortexing (unless you are using high molecular weight genomic DNA in which case
there is the danger of shearing it).
Never touch the end of the plastic pipette tips with your fingers or anything except the solution that
you are transferring.
Always use a clean tip for each operation and dispose of the used tips at once.
In compliance with the BIOHAZARD GUIDELINES, all disposable items (micropipette tips,
microcentrifuge tubes, etc.) used when working with recombinant DNAs and bacterial host cells
must be placed in special waste containers (that is, the disposal boxes at your work stations which
you will then transfer to orange bags) to be autoclaved before disposal.
Molecular Biology-2017 26
The following enzymes do not cut pUC19: AdeI, AloI, ApaI, AscI, BaeI, BbvCI, BclI, BcuI, BglII, BoxI, BpiI, BplI, Bpu10I,
Bpu1102I, BsaAI, BsaBI, BseRI, BsgI, BshTI, BsmFI, Bsp68I, Bsp119I, Bsp120I,
Bsp1407I, BspTI, Bst1107I, BstXI, Bsu15I, BtrI, Cfr42I, CpoI, DsaI, Eco32I,
Eco47III, Eco52I, Eco72I, Eco81I, Eco91I, Eco105I, Eco130I, Eco147I, FseI, Kpn2I,
KspAI, MlsI, MluI, Mph1103I, MssI, MunI, Mva1269I, NcoI, NheI, NotI, PacI, PauI,
PdiI, Pfl23II, PsiI, Psp5II, PsyI, SacII, SanDI, SexAI, SfiI, SgfI, SgrAI, SmiI,
SrfI, SstII, Van91I, XagI, XcmI, XhoI, XmaJI.
The pUC vectors are small, high copy number, plasmids that have a multiple cloning site (MCS), the
pMB1 origin of replication responsible for the replication of the plasmid (source – plasmid pBR322),
and the bla gene, coding for beta-lactamase, which confers resistance to ampicillin (source – plasmid
pBR322). Note that all the restriction sites within the multiple cloning site occur only once.
pUC19
MCS of pUC19
Molecular Biology-2017 27
Tips for restriction enzyme cleavage of plasmids
Amount of DNA to use:
The ease of detection of your restriction fragments (by UV fluorescence after ethidium bromide
staining where fluorescence intensity is proportional to the mass of DNA in a fragment) will depend
on the amount of DNA used (and also parameters such as gel well width, sharpness of bands, etc.).
Typically, 200-600ng plasmid DNA/lane is used for digests with a single enzyme. For digests that
result in many fragments you may need to restrict 400-1,000ng so that the smallest fragment can be
visualized after staining (WHY??)
After taking DNA samples from the freezer, be sure to completely thaw them before pipetting (to
obtain the correct amount of DNA in a given volume).
Your digestions will be carried out in the presence of a commercial buffer from Fermentas.
Restriction enzymes vary in their preferred salt concentration and this can be achieved by using
buffers with different salt concentrations.
A few enzymes require an incubation temperature other than 37oC. Also note that restriction
enzymes having the same recognition sequence are called isoschizomers (e.g. SacII and SstII) and
that some enzymes with very similar names (EcoRI, EcoRV) have distinctively different recognition
sequences (so be sure to read the labels on the enzyme tubes carefully).
In principle, 1 UNIT OF RESTRICTION ENZYME DIGESTS 1g OF PURIFIED DNA TO
COMPLETION IN 1 HR. However, because we are often using crude DNA preparations, we
routinely increase the amount of enzyme used and for high complexity genomic DNAs, incubation
times are usually extended as well. Typically restriction enzymes are supplied in concentrations of 5-
10 units/L.
The final volume of enzyme should not exceed 1/10 the total reaction volume, because the
glycerol in enzyme stocks, added to prevent freezing upon storage in the freezer, may inhibit the
reaction. Also note that solutions containing glycerol are more difficult to pipette accurately than
aqueous solutions, so carefully monitor the volumes in the pipette tips.
For an overview on restriction mapping visit the following web sites:
http://faculty.plattsburgh.edu/donald.slish/RestMap/RestMapTutorial.html
http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/maps.html
http://wps.prenhall.com/esm_klug_essentials_5/17/4576/1171606.cw/content/index.html
Molecular Biology-2017 28
List of restriction enzymes available
ENZYME SITE
BamHI G▼GATCC
HindIII A▼AGCTT
PstI CTGCA▼G
XbaI T▼CTAGA
▼- indicates cleaved phosphodiester linkage
Molecular Biology-2017 29
Method & Materials:
Some of the restriction enzymes you will be using can be found in your freezer box. If they
are not in your freezer box they are in the freezer box of the group facing you on the same
end of bench as you.
Your unknown recombinant plasmid, at a concentration of 100g/mL, is in your freezer box.
10X Restriction enzyme buffers are in your freezer box.
Setting up your restriction digests: Since different enzymes require different buffers, you will need to be flexible in making a restriction
digest. Prepare a chart listing all the components that you intend to add and their volumes before you
begin. As you add a component to your labelled tube, cross out the entry on your list. Choose the
restriction buffer which gives a 100% activity with the chosen enzyme. (Consult the table on the next
page)
Reaction mix for a typical single digest in a 30µL volume:
Ingredients Final Concentration/µL
DNA (100ng/µL) 8.3ng/ µL
10X restriction buffer 1X
Enzyme (approx. 10 units/µL) 0.3 units/ µL
Water Complete to 30µL
For single digests, use the recommended restriction buffer for 100% activity.
For double digests, your reactions must contain each enzyme at a final concentration of 0.3
units/ µL. Use the restriction buffer with the best compatibility for both enzymes.
Molecular Biology-2017 30
Enzyme Recommended buffer
for 100% activity
% activity in Fermentas buffers
B G O R Tango
(blue) (green) (orange) (red) (yellow)
1X 1X 1X 1X 1X
ApaI B 100 20-50 0-20 0-20 20-50
BamHI BamHI 20-50 100 20-50 50-100 100
BclI G 20-50 100 20-50 20-50 100
BglI O 0-20 50-100 100 100 0-20
BglII O 0-20 20-50 100 50-100 0-20
BstXI O 20-50 100 100 50-100 50-100
ClaI Tango 20-50 20-50 20-50 20-50 100
EcoRV R 0-20 50-100 50-100 100 20-50
EcoRI EcoRI 0-20 NR 100 100 NR
HincII Tango 50-100 50-100 20-50 50-100 100
HindIII R 0-20 20-50 0-20 100 50-100
HinfI R 0-20 20-50 50-100 100 50-100
HpaII Tango 50-100 50-100 0-20 20-50 100
HphI B 100 0-20 0-20 0-20 20-50
KpnI KpnI 20-50 0-20 0-20 0-20 20-50
MluI R 0-20 20-50 50-100 100 20-50
NcoI Tango 20-50 20-50 20-50 50-100 100
NdeI O 0-20 0-20 100 50-100 0-20
NheI Tango 100 20-50 0-20 0-20 100
PstI O 50-100 50-100 100 100 50-100
PvuI R 0-20 20-50 50-100 100 50-100
PvuII G 50-100 100 20-50 50-100 20-50
RsaI Tango 50-100 20-50 0-20 0-20 100
SacI SacI 50-100 20-50 0-20 0-20 50-100
SacII B 100 50-100 0-20 0-20 50-100
SalI O 0-20 0-20 100 20-50 0-20
ScaI ScaI 0-20 0-20 0-20 0-20 0-20
SmaI Tango 50-100 0-20 0-20 0-20 100
SspI G 20-50 100 0-20 50-100 100
TaqI TaqI 0-20 20-50 20-50 20-50 20-50
XbaI Tango 50-100 50-100 20-50 0-20 100
XhoI R 0-20 50-100 50-100 100 20-50
NR – Not recommended
Molecular Biology-2017 31
Your digests:
1. Setup the following restriction digests of 0.25g of DNA.
BamHI HindIII + PstI PstI + XbaI
HindIII HindIII + XbaI
PstI
XbaI
2. Prepare a digestion control, which contains all the components except for enzyme. (You may use
any of the restriction enzyme buffers for this reaction)
3. Incubate at 37oC for 60 minutes.
4. While your digestions are incubating, prepare a 1.0% agarose gel containing ethidium bromide.
5. Following the incubation period, transfer 5µL of your digestions to new appropriately labelled
tubes and then add 5X DNA loading buffer to each of them to obtain a final concentration of 1X
or more.
