MOLECULAR BASIS OF INHERITANCE.

• Nucleic acids.• Nucleic acids are the macromolecules present in all

living cell.• Freidrich Miescher was the first person isolated the

nucleic acids from the pus cells. He called it as nuclein.

• As it has an acidic nature, hence Altmann called it as nucleic acids.

• The two types of nucleic acids found in living organisms are,

1. Deoxyribonucleic acid [DNA]2. Ribonucleic acid [RNA].

• Deoxyribonucleic acid [DNA]• DNA is the genetic material of all living

organisms. This carries the coded information from one generation to another generation.

• It is a long polymer of deoxyribonucleotides.• The length of the DNA depends on, number of

nucleotide pair present in it.• In eukaryotic cell DNA is found nucleus. It is the

chief component of chromosomes. DNA also found in the mitochondria and chloroplasts

• Chemically DNA is composed of Deoxyribose sugar, Phosphate group and nitrogenous base .

• Deoxyribose sugar: It is a pentose sugar heaving the molecular formula C5H10O4.

• Phosphate group: The phosphoric acid forms the phosphate group.

• its molecular formula is H3PO4. It is responsible for acidic nature of DNA.

• Nitrogenous base: Nitrogenous base are the nitrogen containing compounds. These are mainly divided in to two types as

1. Purines .2. Pyrimidines.• Purines: Purines are the double ring heterocyclic

structural compounds. The two types of purines present in the DNA are Adenine (A) and Guanine (G).

• Pyrimidine: Pyrimidines are the single ring structured compounds. The two types of pyrimidines present in the DNA are Cytosine (C) and Thymine (T).

• Nucleosides: compounds formed by the combination of pentose sugar and Nitrogenous base is called nucleosides.

• A nitrogen base attached to the C1 of pentose sugar by N-glycosidic linkage.

• In DNA Nucleosides are formed by the combination of deoxyribose sugar and nitrogenous base .

• Adenine + deoxyribose sugar = Deoxyadenosine • Guanine + deoxyribose sugar = Deoxygaunosine.• Cytosine + deoxyribose sugar = Deoxycytidine.• Thymine + deoxyribose sugar =Deoxythymidine

• Nucleotides: The compound formed by the combination of phosphate groups with nucleosides is called nucleotides.

• The four types of nucleotides present in the DNA are,1. Deoxyadenosine monophosphate. 2. Deoxygaunosine monophosphate.3. Deoxycytidine monophosphate.4. Deoxythymidine monophosphate.

• Polynucleotide strand: Number of nucleotides linked each other by phospho-di-ester bond and forms a long chain of molecule called polynucleotide strand.

• The phospho-di-ester bond forms between 5th and 3ed carbon atom position of pentose sugar. Therefore polynucleotide strand contains 5th and 3ed end.

Structure of DNA or Double helix structure of DNA

• J.D.Watson and F.H.C.Crick first proposed the structural model of DNA in 1953.

• They got the Nobel Prize for their work in 1962.

• According to Watson and Crick model of DNA, ‘The DNA contains two polynucleotide strands coiled together in helical manner’. Hence the name Watson and Crick double helix structure of DNA is given.

James Dewey Watson: April 6th, 1928

Nobel prize winner at the age of 34 (1962)

Francis Harry Compton Crick: (8 June 1916 – 28 July 2004)

• The structure of DNA is as fallows,• The DNA is a double stranded polynucleotide

molecule.• Sugar and phosphate forms the backbone . The bases

projected to inside.• The two strands are coiled each other and arranged

antiparallely. I.e. if one strand has 5th to 3ed and other has 3ed to 5th in direction.

• The two strands of DNA have the common diameter of 20 0A.

• Adenine of one strand pairs with Thymine of another strand by two hydrogen bonds and vice versa.

• Guanine of one strand pairs with Cytosine of another strand by three hydrogen bonds and vice versa..

• Because of complementary base pairing arrangement, if one strand of polynucleotide sequence is known, another can be deduced.

• Ex: 5th AGCTTTACATACCGGAAAATTACAGT 3ed first strand.

• 3ed TCGAAATGTATGGCCTTTTAATGTCA 5TH second strand.

• The complementary strand twisted each other at the distance of 34 0A.

• Each twist of DNA contains 10 base pair.• The distance between these two base pairs are

3.4 0A.

