Molecular analyses of antibiotic production in fluorescent

pseudomonads

Thesis submitted to the Pondicherry University for the degree of

DOCTOR OF PHILOSOPHY

R. SUNISH KUMAR

Department of Biotechnology

Pondicherry University

Pondicherry 605 014

INDIA

October 2004

PONDICHERRY UNIVERSITY DEPARTMENT OF BIOTECHNOLOGY

PONDICHERRY 605 014 INDIA

Dr. N. SAKTHIVEL LECTURER

CERTIFICATE

Certified that this thesis entitled "Molecular analyses of antibiotic production

in fluorescent pseudomonads" is a record of research work done by the cand~date, Mr.

R. Sunish Kumar, dur~ng the period of his stud) in the Department o i B~otechnology.

Pondicherry Unihersity. Pondicherry, under my super~ i s~on and that it has not formed

previously the basis fur the award of an) degree, diploma, associateship or felloil.ship

Pondicherry Dare: ~ y j ~ o j z f i y

L4/---- -. ,

(N. SAKTHIVEL)

Phone: t91-413-2655715 (Office) Fax: t91-413-26557 151!655!i 1 t91.413-2213936 (Res.) Ernail: natarajansakthi~rl8yahoo corn

DECLARATION

I hereby declare that [he hark presented In thir the+ has been cartled out by me

under rhc pu~dance and supcnlslcili of Dr. U. S.4KTHIVEL. Department of

H~otechnolog). Pondlcherry I'n~bersit!. Pondichcrr) 605 011 and this work has not heen

auhmitted elsewhere hr any other degrec.

(R. SrNISH KUMAR)

In memory.. . . . . . . . of my Father

Dr. S. R. Prabagaran and my cnlleogues. Apadurai, Ravi, Isaac, Rupesh. Nimal,

Gopal and Sara\anan for their co-operation and help.

Ofiicc staff, Mr. Balakrishnan and hlr. Rajendran

My friends. Shiba, Agiesh. Sanhar, Ganapathy. Rajiv, Bharath. Anoop, Basanth.

Harshan, Sararanan, Venkatelan, Balaji, Vijayalatha and Srilu fur their company

and help.

Department of Biotechnolog! (DBT). he\\ Delh~ and Council of Srientific and

Industrial Research (CSIR) UCN I ) ~ l h l !or p lo~ld lng me ~ ~ t h Junior dnd Senlor

I b e a r c h Fcl lo~rah~ps

hi) mother, sister and all family nirmhers h r them encouragements, and carc.

CONTENTS

CHAPTER

1. INTRODUCTION

2. REVIEW OF LITERATURE

3. MATERIALS AND METHODS

4. RESULTS

5. DISCUSSION

6. SUMMARY

Page No

LIST OF ABBREVIATIONS

ADIC

HI.AST

bp

CLP

cm

2D

IIAHP

IIAPG

I)DR

DF

DHHA

DMSO

DNA

d?TP

DQF-COSY

AF

FDTA

b l - v s

tSI -MS

FAB-MS

I,''I,-IR

h

HCN

HPI .C

IAA

kb

KB

KBA

kV

2-amino-2-deoxyisochonsmic acid

basic local alignment search tool

base palr

cyclic lipopeptidc

centimeter

t w ~ dimensional

3-dcoxy-D-arab~no-heptulohonic acid ?-phosphate

?,4-diacetylphloroyluc~nol

2.3-deepoxy-2.3-didchworhizoxin

Ilworkin and I:oster

trans-2.3-duhydro-3-hydroxyanthranillc acid

dimcthyl sulfoxide

deowyribonuclcic acid

2'deoxy11uclcotidc S'triphosphate

double quantum liltcrrd correlation spectroscopy

free encrgy

ethylcnvdian~inetetraacctic acid

electron ~onization mass spectroscopy

electrospray ionization mass specrroqcopy

fast atom bombardment mass spectroscopy

bouricr transforn~ infrared

hour

hydrogen cyanide

high performance liquid chromatography

~ndole-?-acetic acid

kilo base

Klng's medium

King's medium R agar

kilo bolt

LBA

nu4

M.4PCi

MIC

mln

n1L

mm

hl S

hlTT

m'z

KADH

NADPI I

NB

nm

Nl lR

K O t S Y

OD

PBS

PCA

P r N

PC'R

PI)A

PI1

Prn

RDP

RNA

'pm

rRNA

SDS

SEM

S \v

Lurla Henani agar

m1l11 Amperc

monoace1ylphloroglucinol

minimum inh ib~ toy concentration

minutes

milliliter

mill~mcter

mash spectrohcopy

.?-(1-5 d~methylth~ozol-+I) 2-5 d1phcnyl-te1ra7oIium bromide

mass'chargc

nicotlnam~du adcnlnc dlnuclcotldu reduced

nicotinamlde adenine dinucleotide phmphate reduced

tlutl.ient broth

nano meter

nuclear magnetic resonance

nuclear o\erhauser efcect spectroscopy

optlcal dcns~ty

pliosphatc buffer saline

pl~enatine-I-carhoxqiic acid

phenarinc-l -carhoxamide

polymcraac chain reaction

potato dextrose agar

pyoluteorin

p)~rolri~trin

rlhosomal databasc project

rihonucle~c acid

re\.olutions per minute

ribosomal RKA

sodium dodocyl sulphatc

scanning electron microscope

spectrum wldth

1 AE

'I'F

TLC

TOC'SY

LTPCiMA

lJV

WI IF

Tris acetate EIYI A

Tris LDTA

thin layer chromatography

total correlation spectroscopy

unueighted pair group of arithmetic mean analysis

ultraviolet

white line inducing principle

INTRODUCTION

CHAPTER 1

INTRODUCTION

Importance of hlolog~cal control has hecn rccoyni~cd in recent )ears by trenda in

agiiuulture towards sus ta~nab~l~ty and puhllc concern ahout the usc of' chomicala.

Incessant and i n d ~ \ c r i n ~ ~ n a t e use of futlg~c~des. herhlcidc5 and insectic~dea In agnculturc

is koo\in to bc hazardous to thc cnuronmcnt. is lethal to other bcnclic~nl organisms. can

lead to the dcvclopmcnt o f rcvstance against target organ~sma (C;oldnian et al. 1991).

aftect plam nutrition (O\homc and I<ohuon I902I and Increase fungal root d~seases

(Ro\ira and 1lcl)onsld 1986). H ~ o I o ~ ~ c a l ~ o n t r o l IS a C O \ L efrective, nu\el and

environment incndl) tcchnolog?

Ibluorescent pscudomonads. the Gram-negative. motile, rod-shapcd bacteria are

present In soil. &ater and phylloyhere but predominantl) in plant rhizosphcrc due to thr

eaudat~on of organic acida, sugar5 and ani~no a c ~ d s (I.ugtenberg and Dckkers 1999). T h ~ s

L T O U ~ of' hacter.1 is corls~dcrcd to be the n~cl<t promlslng group among plant growth

prornotlng rhirohacter~a invol\ed in biocontrol of plant diseases.

Although several hiocontrol mechanisms such as conipctitlon. induced resistance

(\an Loon s t al. 1998: Mcyer et al. 2002), production of s~dcrophores (Hamdan el al.

1991) phytohornlones (Kcel et a]. 1992: O'Sulllvan and O'ciara 1992) and extracellular

enzymes (Ellis et al. 2000) haire been identified, the production of antibiotics (James and

Gutterson 1986: tiutterson et al. 1988: I h o m a s h o ~ el al. 1990) is considered as the must

Important trait. W ~ t h he advent uT recombinant DKA technologies, the Impoflance of'

antibiotic production in blocontrol of fluorescent pseudomonads has bcen demonstrated

using antibiotic-deficient mutants (Colyer and Mount 1984. ranuthers et al. 1905:

Chatterlee ct al. 19')(1; Vcluaan~) ct al 20011. C'oncened efforts h a t e been mads to study

thc g m e s ~nvol ied in the hloa)nthesis of antibiotio juch as phenarlnzs ((iumjiddaiah et

81. 1086: I'homashoi\ and \Veller 1988: Picrsun and Thornashoa 1992: Ch~n-A-IVoeng et

al. 1998). phenolics (Kccl ct al. 1990. 1992: V~nccnt ct al. 1'191: Shallahan et 81. 1992:).

p)irrulc-typc compounds illomma and Su7iii I1)SY. Prcnder ct 81. 19i13), polyhctides

(Uoaak-l'hompzon et al. 1'194, Kraw and Lopci 19951 and peptldes (Nlelsen et al. 1999.

2000: Sorensen et dl. ?0011. Antibiotic pruducing lluurcsccnt pscudomonads. P

fluor.e\ir,?is 2-79, Pf-5. CHAR 9h 578. DR 53 (Thoniashou er al. 1900; Keel et al. 1992:

Nounh-Thompson ct al. 1004: Nielsen el al. l')OIJ: 20001. I' iiiire?/iicietis 30-84 (P~erson

and Thoniahhou lYY2) and P. ihiororupi~is 1'1'1.1391 (Chin-.4-\Vocng et al. 1998) uith

\arying degree of biucontrol abllity ha\e heen reported.

Ab~lity to pmducc an arraq of antihint~cs and icrsatilc nietaholic activities of

fluorcaccnt pscudomunada havc st~mulated numerous ecological molecular and

biochcmlcal studies. Present study was calned out to itivestlgate the no\cl antibiotic

producing fluorescent pseudomonads associated \\~tli rlcc rhilosphere. Therefore, sffuns

Mere madc to iiolate tluorescent psrudomonads from rice rhvosphere soil, Antagon~st~c

bacterial stralns showing broad-spectrum act~i i ty nerc taxonomically characteri~ed on

the basis of morphological. biochemical traits and 16s rRNA sequence homology.

Antibiotics produccd h) potent strains have bcen porified, structurally charactenled and

evaluated for antiniicrohlal and anticancer acti\lties. Genes in\ol\,cd In the hiosynthesis

o f a novel dirner anr~blotlc have been dellncated and characterized.

I he objectlires of the present inicbtigatiun nere:

1 lbolallun and ~creening of fluurrscrnt p~eudomonad bacteria for broad-spectrum

antagonism tonards ph)Topathogenic funy

2. Tauononilc cherecterlzntlon of ef'ticient strains oi'antagon~stic bacteria by

a . Biochcmical tuats

b. 16s rRYA acqucncc horncilus)

3. l)c~crminat~on oTexlrdcellular fungal cell nall desrading enzymes. plant gronth

~nt luenc~ng rncrahol~te? and hormones

1. lsolnt~on and puritication ofant~hiotlcs produccd by anttagonislic baclcria

5 . Structural charactcn/atlon ofantih~otics h!

a. Four~cr transtorni Infixred sprclruscopp

h. hlasc spcctrobcopy

c lui~clear magnetic rrsoliance Fpectrorcopy

6 . Molecular modelins oSa novel dimer antlbiot~c

7, Isolation and characicri/ation of gene5 in\ol\cd In the h~osynthesis of dinier

antibiotic. and

8. Fvaliialion of ant lb~ot~cs for a~lt~microbial and antlcanccr actlvlties.

REVIEW OF LITERATURE

CHAPTER 2

REVIEW OF LITERATURE

Fluorescent pseudornonadh arc Gram-ncgatiir bacteria belong~ng to the hacter~al

hmily l J ~ e u i i o ~ n o ~ ! u i / i i ~ ~ ~ u ~ The informal name given to the Rrnily 1s "pseudomonads".

hlcmhers of fluorerccn~ pscodomonads are found ahundalltly as kee-llving organlsrns In

,011s. fresh \hater and manne en\lronmcnth. and in man! othcr natural habitats. 'l'hcy may

also he ibund In association n ~ t h plants and animals as nonnal flora or agents of disease.

I\.lorpholoyicall~ thc fluorcsccnt pscudun~otiads are Ciram-negatiie, non-spore

fomling, straight or slightly curved rods. The) are typically motile by means of one or

more polar flagella and ox~dase-positiie. These bacteria h a l e the abillt) to grou in

simple minimal media at the expense 01'3 large \arietv of low-molecular-height organic

cumpoundr u ithout organic grouth f:dcton.

Stralns such as P ji'lloiv?r.err\ 2-79, Pi-5. 96.578. DR 54. P. i~ougrnuru 7NSK2,

PNAI. 1'. ~ i i , i~o/iicrcns 70-81 and P, c/~loror~rph!s P('L139 1 . have bean used as

hiocontrol agents against fungal pathogen?. of cotton (Ilou'cll and Stipanoiic 1980).

aheat (Wellrr and Cook 1983; Wcller et al. I 9 R ; Roura and McDonald 1986). rlce

(Mew and Rosales 1986; Sakthilel and Cinanarnanlckam 1987: Kosalcs et al. 1995).

barley (Rovira and McDonald 1986: I s ~ a n d i et ai. 1087). tomato (Huysens et al. l')Lih;

Chin-A-Woeng et al. 1908). sugarbeet (Nielsen et al. 2000: I'hrane el al. 2000; Thrane el

al. 2001). ch~ckpca (Anjaiah ct al. 2003). tobacco (Keel ct al. 1990). radd~sh (Hornma and

Suzui 1989) ~oyhean (Cattelan ct al. 1999). potato (Bakkrr and Schippers 1987). apple

and pears (Jamisieulcz r t al. 1991). These strains ha le been reported for the product~on

of' antibiotics such as phcna~ine-I-carhoxyIic acid (PCA) (Guruslddaiah et al. 1986:

Bnshane et al. 1987: Thomashow et al. 19901, phenazine-l -carhoxam~de (PCN) (Ch~n-A-

IVoeng rt al. 1998), pyocyanin (Dcmange et al. 1989). 2.4-diacetjlphloroglucinol

(D.4PG) (Keel et al. 1990: Fenron ct al. 1992). pyoluteorin (Plt) (Maurhofer et al. 1994;

Nonak-lhompsun et al. 1997). pyrrolnltrln (Pm) (Arima et al. 1964), tensln (Nlelsen et

al. 2000). \iscuainamide (Nielsen er al. 1999) and amphlsin (Sormsen ct al. 2001).

Stramr of fluurcaccnl pszudonionads also iinve hecn idcntilicd for thc production of plant

y o n t h proniotlng substances such as sirlcrophorcs. IAA and pliosphatase as uell the

plant ~nhlhlror?; metahol~te, hydrogen cyanlde (HC'N) (Chin-A-Woeng et al. 1908; Bano

and Ilusarrat 2003). I h e H('N producing tluorcsccnt pscudomonads interfere in the

c)lochrome oxidase resplrotlon and thus dccrcasz the growth and y c l d of crop plants

(Hakker and Scliippers 1987).

2.1. Siderophores

l lnder iron-l~niitlng conditions. Ilui~rrscsnt psrudur.iunads producc a range of

irun-iompleuing agents or sideropilores, uhich hnvo a \ z r j high affinity for femc ion.