6. Load the samples containing the loading buffer in the gel.
7. Load 5μL of the digested pUC19 vector which has been prepared for you.
8. Load 5µL of the molecular weight ladder.
9. Carry out the electrophoresis at 100V.
10. Following the electrophoresis, examine your gel under the UV light and take a picture for your
analysis.
Molecular Biology-2017 32
Plasmid DNA isolation with the QIAGEN kit Another method used for the isolation of plasmid DNA makes use of commercial kits such as the one
offered by Qiagen. Fundamentally, this technique is based on the alkaline lysis procedure that you
previously performed. In order to compare the two, you will use the Qiagen kit for the purification
of the pUC19 vector. At the end of this procedure you are expected to be able to compare these two
methods with respect to their similarities and differences.
Step 1
Steps 2-5
Steps 6-7
Steps 8-9
Step 10
Bacterial pellet
Wash
Elute
Bind
Suspend
Lyse
Neutralize
Pure plasmid DNA
Molecular Biology-2017 33
Protocol for the purification of the pUC19 vector: 1. Obtain the 1.5mL plasmid containing E.coli culture that was prepared for you and harvest the
cells by centrifugation at maximum speed for 1 minute. Decant supernatant.
2. Suspend the cell pellet in 250L of Buffer P1 (+ RNAse) and transfer to a microcentrifuge tube.
No cell clumps should be visible.
3. Add 250L of Buffer P2 (containing NaOH/SDS) and gently invert the tube 4-6 times to mix. Do
not vortex, as this will result in shearing of genomic DNA. If necessary, continue inverting the
tube until the solution becomes viscous and slightly clear, but do not exceed 5 min because the
plasmid DNA may become irreversibly denatured.
4. Add 350L of Buffer N3 (neutralization, high salt buffer) and immediately invert the tube gently
4-6 times. The solution should become cloudy.
5. Centrifuge at maximum speed for 10 min. A compact white pellet will form with the “cleared
lysate” above it.
6. Using a pipette, transfer the supernatant from step 5 to the QIAprep column placed in a 2mL
collection tube.
7. Centrifuge 60 sec. at maximum speed. Discard the flow-through volume in an organic waste
container.
8. Wash the QIAprep spin column by adding 0.375mL of Buffer PE (containing ethanol) and
centrifuge 60 sec. at maximum speed. Discard the flow-through (organic waste). Repeat a second
time.
9. Discard the flow-through (organic waste), transfer to a centrifuge tube with the cap cut off and
centrifuge for an additional 1 minute to remove residual wash buffer.
IMPORTANT: Residual ethanol from Buffer PE may inhibit subsequent enzymatic reactions so
steps 8 and 9 are therefore very important.
10. Place the QIAprep column in a clean 1.5mL microcentrifuge tube with the cap cut off. To elute
DNA, add 50L of Buffer EB (elution buffer = 10mM Tris-HCl, pH 8.5) and centrifuge for 1
minute.
11. Transfer to a new microcentrifuge tube. MAKE SURE TO APPROPRIATELY LABEL THIS
PREPARATION AND TO STORE THE REMAINDER AT -20OC IN YOUR FREEZER
BOX SINCE YOU WILL NEED IT FOR EXERCISE 3 AS WELL AS FOR THE
PRACTICAL EXAM!
12. Transfer 5L of your preparation to a new tube and add a sufficient amount of loading dye to
have a final concentration of 1X or more.
13. Load your sample in the prepoured gel which has been prepared for you.
Molecular Biology-2017 34
Mapping of a yeast gene – Southern analysis (Groups of 2) Restriction mapping of plasmids is a relatively simple task given the low complexity of plasmids.
The same cannot be said of genomic DNA. A technique which was developed to perform restriction
analysis of complex DNA such as genomes is the Southern. The principal of this technique relies on
the digestion of the DNA of interest, followed by electrophoresis, denaturation, transfer to a solid
support and finally hybridization to a complementary probe directed against the region of interest.
Given the advent of PCR and sequencing, Southern analysis is not much used nowadays. However,
this type of analysis remains useful to…
― find the position of a sequence in a large DNA fragment
― detect chromosomal rearrangements
― determine the number of copies of a gene
― find sequences with low homology
― analyze unsequenced DNA from an unknown organism
Isolation of yeast genomic DNA
Materials provided:
Pellet from 2mL yeast culture
Lysis buffer
Screw cap tube containing glass beads and 200μL phenol:chloroform:isoamyl alcohol (25:24:1)
99% ETOH
RNAse (In ice bucket at the front)
4M ammonium acetate
Method:
1. Suspend yeast pellet in 200μL of lysis buffer.
2. Transfer yeast suspension to screw cap tube containing glass beads and 200μL
phenol:chloroform:isoamyl alcohol (25:24:1).
3. Vortex for 1 minute, then place on ice for 1 minute.
4. Repeat step 3 two more times.
5. Centrifuge at maximum speed for 5 minutes. Transfer the upper aqueous phase to a new
microcentrifuge tube. AVOID TAKING ANY OF THE INTERPHASE!
6. Add 1ml of 99% ETOH to the aqueous phase, mix well by inversion and spin at maximum speed
for 2 minutes.
7. Discard supernatant and suspend pellet in 400μL water.
8. Add 2μL RNAse and incubate at 37oC 15 minutes.
9. Add 10μL 4M ammonium acetate, 1mL 99% ETOH, and Mix well.
10. Centrifuge at maximum speed for 2 minutes.
11. Discard supernatant and suspend pellet in 100μL water.
12. Prepare a 1/10 dilution in water in a final volume of 250μL of a sample of your genomic DNA
isolation.
13. Label your diluted sample and give it to your teaching assistant so that he will obtain the reading
at 260nm.
14. Determine the concentration of your preparation.
Molecular Biology-2017 35
Digestion and electrophoresis of yeast genomic DNA
Method:
15. Having determined the concentration of your genomic DNA preparation, prepare a digestion of
5μg of DNA with 20 units of the enzyme BamHI in a reaction volume of 50μL.
16. Perform the digestion for 1 hour at 37oC.
17. Following the incubation period, transfer 15μL to a new tube and then add a sufficient amount of
5X DNA loading buffer to obtain a final concentration of 1X or more.
18. A picture of the gels will be taken following their migrations. The gels will then be transferred to
a membrane which will be hybridized with a probe against a yeast gene.