• Central dogma• One way flow of genetic information from DNA to

protein is called central dogma.• DNA→ RNA→ Protein.• Packaging of DNA in prokaryotes:• Prokaryotes do not have definite nucleus.• The DNA is not scattered throughout the cell.• It is held together with some proteins in a region is

called ‘nucleoid’.• The DNA in nucleoid is organized in large loops held

be proteins.

• Packaging of DNA in Eukaryotes:• In eukaryotes DNA is stabilized with positively

charged, basic protein called Histones.• Histones are positively charged due to rich in basic

amino acids like Lysines and arginines.• Histones are organized to form a unit of eight

molecules called histone octamere.

• Negatively charged DNA wrapped around positively charged histone octamere to form a structure called nucleosome.

• The nucleosomes are seen as ‘beads-on-string’ structure under electron microscope.

• Nucleosome forms the repeating unit of a structure in nucleus called chromatin,

• The chromatin is packaged to form chromatin fibers. These are further coiled and condensed at metaphase stage to form chromosome.

• euchromatin: In the nucleus some loosely coiled regions of chromatin (light stained) is called euchromatin.

• Heterochromatin: In the nucleus more densely packed regions of chromatin (stains dark) are called Heterochromatin.

• Euchromatin is transcriptionally active than heterochromatin.

• Transforming principle:• Frederich Griffith conducted experiments to show

Transforming principle in bacteria• He conducted an experiment on mice and

pneumonia bacteria streptococcus pneumoniae. These bacteria are found in two strains, as

• 1 virulent (smooth strain) • 2 non-virulent (rough strain). • The S-strain bacteria produce capsule and is

pathogenic. • The R-strain lacks capsule and is non pathogenic.

• When the R-strains are injected into the mouse, it is a non pathogenic and does not causes pneumonia. The mouse continued to live.

• When the S-strains are injected into the mouse, that causes pneumonia and mouse dies.

• When heat killed S-strains are injected into the mouse that does not causes pneumonia. The mouse continued to live.

• When the heat killed S-strains and R-strain are mixed and injected into the mouse, that causes pneumonia and mouse dies.

• Conclusion of experiment:• R – Strain bacteria had been transformed by the

heat killed S-Strain bacteria.• The transformation of R-Strain to S-Strain is due

to transfer of Genetic material.• The biochemical nature of genetic material was

not defined from his experiment.

• Biochemical characterization of transforming principle:

• Oswald Avery, Colin Macleod and Maclyn McCarty. (1933-44) worked to determine the biochemical nature of the ‘transforming principle’ of Griffith’s experiment.

• They purified biomolecules (proteins, DNA and RNA) from the heat killed S strain. They added digestive enzyme of each, to see which one could transform live R cells to S cells.

• Heat killed S-Strain + protease + Live R-Strain → transforms R strain to S strain.

• Heat killed S-Strain + RNase + Live R-Strain → transforms R strain to S strain.

• Heat killed S-Strain + DNase + Live R-Strain → unable to transforms R strain to S strain.

• Conclusion of the experiments:• Protein of heat killed S-Strain is not the

genetic material• RNA of heat killed S-Strain is not the genetic

material.• DNA of heat killed S-Strain is the genetic

material.– Because DNA digested with DNase mixed

with R-strain unable to transform R-Strain to S-Strain.

• But all biologist are not convienced.

• The Genetic Material is DNA:• ‘DNA is the genetic material’ is proved by Alfred Hershey and

Martha Chase (1952).• They worked on the virus that infects bacteria called

bacteriophage.• During infection the bacteriophage first attaches the bacteria

cell wall. It inserts its genetic material into the bacterial cell.

• The viral genetic material became part of the bacterial genome. It manufactures more virus particle using host content.

• Hershey and Chase worked to discover whether it was protein or DNA from the viruses that entered the bacteria.

• Experiment :( blenders experiment)• They grew some viruses on a medium having radioactive

phosphorus . Some others on medium having radioactive sulfur.

• Viruses grown in radioactive Phosphorus have radioactive DNA but not radioactive protein. Because Phosphorus present in DNA not in protein.

• Viruses grown in radioactive sulfur have radioactive protein not radioactive DNA. Because sulfur present in protein but not in DNA.

• radioactive phages were allowed to infect E.coli bacteria. The phages transfer the genetic material to the bacteria.

• The viral coats were separated from the bacteria surface by blender.