S e ~ e r a l pyoverdins comprising ol' a sharzd dihydrox)-qu~nolint: chrun~ophorc joined to

an acyl (carbokylic acid or anl~de) group and a 6-12 amino acid rbpe-spec~fic peptide

have been characterized (Budzikienicz 1993: Mzqer 2000; Lamont and Martin 2003).

Pyoverdins and p~eudohactins produced hy a single strain ha \e the same peptide but

differ In the nature of acyl group (1.aniont and martin 2003). ~ e " hinding sites of

pyuverdin are prescnt in the quinoline chromophore and the peptide chain (Budz~k~ewlcr

1003) Stralns of Pscudonlnnas u t i l i~e heterologous pyovrrdins and pscudohactins h r

lron acqu~sltlon and the spectrum of fcrrlslderophores used forms the hasia of' straln

identification method tcrmed s~derot.yp]ng ihleycr ct al. 2002; Lamont and Martin 2003).

I')o\erdlns can he idcnl~fied by their UV-Vis absorption. Ihe l;e'--complexes show

absorption niaxima ar 4(W. 320 and 280 nm in corrclatlon with the qulnolinc system

(l'oppe et al 1987).

Sidrrophores are thought to scqucslcr tlic linl~ted Iron supply available In thc

rhizosphcrc making 11 u n a ~ a ~ l n h l e to pathogenic fungi and thereby suppressing their

grouth (Kcol cl a]. I'iVZ). Xldcrophorcs such as pyovcrdln and pqochclin arc roportcd to

pla) in the suppression of ~jrhf~rm-induced damp~ng-off d19eaqe of tomato (Ruysens et

31. 1996). i luwc\cr, it IS generally suggested that siderophores of fluorescent

pscudonioneds do not play a mle In hlaconlroi In Iron rich sotla (Campboll ct al. 1986).

The beclcnal lion-coniplexlng agent. pyoverdin and snl~cilotc mil) act as el~cltors for

induc~ng s!alcmlc resistance againat pathogcnl in tohacco (Maurhofer et al. 1998: van

I.oon et al. 1908).

I ig. I . I . Structure of pyoierdin from P. acrugirinsu PA01 (Abdallah 1991)

2.1.1. Biosynthesis of pyoverdin

The gencs iwolved in thr production of pyolerdin have been well charactenred

in P iientginoit PAOl The pyoverdln genes are malnly located at about 47 min on the

genetic map (Ankonbauer et al 1986: Ilohnadel et al. 1980: Romhel and Lamont 1992:

suda et al. 19(l5: Stint/] et al. 1996). Thc p ~ d A gcne cncodcs thc cnrymc I.-omithinc

~ ~ - o u ) ~ e n a s e catalyring the s)nthcsls of N'-hydrou)ornithine (Visca et al 1994). The

p i d F gcne cncoding N'-liydroxyornithine tranrli,rn~ylusc cntuiyscs the fomatlon of N'-

ibrnyl-~'-h~drox~orn~th~nc by the formylation of^'-hydrouyomithine (McMorran et al.

2001) In tile synthois of type I pjoverdin. I h c p ~ ( i l 1 gcne encoding pepride synrhetase ir

~nvolved ~n the iniuiporation of two L-thrconlnc rcslduer Into the peptlde of pyoverdin

(Merriman et al. 1995: hckerley et al. 2003). '['he genespvrIA andpvdD are located in the

yams reglon US thc chroniosonie (J? min) along \bit11 other genei.fii '4, p1i1E and p l d S

\ihlch 1s propoicd to he ~nvolved In l'crripqo\erdln uptake, p)ovcrdin excretion and

p!o\erdln regulation respect~\ely (Meyer and Stinto 1998; Meyer 2000). Ihe pviil and

p1,iLI gene products are also ~n\,ol\ed In peptide synthesis (Lehoux et al. 2000). The

product ol'pl,dE gene 1s proposed to act likcly as a transpoflcr protein, in which. the

transported substance is still to be identified (VcMorran et al. 1996: Lamont and Martin

2003). Chromophorc core of the pyoverdin is synthesized b) a separate cluster o r 4

genes. pi,c.4. B. C and D located at about 66-70 min on the genetic map (Stintzi et al.

1996, 1999). The expression of all the pyoverdin genes that have been characterlred so

far is contrullcd by the slgma factor protein P\.dS. Promoters that are recognized by RNA

pollmerase cornatnlng PvdS has a sequence motif, the IS box, at about 33 hp from the

transcription stan slte and ibnns a pan of the promoter scqucnce (Rombel et al. 1995:

Il'ilson el al. 2001 j. A second sequence. CGT at aboul -10 bp is also found tu be rcquiied

for the promoter recognition by P\dS (Lamont and Manin 2003). I'he activity of PvdS is

regulated post-trancriptionally by an anti-s~gma factor FpvR (Lamont et al. 2002). The

chprcsslon of the ycncp1.ii.7 IS repressed in Iron rich cellv (C'unl~ffe et al 1995: Leoni et

al. 1996). Thus a t a o Icvcl cuntrol is provided l i ~ r the production of pyovcrdin Oue to

the vtructural complex~t) ol' pyovcrdin. 11 has been ruggeued that there might be niore

number ofolher genes ~ n \ o l \ e d in the p)oberd~n hiosqnthcsis (Lamont and Manin 2003).

2.2. Phenazines

Pliena7ities are ~ntcnscl!. colosircd I\-iantnining hcterocyciic pigments

synthcai7cd by diftkrent bacterial st1-a11is (Lc~\iiigcr and Llargraff 1979: Hud7ik1ewic7

1493: S t e i a n ~ et al. 1994). Thcrc arc ahout niore than 50 naturally occurring phenazines

descr~bcd until no\+. Thc tipc of phsna71tie produced Is manly determined by the

cntlronmental condltii~ns in w h ~ c h the hactcnal stralns are present. Some bacter~al stralns

synrhesi7e more than 10 diflcrcnt phennzine derilatives (Turrrcr and Mcshcngcr 1986:

Srn~rnov and Klpnanova 19Y0: Mabrodi el al. 1998). Phenannr nucleus is formed by the

symmetric condensatioli of 2 molecules of chorismic acid (C'hang and Blackwood 1969;

Herben et al. 1976) wherein. N of the heterocyclic nng IS derived from the nitrogen of

glutarn~ne. Almost all phenazines exhibit broad-spectrum act~r i ty against bacteria and

fungi (Smirnov and Kiprianova 1990). The broad-spectrum activity exhibited by

phenazlne compounds against fungi and bacteria IS not hell understood. However, it is

helievcd that phenazines can accept electrons. yielding a r e l a t ~ ~ e l y stable anlon radical

that readily undergoes redox cyclc (Hassan and Fr~do\+ich 1980; Viood and I'ierson

1996). Phena~lncs also play an imponant role of microbial cornpctition in rhlzosphere.

including sunlval and competcncc (Mazzola et al. 1992).

Phenazine-1-carbox?lie acid (PCA). Pruductiun of PCA has heen reported fiom

P. flrror.~\crt~r. I' i~irrro/ririrn~ and P ur,ruginosa. 1'( .4 uab dzmonstratcd to bc cf'fect~\c

agalnst barioua tinpol pathogens such as ~ ; i i e u n r i r r ~ r i o ~ n ~ ~ ~ c ~ ,groininis \ar. rririci. P,rthium

rp . P o l i p o r ~ ~ s sp.. Rhcocrotiiii solani etc. and bacterial pathogens such as .-lrtrnonn;<er

i ~ i s i o ~ i i \ . Hiii~illus ~uhiilis. G ? i i ~ i i u o r i ~ ~ l u ~ ~ o r a ctc. ((iururlddalah et al. 1986:

Thumaahuu ct al, IOOO). Gurus~dda~ah ct al. (1986) characterized the PCA produced by

P jliiores<ois 2-70 and considcrcd 11 to bc i~gn~f icant In supprcii~on of lalie-all diseasz

ot \\heat. Brlsbane ct al. (1'187) ralsed the doubt on the usefulness ol' PC'A producing

hacter~a as e f i c t ~ i c bluconrol agcnts against phytopathugcns 111 alkaline mvironrnents

due to complete ioniznt~on of monomeric PL'A Into inactlrc carboxylate ion.

FIB. 1.2. Structure of phenazine-I-carboxylic acid (Gurus~dd~ah et al. 1986; Brishane et

al. 19871

Phenazine-I-carboxamide (PCS). Chlororaphin is popularly known as PCN

Production of PCX had hcen reported In P orriiginusu and P chioror-ophis (Chin-;4-

Wueng ct al. 1998: Mavrodi ct al. 2001). I'CK difrers from P C 4 with a carhoxam~de

(CONlI?) group rrplaclng thc carhunyl (COOH) group at the first por~tion of the

p h c n a ~ ~ n c core. P r N i? more stahlc lhdn PC.4 and exhibits antifungal activities cvcn in

alkalinepH (C'liln-A-LYorng et a1.1998)

Fig. 1.3. Stiucturc ofplicnarinc-I-carhoxamide iChin-A-il'orng rt a1.1998)

P!oc!anin. 11 is hluiah coloured I-h>drox!-5methyI-phenazine, predominantly

produced hy P i irriigi~io\~i (1)emange el al. 1989). The antihiot~c c\.anoni)cin. froni

Sir~~prom,~ccs <!.orruflu~~ur (Funahi et al. 1958) is also kno=11 as pyocyanin U'umrr and

Messenger 1086). Pyoc!nnln ii tunic lo a n ~ d e range of iungi and bacteria (Hnssan and

Fr ido\ i~h 1980). The tohiciry of pyocyani~i ia attnhulcd to rhc accepting of a single

elcctron. yielding a stahlc anion radical (Mornson and Sanyer 1978) ard thereh)

undergo~ng a rcdox cycle ( h e d h c i m and Mlchael~s 1931. Friedhelm 1934: Nishiklmi et

al 1072: Murrison et al. 1978). Pyocyanin Induces the hiosynthesis of the manganese-

containing-superoxide d~sniutasc in E coii, thus causing enhanced production of 0 2 '

(Hassan and FridoLich 1978: 1979). Thus the antibiotic action of pyocyanin was

attributed as an expression of the t o s ~ c ~ t y of 0< and H202 pr~~duccd in increased amounts

in thc presence of pyocyan~n.

Fix. 1.4. Srructurr of plocyanin (1)cmange ct al. 1989)

2.2.1. Binsynthesis of phenazines

I he hlosynthes~s of phena~lne compounds by fluorescent pscudumunadi ha\c

been traced to the s h i h ~ m a ~ c pathiv,i? u ~ i h trio mulcculcs oTmonomcric precursor palring

hcad to tail (Hollstein et al. 1978: XlcDonaId ct al. 2001). I he phena71ne h~osynthetic

operon fiom P. f7uon,srcni 2-71) contains a seven gene cluster phrABC'DLFG. OC thc

seven genes. f ; \e ~ C I I C S , ph;C-G are e ~ s c n r ~ a l fbr phcnil~inc synthcbis and thc other t ~ o

genes. phz4 and H enhances thc product~on of phenazine compound by P /luorescrru 2-

79 (McDonald a al. 2001) I>ur~ng phenazine biosynthesis. phosphuenol pyrubatc and

crythrose-4-phosphate undergoes a condensation in the presence of the product of phzC

gene, resulting ~n the format~on of 3-dcoxy-1)-arahino-heptuloson~c acid 7-phosphate

(DAIIP). In the presence o f p n m a r y shik~mate pathway enzymes, DAHP is convened

into chunsmic acld. uhich acts as a precursor for 2-am~no-2-deoxyisochorism~c acid

(ADIC) in the presence of phrE gene product (LlcDonald et al. 2001). 'The enzlme

produced b) phzl) gzne, a homolog of hactenal isochorismetases (Budzikieuicz 1993;

Earhart 1996) converts ADIC to trans.2,3-dlhydro-3-hydrovyantranllic a c ~ d (DHHA)

(Mcllonald et al. 2001). 1 he dlmenzatlon of DHH.4 illto 2.3-dihqdro-3-0x0-anthranilic

acid occurq in the presence ofph:G and ph:F gene products. It has been speculated that

dimeniation of t u o niolecules of I)HtIA involves their ox~dation, cavdlyzcd by PhzG

protein to the C-3 ketone. 11 has hsen funher proposcd that thc molscules uould react

tuice w ~ t h each other hy nucleophilic add~tion. dehydration and tautomer~zation to g1\2 a

5.10-diliydrophonazine that suhsequen~ly 15 o\ idi iud to plicnazlnc-1-carbux>I~c acid. T h ~ a

reacuon 1s proposed to be s tahi l i~ai by ilic enzvnizs. PhzA atid B (\lcDonald et al.

2001 3 .

'Ihc homolugues of the acrcn phenaiinc synthctlc gcncs arc also found in other

fluorescent pwudonionad strain$ I' ilur.eo/bcrenr and P o n . u g i ~ ~ o ~ u (Mar-rodi et al.

2001). Although, phcnanne h~o?)nthetic loci of varlour stralns of fluorescent

pscudon~onads are highly '.omologous. ~ndiv~dual ipcclch d~li'crs In the tyTe of compound

they produce (1)elany et 81. 2001). In P. iicru,yino\u, apart from t h ~ s sercn-gene cluster.

other genes sucn as picif. ph:M and phzS are a lw iiiund to he present (hlavrodi et a).

2001). I he sequenco of ph:H gene ha9 a s ln i~lar~ty to the ph.-ii gene rcponcd kom P

chloror-aphis (Chin-A-\Yoeog 2000; Mavrodi et al. 2001 ). The deduced product ofph:H

gene is found to be s ~ n ~ i l a r to class I1 glutamine amidotransferases. Based on the

sequence similarity and the ti~nctional data. ~t has hccn proposed that ph:li of P.

acruginusu encodea a glutamine-dependent phcnaz~nc specific amidotransferase that

catalyzes the amidation of PCA to PCN (Marrodi et al 2001). Theph:.U andphzS genes

encoding putatne phenarine-specific mcthyl transferase and ila~in-contain~ng

monooxygenase, rcspectlvely. arc involvcd In the sqnthes~s of pyocyanin. It has been

proposed that in the presence of S-sdenosyl-L-methlonlnc dependent mcthyl transferase,

phenazine-I-carboxylic acld is con\erted into 5-methyl phenarine-I-carboxyllc acld

betalne. which is funher convcrtcd to pyocyanin in the presence of NADH or NADPH-

dependent tla\oprote~n nionooxyycnase. PhzS (Mavmdi et al. 2001).

The phma/inc productlo~i 1s regulated by cell-density dependent manner by

homologucs of Luwl 2nd LuxR protein (I.atifi et al. 1905. C'hln-11-Wocng ct al. 1998).

1 hc h~iniologue< of these rcpulatory ihctors In P, iluorrsccris 2-79. P, nurro/acirns 30-84

and P chiororupiiis PC'L1391 are ibui~d to bc phrl and phrR gcncs found directly

upstream ol'thc phenazlnr core (Chin-A-LVomg et 31. 1098: Dwived~ and Johri 2003). In

P, o m ~ p ~ ~ i n s t i , thc phcna/lne production 1s rcgulatcd hy rcgulatorq protclnr. Khll K and

LasI'R thnt are located clscwhcre In thc gcnomc (Latlli et al. 1995).