19. The results of the hybridizations will be available on the T:\ drive.
Molecular Biology-2017 36
Exercise 3
What are we doing today!
Site directed mutagenesis and cloning of GFP
PCR amplification and mutagenesis of GFP
Purification of PCR reactions with QIAQUICK
Digestion of GFP PCR product and pUC19 vector
Ligation of GFP amplicons
Molecular Biology-2017 37
Site directed mutagenesis and cloning of GFP (Groups of 2)
The ultimate goal of this project is to use PCR to mutagenize the GFP protein. To achieve this goal
you will use the polymerase chain reaction to amplify and perform site directed mutagenesis of the
gene. This project involves several parts which will be performed over the next two weeks. Consult
the following web pages to refresh your knowledge on PCR:
http://www.maxanim.com/genetics/PCR/PCR.htm
http://www.dnalc.org/resources/animations/pcr.html
Overview of the steps which will be performed are presented in the flowchart below.
PCR amplification and mutagenesis of GFP (Step I)
Cleanup of GFP PCR products (Step II)
Digestion of GFP PCR products with HindIII and EcoRI (Step III)
Digestion of Qiagen purified pUC19 with HindIII and EcoRI (Step III)
Cleanup of digested GFP PCR products or digested pUC19 vector (Step IV)
Ligation of GFP PCR products in digested pUC19 vector (Step V)
Transformation of ligations in E.coli Xl-1 (Step VI; this will be done for you)
Screening of transformants (Step VII; to be done next week)
Molecular Biology-2017 38
Step I: PCR amplification and mutagenesis of GFP Primers have been designed to amplify and mutagenize the coding sequence of the GFP gene in the
plasmid pGFPuv. The primers you will use are indicated below.
“Forward” primers:
GFPfor-1: CGCCAAGCTTGCATGCCTGCAGGTCG
GFPfor-2: CGCCAAGCTTGcCATGCCTGCAGGTCG
GFPfor-3: CGCCAAGCTTGaCATGCCTGCAGGTCG
Characteristics:
A HindIII (AAGCTT) site is indicated in italics and underlined and will be used for cloning.
“Reverse” primer:
GFPrev: CCGTCTCCGGGAGCTGCATGTGTCAG Method:
Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L
thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each
component use a new autoclaved tip. Note: The Taq polymerase will be added by the T.A.
Ingredients Stock Conc. Final Conc. Volume
Water Complete to 50µL
Taq PCR buffer 10X 1X
*Assigned GFPfor primer 2µM 0.2µM
GFPrev primer 2µM 0.2µM
MgCl2 50mM 1.5mM
dNTP 2mM 200µM
pGFPuv - 5 µL
Taq polymerase 5 units/µL 0.05 units/µL
* Make sure that you record which reverse GFP primer you were assigned!
Once your reaction setup is completed give them to your teaching assistant.
PCR amplification conditions:
1. 1 cycle of 5min, 94oC to denature;
2. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.
3. 1 cycle of 5min, 72oC.
4. Cool to 4oC indefinitely.
Molecular Biology-2017 39
Electrophoresis of GFP PCR amplicons Once the PCR reactions completed you will use agarose gel electrophoresis to determine whether
your amplification was successful before initiating the cloning.
Method:
1. Obtain your PCR reactions.
2. Transfer 8 L of your PCR products into new tubes and add 2.5L of 5X loading buffer. Return
the remainder on ice for subsequent experiments.
3. Load your samples on a 1% agarose gel, that has been prepared for you, containing ethidium
bromide and on which appropriate DNA size markers have been loaded.
4. Examine under UV light and take a picture for analysis.
Step II: Purification of PCR reactions with the QIAQUICK purification kit (Assigned groups of 2)
Method:
1. Add 5 volumes of Buffer PB to 1 volume of the PCR reaction and mix by inversion.
2. Place a QIAQUICK spin column in a 2mL collection tube.
3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.
4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back
into the same tube.
5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.
6. Discard the flow-through to ORGANIC WASTE.
7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.
8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into
the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol
from Buffer PE that may elute with the DNA and interfere with subsequent steps.
9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.
10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK
spin column, wait 1 minute and then centrifuge for 1 minute.
11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK
spin column and centrifuge for 1 minute.
12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store until needed.
(If you were unable to recover 30L, add elution buffer to bring the volume up to 30L).
Molecular Biology-2017 40
Step III: Digestion of GFP PCR product and pUC19 vector (Assigned groups of 2)
Method:
One of the groups of two will perform the digestion of the GFP amplicon whereas the other
group of two will perform the digestion of the pUC19 vector.
1. Setup a reaction mixture of 50µL to perform HindIII-EcoRI double digests of the GFP PCR
product and the pUC19 vector you purified by the Qiagen method last week.
Volume PCR Volume Vector
GFP PCR product 10µL ---------
OR pUC19 vector --------- 5µL
Red 10X Restriction buffer 5µL 5µL
HindIII 1µL 1µL
EcoRI 1µL 1µL
Water Complete to 50µL Complete to 50µL
2. Perform the digestion at 37oC for 1 hour.
Step IV: Purification with the QIAQUICK kit of digested PCR products or
pUC19 (Assigned groups of 2)
Method:
1. Add 5 volumes of Buffer PB to 1 volume of the restriction mixture and mix by inversion.
2. Place a QIAQUICK spin column in a 2mL collection tube.
3. To bind DNA, apply the sample to the QIAQUICK spin column and centrifuge for 1 minute.
4. Discard the flow-through to ORGANIC WASTE and place the QIAQUICK spin column back
into the same tube.
5. To wash, add 0.375mL of Buffer PE to the column and centrifuge for 1 minute.
6. Discard the flow-through to ORGANIC WASTE.
7. Wash again by adding 0.375mL of Buffer PE to the column and centrifuge for 1 minute.
8. Discard the flow-through to ORGANIC WASTE. Place the QIAQUICK spin column back into
the same tube. Centrifuge for 1 minute. This second centrifugation removes any residual ethanol
from Buffer PE that may elute with the DNA and interfere with subsequent steps.
9. Place the QIAQUICK spin column into a new labelled 1.5mL microcentrifuge tube.
10. To elute DNA add 30L of Buffer EB (10mM Tris-HCl, pH 8.5) to the centre of the QIAQUICK
spin column, wait 1 minute and then centrifuge for 1 minute.
11. Using a new pipette tip, transfer the recovered liquid BACK onto the center of the QIAQUICK
spin column and centrifuge for 1 minute.
12. Transfer the recovered liquid into a labelled 1.5mL microcentrifuge tube and store in your
freezer box. (If you were unable to recover 30L, add elution buffer to bring the volume up to
30L).
Molecular Biology-2017 41
QIAquick Spin Purification
Procedure
PCR reaction
or
Solubilized gel slice
or
Enzyme reaction
Bind
Wash
Elute
Molecular Biology-2017 42
Step V: Ligation of GFP amplicons Having digested the GFP PCR amplicon and the pUC19 vector you will now proceed with the
ligation. Your ultimate goal is to clone the amplified GFP sequence in the pUC19 vector.
Ingredient Tube 1 Tube 2
Digested pUC19 5.0L 5.0L
10 X ligase buffer 2.0L 2.0L
Digested GFP PCR amplicon 5.0L 0.0L
Water add water to complete the volume to 19.0L
Ligase 1.0L 1.0L
GIVE YOUR LABELED SAMPLES TO THE DEMONSTRATOR
The ligations will be incubated at room temperature until tomorrow and then transformed in E.coli
Xl-1.