• The virus particles were separated from the bacteria by centrifuge machine.

• Observation:• Bacteria infected with viruses that had radioactive DNA were

radioactive. No radioactivity in the supernatant.• Bacteria infected with viruses that had radioactive protein

were not radioactive. But radioactivity found in the supernatant.

• Conclusion of Experiment:• DNA is the infecting agent that made the bacteria radioactive

hence DNA is the genetic material not the protein.

• Criteria for genetic material:• It should be able to generate its replica

(replication)• It should be chemically and structurally stable.• It should provide slow changes (mutation) that

required for evolution.• It should be able to express itself in the form of

‘Mendelian Character’.• Protein dose not fulfill the criteria hence it is

not the genetic material.• RNA and DNA fulfill the criteria.

• Replication of DNA:• “It is the process by which DNA produces the exact

copies of the original DNA." • In eukaryotes, DNA is double stranded. The two

strands are complementary to each other because of their base sequences.

• Semi-conservative method of DNA replication• It is the most common method of DNA replication. • It takes place in the nucleus where the DNA is

present. • Replication takes place in the S-phase of cell cycle. • Deoxyribose nucleotides needed for formation of

new DNA strands are present in nucleoplasm.

• At the time of replication two strands of DNA separates.

• Each strand acts as a template for the formation of a new strand.

• A new strand is constructed on each old strand by complementary base pairing.

• Hence two exactly identical double stranded DNA molecules are formed.

• In each new DNA molecule, one strand is old while the other is newly formed. Hence, Watson and Crick described this method as semi-conservative replication. .

Semi conservative nature of DNA Mathew Messelson and Franklin start.

Semi conservative nature of DNA Mathew Messelson and Franklin stahl.• They grew E. coli on 15 NH4Cl culture medium. 15N

is the heavy isotope of nitrogen• Both strands of DNA have 15N (15N 15N).• These bacteria are Shifted to 14NH4Cl culture

medium• DNA extracted subjected to [Cesium Chloride

(CsCl)] CsCl density gradient centrifugations. • Hybrid/ Intermediate type of DNA (15N 14N)• After next generation equal amount of light DNA

(14N 14N) and hybrid DNA (15N 14N) are formed.

• Mechanism of DNA replication:• The process of DNA replication takes place by

number of substance, enzymes and proteins. They are,

• Substance: Deoxyribonucleotides.• Enzymes: DNA Helicase. DNA Polymarase III, II, I. RNA Primase. DNA ligase.• Protein: SSB [ single strand binding protein]

• Mechanism of replication starts at a specific point of DNA molecule called point of ori.

• At origin, DNA strand unwinds by breaking hydrogen bonds. This takes place with the help of an enzyme DNA Helicases.

• At the point separation it appears like a fork or a Y-shape. It is called replication fork.

• Each old DNA strand acts as a template for the synthesis of new strand.

• SSB protein attaches to un-winded strand and prevents rejoining.

• the synthesis of new DNA strand on old strand takes place by an enzymes DNA polymerase III. It adds new nucleotides through complementary base pairing.

• DNA polymerase III always synthesis new strand in 5 to 3 direction.

• The synthesis of new strand for the parent templet strand heaving 3 to 5 end is continuous. This strand is called leading strand.

• The synthesis of new strand for the parent templet strand heaving 5 to 3 end is discontinuous. It forms by small segments of DNA called Okazoki fragments. This strand is called lagging strand .

• During the formation of okazoki fragment RNA primase first synthesis RNA primer

• DNA polymarase III continuous the synthesis of okazoki fragment in 5 to3 direction.

• At the end RAN primer are replaced by deoxyribonucleotides with the help of enzyme DNA polymarase I.

• The okazoki fragments joins together with the help of an enzyme DNA ligase.

• DNA polymarase II once again checks and repairs the errors occurred in new strand.

Central dogma.• One way flow of information from DNA to m-

RNA and from m-RNA to protein is called central dogma.

Mechanism of Transcription.• The processes of transcription takes place by

1. DNA helicase.2. RNA polymerase II. 3. Ribonucleotides.

• Ribonucleoside monophosphate activates into ribonucleoside tri phosphate by phosphorylase enzyme and phosphoric acid. Hence ATP,GTP, UTP, CTP forms.

• Transcription begins by uncoiling of DNA at specific site called promoter region of cistron. It takes place by DNA helicase.