2.3. Phloroglucinols

Phloroglucinolr are broad-spectrum antibiotics produced hy a vanety of bacterial

stralns. 2.4-diacetyl phloroglucinol (1)hPG) ir a broad spectrum phenolic antlblotic

produccd by P. ,'7uorcsrcns Pf-5, IJ.,fluore.~cet~r ('1140 and P.,fluoresccns Q2-87 (Fenton

et al. 1992; Rosales el al. 1995). DAPG is found to exhibit antifungal, antibacterial and

antihelmrnthic actlvlt~es (Vineet et al. 1991: Keel el al. 1992: Levy et al. 1992: Hamson

et al. 1993; Nowak-Thompson el al. 1994: Bangera and Thomashon 1996: Ahhas et al.

2002) as \sell phpotoxlc propcrlies (Reddi et al. 1969). The compound also rxh~blts

herb!c~dal activity resembling 2,4-d1chlorophenoxyacet1c acld (2. 4-[I) a commonly used

post-emergence h c r b ~ c ~ d e for the control of man) annual broad leaf \\reds of cereals.

sugarcane and plantat~on crops (Dulvedi and John 20031. DAPG also produces ~nduced

syqtemlc resistance In plants and thus serving as a spesilic clic~tor of phytoalexins and

other sim~lar molecules (D\uvedi and John 2003).

Fig. 1.5. Sttucturc oC 24-diacet!l phloro~lucinol (I e n b n el al. 1902)

2.3.1. BiosyntheGs of phloroglucinol

Syi thes~s of DAPG ~ n ~ o l \ e s the condensation of 3 molecules of acet)I C'o.4 with

one molcculc of malonyl CoA, lead~ng to the formation of monoacotylphloroglucinol

(MAPG) and subsequently I)AP(i (Dwivedi and John 20033. A four gene cluster

piiiACBD tlanked by a regu1ator pl!lF and an efflux protein gene phlE is found to be

~n\cilved in the product~on of DAPG by P. ,fliiorcsce~~.r 42-87 (Bangera and 'Thomahou

1996). ThephlACBDE operon 1s found to be indispen~ahle for the product~on of DAPG

and MAPG, a potential precursor of D-APG (Shanahan et al. 1993: Hangera and

1 homashou 1906). The products of phlA. ph1H and phlC acts collrcti\ely in the dual

function of s)nthesis of MAPG by enahllng the fomiation of acetoacetyl-CoA and In

conber~ion of MAPG to IIAPG. TheptiiD genc in\olves In the conversion ol'acetoacetyl-

CoA to an 8-carbon polyketidc. The p t i l i gene product in\olvcs In the export of IlAPG

or MAP(, (Bangera and I'homasho\b lOO6l. Tlic dl! ergcntly oriented phlF gene encodes

a pothnny-spec~lii repressor (Bangcro and Thomashow 1906) but ltrtlc is known ahout

tliu mcchanism by \\ hich PhIF ~eyulates ~ h c pi11 h~osytithctic genes (Schn1dt.r et al. 2000).

Four global rrgulatora such a the senwr hinasc. ClacS, ci~gnate response regulator.

Gac.4. house hreplng sigma Ibctor. Ilpr11) arid \trcrs sigma tictor. RpoS controls thc

product~on of llAP(i In 1' j l i iorcsr r r~~ (hdaurhokr ut ul. 1904. Sachrrer ct al. 1994:

i'orhcll and Loper lY'15: Sarn~guct ct al. 1'195: Schtl~der al. 1')05. I .ai~llc et al. 1908:

b!h~stier et 31. 1008: Blutiier el al. 1090: Schnlder et al. 2000).

The product~on of UAP(i in lluorescent pscu~lomonnds ii stimulated h) glucose.

sucrose or ethanol (C'oisard cl 31. I9Xh: Shandhan cr ol. IOq?; Dully and I)clhyo 1999).

Z ~ n c sulfate and arn,nonium molyhddlc arc also rcportcd I<> fa\or I).\l'Ci production

( U u h and Dclhso 10OOl lhe production of I)Al'(i i inhih~ted to a largc cvtent by

tnorganic phosphate (Iluffy and Del'dgo 19')')). Eungal Ioxlns such as fusar~c acid

produced by t o.rysp:si,oruni IS found to be an effectike rcpresatng agznt of DAl'G

production (L>uflj and Defago 1997).

2.4. Pyrrol-type compounds

Pq'rrolnitrin (3-chloro-4-(2'-nlao-3'-chiorophen)l)pyrrolc) is a broad-spectrum

antitilngal metaholltc first dcscrihcd hy .Anma t.1 al. (1964). It is produced by tloorcscent

pscudomonads hucll a.: P l l uo r i~ rco is (Klnier et al. 1')')X) and P. uurc,i$iciois (Ilandcr et

ol lOh8). P jnoln~tr in has lound ~ t s application more as a clinical compiiund than a\ an

~gricultoral fiingicidc. Othcr \aridnts CIS pyrroln~tiin such or isop)?-rolnitrin.

oh)pyrrolnitrin and monodcchluropyrr~~l t~~r~n ha\,c louer antillingal activiteq (I'landcr et

al. 196X1.

2.4.1. Bios! nthesis of p) rrolnitrin

Pyssolnirnn is a secondary metahohte dcri\cd from tr)ptophan. '[he b~osynthetic

pathway ofpyssolnitrin \%as propohed as eerly as 1067 (Hamill et al. 1967) and refined on

the basis of traccr studies and isolation of ~ntennedlate\ (Lively et al. 1966: Hamlll et al.

IY70: Martin et a \ . 1972: ban Pee et al. 1980: Chnng et al. 1981; Zhou et al. 1992; Kimer

et al. 1948). Two different b~osqnthetic pathways habe bccn ambed upon for pyrrolnitrin

btoqmthesis. Accordtng to the model proposed b) \,an Pre et al. (1080). L-tryptophan is

corivcncd into 7-chlorotr)ptophan and monodcchloroamtnupyrrolnitrili before the

formation of the tntermcdiate aminop)rrolnttrtn which goes onto Ibrm p)t~olnttrtn. In the

btosynthetic pathuny proposed by Chong rt al (1981) I -trjptophan 15 converted into

aminophenylp)n.ole before tlic hmmatlrin of aminopyrrolnitrin ntid p)rrirlriitrin.

Hammer rt al. (1997) isolated and characterired a bur-gene cluster. [,r?tAH('/) of

(1.8-Lh st/c in\ol\ed in the sjiithesls ol' p)~rolnitnn. Enz)mc encoded hy pr11 1 gcnc.

in\ol\cs 111 the chlurinarion of' L.-tr>ptophan to fbml 7-cliloro-1.-tryptuphm I'hc prrill

gctic product caral)rcs a rlng rearrangement dnd decarho\yl;nlun i n r o l ~ c d ~n the

corlrcrslon of 7-clililro-l -tr~ptoplian to nioi iodechioroani~n~ip~~tuln~rri i i Cliloritiotioti of

rn~~riodechloroaminupyrr~~ln~trin at posttion 3 to form aminop)rrolnitrin is catal!/cd hy

the prri(' pcne product, I itially, thc tbrniation nf pyrolnitriii from aminop)rrc~lnilrin by

thr contersioti of 11s amlno group to nitrn group is cataiy/cd hy the enrymc product of

the gcneprnn ( K t r n ~ r et al. 1908. 1ianimcr ct al. 1'1991.

2.5. Polyketides

Pyoluteorin. Pyoluteorin, the chlorinated antifungal metabolite of mixed

polykctidc'amino-acid origin produced b) ccflain strains oTPscudomonti spp, including

7011 bactenum, P . J'uorcscens Pi-5 (Ilaurhofer et al. 1092: Maurhufer et al. 1994 : Kraus

and Loper 1995; So\rak-Thompson ct al. 1997). I'hc primary precursor fur thc

production of p)oiuteonn has been established as prollne (Cuppels et al 1'iXh: Noaak-

Ihompson el al. 1997). lnltially 11 u a s suggested that the bios)nthes~s of'polyketide unlt

of the pyoluteorin in~tiates from a starter unit orlg~nating from a tr~carhoxylic a c ~ d cycle

~ntsrmed~ate (Cuppcls et al. 19861 and later it has heen establ~shed that prul~nc servcs as

the precursor for the polqkct~de pdrt of pyoluteorin Stwins producing pyolutzorm

suppress seleral soilborr~e plant d isuses (Howell and Stipanouic 1980: L)efagc, ct al.

1000: Maurhokr ct al. 10L)4). l'yolutcorin I S hund ti] he more cfli.ct~\e againqt the

damping-off d i w s e causlny oom)crtc. P ltiirniitnr (Maurhufcr ct al. 1992).

big. 1.7. Structure d'pyolutcor~n (Md~1rholi.r ct al. 1902)

Mupirocin. Mupiroc~n, the naturally occurring polykztidc antihlotic of

floorcscenr pscudumoneds is also known as p ~ e u d o m o n ~ c acid. Vupiroon produced by

P. Juore~cens XCI31B 10586 is highly ac t~ve aga~nst ,Srul~l~riococcus uureus resistant to

rnethicill~n and a \.arlet) ofGram pos~tive organlsnls ([,I-Salcd et al. 2003). Ihe mode of

11s ant~microbial activit) is by the sclecti\e inh~b~t ion of bacterial iroleucyl-tKNA

s)nrhctase (Bennett et al. 1999). Mupirocin IS alsu used as a tropical and intranasal

antibiotic (Carcanague 1997). A 74-kb gene clustcr is iniolved in the b~osynthesis of

mupirocin. which occurs by a process s ~ m ~ l a r to ht ty auld biosynthcsii, a ~ t h a carboxylic

acid as the starter unlr (FI-Saycd st al. 2003). Thc mupirocin gcne cluster contains six

larger ORFs (n~nipA-F? consistlng of several domains \+hich resemble multifunctional

proteins of polyketide synthase and tktty a c ~ d s)nthase tppc 1 systems. I-he hiosynthct~c

gelic clusier also contains s c ~ c r a l lndlvidual genes, mirp,I-.Y and n1ocpA-6, some of whlch

have slnularity touardr type I I s)sterns(El-Sa)cd et a1 2003)

2.3-deepox?-2.3-dideh?drorhizoxin (DDR). 1 he polykctldc a n t l h ~ o t ~ c . 1)I)R.

pr<~duccd hy f' c / i /uro ,v~pi~~s h14312 I ? ett 'ecl~ic agarnrl \cvcral phytopathogen~c fungl.

lncludlng net hlotch of herley cauwd h! the l'ungus /)ri,cIis/crii icrcv (Tornhol~n~ ct 41.

1909). The pr~lducer \tlrln of t h ~ s dnt~hlotic. P c/~/ororiipli~s MA342 I commercially

used In Swfdcrl oa a hlocontrol agent i~ndcr the tradc name ('edonion ( I ~ m h < ~ l ~ n l et dl.

I 999 ),

2.5.1. Biosynthesic of pyoluteorin

The bios!nthcs~s of pyoluteorin i \ a complcx pathuay ~nio lv lng a ~ luqter of 10

gencs. pl1l.,4HCZlL:I:(;.iiR, spannlng ahout 24-Lh in thc geliomic IIN 1 of P f l u o r c s n ~ ~ i s

I'G5 (Nouak- l h o m p ~ o n et al. 1')')')). Thc p i r r gene is proposed to have a deduced

function of acyl-?oA-synthetesc. Due to the presence of adenylation d o m a ~ n s in the PItF

c n q m e . it has been suggested that this protein might activate an early pathway

~ntcrmediate of pyoluteorin hiosflthesis (Noaak-Thompson ct al. 1999). 'The possible

function of plr(; encoding putat~\.e thioesterase 1s responsible for the termination of

polyketide assembly. The p)rrolc ring fbrmatlon in pyoluteorin by the uxldatlon of the

proline-derived carhon n n g i ? cataly7ed by th6 product of the gene p/iE (h'owak-

1 hompson et al. 1909). Cicncs pIl.4. p i 1 0 and plr.l4 belongs to a n e b class of halogenase

enzymes in\,ol\cd in chlunnatlon of secondas). metuhlolites ( \ a n Pce 1996: tluhaus et al.

1097). With thc exception oi'plri) gene. the t\vo othcr genes, plrA and pllM arc found to

posses a putatibe NAIIII cofactor-binding siic (So\\ak- lliompson ct al. 1')l)9). The

en/)me product ofp i iH acts as d poaltlic tran\cript~onal dctnator of I~nkcd pyolutcorln

b ~ o s ~ ~ i t l i c t i c genes in P f luotesc~~ris l'f-i iNuwak-Thompson ct al. 1')')')).

2.6. Peptide antibiotics

l'cptidc unt ih~ot~~c\ arc p~edominatcl) p r o d u ~ u l In both Cirani-positile ( K a o and

1)cmain 1977) and Gram-nrgat i~e hacteria i l)ouling and O'Gara 1094) by a noli-

rihoro~nal multi-znryniatic pcplldc s!nthc\i\ (Klcinkaiif and Ilohrcn IC)')O). I'eptide

ant~hiotics are Lnoun to contain non-pn~tc~n amino acids. 1)-ani~no acid\, h y d n ~ x ) aclds

and other unusual constituents. I hck ma! be rr~oclifird h) N-mcthylat~[~ii and c y c l ~ ~ a t i o n

rcactlons (Kleinkauf and I)olirni 1000).

Kecen[l). 11 has heen ohscr\ed that fluorcscmt pscudomonad~ prirducc o number

of different cyclic lipopeptide? (( 'I 1's) which arc uscrul in biuloglcal coorrol. 11 ia tuund

that r1.P production IS o common trrlt among fluuroccnt pseudomonads isolated tiom

augar heet rli~zosphere (Nielsen et al. 2002). The CLPs identified from the fluorescent

P ~ ~ u d o m o ~ t u s spp, of sugar beet rhirosphcre is found to contain 0 to I I amino a c ~ d s In

the peptide rlng structure and a CI,, fatty acid moiety attached to onc of the a m n o acids

(Nielscn et al. 2002). CLPs isolated from h e u i f o r n o n o spp. include nonapepr~des such

as eight d~fferent masscroltdes from an unidentilied ficit~iomoniis sp (Gerard et al.