Molecular Biology-2017 43
Exercise 4
What are we doing today!
Mutagenesis and cloning of GFP - Analysis of transformations
Colony counts
Colony PCR
Restriction digest of colony PCR products
Molecular Biology-2017 44
Mutagenesis and cloning of GFP (Groups of 4)
Analysis of transformation results
The ligations you performed last week were used to transform the E.coli strain Xl-1 blue. You have
been supplied with the transformation plates to continue with the analysis of the cloning experiment.
Obtain the following data for each of the transformation plates provided:
Reverse primer used for the amplification and mutagenesis
Total number of colonies observed
Number of white colonies
Number of blue colonies
Number of green fluorescent colonies
Make sure to obtain this data for each of the mutagenesis experiments performed (i.e. each of the
three different forward primers.
PCR screening of transformants
Once you have recorded your counts you will use PCR and a digestion to screen the recombinants
for inserts (and view PCR products after electrophoresis).
Method:
1. Label 7 microcentrifuge tubes from 1-7.
2. Add 50L of water to each of the tubes.
3. Using a sterile pipette tip, pick one of the blue colonies from a plate representing the
transformation of plasmid + insert and place the tip in the corresponding tube labelled 1.
4. Repeat the above procedure for 6 white colonies. If you had white colonies which were
fluorescent and some which were not, pick three of each. If all the white colonies were also
fluorescent, then pick 6 of these.
5. Briefly vortex each of the 7 tubes containing the pipette tip, to suspend the colony (Hold the tip
while vortexing).
6. Remove the tip from each tube, close the tube, and boil for 5 minutes. Place on ice for 1 minute.
7. Centrifuge at maximum speed for 5 minutes. You will be using the supernatant for the PCR
analysis.
8. Prepare a PCR cocktail for 8 reactions of 20L. KEEP ON ICE. Below is the recipe for a single
20L reaction.
PCR Reaction
Solution Stock conc. Final conc.
Water L to a final volume of 20 L
Taq PCR buffer 10 X 1 X
MutScreenFor primer 2 M 0.2 M
MutScreenRev primer 2 M 0.2 M
MgC12 50 mM 2.5 mM
dNTPs 2 mM 200 M
Taq DNA Pol. 5 U/L 0.25U/L
Molecular Biology-2017 45
9. Distribute 19L of cocktail to each of 7 appropriately labelled PCR tubes (ON ICE)
10. Add 1L of each of the colony supernatants you obtained in step 7 to each of the appropriate
PCR tubes.
11. Prepare a 1.25% agarose gel containing ethidium bromide.
PCR conditions:
i. 1 cycle of 5min, 94oC to denature;
ii. 30 cycles of 30sec 94oC to denature, 1 min at 68oC to anneal and extend.
iii. 1 cycle of 5min, 72oC.
iv. Cool to 4oC indefinitely.
Primers:
Forward : AGCTCACTCATTAGGCACCCCAGGC
Reverse: ATCGGTGCGGGCCTCTTCGC
Restriction digestion of colony PCR products:
1. Obtain your PCR reactions.
2. Prepare 7 BamHI digestions, one for each of your PCR reactions, in a final volume of 20µL
containing 5µL of each of your PCR reactions.
3. Prepare an undigested control, using any of the 7 PCR reactions.
4. Digest for one hour.
5. Following the digestion, add 5µL loading buffer to each sample.
6. Load 10L of each mixture, as well as the molecular weight ladder, on your 1.25% agarose.
Migrate for 1 to 1.5 hours at 100 V.
7. Take a picture of your gel.
Molecular Biology-2017 46
Exercise 5
What are we doing today!
Gene expression - Transcription
Yeast RNA isolation
RNA electrophoresis
Principals of RT-PCR
Molecular Biology-2017 47
Gene expression - Transcription The information contained within our genomes is of little use, unless the cell can decode it to
produce useful products that can perform work. This information is contained within units called
genes (or coding DNA). The expressed product of a gene can be either RNA or protein. However,
not every gene product is needed at all times, nor are they needed in the same amounts. It would be
very energetically demanding and wasteful for a cell to express every gene all the time. Furthermore,
an inappropriate ratio between the different gene products may hinder their function and be harmful
to the cell or the organism. Consequently, the cell regulates the expression of genes in response to
different intracellular and extracellular cues. The first step in gene expression is transcription a
process whereby the enzyme RNA polymerase reads the DNA sequence of a gene to generate either
a coding transcript (mRNA) or a non-coding transcript such as ribosomal RNA or tRNA. Thus the
first step in the study of gene expression is to examine the relative abundance of an RNA of interest
among the population of total RNA expressed at a given time under different conditions.
Yeast RNA isolation (Groups of 2)
Each group of two will be provided with a yeast culture which was subjected to one of the following
environmental condition:
Cultures exposed to 0.85M NaCl for 0 minutes.
Cultures exposed to 0.85M NaCl for 30 minutes.
Cultures exposed to 0.85M NaCl for 60 minutes.
Cultures exposed to 0.85M NaCl for 120 minutes.
Make sure you record which environmental condition you were assigned. You will need this
RNA preparation for experiments which are to be performed next week.
Method: (Steps 1-3 have been done for you)
1. Obtain 10mL of the assigned yeast culture.
2. Centrifuge for 10 minutes at 7 000 rpm.
3. Discard supernatant.
4. Suspend pellet in 200μL lysis buffer.
5. Transfer to a screw cap tube containing glass beads and 200μL phenol : chloroform : isoamyl
alcohol (25:24:1).
6. Vortex 2 minutes and then place on ice two minutes.
7. Repeat step 6 two more times.
8. Centrifuge at maximum speed for 5 minutes. Transfer the upper aqueous phase to a new tube.
9. Add 0.1 volumes of 3M NaOAc and 1mL 99% ETOH. Mix by inversion and centrifuge at
maximum speed for 2 minutes.
10. Discard supernatant and suspend pellet in 100μL DEPC treated water.
11. Determine yield and purity.
Molecular Biology-2017 48
RNA electrophoresis (Groups of 4) Having isolated total RNA from a given condition, it can be run on an agarose gel to assess, its
quality and to verify the correspondence with the predicted yield according to the absorbance at
260nm. Typically, RNAs are separated as a function of their size on denaturing formaldehyde
agarose gels. This type of gel provides denaturing conditions that prevent base-pairing and thus
reduce RNA secondary structure. This is important because unlike double-stranded DNA fragments,
which have the same conformation regardless of length, single-stranded RNAs can adopt different
conformations due to intra-strand base-pairing. This would affect electrophoretic migration.
Methods:
A. Preparation of an agarose-formaldehyde gel (One gel per groups of 4) 1. To prepare a 1.5% agarose-formaldehyde gel (25mL) (using the 8 well comb), combine the
following:
5X MOPS buffer 5mL
H20 15.5mL
Agarose 0.375g
2. Dissolve agarose in microwave oven. Cool slightly; then add 4.5mL of formaldehyde (37%
solution) (WORK IN THE FUMEHOOD. CAUTION! VOLATILE FUMES). Swirl to mix
and cast the gel immediately.