• RNA polymerase II recognizes and binds to the promoter sequence.

• RNA polymerase II synthesis RNA, always from 5’ to 3’ direction.

• Hence among two strands of DNA one strand 3’ to 5’ end act as a templet.

G C A G T A C A T G T C5' 3'

3' C G T C A T G T A C A G 5' template strand

coding strand

transcription

RNAG C A G U A C A U G U C5' 3'

• The complementary base for templet strand pairs to transcribe m- RNA.

• When the RNA polymerase reaches the terminator point, synthesis of RNA stops up.

• Newly synthesized m-RNA in eukaryotic is called hnRNA (heterogeneous RNA). It undergoes post transcriptional process by splicing.

• The eukaryotic m-RNA contains exons and introns. In splicing introns are removed and exons are joined in a defined order.

• hnRNA undergoes additional processing called as capping and tailing.

• In capping an unusual nucleotide methyl guanosine triphosphate is added to the 5 -end ′of hnRNA.

• In tailing, adenylate residues are added at 3 -′end as a template independent manner.

• Fully processed hnRNA, now called mRNA. It transported out of the nucleus for translation

Messenger RNA (m-RNA)

• It is the RNA that carries message from DNA to the site of protein synthesis. It represents about 5 to 10% of the total RNA of cell.

• It carries the genetic information in the form of triplet codons,

• m-RNA is a single stranded poly nucleotide chain.• The eukaryotic m-RNA contains a cap at 5th end

composed of 7 methyl gonosine. It is absent in prokaryotic m-RNA.

• Next to the cap it has non coding region called leader sequence.

• Next to it has an initiator codon. AUG. It initiate the protein synthesis.

• Next to initiator codon, the coding sequence is present. It codes for specific protein. It is called exon.

• Next to this terminator codon, UAA, UGA or UAG is present. It terminates the protein synthesis.

• Next to this again non coding region is present.• In eukaryotic m-RNA poly A tail is present at 3’ end.

Functions of r- RNA:1. It helps in binding of ribosomes to m-RNA.2. It acts as an enzyme(ribozymes), helps in

formation of peptide bond during protein synthesis.

Difference between DNA and RNADNA

• Has high molecular weight.

• Double stranded poly nucleotide chain.

• Deoxy ribose sugar is the pentose sugar.

• Thymine is present.• Unusual nitrogen bases

are absent• Genetic material of living

organism.

RNA• Has very low molecular

weight.• single stranded poly

nucleotide chain.• ribose sugar is the pentose

sugar.• Uracil is present.• Unusual nitrogen bases are

present.• Genetic material of some

virus.

Note:• RNA polymerase is also called DNA dependent RNA

polymerase.• RNA polymerase I is found in nucleolus and helps in

synthesis of r- RNA. Hence nucleolus is called ribosome factories of cell.

• RNA polymerase II helps in synthesis of m-RNA.• RNA polymerase III helps in synthesis of t-RNA.• Ribosomal RNA is the insoluble RNA.• Pribnow box: It is a DNA sequence found in the

promoter region of genes in prokaryotes. It has the sequence of TATAATG.

• TATA box: The TATA box (Goldberg-Hogness box) is a DNA sequence found in the promoter region of genes in eukaryotes. It has the sequence of TATAAAT.

Concept of gene.• Gene is the basic unit of inheritance that express

specific character. • 1857 - Gregor Johann Mendel conducted

hybridization experiments with pea plants. He called them as factors.

• 1909 - Danish botanist Johannsen proposed that each portion of a chromosome that controls a phenotype is called a “gene” (Greek: “to give birth to”).

• 1941 - George W. Beadle and Edward L. Tatum discovered that genes control the production of enzymes. They proposed One gene one enzyme hypothesis.

• 1944 - Oswald T. Avery announced that DNA is the substance responsible for heredity.

• 1950’s – Watson and Crick discover chemical structure of DNA,

• The gene is made up of a specific sequence of DNA nucleotides.

• Symer Benzer proposed modern concept of gene, while working on Ecoli and T4 bacteriophage.

• According to him gene is ,1. Cistron.2. Recon.3. Muton.4. Replicon

• Cistron: It is the structural gene. It is functional unit of DNA molecule that codes for specific protein.

• Recon: It is the unit of DNA that undergoes recombination.

• Muton: It is the unit of DNA that capable to undergo mutation.