1'197). the white line tnduclng pnnciple (WI.IP) compounds lion1 P reaciur~s

(Ilortishlre-Smtth el al. 19911, v~scosinaniidc and tcnstn iiom P, fluor!nccni (N~clscn et

al. 1990; Nielren ct a1 2000). Botli the topological conliguratlon of the amino acld

reslducs and the existence of carbox)l~c groups in the pcpttd~. tliolety are impowant kir

water soluh~ltt) and the surfacvant p~i ipc~t tes oI' ('L1'\ (Morlhawa rt al. 20(lO). I he

h!iiropllob~c h t t y actd Idtl. logetlicr oith the aniph~phil~c pnipcny of the pcpudc plays an

Imponant role in pcnctratiol1 and h ~ n d ~ n g of ( ' I Pc ulthin the h~ological membranes

jk~elsen rt al ?OO?i. This in lurn supp~irts the~r role 4.; suriactantr and as ont~hl~itlca, hy

functions like diaruptlng nimihrane function\ leading to excess < 3'- ~nl luu ~ n t o target

cclls (l'hranc ct al. IOOO).

Tensin. This I \ a cyclic I~podecapcptidc pmduced h) P /litorc.iirns 00.578

(htcl\cn et al. ?000). I hc structure of ten<in i \ a~milar to c)cllc pcpudcs such a? fcngyctn

li-om Roiiiluj c c v c i i ~ (Vanittanahom and 1,ocfflcr IOXO), aurraclln liom B, .siihiili\ (Artma

st al 1908) and iVLI!' friim I' rciii/uti\ (Morttali~re-Snltth cr dl 1'191 ), l'he producl~on of

lcnsln In P. ,fluor-i~~ciw, 90.578 is kiunil to he more in nicdia an~cnried with gluco\c.

niann~tol and glutamate and less in fruct~isc, sucrorc and aaparagincs m e n d e d media

(N~elscn et al. 2000). Tens~n showed potcnt antagonistic activity agalnst the

basidloni)cctc fungus, R. solunr. Significant reduction of H roloril infectton was lbund in

sugar beet seedc trcatcd w ~ t h tensin producing strain P fIuorcrcens 96.578 (Nielsen et al.

2000). The mode of actlon of tensin on R, soliini is st111 not clearly undcrstood. Honever.

it is proposed that the activity mlght be in synergism with chttinulyt~c or cell wall

drgradlng en7)mes produced by t'. /7uor~'rcn~s 96.578 (K~elsen and Sorensen 1999:

Ulclsen ct al. 2000).

Fig. 1.8. Structure of temin (Nlelsen et al. 2000)

Viscosinamlde. Viscosinaniidr i? a c)clic lipopcptldc produced by P , / i i rorr~<cr~\

I)R54 ihielsen et al. 1')')Y). I l i c amino 4c1d scqucncc (ii'v~scos~nam~de (I.-l.eu-1)-Cilu-1)-

rillo- l lir-1)-Val-L-Le11-D-Ser-L-Leu-D-Ser-l Alc) d~ffers from vi\corin isolated from P

1,iimrii (Kochi er al. 1951) by the U- Cilu suhstlti~tion a1 po5ition 2 (Uici\en et dl 2002).

This compound shoiva prominent antifungal and bioaurljcuant propertita (Nieiaen el al.

?(IOU: lhranc et al. 2001: N~cl \cn et al. 2002). I t 1s l i~g l i ly elfectlve agalnst H iollini

When R. soluni mycellom bas challenged b i th purified viscosinani~de unde~ In I i t ro

cond~t~ons, a numbcr ol'gronth modlt'icar~ons at hyphal tips such as incrcesed branching.

shelling and septation leading tu inhib~tion in radial growth bcre obse~ed (Thrane et 81.

2000). In boil condition5, \iscoslnamide producing 1' /7uoreswns IlR.54 is found to

reduce thc mycelial hiomass and sclerotia formation by R. solilrii closc to thc seed or

seedling root surface$. lhus rnak~ng the fungal h~urnass inndcquatc fbr infection (Thrane

CI al. 2001).

I'ig. 1.0 Structure of! ~scoslnan~ldc (hicl\un cl al. IOL)9)

Amphisin. Anlphliln I \ a I~poundecnpcpt~dc orlylnatlng from thc non-r~bosornal

h~os)nthesls b! P.\~ i i i io~ i io~ i~ is sp. 115773 (Sorcnaen et 31. 2001 1. 1 hc pnmnry jtructurr. I S

9-h!droxydccanoyl-1)-Leil-TI-,\sp-U-iill- I l ir-l~-L,ou-l)-Leu~)-Ser-l.-l .eu-l)-til~~-l~-l,cu-

1,-lle-L-Asp I he pcptidr i \ a Iactonc. IinLing 'I hr4 O y to rhc C- tcmii~~al . It is a close

analoguc of the cycl~c lipopeptldes tensin and poliprptin produccd by P fluorc~sccns

( \ ~ c l s e n st al. 2000: Sorenssn el a1 2001). I he antlfungal actl\ity ii l 'anipli~s~n la lound tu

hc morc than that U S CI~IIL.I f l u o r c s ~ ~ n t psrud(~nionad CI.Ps such aa tcnsln and

~iscosinamide (Nielsen et ill. 21102).

Fig. I . l o . Structure of Amph~ain (Snrensen el al. 2001 )

2.7. Oompcin

Oomqcin antibiotic prc~duczd hq P fliiotcrcctir lIV376 exhlh~ls suppression of

daniping-off of cotton cauicd h) P ullimiit!i (Cilltreruon cr 31 10810. Rios).iithes~s of

~ ,oniyun i in \o l \o Ibur opercms. q/iiE, iifirR. o f i r l n and ri/ir/', uhicli is regularcd by

elucose at tmnscr~ptional Ic\'cl iGiitterson ct a1 I9tiSl. Tlic gcnc products of rrfi1.1R and

ir/iiP mediate catahol~tc indilct~on of nfiiE and u,hiK opesons, I-lic gclizs o/~ii: and obrH

ellcode the en/)mus Ibr the s)nthcci\ i11'oomyc1n ((;utlcrsrin et al. 1088).

Diversity of fli~oresccnt pscudr~mnnadr ill plml rhirosphere and thc i~ ah111ty to

prnducc an a m ) of aritiii~ngal nietaholitc\ hnkc s t~ml~la t rd our inlcrc\l and thcrclore. In

1h1\ study nce rhirospherc ni\ociatcd lluorescent pgeudomonads hakc hccn ~nres t~gnted

i i ~ r 11o\ cl a n t ~ b ~ o t ~ c compounds

MATERIALS AND METHODS

CHAPTER 3

RIATERIALS 4 N D hlETHODS

3.1. hlaterials

3.1.1. Chemicals

Llcd~a conlpunenrs, protcose pcptone. trjptoiic. )c3ht c\tract, heef extract.

ulkccrol, agar and othzi cheni~cals. , o l i ~ o ~ n cl1l1,ridr. ammonium cliloridc. d ~ s o d ~ u n i - .

l iyd~ogc~i phosphate. dlpowsilum hydrogen pIiospIint~' a11d n l a g n e ~ ~ ~ l n i s~ lp l ia tc were

piirchaszd frum HI-Mcd~a. India ' N lahelsli amnionium chloride \\as purchaacd from

C'ambridye isotopc lah<~rator~ur. 1IS:i. Organic salient\ such a\ bcltrcilc, ethyl acetate.

mcthenol, chloroibrn~. d~chloroniethanc, dlcthkl cthcr. acctonc arid ilcelon~tr~lc a r r u

porchascd from Sisc(1 Rcscarch Lnhorntories (Sit1 ) and Quol~gcn\. lndla All col\cnts

2nd reaycnth uccd a c r e anal>ticnl or I~quid chronintog~.aphic grade chemicals.

('lirumatographic materials such a\ prcpdr~t i \c ti1111 l a y chromatograph\. ( 1I.C) p l a t o

dild silica gel (100-200 mcsh) \\tic auppl~cd b! F~,chi.r S~icntil ir . . 1 S A and Sl) line.

Ind~a respectively. PCR reagents such as laq DNA p~l!mcrasc. lnagneslum chlor~dc. 10x

reaction buffer and dNTPs \\ere purchahed Tram Promcga. 1IS.A and the 1)yNAzyme

I)UA pol>merase and t X T b u f i r a a s purchaxd frr~ni I in/)mcs. Finland

3.1.2. Microorganisms

Fungi. Mucrophorninit phusrolino MI'S. !%fugnoporfhr grrreu MGS.

Collr~o~richurn ,/n/caturn C'1:l.. C, glcosporotilc~s ('(;I.. C (upsrci ('CL.. Rhi:ocfoniu

soiani KSRI. F u s n r i ~ i n ~ orrsporuttz f. sp. ~rihcrt.\(~ FOC. F o\lsporldm 1: sp. ~ ~ i i s i t ~ r ~ u n ~

1 OVS. Sirroclirdiiini o~?,:(!c SONS, Borr:i,~is cincru BCI 'NAI ' and Pcsriil~iiia f h m ~ PI'S

a z r e obta~ned finin the culture collecr~on of 1)epartmmt ol'f31otechnolog). Pondicherry

Ilni\crslt\.

3.1.3. Cancer cell lines

('olon canccr cclls. S\V4RO, lung cancer cell$ 4530, hrcnst cancer cclls. MCP7

and cer~ica l caiiccr cell\. Hei a ~ c r c obtn~ncd l i u l n tllc hatlondl rcnt re Ibr ( cll Scicncc.

I'une. Indla.

3.1.4. hledia

King's medium B (KB) (King 1951)

Protcusc peptone 20 g

Cilycerol 1.5 ml

K2HP04 1.5 g

MgS04.?1I?0 1.5 g

Uistillcd \\atcr 1000 ml

pll adjusted to 7.0 using NaOll

King's medium B agar (KBA)

1.5% of agar \rns added to KH hefore autocla\ing

Lh-anner medium (Kanner 1978)

NazHPO? 4 g

KzHPOl 1.5 g

NH4C-1 1 .O g

MgS04.7t IzO 0 . 2 g

Ferric citr-ate 0.005 g

pll was adjusted to 7.2 using NaOH

Distilled water- 1000ml

liutrient Broth (NB) (Atlas 1993)

Pcptonc 5 g

Na('1 5 g

Hoef'extrnct 1.5 g

Y cast extract 1.5 g

pi4 adjustcd to 7.4 with NaOH

Distilled water I000 nil

Potato dextrose agar (PDA) (Atlas 1993)

Potato infusion 200 g

Cilucosr 20 g

Agar 1.5 g

Distilled water I000 mL

Dworkin and Foster (DF) salt medium (Atlas 1993)

h19 minimal medium (Miller 1974)

Thiani~ne I IC I sol utlon ( 1 0 0 rng 1 I00 m l )

0 2 g

1 niy

1 0 PC

1 0 pg

70 Pf

5 0 Pf

1 0 pg

1000 nil.

1 nil

1,uria Bertani agar (LBA) (Atlas 1993)

Tryptone

Yeast extract

NaCl

Agar 15 g

p H adjusted to 7 2 with NdOII

D~stllled water 1000 rnL

plkovrkayd's agar m e d ~ u m (Plkovskayd 1948)

Yeaa extract

C alc~um phoiphdte

Ammon~um sulphatc

KC I

MgC l

M n \ 0 4

r ~ r r o u s sulpl~dte

Agdr

I I I \ ~ I I I L ~ WLLLLI.

3.1.5. Buffers and solutions

DNA extraction

Glucosc 0 99 g ( 5 0 m M )

Trls 0 3 g ( 2 5 m M )

FDTA O 7 7 g ( 1 0 mM)

Adlusted to pH X 0

Double dlbtlll~d w d t ~ r 1 00 m 1

Sodlum dodecyl ~ u l p h a t e (5DS) 20%

20 g of SDS was dlssolvcd In 100 ml o f douhlr d i s t ~ l l ~ d water

2.5 rng of KUase .4 u a s dlurol!ed in 1 ml ol' 10 mM I rih (p t l 7 . 0 ) dnd h[~tlcd at

7O"C l'or I0 rnln.

1X.i11 g o f b l 1 l . l u a \ d l s s o l i r d in 100 nil ul'douhlc dtstillcd i\atcr

0.12 g of Irir mas d!\\ulicd [ti 100 mL ol double disttllcd watcr and aillusted to

pH 7 h using I [('I.

Sodium acetate (3 \I)

10.2 g of codllim acetate was d~ssol \cd In 25 ml. ol'douhle d ~ s t ~ l l e d water

Buffered phenol

Distilled phenol was extracted once with eqlial volumv ol' 1 M Iris II('I hufl'cr.

'The upper aqueous phase u a a dlscardcd and the phenol u a s again extracted w ~ t h 0.1 M

Tris until pH 8. To thc phcnol. 0. 8-hydroxyquinoltnc (0.1'%1) u a s added.

Chloroform : lsoamyl alcohol

Chlomfom 24 ml

lsoamyl alcohol I mL

'TE buffer

'I Iis

I 1) 1.4

pH adjusted lo 8.0

D \ 4 loading d!e

Glycerol SOUb

k1)TA pH 8.0 0.2 M

Hromophcnol blur 0.0.5"/~,

Kthidium hrornide

10 mg of rthidium brom~de nab dlssol\'sd In 1 ml. ol'uarzr.

'T4E buffer 50 X

l r l r base 242 g

Glacial acetic acid 57.1 mL

O.iM E.1) I A. pH 8.0 1 O i l mL

Adjusted to pH 7.2 and final volurnc madc up to 1000 mi uvng dluilled watcr.

3.1.6. IAA estimation

~ a l b o n s l i i ' s reagent (Bric et al. 1491)

Conc. II-.SO? 150 mL

Diar~lled water 250 mL

0.5 M Tc('li.6H:O 7.5 mL

3.1.7. Cytotoxicity assay

I'BS

C r o n t h medium

T r y ~ s l n 0.25°;,

LDT.4 1 mh4

Thc a h o w component5 werc dissolbcd In PHSA

hlTT

5 mg of MTT was dlssol\ed in I mL of double dlatlllcd >+ater and filler stcrillred.

MTT lysis buffer

209, SIX In 50% d~mcthyl f o n a m i d c

3.2. Methods

3.2.1. Maintenance of bacteria

Rdctenal culturcs were maintained o n KBA plates in a rzfngerator fiir routine use.

I or lung lerm storage. the cells ucrc suspenrlcd In ster~le uatcr and htvicd at 4°C' or ucrc

prc\t.ncd in 40°0 glycerol at -7O'C.

3.2.2. Maintenance of fungi

rung" culturcs n r r r mnlnlaincd on I'I)A pldti.5 In a refr~gcrator fbr routlnc we.

I ~ i r long term storage. the culturcs were maintamed oil PDiI ~ l a n t s In a stenle test tuhc at

4'C

3.2.3. Sterilization

All ths m e d ~ a , h u f i r a and reagents used in )hi+ ?tidy ibsrc stcril~/ed st IS

Ih? Inch' for 20 min u n l e s ~ othcruise specified. Thc chemicals u111ch M C I ~ i"ound to he

h u t lab~le wcrc filter sterillrcd uslng 0.2 p filter (Milliporc. Molahclm. F r a n u ) .

3.2.4. Isolation of fluorescent pseudomonad bacteria

A suspension of rlce rhirosphere soil was obta~ned by shaking 10 g of root plus

1~~1,tl) odhcnng soil in 90 ml 0.1 M 41gSO1.7I420 huiftr for 10 min at 180 rpm In a

lovary shaker. Hundrud ~nlcroliters oC the ruspenslon nay spread onto KHA (King et al.