3. Close the cover and let the gel set for at least 30 minutes.
B. Preparation of RNA samples (Each group of 2)
1. To prepare the RNA samples prior to loading on the gel, each group of two will mix the
following components using labelled tubes KEPT ON ICE:
Final volume = 30L
RNA sample: L (This volume should contain 5g in a maximum volume of 9L)
Loading buffer: 21L (RNA loading buffer not the DNA loading buffer)
Water to 30 L: L
2. Incubate your samples at 700C for 10 minutes and then place the samples on ice. If there is liquid
on the side of the tube, spin in the microcentrifuge for a few seconds.
3. Load 14L aliquots of each of the RNA samples on your gel:
C. Gel electrophoresis 1. The gel running buffer will be 1X MOPS buffer. Run the gel at 80 V (current ~80 mA) until the
bromophenol blue dye is further than half way down the gel.
2. Remove the gel from the electrophoresis chamber, observe under U.V. and take a picture.
NB: Formaldehyde gels are MORE FRAGILE than non-denaturing gels so be extra careful!
Molecular Biology-2017 49
PRINCIPALS OF RT-PCR (Groups of 2) A method commonly used for the analysis of RNA transcripts is RT-PCR, or a technique derived
from this one, Q-PCR (Real time PCR).
In contrast to standard PCR reactions, RT-PCR is an amplification that uses RNA rather than DNA
as template. However, since the thermostable DNA polymerase that is used in the PCR reaction can
only use DNA as a template, the RNA of interest must first be transcribed into DNA. This can be
accomplished by the RNA-dependent DNA polymerase reverse transcriptase (RT). Initially, reverse
transcriptase is used to synthesize a single-stranded complementary DNA (cDNA) strand of the RNA
of interest. Once the cDNA has been generated, a standard PCR reaction can be used to amplify the
DNA sequence complementary to the mRNA. This can be done either through end-point PCR
(classical PCR) or real time PCR.
Consult the following web site for an overview of RT-PCR:
http://www.bio.davidson.edu/courses/Immunology/Flash/RT_PCR.html
The following experiment has been designed to show you the principals of RT-PCR. We will
examine the expression of the yeast gene YRA1. Essentially, total RNA will be isolated from yeast
cells. Then, all mRNA which are typically polyadenylated will be converted to cDNA using an oligo
dT primer and reverse transcriptase. Specific primers against the YRA1 gene will then be used on the
cDNA template to perform an end point PCR. Following the analysis of the results obtained, you
should be able to answer the following questions:
Are the amplification products observed derived from cDNA or contaminating genomic DNA? In
other words are the products RT dependent or independent?
Is the gene expressed under the conditions examined?
Is the transcript processed?
Isolation of total RNA (R)
↓
DNase treatment of RNA (DR)
↓
Reverse transcriptase reaction of non-DNase treated (R) and DNase treated (DR) RNA
↓
End-point PCR
Molecular Biology-2017 50
Method:
Step I: Preparation of RNA samples for RT reactions:
1. Prepare the following mixture from your RNA preparation. This dilution will then be used as
your source of RNA for all the following reactions. Store the remainder of your undiluted
RNA in your freezer box until next week.
4.0g of your RNA sample
5.0L of 10X DNAse I Buffer
Water to a final volume of 48L
LABEL THIS SAMPLE “R”: NON-DNASE TREATED RNA
STORE THE REMAINDER OF YOUR UNDILUTED RNA PREPARATION IN YOUR
FREEZER BOX. YOU WILL NEED IT FOR EXPERIMENTS TO BE PERFORMED NEXT
WEEK
Step II: DNAse treatment of total RNA:
2. Prepare the following reaction mixture to treat your RNA with DNAse:
24L of non-DNase treated RNA prepared above (R)
1L DNAse I
3. Incubate at room temperature for 15 minutes. Following the DNAse I treatment, inactivate the
enzyme by adding 2.5L of 25mM EDTA and heating at 65oC for 10 minutes. Chill on ice.
LABEL THIS SAMPLE “DR”: DNASE TREATED RNA
Molecular Biology-2017 51
Step III: Reverse transcriptase reactions:
4. Prepare the following RT reactions in 2 PCR tubes labelled RT-R and RT-DR. Use a new
autoclaved tip for each component added.
5. Add 19L of DEPC treated water to each tube
6. Add 4.0L of the oligo-dT primer to each tube.
7. Add 4.0L of a 2mM dNTP mixture to each tube.
8. Add 2L of your non-DNAse treated RNA (R) to the tube labelled RT-R.
9. Add 2L of your DNase treated RNA (DR) to the tube labelled RT-DR.
10. Allow annealing of the oligo-dT primer by incubating your RT pre-reaction mixture at 70oC for 5
minutes.
11. Let your tubes slowly cool down on the bench for 5 minutes.
12. Add 8.0L of 5X RT buffer to each tube.
13. Add 2.0L of 100mM DTT for a final concentration of 5mM to each tube.
14. Add 1.0 L MMLV reverse transcriptase at 200U/L for a final concentration of 5U/L to each
tube.
15. Incubate at 42oC for 60 minutes.
16. Inactivate the RT enzyme by incubating the reaction mixture at 70oC for 15 minutes.
Step IV: PCR reactions: 1. Following the RT reactions, prepare 5 PCR reactions with the following templates:
Reaction Template Volume to be used in PCR
reaction
PCR-1 R (Step I) 1L of a 1/20 dilution
PCR-2 DR (step II) 1L of a 1/20 dilution
PCR-3 RT-R (step III) 1L
PCR-4 RT-DR (step III) 1L
PCR-5 Yeast genomic DNA (Provided) 1L
Ingredient Stock conc. Final conc. Vol. for 50L reaction
Water - - L to a final volume of 49L
Taq buffer 10 X 1X
Template (see above) - - 1L
YRA (For) primer 2M 0.2M
YRA (Rev) primer 2M 0.2M
MgCl2 50 mM 2.0mM
dNTP 2mM 200M
Taq Polymerase 5 units/µL 0.05 units/µL
Primers:
YRA (FOR) CCCGTGTCGGTGGTACTCGTG
YRA (REV) GTCCGCCATTTCCTTGTCCAGAT
Molecular Biology-2017 52
2. Once your PCR reactions have been prepared, place them in the ice bucket at the front for the
PCR to be performed.
3. Your PCR reactions will be returned to you once completed.
Your PCR reactions will be performed under the following conditions:
i. 1 cycle: 5 min, 94oC denaturation;
ii. 30 cycles: 30 sec, 94oC denaturation; 30 sec, 70oC annealing and extension.
iii. 1 cycle: 5 min, 72oC.
iv. Cool down at 4oC.
Step V: Analysis of RT-PCR reactions
1. Pour a 1.5% agarose gel.
2. Obtain your RT-PCR reactions.
3. Add the appropriate amount of DNA loading buffer to 10µL samples of each of your reactions.
4. Load and fractionate at 100V.
5. Following the migration, visualize under UV and take a picture.
Molecular Biology-2017 53
Exercise 6
What are we doing today!
Transcriptional control of yeast CTT1 gene
RT-PCR
Northern analysis
Molecular Biology-2017 54
Transcriptional control of the yeast CTT1 gene (Groups of 2) Several different conditions influence the expression of global response networks which comprise
several genes which are coordinately regulated to cope with various stressors. One of these genes is
the CTT1 gene of the yeast Saccharomyces cerevisiae, which is part of a network of stress-protective
genes. The CTT1 gene codes for the enzyme catalase. Catalase is an enzyme found in the cells of
most aerobic organisms which breaks down free radicals resulting from oxidative metabolism.