• Replicon: It is the unit of DNA that undergoes preplication.

• Genetic code: The three specific nucleotide sequence that codes for specific amino acid present in DNA is called genetic code.

• Codon: The three specific nucleotide sequence that codes for specific amino acid present in m-RNA is called codon.

• Anti codon: The three specific nucleotide sequence that codes for specific amino acid present in anticodon arm of t-RNA is called anticodon.

• Anticodons are complementary to codons.

General features of genetic code.

• The genetic code is triplet: Each codon is made up of three specific nucleotides.

• Genetic code is universal: each codon codes for specific amino acid in all living organism.

• Genetic codons are no over lapping: Adjacent codon never shares there nucleotides.

• Genetic code is comma less: There is no gap between neighboring codon.

• Genetic codon is degenerative in nature: more than one codon codes for single amino acid.

• Ex GUA, GUG, GUC,GUU codes for valine.

• Initiator codon: AUG is the initiator codon that initiates the protein synthesis. It codes for amino acid methionine.

• Terminator codon: Among 64 codon, three codon UAG, UGA, UAA does not codes for any amino acids. These are called terminator codon or non-sense codon.

• Genetic code is unambiguous: Each codon codes for specific amino acid, and only one amino acid.

• Ex: The codon UUU codes for the amino acid phenyl alanine only.

• Genetic code is unidirectional: codon reads only in 5’ to 3’ direction.

• Wobble base: In each codon third nitrogenous base is less specific.

• Ex: GUA, GUC, GUG, GUU codes for valine.

Transfer RNA (t-RNA)

• The RNA that carries and transports activated amino acid to the site of protein synthesis is called t-RNA.

• It represents about 10 to 15% of the total RNA in the cell.

• The polynucleotide chain is folded on itself to have the shape of a cloverleaf.

• Cloverleaf model of t-RNA was proposed by American biochemist Robert Holley in 1965. He shared the Nobel Prize in Physiology in 1968 1922 - 1993

Structure of t- RNA.• t- RNA is a single stranded

polynucleotide chain. It folds in some region and resembles as trifoliate leaf of clover plant.

• It contains 4 arms as,1. Amino acid binding site or

acceptor arm.2. T Ѱ C arm and loop.3. DHU arm and loop.4. Anticodon arm and loop. 5. Rarely small 5th arm is present is

called variable arm. • The 5’end has methylated guanosine.• The 3’ end has three free nitrogen

bases CCA.

• Each arm has paired base pairs stem and unpaired base pairs loop.

• Amino acid acceptor arm has 7 base pairs and 3 unpaired bases CCA at 3’end. Therefore amino acid always binds to adenine present in the 3’end.

• T Ѱ C arm and loop contains unusual sequence of nucleotides as thymine (T), pseudo uridine ( Ѱ ) and cytosine (C). It helps to bind ribosome at the time of protein synthesis.

• DHU arm and loop contains dihydrouridine. It helps to recognizing specific amino acid activating enzymes amino acyl synthetase.

• The anti codon loop contains 7 unpaired nitrogen bases. Among them 3 nucleotides acts as anticodon which are complementary to codon of m-RNA.

• Functions: It carries specific amino acid towards the site of protein synthesis.

Ribosomal RNA (r-RNA): • r- RNA is the structural and functional unit of

ribosomes.• It represents nearly 80% of the total RNA in the

cell.

• Translation: • decoding the coded information carried by m- RNA into protein is

called translation. OR• Synthesis of poly peptide chain on m-RNA strand with the help of

t-RNA and ribosomes is called translation.• Translation takes place in cytoplasm.• The required components for translation are,1. m-RNA.2. t-RNA.3. Ribosomes.4. Amino acids.5. Amino acyl synthetase.6. Peptidyle synthetase.7. ATP.8. GTP.9. Mg +2

• The process of translation takes place by 5 steps.

1. Activation of amino acids.2. Attachment of activated amino acids to the t-

RNA.3. Initiation of poly peptide chain.4. Elongation of polypeptide chain.5. Termination of polypeptide chain.

Activation of amino acids.• The specific amino acid present in cytoplasm

gets activated by specific amino acyl synthetase enzyme and ATP. It forms amino acyl adenylate enzyme complex.

• Amino acid + ATP + Amino acyl synthetase. Mg +2 Amino acyl adenylate enzyme complex + PPi

Attachment of activated amino acids to the t- RNA.