1054) and ~ncuhatrd at 27°C for 2 days. Srnglc colonies that fluoresced undcr IrV hpht

,?oh nm) Mcrc s~raahed onto KHA tor ohtrlning purr cultures.

3.2.5. Screening of antagonistic fluorescent bacteria

Standard agar plate bioassay Mas h l l o a e d to acreen the antagonist~c fluorescent

p\cudomonads (Sakthivel and (~nnnaman~ckam 1987). Hr~etl), hoctrrial plugs o f agar

ucre r c n ~ o ~ e d from a 48-h cnlturc and transrerred to potato dcxtm\t: agar (1'I)A) plates

ah101 has hccn spray ~noculatcd prev~nuslj u ~ t t i a lilngal spore whpension (10"

sonidia niL). I he zone ol' i n h ~ h ~ t ~ o n around the hactrrial plug was n~rasurcd aiier 3-4

da!, lncuhat~on of assa) plates at 2SuC.

3.2.6. Experimental design, data collection and analysis

Experiments were set up in a completely randomized design with 3 replicat~ons

lor each treatment. Lkta on lone of inh~bition and cell ~ ~ a b ~ l ~ t y \\.ere recorded 3-4 days

afier incubation. Mean and standard error ( S t ) were calculated and differences hetueen

means were tested using Duncan's multiple range test at the level o f p = 0.05.

3.2.7. Taxonomic characterization of antagonistic strains

Taxonomic characteri~ation of the hroad-spectrum antagonistic hactena %ere

Ljollc on the h a i s of routine hlochemical tests ~ u c h as fluorescence on KHA. c!.tochrome

,,*idn~e, arglnine d~hldrolasc , nitrate rcduction. gelatin hydrolysis, levan production.

l~tiltiatlon oi' carhon source such as glucosc. I.-arahtnuse. werose. sorhilol, er>thrltol.

~n~ann~tol. nlaltose. adonitol, citratc, trehalosc. glycinc, phenyl acetate, hlppurate.

tnlcntinure and paraffins (Staniur n al. lY60: C'hamp~on st al. 1980: Barett ct al. 1986,

I r 0 ~ ~ 1 , ct al. 2000). Keaults of rhcsc teats \%ere acored aa cither p o s ~ t i w or negatibc. Cell

m(~rpholopy. (,ram statning. growth at .?"C and 4?"C %as determ~ned fo l lou~ng standard

nierhods.

3.2.8. Isolation of Cenomic DNA

Total genomlc DNA u a s extracted as described (Leach ct al 19'12: Sakthivel et

dl. 2001). Bacteria wcrc grown for 24 h 111 1.5 mL YB at 28°C on a rotary shaker at 200

rpm I he cells were pelieted at 10.000 g for 5 min In a mlcro centni'ugc tube. 1 he pcllet

\<as resuspended In 330 pL uf solution I and ~ncuhated for I0 nun at room temperature.

l a this, 8.3 pl. o f 2 0 % SOS mas added and incubated at 50°C for 10 min. Tu the mixture.

13 11. of Rhase A was added and after 1 h of incubal~on at 37°C. 17 pL of 0.5 M bD1 A

'+as added and incubated at 50UC for 10 min. ' lo \he lysdtc. 10 pL of pronase was addcd

and lncuhated at 37°C for 3 h. This was extracted ta ice with equal volume of buffered

phenul by centrifuging at 10,000 g for 10 min at room temperature. The aqueous layer

ohtJlnzd was extracted w ~ t h equal volume ufchlorof'olm 1soain)1 alcohol by centnfuglng

,t lo.(i00 g for 10 mln. l o thc resultant aqueous layer. 50 flL of 3 hl amrnonlum acetate

1,000 pL of 95"e ice-cold cthanol mas added and rn~xed uell to precipitate the DNA.

l h e 1)NA \\as pelleted at 10.000 g for 5 min and thc pellet u a s bvashcd in 70% icc-cold

C~IWIIOI. Thc pcllet was then dricd In a I)\A speed \ac system ('I henno Sabant 7hcrmo.

I'orL, l lSA) and dissohed in 5 0 fiI. of I L.

3.2.9. Quantification of DNA

l r ~ i n~icrol~tcrs of DNA sample mas nilxcd a i t h 990 gL of' TE buffer and was

read at 260 nm in a spectrophotomckr iBecknian Cuulter. ITS:\). An O D balue of one

correrpond to approximately 50 pg.rnL double strandcd D S A (Sanibmok et a1 IOX'I).

l ioxd on the 01) \slue, DNA samples ucrc quantified.

3.2.10. Purity of DNA

Purity of 1)YA samples \ l a$ e~timated bawd on ratio between OD at 260 and 280

nm. I'ure Oh'A sample has an OD value 2601280 hetween 1.8 to 2.0. Contamination r i t h

Protrln or phmol reduces the value (Sambrook ct al. 1989).

3.2.1 1 . 16s rRNA gene sequencing

,Amplification of 16s rRNA gene from the genomlc DNA of bactcria was done as

Je,crlbed carlier using unt\ersal pnmers. fI)l (5'-ACil i'T(iATC'CTGCiC7C.A-3') and

(5'-:\C'GOCTACCI'I(iT~IACGACTT-3') (Weisburg ct al. 1991). The reacclon

I , I I \ I U I ~ (50 PI.) consisted o f 5 pL IOx I'CR reaction buffer, I U L of' 10 mM dNI'P mi\. I

1 01 T(1i1 IIN.4 polymerax. 3 )11 or25 mM MgCI:, 50 pmol of each pnnier and 50 ng of

~cmpldtc DNA. l l i r final \olume u a s made up to 5n 111 u\iny sterile double dlst~lled

uslcr The program conslhlzd of Initial dcnaturatlon at '11°C h r 1 min. 30 cyclca of

ilcnaturation at 94°C ibt. I min, annualing at 46°C' [or 3 0 sec and extension at 72°C for 4

in1111 n ~ t h a final cxlcnsion at 72°C' ror I 0 min. Ihc ampl~fted DNA was purificd using

tillcn~con" PC'R purificduon ds i ice (Villiporr Corporation. Bedford. MA. I I S A ) , diluted

ti1 LOO ng'pL, and \,as sequenced uslng the hcilit) ac Microsynrh Inc.. Balgach.

5alt7erland. Similarity searchc\ of ' th r qrquencc ohtamed u a s done using the BLAST

i.-\l~achul et al. 1990) function of CienBank and S~niilarity Rank of the Ribosomal

I)atabasc I'roject (KIIP) (hlaidack et al. 1997).

3.2.1 2. Production of extracellular fungal cell wall degrading enzymes

Production of cxtracellular fungal cell u!all degrad~ng enzymes, cellulase and

Pcctlnase was determined ar described e a r l ~ r r (Cattelan et al. 1999). M9 medium agar

illlller 1971) amended with 10 g of cellulose and 1.2 g of yeast extract per liter of

dl5tlllrd watcr was used to test the cellulase activity. iit w h ~ c h clear halo after 8 days of

of the colonies at 28°C was considered as pohlt~ve for cellulase production.

I detenninlng the pectinase activity. I0 g pcctln plu? 1.2 g yeast extract was amcndcd

~1') nled~um agar and the plates wcre floodcd w t h 2M IICI after 2 days uf ~ncuhatlon

28'C. Clear halos around the colonies uerc cons~derzd as pos l t~ce for pectinase

p~.o(Iuctlon.

3.2.13. Determination of plant growth influencing metabolites,

hormones and enzymes.

3.2.13.1. Hydrogen cyanide (HCS)

I'roductlon of tICN wah carr~rd nut ibllouiny standard method (HaLLer and

Sch~pper\ 1987). Singlc colony n a s strcahud onio KBA amcndcd with 4.4 g:L glycine. .4

'1 cni d~amctcr &'hatman No. I filter papcr disc soaked in 0.5'X picric a c ~ d in ?'%I sodium

i~rhonatc waz placed onto thc lid of the I'etn plate. The Petri platc n a s sealed \\it11

pardiilm and incubated for 4 d a y at 28°C. The change of coiour of' filter paper from deep

!~llou to orange indicated the product~ori of H('S by the bacterium 4 n unlnoculated

plate u a s used as control.

3.2.13.2. Phosphate solubilizing enzyme

In ordcr lo dctcrmine phoqpharaic cnzlme that minerail7es organlc phosphate,

p~hin\ka)n ' s agar medium conta~niny tlicalciunl phosphate was used. Agar plates were

.pof innoculated a ~ t h the test hactcnal strains and incubated for 2 - 5 days at 28°C. The

,Is\c.lopmcnt of clear 70nc around inociilatlon site naa considered as an index of

soluhillration (Pikonkoya 1048).

3.2.13.3. Indole-3-acetic acid (IAA)

The production of I 4 A %as dctcmincd by using standard mcthod (Bnc el al

lC)OI) Single colony isas streaked onto I HA amended uith 5 mhl L-1r)ptophan. 0.06'%,

,udiorn dodccyl suiphatc and I n u glycerol. Plates here o\erlaid uilh Whatman no. I tiller

pdprr ( 8 2 mni diameter) ~ n d thc backr id alrain \%as alloi\cd lo gro\b fur a pcriod of 3

(ldys. i\ftcr the lncubat l~n pcriod, thc pdper u a s remo\ed and 1redtt.d nith Salkowski's

lcnpent (Gordon and Wchcr I q 5 l ) u11h rhe forn~ulation 2Do of 0.5 M ferric chlor~de In

ji'% perchloric acid. Membranes here saturetcd in a Pctn dlsh hy soaking dircctly In

Salkouski's rcagcnt and the production of 14A h a s ~dcntificd hy thc formation of o

characteristic red halo nithin the memhrenc immediately surrounding the colony.

Quantification of IhA u a s done folloning colorimetric method described earlier

(Pattzn and Glick 2002). A single colony of the bacterium was propagated overnight in 5

mL of I)F minimal salt medium and 20 $L of al~quot was transferred Into 5 ml. of L)k

ll,,nlmal salt medium amended with 500 fi&'mL of L-trqptophan. Alicr 40 h of growth at

1 5 , ' ~ in a rotary shaker at 180 rpm, the cells uerc pcllctcd at 5,000 g for 10 min. 70 1 ml.

,I the supernatant, 4 mI. of S a i k o ~ s k ~ ' ~ reagent was added, mlxed well and allowed to

, t~nd at room temperature for 20 mrn. The absorbance u a s measured immediately at 535

nl~,. An uninoculated control uith S a l k o u s k i ' ~ reagent was used as referalcc. I h e

iolicetltrotioll of IAA \%a> determined on comparing with the standard c u n c .

3.2.14. Extraction and purification of antibiotics by the antagonistic

strains. PUPa3 and PL23

3.2.14.1 Fermentation Media

I.or the product~i~n of anlibiotics by the atrarna. PCPa3 and P1123. PPM (Rosalcs

cl 41. 1995) and Kanner medium (Kanncr et al 1978) was uscd rcspcclr\ely. In order to

ohtsln ' N labeled antibiotic horn strain 1'1123. amm<)nium chloride in Kannsr medrum

iias suhsrltuted a l t h "N ammonlum chloride.

3.2.14.2. Extraction and purification of' antibiotic by the strain PLPa3

I h e strain PUPa3 was &Town in PPM for 5 days a1 28°C. The fermentat~on broth

"as then centrifuged at 10,000 g for 10 mln in order to remove thc cells and the

Yupernatanl (10 1,) was extracted into equal lolurne of ethyl acetate. The comhlned

,,li.nnic layer u a s concentrated under reduced prcssure and the crude extract u a s tested

hroad-spectrum actlblty against the f u n g ~ listcd carl~er. I h c crude extract uras

,l,romato&~aphed over slllca gel eluting with chlorofbrm. chiorofcirm-methanol mlxtures

,s I ) and finally with methanol and was further punfied using chromatotron. u ~ t h j0/,,

nlcrhanol in chlororonn as sol\ent slsteni. 7liese purified fractions were tested for

,il!t~lbnpal acti\lt) using .if. pha.seolina as the rest fungi following agar diffusion method

~ ( ~ i ~ r u s l d d a ~ a l ~ et 81. 1986). Actlve finct~ons \\ere poolcd trigcthcr and conccnaatcd under

icdu~cd nressurc.

3.2.14.3. Extraction and purification of antibiotic by the strain PC23

Ihc strain PL23 \%as grown in Kanner m e d ~ u m for 120 h at 25°C. The

lzrrnentation broth Mas centnfugzd at 5.000 g ibr i nun 111 order to remo\c cells. To the

\ilpcrnatant (4 1) equal iolume of ethyl acetate war addcd and mincd in a rotarq ahakcr

lor 1-2 11 The resultant emulsion war then filtered in cheesecloth and ih i aqucoua layer

1\35 separated in a separating funnel. The crude ant~biotlc was rzco\crcd from organlc

Idler hq cvaporauon in a rotary evaporator. I hc antibiotic a a r adsorbed on a sillca gel.

dpplied to a previously packed silica column and eluted with chlorulom. Thc a c t h e

fructlons h e r e collected, applicd onto the prc-coated preparative thin layer

chroma[ogaphy (I1.C) plates and developed with sulvent system of chloroform-acetone

('1 1). I he plates were examined under LIV at 254 and 365 nm. ?he active greenish

!tlloa spot was scraped and extracted from s~l ica gel using chloroform. The purity of the

~ltlhiotic was confirmed by high-performance liquid chromatography (HPLC). .A slngle

\\,Ic detected in a Phenomenex Luna (2) ('18 reverse phased column (250 mm X 4.6

,,1111) "hen aceton~trile and uater (both containing 0.1% tntluoroacetic acid) in a 30 to

- r r o o Ilnenr gradlent u a s uszd as thc solvent qyqtem with a flow rate of 0.7 mlimin

(Thrrrnashow el al. 1990). The chromatogram was detected at 254 nm.

3.2.15. Structural elucidation of the antibiotics by the strains, PUPa3

and PL23

3.2.15.1. Fourier transform infrared (FT-IR)

To analyze tlic functional groups of lhc purllied antibiotic, FT-IR spectrum \\.a7

rzcorded using the Shlmndru 1'1-II~-1(300~8700 (Shimadlu, lokyo. Japan). with a

rcholi~tion of 4 cm, auto g a ~ n and at1 average o f 4 0 scans in the frequency range of 4,000

'00 cm I . L)ncd sample was loaded d~rectly and thu spectra Rere rrcordcd at room

temperature.

3.2.15.2. Mass spectral analyses

Electron Ionization Mass spectroscopy (El-%IS). The El-MS datd waa recorded

using Finn~gan MAT 1020 (Thermo Electron Corporation. San Josc, CA. LS.4).