Specifically, catalase carries out the following reaction:
This week we will examine the expression of CTT1 at the transcriptional level following an osmotic
shock of yeast cells. RT-PCR will be used to examine the expression of the CTT1 gene in yeast cells
exposed to an osmotic shock for different durations. To compare the relative abundance, and thus
expression of the CTT1 gene, normalization will be performed to a second gene, a house keeping
gene; actin. Actin expression is known to not be part of the global stress network of genes and its
expression should therefore remain constant. This experimental approach will be compared to
another method, northern analysis. In this case, RNA is fractionated on a denaturing gel, as you did
last week, transferred to a solid support and then probed with sequences targeting the transcripts of
interest.
Method:
1. Last week, each group of two isolated total RNA from a yeast culture representing one of the
following conditions:
Cultures exposed to 0.85M NaCl for 0 minutes.
Cultures exposed to 0.85M NaCl for 30 minutes.
Cultures exposed to 0.85M NaCl for 60 minutes.
Cultures exposed to 0.85M NaCl for 120 minutes.
Obtain your RNA sample from your freezer box and prepare the following mixture. This dilution will
be used as your source of RNA for all subsequent reactions.
4.0g of your RNA sample
5.0L of 10X DNAse Buffer
Water to a final volume of 48L
2. Prepare the following reaction mixture to treat your RNA with DNAse:
24L of the RNA dilution prepared in step 1
1L DNAse I
3. Incubate at room temperature for 15 minutes. Following the DNAse I treatment, inactivate the
enzyme by adding 2.5L of 25mM EDTA and heating at 65oC for 10 minutes. Chill on ice.
2H2O2 2H2O + O2
Molecular Biology-2017 55
4. Prepare the following reverse transcriptase reaction:
Ingredient Volumes
DEPC treated Water 19L
Oligo dT 4L
2mM dNTP 4L
DNase treated RNA 2L
Allow annealing of the oligo-dT primer by incubating your RT pre-
reaction mixture at 70oC for 5 minutes.
Then let your tubes slowly cool down on the bench for 5 minutes.
Following the annealing step, add the following ingredients 5X RT buffer 8L
100mM DTT 2L
MMLV 1L
Incubate at 42oC for 60 minutes. Then, inactivate the RT enzyme by
incubating the reaction mixture at 70oC for 15 minutes.
5. Following the RT reaction, prepare two PCR reactions: One to amplify actin and one to amplify
CTT1.
Ingredient Stock conc. Final conc. Volumes
Water L to a final volume of 50L
Taq buffer 10X 1X
Template (see above) - - 1L cDNA from step 4
Actin primer (For)
or
CTT1 primer (For) 2M 0.2M
Actin primer (Rev)
or
CTT1 primer (Rev) 2M 0.2M
MgCl2 50mM 2.0mM
dNTP 2mM 200M
Taq Polymerase 5 units/µL 0.05 units/µL
6. Once your PCR reactions have been prepared, place them in the ice bucket at the front for the
PCR to be performed.
7. Your PCR reactions will be returned to you once completed.
Molecular Biology-2017 56
Analysis of RT-PCR reactions (Groups of 4)
1. Pour a 1.5% agarose gel with the 10 wells comb.
2. Obtain your RT-PCR reactions.
3. Add 15µL of 5X DNA loading buffer to the total volume of each of your two PCR reactions.
4. Each group of 4 will load a gel as follows. Note that the 4 groups of a given table will have to
share their samples among themselves.
Lane Molecular weight ladder
1 RT-PCR of actin from cultures exposed to 0.85M NaCl for 0 minutes.
2 RT-PCR of actin from cultures exposed to 0.85M NaCl for 30 minutes.
3 RT-PCR of actin from cultures exposed to 0.85M NaCl for 60 minutes.
4 RT-PCR of actin from cultures exposed to 0.85M NaCl for 120 minutes.
5 Empty
6 RT-PCR of CTT1 from cultures exposed to 0.85M NaCl for 0 minutes.
7 RT-PCR of CTT1 from cultures exposed to 0.85M NaCl for 30 minutes.
8 RT-PCR of CTT1 from cultures exposed to 0.85M NaCl for 60 minutes.
9 RT-PCR of CTT1 from cultures exposed to 0.85M NaCl for 120 minutes.
10 Empty
5. Carry out the migration at 100V for approx. 45 minutes.
6. Following the migration, visualize under UV and take a picture.
Molecular Biology-2017 57
Northern analysis Since the advent of RT-PCR and Q-PCR, the use of a Northern analysis to study gene expression has
been almost phased out. However, some information can still be obtained from a northern
hybridization which cannot easily be obtained by PCR based techniques. These include the analysis
of the size of the transcript and post-transcriptional processing. As with Southern analysis, the RNA
to be analysed is initially separated according to size on a denaturing agarose gel after which it is
transferred and probed. In the following exercise you will perform an analysis of a northern blot
which was performed on RNA isolated from yeast under the same growth conditions as you did for
the RT-PCR. You will then compare the results of this analysis to those you obtained by RT-PCR.
Method: (Note, this must be completed during the lab period)
1. Provided to you are two northern hybridizations of duplicate RNA gels representing yeast
subjected to an osmotic shock for varying durations. One of the gels was probed with the CTT1
gene whereas the other was probed with the house keeping gene; actin. These blots are available
on this course’s web page.
2. Use the program ImageJ to analyze each of these gels. Follow the tutorial for the use of ImageJ
available on this course’s web page. The program is available on the hard drive of your computer
in the week 5 folder.
3. Complete the following table and then ask one of your teaching assistants top verify that you’ve
completed the task.
Source of
RNA
Raw data from Image J Normalized values of
CTT1
Relative
expression* CTT1 Actin
0.85M NaCl
0 minute
1
0.85M NaCl
30 minutes
0.85M NaCl
60 minutes
0.85M NaCl
120 minutes
* Indicate the relative expression of CTT1 as compared to the zero minute exposure.
Molecular Biology-2017 58
Exercise 7
What are we doing today!
Genomic fingerprinting
Isolation of genomic DNA from cheek cells
PCR amplification of ApoC2 VNTR
PCR amplification of ApoB RFLP
Stringency – DNA melting curves
Molecular Biology-2017 59
Genomic fingerprinting (Groups of 2) The analysis of genomic polymorphisms has become a current trend to identify disease and non-
disease genotypes.
VNTR
The evolutionary principle of variation within a population is a cornerstone in biology. This variation
results from subtle differences in the DNA sequence in individuals of a given species. Variation
commonly originates by the mistaken duplication of a small sequence of nucleotides when only one
copy was present before replication. This results in a tandem repeat of the original sequence. If this
mistake occurs again in another round of replication, then three copies of a sequence will be in
tandem (figure). These tandem repeats are part of our chromosomes and as such, they will be
inherited according to Mendelian genetics. Over the centuries, the number of tandem repeat units has
increased, therefore each of us has inherited a variable number of tandem repeats (VNTRs) at many
loci scattered throughout our genomes. A VNTR can be thought of as a locus with each particular
number of repeated units being analogous to different alleles. Therefore, each human (except for
identical twins) carries a unique combination of VNTRs and these alleles can be used in population
studies or to identify a particular individual.