• The DHU loop of specific t-RNA recognizes the activated amino acid according to its anticodon.

• The activated amino acid binds to the 3ed end of t-RNA. It results in the formation of amino acyl t- RNA.

Initiation of poly peptide chain

Initiation of poly peptide chain• The ribosome binds to the m-RNA at 5’ end.• The ribosome recognizes the initiator codon AUG

on m-RNA.• The t- RNA having anticodon UAC carries formyl

methionine acid to the site of initiator codon.• It initiates the poly peptide chain.

Elongation of polypeptide chain.• It is the linear growth of poly peptide chain on m-

RNA.

• The charged t-RNA that carries specific amino acid enters the ribosome. It attaches to m-RNA next to initiator codon with the help of anticodon.

• The peptide bond forms between these two amino acids by peptidyle synthetase.

• As the peptide bond forms the t-RNA becomes uncharged. It leaves the ribosome.

• The ribosome moves codon by codon in the direction of 5’ to 3’ end.

• As the ribosome moves over m-RNA, the coded information decodes into polypeptide chain.

Termination of polypeptide chain• The termination of poly peptide chain takes place

due to the presence of terminator codon UAA, UGA or UAG.

• when terminator codon comes, it does not codes for any amino acid. It leads to termination of polypeptide chain.

• The poly peptide chain synthesized releases out from ribosome. It undergoes folding to form specific protein.

• The ribosome leaves the m-RNA.

Lac operon concept. OR

Gene expression in prokaryotes.OR

Inducesable operon concept.

Lac-operon concept was first proposed by French biologists Jacob and Monad.Experimentally they demonstrated the regulation of gene in E.coli.

17 June 1920 (age 92) 9 February 1910 -31 May , 1976.

• An operon is a group of genes that are transcribed at the same time.

• The sequential arrangement of regulatory gene, promoter gene, operator gene and structural genes in prokaryotes is called operon concept.

• The lac operon consists of three structural genes. Each involved in processing the sugar lactose

• One of them is the gene for enzyme β-galactosidase. This enzyme hydrolyses lactose into glucose and galactose.

Cultural situation for E.coli

1. When glucose is present and lactose is absent the E. coli does not produce β-galactosidase.

2. When glucose is absent and lactose is present the E. coli produce β-galactosidase.

• E. coli can use either glucose, which is a monosaccharide, or lactose, which is a disaccharide

• The lactose needs to be hydrolysed (digested) first into glucose and galactose.

• Promoter gene: It is the site for attachment of RNA polymerase II. It promotes the structural genes to transcribe through operator gene.

• Operator gene: it operates and controls the expression of structural genes.

• Regulator gene: It regulates the operator gene incorporation with repressor chemical.

• Structural genes: Three structural genes are present next to operator gene. They are,– Lac Z : codes for enzyme β –galactosidase. – Lac Y: codes for lactose permease – Lac A: codes for enzyme thiogalactoside

transacetylase.

In absence of lactose. ( switched off condition)

• The E.coli bacteria that cultured in absence of lactose media, it would not produces the enzyme β –galactosidase. That necessary for lactose metabolism.

• In this condition structural genes are in switched off.

• In absence of lactose, the repressor protein synthesized by regulator gene binds to operator gene.

• This blocks the RNA polymerase II to transcribe structural gene.

• Hence enzymes are not produced.

In presence of lactose. ( switched on condition

• The E.coli bacteria that are cultured in presence of lactose media, it produces the enzyme β –galactosidase. It is necessary for lactose metabolism.

• In this condition structural genes are in switched on.• In presence of lactose, the repressor protein

synthesized by regulator gene binds to lactose molecule. It forms repressor inducer complex.

• The inactive repressor complex does not binds to operator gene.

• The RNA polymerase II transcribes structural genes to produce enzymes.

• U.S. govt. started Human genome project in 1990 co-ordinated by the Department of Energy and the National Institutes of Health.

• GENOME – The whole hereditary information of an organism that is encoded in the DNA is called genome.

• . Human Genome Project (HGP) was called a mega project because,

1. Human genome have approximately 3 x 109 bp. The cost of sequencing required 3 US $ per bp. Then total estimated cost of the project is 9 billion US dollars.

2. The obtained sequences were to be stored in typed form in books. If each page of the book contained 1000 letters. each book contained 1000 pages. Then 3300 such books need to store information from a single human cell.