Fast atom bombardment mass spectra (FAB-MS). The FAB-MS Fpcctra ucre

rrcllrded on a JOEL SX 102lDA-6000 mass spectron~eter uslng argon (6 kV. IOmA) as

tile FAB gas. The accelerating voltage \>as 10 kV and the spectra were recorded at room

tc"lpcrature, m-n~trobenryi alcohol (UBA) u a s used as the matrix.

Electrosprag mass spectra (ESI-\IS). 'I hc tSI-MS spcctra were recorded on a

\iI('KOM:ZSS QL:ATTRO I1 triple quadrupole mass 5pcctromctr.r. Ihe sample was

,ii,sol\ed in aceton~trile and introduced into 1:SI source through a syringe pump at the

~ ~ t e oESp1. min. The ESI capillary n a s set at 3.5 kV and the cone \ulidgr waa 10 V. Thc

q c c a a were collected in 6 s scana and rcwlt uos an abcragc spcctrum of 6-8 scans ['or

rllc \ I S M S spectra of EST-MS the cap~llary was sct at 3.5 k\' and the cone bollape way

511 \ , Argon u a s used as the collis~on gas at a prcsaurc such that the parent ion heam

~ntcns~ty was reduccd to 50''. The collision energy u,as 5-30 c\' u a s rccorded In the

spectra. The spectra a c r c collected in 2s scans and thc rchults wcrc axraged spectra of

25 rcana.

3.2.15.3. Nuclear magnetic resonance (NMR) analyses

One and two d~mensional NMR spcctra of the pur~fied antibiotics were recorded

on a 'state of art' 600 MHz Varian Lnity-Plus spectromcter (Vanan. Pal0 Alto C'A.

1 SA), operating at 499.96 MHz for proton and 50.68 MHz for ' N respectively, with a 5-

1nM trlple resonance Inverse detect~on probe. NMK data set was acquired at 27°C uvng

( DC1, as sol,ent. 'Two-dimensional l ~ - l l i 2D doublc quantum filtered correlat~on

,pcctroscopy (LIQF-COSY) (Piantini ct al. 1982) and the total correlation spectroscopy

( r ( K 5 Y ) methods were employed to resolve the complex ' H K41R signals. 'The

,~li.mical ~ h i f t assignments were confim~ed by a comparison of NMR slgnals In I D

jpcztrum w ~ t h those in 21) L)QI,-COSY and 7 0 T S Y spectra under sltnilar expenmental

,,,nd~tiona. .I11 2D NMR data sets a e r e collected In hyper complex phase acnsilice modc.

\cqulsltlon parameters includcd n 7iiOO Hz spectrum w d t h (SW). (1.4 s acquisition time

,.\TI. 9.Ous as 90" proton pulac a ld th and 2.0s pulse delaj and 16 transients per

~nclznicnt 'H- 'H 2D- TOCSY spectra ucrc recordcd urlng M I 1.V-I7 (Hal and Davis

IOhO fur so tropic miring for 70 ma at a HI field strength o f 7 KHz. Behre processing.

IIIC I? d~menslon ofl)Ql'-C'OSY darn sets were zero-filled to 8K and thc 11 dimension of

1)01 ( 'OSY data sets to 4K. All other evpenments s e r e zero-filled to 4K. When

ncczsiary. spectral rcsolut~on was enhanced hy I.orenztan-(jaussian apodlration and

( ' l ) i l : pcak at 7.26 ppm, \%as used as a chemical shift referencc. Proton decoupled '"4

\ h l K rpectrum u a s recorded using Cl)C'I, as the s o l ~ c n t .

3.2.15.4. Molecular modeling of antibiotic by the strain PLl23

For molecular modeling studies of thc antibiotic by thc strain P1J23. Ah rnilio

calculations were performed using Juguar-v4 ? from Schroed~nger Inc. and Gaussian98

ILaursian Inc., Wallingford. Cl'. LSA) . Geometry optimizations and energy

nlinlm~zations for monomer as well as the three dimcr conformations were performed

UUng B31.YP.6-31G* basis sets. All the energyminimized structures were further

charactcr17cd to be stable molecules by computing the second deri\atives of the energy.

3.2.16. Isolation and characterization of genes involved in the

11ios)nthesis of a novel dimer antibiotic by strain P.Juorescen.s PU23

3.2.16.1. Amplification of phenazine gene cluster and agarose gel

electrophoresis

The phrnarlne b~oaynthct~c gcnc cluster uns nnipl~ficd l i o n the yenomic DN.4 of

,[rain PL'2.i using the gene-rpecllic prlmcrs. P h ~ r (5'-TA:IGGII I CC'CiCi IAGTTCC'AA

~,CC'CACiAMC'-3') and l'hzI< I~'-C~CTTCTAC~AATCC~.-~.~C'AGCG~~AAC:~C~GCACA

( ~ , - 3 ' ) The reactlon mixturc (25 p1.I c i~ns~sted of Ix LYT bulTcr (f'in/ymes. Finland). 2

mM MgC12. !'V,, IIMSO. I 0 mhl cacb d N I P, 2(1 pniol of each primer. I 11 of D y N A / y i e

i l ~n/)mca. Finland) and 20 ng of ~ c n ~ p l a t e DNA. The nmpl~fication Mas performed on a

I'erkin Elmer GeneAmp PC'R ayslem 2400 (I'crkin Elmer. Rothrcu/, Si+it7erland) using a

30 cyclc program of denaturatlon at 04°C tor 30 scconds, anneal~ng at 64°C for 30

\cconda and extcnrion at 72'C for 7 niin with an inltial denaturation at 94"(' tbr 1 min

dnd a final extension at 72'C for 10 min. A 3-pL al~quot of ampllficatlon product was

s lcc t r~~horesed on a 0.7OLl agarose gel In I x 7.4E buffer at 50 V for 45 mln, stained w ~ t h

ctli~d~urn bromide, and the PC'R product was viauali7ed under UV.

3.2.16.2. Sequence analyses of phenazine biosynthetic gene cluster

I'he amplified DhA uras puntied using ~ l c r o c o n " PCR purlficatlon d e v ~ c e

i\lillipore Corporation. Bedfurd. M A . IlS.4). diluted to 200 n g p L , and was sequenced

ublng the facility at Micros)nth Inc.. lialgach. S\\itscrland. ' lhe ssquences were

ds,crnhled using the program "Seqald". Sim~larity searches of the sequence were

p ~ ~ f o r n i e d uzlng HI.AS I (Altschul et al. 1990) funcilon ofC;unHank.

3.2.17. Antimicrobial acthi@ of the purified antibiotics

I o test the hroad-spectrum antlmicmhial activlt! of the purltied antibiotics, agar

citnilcion mcthod (Ciurusiddaiah er al. 1979) was I'ollo\~cd. Stenle paper discs ih mm)

\*err separately treated wlth diffcrcni concentration of nntihiot~c (2.14 pgniL) and

ylaccd iin the surface of P D A agar plater thar u e r r sprcad-~noculatcd with conidial spores

I 10'' mL) of test fungl, Assily plates \\ere ~ilcuhated at 28°C' fur 3 ddyi and the 7one

po\vth lnh~bition mas measured or hllC \%as iietemiincd in cazc of thc metahol~te from

\trnni 1'1123.

To evaluate the pH dependent activity of the antlhiotic by the strain P1123, the

.issays Here done on PI)!\ plates with pll range of 5 . 5 , 6 . 5 . 7.5. 8.5 and 9.5, uslng M.

l~~l~iic~olinrr M P S as the test ftmgus. hntimicrohlal acti\ity of monomeric phenazlne-1-

"rhoxyic acid n a s compared with antibiotic by the stratn PU23 usmg .S. onzue SONS.

3.2.17.1. Scanning electron microscope (SEM) analyses

In order to nna1)ze the morphological changes in the niycclial grouth and

spon~lat~on. SEM analy~es were camcd out. For SPM analyses. mycelial hamples from

111c peripher) of the rone of inhibition and control plates were mounted directly on

sciricli douhle-adhewe tape, coated w ~ t h gold to a thickness of 100 A" using Lacuum

cloporator ( H ~ t a c h ~ . 1ILS 5 GH, IoLyo. Japan). ('oated aaniples a e r e nnnljred In a S1.M

( 1 l ~ t ~ i l i l . S-40 . l ohyo. .lapan) operatcd at 15 L\' and at a resolution of 1000x.

3.2.18. Anticancer activity of the antibiotic by the strain PU23

3.2.1 8.1. Cell viabilic assays

Cellc line. SIV480. Ai.49, MC'l:7 and HeLa ~verc lcbtcd Car ccll biahility follouing

tlir modified method of Anto et al. (2000). Brlefly, cclls grown in 96-well microtitre

pldlex (5.000 celis'well) \\ere incubated for 18-h uith or w~thout different concentrations

ol' the alilihiotlc b! the saain PI123 (0.5 5 pM). \licortitrc paltcs (5000 cells'uell

uilhout a n t i b ~ o t ~ c sewed as control. Then the medium was removed and tiesh medlum

aaF added along with 20 pl- of 3-(4-5 dimethylthioiol-2-41) 2-5 d~phenyl-tetrazolium

bromide (MTT) (5 mg mL) to each hell. I he platcs uere incubated for another 3 h and

the formalan crystals formed were solubilized with MTT lysis buffer. The plates uere

placed protected from light. overnight at 37°C in on incubator. The color developed was

quantitated (measuring wabclcngth: 570 nm, reference wavelength: 630 nm) a ~ t h a 96-

n ~ l l $ate rcader (Bio Rad, USA). 7 he cell v~ablllty was expressed as percentage over the

~ i ~ n t r o l .

3.2.18.2. Acridine orangelethidium bromide and annexinlpropidium

iodide staining methods

Lung cancer cell?. 4549 (5.000 cclls:wcll) Rere cultllred In a 96-\bell plate and

~rc,itrd irlth the antihiot~c hy the strain 1'1123 in dirrcrcnt conccntratlon\ fur 24 h.

Il~cottitru p a l t e ~ (5000 cells uell uithour antlhlotlc acned as control. iifrcr \ \ash~ng once

uith pliosphate-bufkrcd snllne (PBS), the cells were stained u ith 100 pL of a mixture

11.1) of ncndine orange-cth~dium bromide (4 p g m L i solutions. The cclls uerc

immcdlarcly washcd once \ \ ~ r h PHS and vicwtd using an i n \ t n c d fluorescent microscope

I t,clip\c rl:!00. \ikon. 1 oi\)o. Japan).

I.or anncxlnpropldiuni iodide stalnlng, the A549 ccllr were seeded In a 96-\\ell

pldte (5.000 cclls'well) and treated with different concentrations of the ant~hiotic hy the

rtrdln PC23 for I h h. The cells were ujashed once with PBS and subsequentlq trealcd

~ l t h I X assay huiier, annexin-fluorescein isothiocyanatc and prop~dlum ~ o d l d e as per the

protocol described In the annexln V apoptosis detection kit (sc-4252 AK) (Santa CNZ

Hiotechnulogy, Santa C'ruz, CA. liS.4). After 10 niin in dark, the cells uere washed with

PBS and the green~sh apoptotic cells were observed uqing an invened fluorescent

nllcroscope and photogaphed.

RESULTS

CHAPTER - 4

RESULTS

4.1. Isolation and screening of fluorescent pseudomonads

A total of 56 isolates of tl~iorescent hactcrln were lsolatcd froni thc rice

ltl~/osphcre so11 These Gram-negatne. rod shapcd. motilc bactcrla a c r e tentatively

ilicnt~lied as fluorciccnt pscudomonads b a e d on the prrience of fluorc\ccnce on KBA

ar id poqitive rraclions Sor arglnlne dlhydrolase and oxidase. Of 56 iiolates, only PL23

a114 T1I1Pa3 cxh~hitcd a broad-spcctrum antifungal ac t ib~ty ageinst the test fungi such as

I 1 $risen W(iS. H suiizni K S R I . S. o n x c S O N S . 21 phascoihii. MPS. B cinera

B( TK.411. C c~ipsici CCL. C' ~/cuspur.uiilcs CGL. (: fii/<nrirm (FL. P, rhcoc PTS. F.

on~poruni f . sp i~a~rnf~cf i i in FOV. and E orysporiini S, ap cuhcnse FOC dnd induced 1-

? 5 cm dianierer of growth-free inh~hitlon zonc ( f i h l c 1).

4.2. Biochemical characterization of broad-spectrum antagonistic

bacteria

Strains PI123 and PIlPa7 produccd fluorescent p i ~ v ~ c n t on K R A mcdiuni and

,Iloi\ud p o s t ~ v e rracrlons for arginine dihydrolase. gelat~nasc and cytochrome ou~dase.

\trJlIl PI'?! tested positi\e tbr nitralc reduction and otili7ed carbon sources such as

clu io\e. L-arahinose, sorhitol, erythritol, ndon~tol. cltrate. trehalosc and gllclne hut falied

10 p~oducc lexan and d ~ d not utilize sucrose. niannitol, maltose. h~ppurate, nlcotlnatr and

p a ~ ~ f i i n b and d ~ d not produce levan. Strain P1123 qhoued g o \ + t h at 4°C' and d ~ d not g o a

~t 1?"C (Tablc 2). Strain PL Pa3 tcslcd poaitivc [or l u a n production hut nogatibe for

n~trnre reduct~on and L I ~ I I I L C ~ glucose, niil~inil~l. CIITBLC. 011d trehalosc. Sh-aln PI'Pa7

bled to ut~lize L-arabinose, sucrose, aorb~tol, crythritol, maltoao. adonltol. gl)cinc.

I l ~ p p u ~ ~ t r . nicot~nate and parsl'iins and naa able to y o u at 42"C'but not at ?"C' ( I able 2 ) .

~ s b l e 2 Biochemical characteristics of the fluorescent pseudomonad strains, PC23

and P t Pa3

- - - ~.

I luorc\ccnce - ( ' j~ochrome ohidasc t t

11.g111ne ddthydnilasc i i

\'11r,itr reduction

i ~clotdtn hydrolysis

('arbon L-tilization

(rlucosc

I -dlnb~nosc

burrose

borhirol

I n thr~to l

Clannitol

Llaltosc

d o n ~ t o l t

( ~tratc t

1 rehalose + (il!c~nc t

Iiippurate

I\lcot~nate

I'araffins

4.3. 16s rRNA gene sequence homology

I'rimers. ml and rP2 aniplllied the IIN.4 iidgmenr of 1.5-kb slrc ol' 165 rKSA

iihcri total genomic DY.4 of PI.23 and PCP23 \\as uscd as template. Analyes of

q u e n c e of 16s rRN.4 uaing the HI.AST f'unct~on of the GenBanL rebealed that the

11131n PL'23 helonged to P Jli~oresceri and the ph!logcnctic analyses ~ d e n t ~ t i e d P.

r/~ior<,,ie,ts A1108303 as thc closest nr~ghbour (Fig l i and thc strain PITPa? was

i~iclirified ar P, i~o. irgi~iosu ~ ~ t h its closcst ph)logcnct~c ne~ghhours. P ui.ru,yinosa

1ltO:?312 and .4Y631?30 (Fig. 2 )

Fig. 1. Phylogenetic position between the strain P1123 and its closest relatixes In the

genus Pseudon~onar based on the 1 hS rRVA ualng IJPGMA.