Figure. Illustration of variable number of tandem repeats (VNTRs). Single strands of DNA from the
same locus from three different individuals are shown. Within this region, the trinucleotide repeat
CAT is present once, twice, or three times which results in alleles of three different lengths.
RFLP
Another type of polymorphism which occurs is called restriction length Polymorphisms (RFLP).
These polymorphisms occur when a single nucleotide change occurs in a restriction site, thus
abolishing or changing it. Consequently, a given region of the genome may possess a restriction site
that is absent from the same region in another copy of the genome or in the genome of a different
individual.
Molecular Biology-2017 60
Isolation of genomic DNA from cheek cells:
1. One person from each group of two should use a sterile cotton swab to gently scrape the inside of
one cheek six times. Without rotating the swab, move the swab directly over to the inside of the
other cheek and gently scrape six times.
2. Insert the cotton portion of the swab into a 1.5mL microcentrifuge tube. Then, break off the stick
just above the cotton so that the cotton part falls into the tube.
3. Add 400µL of 1X PBS pH 7.4 to your sample tube.
4. Add 20µL of proteinase K followed by 400µL buffer AL. Mix immediately by vortexing for 15
seconds. Do not add proteinase K directly to buffer AL.
5. Incubate at 56oC for 10 minutes. Spin briefly to remove drops from tube walls and lid.
6. Add 400µL 99% ethanol. Vortex 8 to 10 seconds to mix. Spin briefly to remove drops from tube
walls and lid.
7. Apply 600µL of your mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for 1
minute. Change collection tube.
8. Apply remaining mixture to the column. Cap to avoid aerosols and centrifuge at 8k rpm for 1
minute. Change collection tube.
9. Add 500µL AW1 buffer. Cap and centrifuge at 8k rpm for 1 minute. Change collection tube.
10. Add 500µL AW2 buffer. Cap and centrifuge at maximum rpm for 3 minutes. Change collection
tube.
11. Centrifuge at maximum rpm for 1 minute to remove residual buffer and reduce carryover.
12. Place the QIAprep column in a clean 1.5-mL microcentrifuge tube with the cap cut off. Add
150µL AE buffer to the column. Wait 1 minute and then centrifuge at 8k rpm for 1 minute to
elute.
13. Transfer eluted DNA to a new properly labelled tube and store for future use.
Molecular Biology-2017 61
PCR amplification of VNTR of ApoC2 & the RFLP of ApoB Even numbered groups will amplify the RFLP of ApoB
Odd numbered groups will amplify the VNTR of ApoC2
Method:
Prepare your PCR reactions in a total reaction volume of 50L. In labelled PCR tubes (use 200L
thin walled PCR tubes) add the following ingredients in the order listed in the table below. For each
component use a new autoclaved tip. Note: the Taq polymerase will be added by the T.A.
Ingredients Stock
Conc.
Final Conc. Volume
Water Complete to 50µL
Taq PCR buffer 10X 1X
ApoB For or D1S80 For primer 2µM 0.2µM
ApoB Rev or D1S80 Rev primer 2µM 0.2µM
MgCl2 50mM 2.0mM
dNTP 2mM 200µM
Cheek Genomic DNA 5µL 5µL
Taq polymerase 5 units/µL 0.05 units/µL
Once your reaction setup is completed give them to your teaching assistant.
PCR amplification conditions:
1. 1 cycle of 5min, 94oC to denature;
2. 35 cycles of 30sec 94oC denature, 30sec 55oC (ApoB) or 65 oC (ApoC2) anneal, 1min 72oC
extend.
3. 1 cycle of 5min, 72oC.
4. Cool to 4oC indefinitely.
Analysis of DNA fingerprints
ApoB gene:
1. Obtain your PCR reactions for the ApoB gene.
2. Use 10µL of the PCR reaction to set up a restriction digest with the enzyme EcoRI in a final
volume of 20µL.
3. One group in the class will prepare an undigested control as well.
4. After having performed the digest for one hour, add loading dye and load on the pre-poured gel.
5. Once everyone has loaded the gels, these will be migrated and a picture taken.
ApoC2 gene 1. Obtain your PCR reactions for the ApoC2 gene.
2. Add loading dye to a 10µL sample of the PCR reaction.
3. Load on the pre-poured gel.
4. Once everyone has loaded the gels, these will be migrated and a picture taken for your analysis.
Molecular Biology-2017 62
Stringency This parameter describes the extent to which annealing can occur between strands of nucleic acids
under given environmental conditions. High-stringency conditions require a high degree of
complementarity between the molecules, while low-stringency conditions permit annealing even if
there are some mismatched bases. Typically, high-stringency conditions are achieved either by
reducing NaCl concentration or increasing temperature. Lower-stringency conditions are achieved by
increasing NaCl concentration or decreasing temperature. The level of stringency can be varied by
adjusting temperature, salt concentration or other chemical which impact the melting temperature of
nucleic acid hybrids.
This concept can be illustrated by the following formula: Notice that the percentage of G:C base
pairs has a direct impact on the melting point (Tm) of nucleic acid hybrids.
Below the Tm, double stranded nucleic acid hybrids will be favored. Whereas above the Tm, the
single stranded state will be favored. Consequently, any environmental condition (or chemical)
which reduces the Tm will increase stringency.
Tm = 81.5 + 16.6 (log M [Na+]) + 0.41 (%G+C) – 0.72 (% formamide) – 500/n – (% mismatches)
M : Molarity of monovalent positive ions
n : Length in bases of nucleic acid
For example, let’s determine the Tm of a 1 kb nucleic acid molecule which is 50% G : C in the
presence of either 0.1 or 0.2M NaCl .
Tm (0.1M NaCl) = 81.5 + 16.6(log 0.1) + 0.41(50) – 0.72(0) – 0.5 = 84.9oC
Tm (0.2M NaCl) = 81.5 + 16.6(log 0.2) + 0.41(50) – 0.72(0) – 0.5 = 89.9oC
Consequently, at 68oC a double stranded state would be favored at 0.2M NaCl, but the single
stranded state would be favored at 0.1M NaCl. Thus NaCl effectively decreased the stringency by
increasing the Tm and thus the maximum temperature at which the double stranded state can be
maintained.
Stringency - DNA melting curves (Groups of 2) Hyperchromicity or the hyperchromic effect is the property of biological polymers, and in particular
DNA and RNA, to see their UV absorption increase when they undergo denaturation. This property
is commonly used in biology to analyze spectrophotometrically the structure of nucleic acids
according to physico-chemical parameters (temperature, pH, ions…). Hyperchromicity can be used
to track the condition of DNA as temperature changes.
Molecular Biology-2017 63
In this exercise we will examine the effect of different environmental conditions on the denaturation
profile of genomic DNA. Specifically, you will determine the Tm based on different physico-
chemical parameters: temperature, formamide concentration, urea concentration, and the
concentration of positive ions.
Materials:
Heat blocks set at 55, 60, 65, 70, 75, 80, 85 and 90oC
Salmon sperm genomic DNA (50µg/mL)
1M NaCl
1M MgCl2
100% Formamide
50% Urea
Method:
1. Each group will be assigned one of the chemicals above. Prepare 9 500μL solutions with a final
concentration of 5µg/mL DNA and a final concentration of the assigned chemical as indicated
below:
0.25M NaCl
0.25M MgCl2
25% Formamide
25% Urea
2. Incubate for 5 minutes each of the eight mixtures at the temperatures indicated above in the
preset heat blocks.