• Aims or goal of the project:1. To identify the approximate 20,000-25,000

genes in the human DNA.2. To determine the sequences of the 3 billion

bases that make up human DNA.3. To store this information in data bases.4. To Improve tools for data analysis.5. To address the ethical, legal, and social issues

that arise from genome research

• Methodologies :

• The methods involved two major approaches. 1. Identifying all the genes that expressed as RNA

(Expressed Sequence Tags - ESTs). 2. Blind approach of simply sequencing the whole set

of genome. That contained all the coding and non-coding sequence. later assigning different regions in the sequence with functions (Sequence Annotation).

• Salient Features of Human Genome• The human genome contains 3164.7 million nucleotide

bases.• The average gene consists of 3000 bases, but sizes varies.• the largest known human gene being dystrophin has2.4

million bases.• The total number of genes is estimated at 30,000. it is

lower than previous estimates of 80,000 to 1,40,000 genes.

• Almost all (99.9 per cent) nucleotide bases are exactly the same in all people.

• The functions are unknown for over 50 per cent of discovered genes.

• Less than 2 per cent of the genome codes for proteins.

• Repeated sequences make up very large portion of the human genome.

• Chromosome 1 has most genes (2968), and the Y has the fewest (231).

• Scientists have identified about 1.4 million locations where singlebase DNA differences (SNPs – single nucleotide polymorphism -‘snips.

• This information helps to finding chromosomal locations for disease-associated sequences and tracing human history.

DNA finger printing technology

• It is the technology used for identification of individual at genetic level.

• This technology was first developed by alec Jeffreys, in 1985.

• DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA,

Born: 9 January 1950 (age 62)Oxford, United Kingdom

• These repetitive DNA are separated from bulk genomic DNA at different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA.

• These sequences show high degree of polymorphism and form basis of DNA fingerprinting.

• The inheritable mutation is observed in a population at high frequency it is referred as DNA polymorphism.

• The principle of DNA finger printing is based on matching of VNTRs of DNA collected at crime spot with suspect person DNA.

• VNTRs: Variable number of tandem repeats. It is also called as mini satellites that shows very high degree of polymorphism.

• VNTRs are very specific to individual and differs from person to person. It shows some similarities between family members.

• VNTRs of identical twins are same. Hence it is not possible to identify individuality in identical twins by DNA finger printing technology.

• Southern blotting: It is the technique of transferring DNA from agar gel to nylon sheath.

• Probe: Single stranded polynucleotide fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene

Steps involved in DNA finger printing technology.

• The DNA finger printing technique involved Southern blot and hybridisation using radiolabelled VNTR as a probe. It included

I. isolation of DNA,II. digestion of DNA by restriction endonucleases,III. separation of DNA fragments by electrophoresis,IV. transferring (blotting) of separated DNA fragments

to nylon sheath.V. hybridisation using labelled VNTR probe, VI. detection of hybridised DNA fragments by

autoradiography.

Application of DNA finger printing technology.

1. It is used to identify criminals and rapist.2. To solve parental dispute.3. To solve immigrant problems.4. To identify dead bodies of soldiers died in wars.5. To identify dead bodies of person died at

accidents and bomb blast.6. To identify racial groups.7. To detect inheritable disorders.8. To detect donor cell in case of transplantation.

• The DNA is isolated from the sample of blood cells, hair root cells, semen or bone collected at crime spot.

• The DNA of suspect also collected and isolated separately.

• The isolated DNA is treated with REN to cut into number of fragments.

• The DNA fragments are separated according to their length on gel slab using gel electrophoresis.

• The DNA strand on gel slab is treated with alkaline solution to split double strand in to single strand.

• The single strand DNA is transferred to nylon sheath using southern blotting technology.

• The single stranded DNA is hybridized with radioactive probes of VNTRs . The excess of probes are washed off.

• Nylon sheath is X-ray photographed to get bands of VNTRs.

• The bands of X-ray sheath is the DNA finger print.

• Comparing the DNA finger print of sample collected at crime spot with suspect identifies the individuality.

• Southern blotting: The technique of transferring DNA from agar gel to nylon sheath is called southern blotting.• Probe: Single stranded polynucleotide

fragment complementary to specific sequence of nucleotides of DNA is called probe. It is mainly used in identify VNTRs and desired gene