Fig. 2. Phylogenetic posit~on hetneen the stram PlrPa.? and ~ t s cloacst relatives In the

genus Pse~in'omoncis based on the 10s rKNh using LP(GMA

4.4. production of extracellular fungal cell wall degrading enzymes and

plant growth influencing metabolites, hormones and ennmes

P flrrorertr~~is P1'23 s h o ~ r d pilsilire reactions for phosphatase and ncgatibe for

[.\.I. HCN. cellulase and pectinase. I' nc,rugirio\o PUPa3 showed positne reactions for

c~~alaac , phosphatase and prt~duced ?h 6 pg mL 01),,,, of 1.4.4. Straln PIIPa3 s l ~ o a e d

ncp.~r~\e reactions for pectinaw, ccllulase and I1CK.

4.5. Extraction and purification of antibiotics

Crude extract ( 2 g) ohtaincd from P, ur'riigrnosa P1TPa3 \\as bn~a,nish In colour.

I'pon pi~rificat~oli through allica gcl and chromatotron. the extract yeldcd 20 mg o i

purltied ~ r e z n i i h - ~ e l l o \ v nictahulitc.

C'rudc cxtract (600 my) ohtaincd from 1'. /7uorc\(e11.! 1'1'23 shoned greenish-

lcllou colour. On pur~ficatioil to homogeneity hy silica gel colllmn chromatography and

preparative TI.('. 50 mg (11' purilied compound was ohta~ned. A single peak with a

retention rime of'4.94 min In analytical HPLC confirmed thc purlty of the antibiotic (Fig.

31.

119 33

.a0 I 20 ' W1n ' 3 4 <a1

Fig. 3. HPLC profile of the pun l id antibiotic by thc strain P. f l ~ ~ o r r s r ~ n s Pll23

4.6.1. Structural characterization of antibiotic by P. uerugino~u PUPa3

Thc yseni~h-)e l lo \ \ metaholilc from 1'1 I'a? shoucd a rncltlng point of 246°C.

'11-VhIR spectrum (600 MHz, CIICl;) shoued s i p a l a due to the presence of w e n

a~i,nlatic protons at 8 9 fl? I IH, dd. .l=Y.?. 2.1 Hz 2-H). 8.45 (111. dd. J=8.2. 2.1Hz. 4-H),

5.32 1111. ddd..I=2.1. 5.2. 8.2 111,~)-HI, X.31 (111, ddd.I=2.4, 5.2. 8 2 112. 6-11). 7.07 (111,

d,l..l-X?. X4.Hz 3-H).7'14(lH.dd..I=X.2.2.2 t1~ .8-11) .792(1H.dd. . I=8 .2 .2 .2H7. 7-

1 1 1 (Fig. 4) . I urthcr. l ~ ~ - ~ h l ~ d~splayed two i):0 eschangeahle qiynals at 6 10.8 ( I I[. hrs

\11! and 6.31 (IH. hrr KIT). I hc pnlton poqltlonr of the ant~biutic Mere ass~gned uslng

I)()('OSY. TOCSY and NOESY data (Fig. 5. 6 . 7). I hc carhoxam~de proton <i&mals at 8

10 h ppm ~onl i rmcd llic prcscncs of carhoxamide 'I<.-NMR spectra uf thc cornpound(50

Alli/. ( ' l)i l : i ahoucd pcahs a1 6 166. 143.5. 143.0. 111.5. IJ0.X. 133.3, 131.7, 131.0.

I!Y 0.129.l,I2X.8 ppm ( b i g 8). l 'he \1S data shourd molecular ion peak of the ant~hiotic

J I ~n / 223 (Flp. 9) . On the b a r ~ s of'rpectral data and thr i~terature s u n a y (C'hln-~i-\Voeng

ct al. 1908) thc antibiotic has hcen characterized as phenazine-l-carboxamidc (PCN)

i F 13 10).

big. 4. Proton nuclear magnetlc resonance spectrum of antlblotic b! P aeruglnosa

PUPa3

Fig. 5 , DQCOSY nuclear magnerlL resonance spectrum of a n t ~ h ~ o t ~ c h) P aerugrnosa

PUPa3

Fig. 6. TOCSY nuclear magnetlc resonance spectrum of a n t ~ b l o t ~ c by P aeruglnosa

PUPa3

Fig. 7. NOESY nuclear magnetlc resonance spectrum o f a n t ~ h ~ o t ~ c b! P aeruglnosa

PUPa3

Fig. 8. ''c nuclear rnagnetlc resonance spectrum ofant~biot~c by P aerug~nosa PUPa3

Fig. 9. Mass spectrum of a n t ~ b ~ o t ~ c by P aerug1no.w PlJPa3

Fig. 10. Struclurc or anlihiotlc (phenarine-I-carhnxsmidr) by strain I'IIPal based on

U M R and mash aprclrum day4

1.6.2. Structural characterization of purified antibiotic by P,fluore.\cens

PL 23

The purllied antlhlotic from the strain P1'23 hnd a nieltitig point uf24I-243°C'.

rile prwtiish-?ello\\ colored antihior~c was soluhlc In nietllylenr chlorldc. chlurofurm,

d~ei~riltrile and acetone. itisolublc in methanol. hater, dlcthgl ether and hcxanc. The r T -

IR of the antlhiotlc shoued rnajor ahsorptlun hands at 2920. 2850. 1738, 1561, 1521.

1405. lind 1133.04 c m The N-N hnnd stretch oi'tliis anr~biotic u o s obser\sd at 1133.94

cln (Fig. I I ) (Socrates 7001).

'L'lic FAB Inass spectra of the antih~otic g a \ c an M t t l peak at m,z 440 indlcatlng

that the niolecular mass of the compounil is 14X. I he fraplcntation peaks ucrc ohscr\cd

~t ni r 415. 360. 2 2 5 . 207. 180 and 154 ( t i g . 12). Tlir ha% peak u a s ohrened at m//

I54 The electrospray MS also gdie an M-H peak at n1 z 140 w ~ t h M S H J peak at m!7

406 and M+K peak at m'/ 487 (Fig. I?). The daughtcr penks of 466 ES+ were seen at

111 i 449, 242 and 225 ( M ~ t ti. 100 Ofo) (FIX. 13) and the daughter peaks of 225 t S t u3erc

s,h,ci\..ed at nl'l 207 and 179 (100 '!>,I) (Fig. I?). I he fragmmtat~on paltcm of the

d n t ~ h ~ o t ~ c is represented in Fig. 19.

I he aromat~c region of the H NhlR spectrum (Fig. 15) spectrum o r the antibiotic

?ho\sed a typical resonance pattern of p h r n a ~ l n r der~vativr as reported earller

I(~urussidiah et a]. 1986 and Brishane et al. 1987). The sibmals resonated as doublet of a

doublet at 8.98 ppm (J= 8.2 and 1,4117) and 8.54 ppm (J= 8.0 and 1.4 Hz) uere assi&mcd

ptotons at position 4 and 2 respect~\cl). In the 21) H - ' H DQF-COSY NMK spectrum

, I - I ~ 10) both of these signal sho\%ed a cunlnior~ cross peak at 8.05 ppm due to proton at

p n , ~ l ~ o ~ i 3 . This assi@mcnt u o ? fi~rthcr c o n f i n e d through 'H- 'H 2D TOC'SY spectnlm

( 1 IF 17) showing cross peak? at 8.05 and 8.54 ppm to the down field resonance (8.98

pp111i duc to proton at po?ilior 1. Pre\.iously proton-! resonance u o s ~ r o n g l y reported at

\,31 ppni (Ciorusidda~ah el al 1086) based on the 11) It1 N1IR spectra. In our study. 2D

H - I1 I)Ql -('OSY and 'IOC'SY rpcctra iIio\+ed the rcsonancc at 8.30 ppm ashigcd to

pri11011 at position 9 shoaed o common cross peak nlth proton at position X resonated at

% 11; ppm Similarly proton ~t posltlon h a\c~gncd to peak at 8.36 ppn] showed a common

cross pcnk at 7 ')'I ppm duc tu prolon-7. The most Ion field s ~ g ~ a l reqonatcd at 15.h ppm

onamh~guously ass~gned to ~ a r h o x y l ~ c proton. I h r correct and complete ascignments

h ~ h r d on these !\so-dimensiunal NMR cxperimcnts are ahoan in Table 3. Proton

deco,~pled "ti YMR qpectra (Fig. 18) rlio\red ? doublet pcnks at 2'10.5 ppm and 241.8

ppm. ~ndicating two S - N bonds. \%ltIi a coupling constant J"N"N oi' 2.31 l i ~ . On thc

h ~ h of thcsc spectral data the antlb~otlc pmduccd hy 1'. /7uorrsrcri 1'1 23 has hccn

den ti lied as the dimer of'plienar~nc- I -carhouyl~c a c ~ d (Fig. 20).

Fig. 11. Fourier rranstbrm lnfiarcd spcclrum of r h ~ antlblotic by P / l i~ort,s(.rn\ PL127.

1134.94 crn denotes thc N-N bond

Fig. 12. Fast atom bombardment mass spectra (A) and electrospray ~on~zat ion mass

spectra (B) of the ant~biot~c by P. fluorescens PC123

Fig. 13. M S N S of mh 466 (M+NH,) peak of electrospra) mass spectrum of the

a n t ~ b ~ o t ~ c b) P. j7uorescens PU23

Fig. 14. MS,MS of mlz 2 2 5 pedk of elecvospra) mass spei.trum of the a n t i h ~ o t ~ c by P

fluoresrens PU?3

Fig. 15. 'H NMR spectrum of the a n t ~ h i u t ~ c by P, jl~rorescens PU23

- . - - - - . 1

F1 -: ipvm); , , ,,, m."g..

8 2 4 c6.H# CI-H q-H ce-x

84 CI-'d C6.H o . H

8 6 4 8 I C1.8 CI-H

88 -: w-H

90 5 1 #U.H c3-H ' 92 2 94 ~; 96 +v-r--r-mm~~

94 90 86 82 i 8

1.1g. 16. Double Quantum F~ltered ' H - I H Correlated ?D NMR spectrum of the a n t ~ b ~ o t l c

b\ P j7/7uorescens PL23

A C6-H C8.H F1 1

B C 6 A - m I

( P P ~ ) j A C C9.A. C I - H

C6.H C9.I CI-H 1 D W.8-C7.X

64 7 C4-H C7 H C1-H - 6 0

8 6 1

I;ig. 17. Total ' ~ - ' t l correlated NMK spectrum ofthe a n t ~ h ~ o t ~ c by P./luorerrens PU23

l.ahle 3 Complete '11 NhlK chemical shift asugnmcnts (pprn) coi,pliny constants [J (I+.

Fi),II/] ~ ~ t h t~vo-din~ensiuw~1 data (DQt,-COSY) ol' thc antibiotic by P

,Juoreazcns PL23

, I ~ h e m i c n l shift C'oupling c o n ~ t a n ~ n g ~ - c o s ~ ( p ~ n l ) J(I1, H)'(lIz) '11 Crosa-pcaka(ppm1

.~..-~-

11-2 8.51

11.7 8.05

11-4 8.98

H.0 X.36

H.7 7.09

I I-' 8.05

Ij.0 X. i ( l

(OOH 15.6

singlet: ni, rnultiplet

Fig. 18. ( A ) Proton decoupled "4-nuclear magnetlc resonance specuum and (B)

expdndrd "u- nuclear magnetlc resonance spectrum ot [lie a n t ~ b ~ o t ~ c by P

jlllore~cens straln PU23

Fig. 19. ],ragmentation pattern of the antibiotic by P. f7~1uresrois P1123. m'7 448

indicates the structure nf dimer of phenarinc-I-carboxylic acid.

FIG. 20. Structure of the antih~otic ( d ~ n i e r o f phcna~inr-I-carbox).I~c acid) by P

fluori7scans Pll23.

4.7. >Iolecular modeling of dimer of phenazine-1-carboxylic acid by P.

plrorcsccns PU23

1 0 determine thc accuracy of the niolecular modeling calculat~oni, the

,lli>ni~rneric phcna~ine-1-carhox>lic a c ~ d was init~ally geometry optimized. As would bc

niiri~~pated. thc monomer was computed to hc planar hzcausc of thc extended aromatic

,lclocal17ation exhibited hy t h ~ s molecule. I h ~ s 13 further conl imcd hy comparing the

;eometrles of the computed <tructure with the 2.4 resolution X-ray structure of a

iplienaiinz deri\ati\e that has been cocrystali7ed u ~ t h DSA.

hlolecuiar modeling of the antibiot~c by the strain P1123 rc\calcd that

~,>nii1nii8tion 2 (Fig. 23. 24). \\ith thc acid f~lnctional~ty separated b) thc farthest is

cumpi~ted to he the most stable arrangcnicnl fcir tlie dimer. T h ~ s is folioued by confornier

. 1l.1g. 25, 26) and then by conformer 1 (Fig. 21. 22) uith a relatibc oncrgq diil'erence of

'1.3 kcal'mol and 3.4 kcal/niol compared to 1 at the H!LYP,6-31G* le,el of

ronipurational soph~stication.

6 ' H chemical shift

6 I3c chemical shift

1 E = 3.4 Lcrl mol

1 E l - 3.9 Ltal/mol

Fig. 21. Conformation I of d ~ m e r o f phenazlne- I -carbox)l~c a c ~ d by P.j7uorescens PU23

Fig. 22. Three dimensional structure of conformation I of dimer of phenaz~ne-I -

carboxylic acid b) P. f1uorr.rt.rrls PU23

6 ' H chemical shift

F "C chemical shift

Fig. 24. Three dimensional structure of conformation I1 of dimer of phenazine-l-

carboxylic acid by P.,fluorescans PU23

6 'H chemical shift

8 "('chemical shift

Fig. 26. Three d~meni ional rlructure of conformat~on 111 of dimer of phenazine-l

carboxyl~c acid by P.S(rrorncrris PU23

1.8. Amplification and sequence analyses of phenazine biosynthetic gene

cluster of P.fluorescens PU23

A DNA fragment of 6 8-kb (Fig 27) was successfully ampl~fied from the

srnomlc DNA of the straln PU23 using the phenazlne gene-spec~fic prlmers PhzF and

PhrR Sequence analbses of the 6 2-kh c o d ~ n g reglon of the ampl~fied product revealed

that 11 conrained the genes. ph:ABCDEFG w ~ t h 99% homolog\ to P fluorescens 2-79.

8R0% to P. aureofac~en~ 30-84 and P. chlororaphls PCLl391 and 83% to P. aeruglnosa

IJ-\Ol The nucleot~de and ntnlno acid sequence are presented In F I ~ 28

Fig. 27. Agarose gel electrophoresis showing the 6 8-kb PCR amplified DN.4 fragment

ot the phenazlne b ~ o s j n t h e t ~ c cluster Lane 1 I-kb DNA ladder (Promega.