3. Keep the ninth mixture at room temperature.
4. Following the incubation, rapidly chill on ice each of the eight mixtures.
5. Distribute 200µL of each mixture in a 96-well plate as shown below.
6. Once the plate has been loaded, the absorbance at 260nm will be determined.
Layout of the 96 well DNA assay plate
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 1
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 2
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 3
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 4
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 5
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 6
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 7
220C 550C 600C 650C 700C 750C 800C 850C 900C Group 8
Molecular Biology-2017 64
EXERCISE 8
What are we doing today!
Protein expression
Preparation of protein extracts
Protein quantification – Bradford assay
Protein gel electrophoresis
Molecular Biology-2017 65
Protein expression (Groups of 2) Throughout the semester we’ve examined the various techniques used in molecular biology to
analyse DNA and RNA. This week, we will see one of the most common techniques used to study
the proteins expressed within an organism. Specifically we will compare the protein profile within
the muscle tissues from different organisms. Assigned groups will be provided with frozen samples
from ground muscle tissues from different organisms.
Preparation of protein extracts
1. Suspend the tissue sample in 500µL lysis buffer [62.5 mM Tris-HCl, pH 6.8, 2% SDS].
2. Transfer the suspension to a screw cap tube containing glass beads.
3. Vortex for 1 minute followed by cooling on ice for 1 minute.
4. Repeat the previous step 3 times.
5. Centrifuge for 10 minutes at maximum speed in the microcentrifuge.
6. Transfer the supernatant to a new tube and keep on ice for further use.
Bio-Rad protein assay This method which is based on the method of Bradford, is used for determining concentration of
solubilised protein. It involves the addition of an acidic dye to a protein solution, and subsequent
measurement at 595nm with a spectrophotometer. Comparison to a standard curve provides a relative
measurement of protein concentration.
Materials
Dye reagent
BSA 5mg/mL
Method:
1. Prepare 200µL of each of the protein standard solutions of BSA at concentrations of 0.0, 0.05,
0.1, 0.2, 0.4 and 1.0mg/mL.
2. Prepare 200µL samples of your protein extracts which represent 1/4 and 1/10 dilutions.
3. Pipette 20μL of each standard and each of the protein extracts in appropriately labelled
microcentrifuge tubes.
4. Add 400μL of diluted dye reagent to each tube. Vortex each mix for 2-3 seconds.
5. Incubate at room temperature for at least 15 minutes.
6. Load 200μL of each of the reaction mixtures in the wells of a 96 well plate as illustrated below.
7. Obtain the readings of the absorbance at 595nm.
Bradford assay plate layout
0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 1
0 1/4 1/10 Protein
0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 2
0 1/4 1/10 Protein
0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 3
0 1/4 1/10 Protein
0.0 0.05 0.1 0.2 0.4 1.0 BSA Group 4
0 1/4 1/10 Protein
Molecular Biology-2017 66
SDS POLYACRYLAMIDE GEL ELECTROPHORESIS A common method for separating proteins by electrophoresis uses a discontinuous polyacrylamide
gel as a support medium and sodium dodecyl sulfate (SDS) to denature the proteins. SDS is an
anionic detergent, meaning that when dissolved its molecules have a net negative charge. A
polypeptide chain binds amounts of SDS in proportion to its relative molecular mass. The negative
charges on SDS destroy most of the complex structure of proteins, and are strongly attracted toward
the positively-charged electrode in an electric field. Polyacrylamide gels restrain larger molecules
from migrating as fast as smaller molecules. Because the charge-to-mass ratio is nearly the same
among SDS-denatured polypeptides, the final separation of proteins is dependent almost entirely on
the differences in relative molecular mass of polypeptides. In a gel of uniform density the relative
migration distance of a protein is negatively proportional to the log of its mass. Protein separation by
SDS-PAGE can be used to estimate relative molecular mass, the relative abundance of major
proteins in a sample, and to determine the distribution of proteins among fractions.
Materials:
2X Laemmli buffer (4% SDS, 20% glycerol, 125mM Tris pH 6.8, 0.004% bromphenol blue)
Prtotein extracts previously prepared
Protein molecular weight standards
Method:
1. Prepare your protein sample for loading on the SDS PAGE as follows:
Final volume = 10µL
Protein sample: µL (This volume should contain 20g in a maximum volume of 5L)
Loading buffer: 5µL 2X Laemmli loading buffer
Water (up to 5µl): µL
2. Heat for 10 minutes at 70oC, then chill on ice. Centrifuge for 1-2 secondes.
3. Load the whole sample on the prepoured 10% SDS PAGE gel.
4. Carry out the migration at 200V for approximately 30-40 minutes.
5. Once the migration complete, dissassemble and place the resolving gel in the coomasie staining
solution.
6. Microwave for 1 minute, and shake on the rocker for 10-20 minutes.
7. Replace the staining solution with the destain solution.
8. Microwave for 1 minute, then shake on the rocker until the bands become clearly visible.
9. Pour out the destain solution and replace with distilled water.
10. Take a picture.
Molecular Biology-2017 67
Staining Solution:
0.5 g Coomassie Brilliant blue R
800 ml methanol
Stir until dissolved. Then add:
140 ml acetic acid
Distilled water to 1L
Destaining Solution
40% methanol
7% acetic acid
The following is a list of the proteins common to all animal muscle, adapted from Alberts et al. 1994.
Protein MW (in kD) Function
Titin 3000 centers myosin in sarcomere
Dystrophin 400 anchoring to plasma membrane
Filamin 270 cross-links actin filaments into gel
Myosin heavy chain 210 slides actin filaments
Spectrin 265 attaches actin filaments to plasma membrane
M1/M2 190 myosin breakdown product
M3 150 myosin breakdown product
C protein 140 myosin breakdown product
Nebulin 107 regulates actin assembly
A-actinin 100 bundles actin filaments
Gelsolin 90 fragments actin filaments
Fimbrin 68 bundles actin filaments
Actin 42 forms filaments
Tropomyosin 35 strengthens actin filaments
Troponin (T) 30 regulates contraction
Myosin light chains 24, 17, 15 slides actin filaments
Troponin (I) 19 regulates contraction
Troponin (C) 17 regulates contraction
Molecular Biology-2017 68
Appendices
Molecular Biology-2017 69
Amino acid 3 letter code One letter code
alanine ala A
arginine arg R
asparagine asn N
aspartic acid asp D
asparagine or aspartic acid asx B
cysteine cys C
glutamic acid glu E
glutamine gln Q
glutamine or glutamic acid glx Z
glycine gly G
histidine his H
isoleucine ile I
leucine leu L
lysine lys K
methionine met M
phenylalanine phe F
proline pro P
serine ser S
threonine thr T
tryptophan try W
tyrosine tyr Y
valine val V
Molecular Biology-2017 70
Spectrophotometric Conversions
1 A 260 unit of double-stranded DNA = 50 µg/ml
1 A 260 unit of single-stranded DNA = 33 µg/ml
1 A 260 unit of single-stranded RNA = 40 µg/ml
Protein/DNA Conversions
1 kb DNA → 333 amino acids
→ 37 kDa protein
Average MW of an amino acid ≈ 110 daltons
Dalton (Da) is an alternate name for the atomic mass unit, and kilodalton (kDa) is 1,000
daltons. Thus a protein with a mass of 64 kDa has a molecular weight of 64,000 grams
per mole