USA). Lane 2 6 8-kb DNA fagment

&A :;;: T,.:: rTz,;.kL-z->,-A - cr.. --" L?,?r-- - , -n-- - , - - -c- - .

. . >. ..L ,%a2--.-,. 2.LaP.ma .... t. 8..GT ;?,L::m;:tGGz

- ' I , L r l - : I - : . . - . . ~.

1081 A G C G A G T G C G C C T C C G A T G C C G C C G G C C T G G G C C A : G T T G G C A G C C A C T A C ~ G C C T G S E C A S D A A S L G Q V Z S H I K S ;

1141 TGCGACCCGCGCCTGAACCCCTGGCAAGCCATTACTGCGGTGATGGCCTGGMGCCTGC C D P 3 L K P M G A I T A V M A b i K A C

1201 CCTCCTCCCTCTTTTGTTTCCCTTTGP. P P P S E V S L '

p a Z D - 1 CT~GAGTTTGTCGCCATS.~CCGGCP.TTPCCAT:GATCGTCCCTTE.CSC~CTGCCT.~CTTCT -

M I G I ? S I P Y A L P ? S

6; CGCGACCTGCCCGCCAACC?CZCGCM?C-GCACATCGACCCCSMCZCGCCGTA2TGTTG R D ; ? A N ; > . > ; * E I C ? E R A V ; L

12: GTGCA?SP.CATGCAZCGCTAC:TCTGC2GCXTTGCCCGATGCCTTGCGTGACCAAGTG ' b r H D M C i Y 3 L R P L F D A L R 3 2 V

181 G~GGTA~.?SCCGCACGCAT'ICGCZ.4GTZGGCTGCCGACAF.CG~CGTGCCAGTGGCC~AC V G K A A 3 1 3 P W A A C N S V P 7 A Y

2 4 1 hCCGCCCAGCCGGGCAGZATGnACSAGGMCilACGCGG'ZC?GCTCMGGACTTCTGGGGC 7 A Q P G S M S E E U R G L L K D F X ~

3C1 C C G G Z C A T S P - L . G T C C A X C C Z A C C G A C C G T " G C C ? G h ! K A S P T U R E ' V I D A L A P Q P

361 GGIGAZTGGCIGCTGAC~.4bGTGGCGCTACAZCGCGT~CTTCMC~CCGACTTGTTGCAA G S K L i 7 i ; * , R ? S A F F P J S C L ; Q

421 C G 2 C 7 t C A C G C C A S C G G G C G C S A T C A G T G T G T G C C C A T Z ? C G S G R L H X S J ? D j L I i C C V Y A R C S

1441 GGTTACGACCTGGTGATCATGGGCCCTGGCCCCGSCMCCCGAGCGATGTGCAACXCCG Z Y D L V I M E P G P G ~ P S D V P L P

341 ATCCTGCTATGA 1 1 - - . ..

phrG

3C1 A A A G G C C G T G A A C T G C T C C A C A A C C C C T G G G C T T C C - G E C C K G R E L L E N P W A S G V L Y W R E T

4 2 1 GCCTGGCTCPAGCCCCCTTATZCCACGCACCCGATGTCATCGG'GTCTCGCCAGAGTGAA A W L K R P Y A T E P K 5 5 7 S R P S E

Fig. 28. Nucleotide sequence of 6.2-kb codlng region of the dimer of phenaz~ne-1-

carboxylic acld by P, f7uorescens PU23 The ribosomal binding slte of the

genes,ph:ABCDEFG 1s underl~ned The deduced ammo acld sequence 1s shown

below the nucleotlde sequence. TerminatIan codon 1s lndlcated by asterisk.

4.9. Antimicrobial activity of the purified antibiotics

Purified antibiotic, PCN by P, aeruginosn PUPa3 showed a broad-spectrum

anrimicrobial activity against phytopathogenic fung~ (Flg. 29). The dimer of phenazine-l-

carboxylic acid by P, fluorescens PU23 also exhibited a broad-spectrum antimicrobial

actirity against a broad range of fungal and bacterial pathogens of plant, animal and

human, The MlCs of dimer of phenazine-1-carboxylic acid towards fungi and bacteria

arc presented in Table 4. T h ~ s dimer antibiotic showed a novel antimicrobial activity at a

pH range of 5.5, 6.5, 7.5, 8.5 and 9.5 (Fig. 31). whereas the monomer phenazine-l-

carbuxylic acid (control) dld not shou any activity in alkaline pH (Fig. 32).

4.9.1. SEM analyses

SEM image of M phaseolina treated with PCN by the strain PUPa3 revealed

dehrmation of the fungal mycelia and inhibition of spores (Fig. 30). SEM analyses on

treatment of S og'zae with dimer of phenazine-1-carboxylic acid by the strain PU23

revealed septation, fragmentation and lysis of the fungal mycelia (Fig. 33). Both S.

q : u e and M phaseolina control showed normal growth and spomlation (Fig. 30, 33).

Fag. 29. Ant~tungal actll lh of PCN h\ P aeruginosa PUPa3 against 11 phaseoirna MPS ( 4 1

Control plate shouing normal r n ~ c e l ~ a l gro\+th and sporulat~on ( B ) plate treated ~ ~ t h

PCN (I5 pkdis i i sho\+rng m)cel~dl growh suppressron and sporulat~on around the

paper disc

Flg. 30. ( A ) SEM ~mage (1.000\) ot If phmeoirna MPS mbcel~a \ + ~ t h normal sporulat~on m

control and (0 ) Image of delormed m)cel~a and rnhib~t~on of sporulat~on due to PCN

treatment

FIG, 31, ~ ~ t ~ f u ~ ~ ~ l actl,Ity of dlmcr of phenanne-l-carbo~~llc acid b) P.j7llortscms

~ ~ 1 2 3 ( 1 2 pgd,sc) to\+ards \I phoseol~na MPS at banous pH of 5 5 (A). 6 5

(6). 7 s ( 0 . 8 5 (D) and 9 5 (E)

FIG. 32. Antltungal actnlt) of dlrner phenazine-I-carboxql~c a c ~ d bl P fluorescens

PU23 agalnst I on:ae SOYS (A) control pldte treated u ~ t h monomer of'

phenaz~ne-I-carhox\l~c a c ~ d ( 3 p g d ~ s c ) showing normal grouth (B) Plate

treated b ~ t h dlmer of phenazine-I-carboxbl~c a c ~ d (3 pgldtsc) s h o ~ ~ n g

m)cel~al grouth suppression around the paper dlsc

FIG. 33. ( A ) SEM Image ( 1 . 0 0 0 ~ ) of normal m ) c e l ~ a of S. or)-ae SONS in control and

( B ) Image of fragmented mycelia due to d ~ m r r of phenaz~ne-I-carboxyl~c a c ~ d

treatment

TABLE 4. Anttmicrobial activity of dimcr of phenaz~ne-I-carboxylic a c ~ d by P.

//iiorc.~ccrfs P1'23 agalnst plant, animal and human pathogens

Host

F i i ~ o r i i i ~ ~ i oxi.cporunr sub sp, ruhorse

Hoir\'/r\ cincro

l\.lengo

C h l l ~

Sugrcane

Rlcz

Klce

Groundnut

Banana

l ohacco

rattle

l luniali

Human

Human

Anthracnose 7

Ftuit rot 7

Rrd rot 5

Shcath rot 3

Slieeth blight 2

Cfiurcoal nrt 12

Wilt 7

Biight 14

Mastitis '120

4.10. Anticancer activity of dimer of phenazine-I-carboxylic acid by P.

p~~orescens PC23

1.10.1. Cell viability assay

( ytotox~c assay of' dimcr of phenaiine-I-carboxyilc acid using MT'I against

!,~rious cells lines rexcaled 11s antlcanccr acti\iry against czll line\, SW4SO. A549. MCF7

3nil HeLa. T h ~ s antihiot~c \\as ibund to he niorc actixe agilinhl lung canccr cells A549.

llic c ) T u L o ~ ~ c I ~ ) ' cil'dimer oCphena71nr-I-carhox)lic acid against \arious cancer cell lines

I. prescnisd In labls 5, lreatment of lung cancer cclls. .,A540 ~ i t h 2 and 5 pM of this

~nt~biot ic s h o ~ c d Ibs~s and release of the apoptotic hodies from thc cells due lo the affect

171 the drug (Fig. 34).

1 able 5. Ccll viabili~y aahdy of xarious cancer ccll lines treated w ~ t h dlrner of phenarinc-

1-corhowyllc acid by P /luorescen.s P1,2?

('ell )]neb Drug conu. (pM) '%$ of li\e cells % of cytotoxicity

S\\'lRO 0.5 102.81" -2.81'

(~.olon cancer) I .0 91.77h 5.23'

2.0 86 .52 13 48"

5.0 85 87' 14 13"

- -. . -- -

,4549 0.5 86.35' 13.65'

clung canccr) 1 .O 7 4 . ( d t 25.35"

2.0 61.60' 38.40"

5.0 57.64' 42.36"

-- - --

\ICF? 0.5 94 .20~ 5.80'

Ihl-cast canccr) 1.0 94.96" 5.0<

2.0 8 0 . 6 1 ~ ~ 19.39

5.0 78.79" 21.21b'

IieLa 0.5 101.26' -1.26"

icer\ ~ c a l cancer) 1.0 97.83*" 2.17'

2 .O 81 .94Cn 18.06'

5.0 74.85"' 25.15"

Llcans uithin the column f o l l o ~ e d by different lrttcrs are significantly different according lo Duncan's multiple range test (p - 0.05). SL = Standard error Data represents the average of! repl~cations

Fig. 31. Morphological changes In A549 lung cancer cell I~nes, (A) control and treated

with (B) 2 pM and ( C ) 5 pM of d ~ m e r of phenaz~ne-I-carboxyl~c a c ~ d b!. P.

,fluorescens PU23

4.10.2. Acridine orangelethidium bromide staining

In order to study whether the c)totoxic effects induced by the dimer of phenazine-

I-carboxylic acid inbolves typical apoptotic changes, cells were examined for nuclear

condensation. Treatment of lung cancer cell lines. A549 with 2 and 5 1 M dimer of

phenazine-1-carboxylic acid induced nuclear condensat~on at 24 h, whereas the untreated

control cells were healthy without staining by ethidium bromide (Fig. 35)

Fig. 35. Acridins ormgzlethidium hromidz staining of lung cancer '4.549 cells treated

with different concentrations of dimer of phmozine-I-carboxyI~c acid by P

fluoresrrns PU23 ( A ) control, (B) 2 FM and (C) 5 $M.

4.10.3, Annexinlpropidium iodide staining

Dimer of phenazine-I-carboxyl~c acid-~nduced changes in phosphat~d>l serlne here

detected using annexln V labeled h ~ t h fluorescein ~sothioc*anate Apoptot~c cells h e r e

detected uslng annexln V laheled 1~1th fluorescein i so th~oc~anate , slnce under defined salt

dnd Ca' concentrations annewln V can he used to hind phosphatldti serlne Addlt~on ot

propldlum Iodide helps to dist~nguish the early apoptotic cells from late apoptotlc cells

unce prop~dium i o d ~ d e cannot enter the cells in rhe earl\ stages ot apoptosls due to the

Intact membrane integrith A549 cells treated w ~ t h the antlb~otic ( 2 uM) clearl) shohed

earl\ apoptotlc changes l ~ k e anneun b~nding (green~,h belloh) (Fig 36) uhile the control

cells d ~ d not exh~hi t annexin b~ndlng At 5 p V concentration. cells shoued propldium

iod~de stalning indlcat~ng the late stages of apoptosls

Fig. 36. Anneuidprop~dium i o d ~ d e staining of lung cancer A549 cells treated hith

different concentrations ot dlmer of phenazine-I-carbouqlic d c ~ d b> P

fiuorescens PU23 (A) control, (B) 2 pM and (C) 5 pM

DISCUSSION

CHAPTER 5

DISCUSSION

In recent tlmcs, multitudes of birulent pathogenic racev h a i r becn encountered in

crop plants and many of these pathogens ha\e de~cloped alarming reslstancc due lo the

llldl~cnrninatc application of chcmicals Rlocontrol agents that are targccspuciiic.

hio(legradahle. cnbironnient-friendly and most importdntly those cnpahlc of coloniiing in

tlie sprayed cnilronment are in the torcfront ibr the effectlie control of plant pathogens.

The kno\\ledge on the ta~onomic position of the biocontrol stralns and antlhiot~c< that

mvdldte anlaguntsm is a prcrequr.\ite in des~fnlng an effectlte hiocontrol program. In the

plssent Investigation. I h a ~ c idcntiiied two no\cl, broad-spectrum antagonlstlc

Iluolesccnt pscudomonad stralnr. PL:2? and PLlPa3 Phenotfllc. hlochsmical and I6S

11thA characterisatiiins idcnt~ficd the strams. PI:23 and PIJPa?. a$ Pseu(1umonus

Iliior~isccns and P, ueru,yiiios~i respectl\ely. Ciruuth at 4"r and 12°C hy the strains.

i'scuriornonu~ fluori~srens Pll?! and P uerirgiriu\~r PL'1'a.l respcctlicly alao revcaled

thrlr spccles specllic characteristics O n the hasis of N M R and MS data the purified

ontlhiotles produced by (he stralns PI;?! and PLIPa! ha ic hecn ~dent~f ied as the dlmer of

phcnazl~~e-lcarhoxylic acid and phena/inc-I-carhoxamide ( P r y ) respectively.

Farlier s tud~cs h a i e reported the production of PCN by P. clilororuphrs PCLl391

(('bin-A-Woeng et al. 1998) and P ucriryinusii PAOl (Mavrodi et al. 2001). Houe\.er.

t h e ~ c PCN producing strains did not produce IAA and phosphatase that attrihutc plant

growth promotion. It has heen evidenced that the biocontrol activity of PCN was 10 times

hlgher than PCA in neutral ptl (Chin-A-U'oeng et al. 1998). Though another atudy has

,rporied the production oC IAA and HC'N kom P ocruyinosu NJ-15 (Hano and Musarrat

?0071, PCN production by this ttrarn has not been reported. It has been well documented

t l ~ ~ t the productlut~ of 14A, siderophorr< and phosphate solubll~ring enz)~ncs hy plant

he~lzficlal bacteria enhanccs the de\elopnlrnr ofhol t plant root systcm and thut promotes

tili. growth and yield (Rrnwn 1074. Klocpcr el a1 1988: Patten and (;lick 2002)

80th P. .fluoiercoi.\ PL2.1 and P ao.irginosa PUPa3 reported In thls in\estigation

ncrc found not lo produce thc plant delctunoui metabolite. HC'N. Eben though. the

production of HCN has been correlated u.ith in iit1.o antrfunpnl actlrlt). thc role of t I f3

lor biocontrol actlvrty ~n so11 is nnt clcnr. Ihe in i1ir.u antifungal actnlt?; of HCN

producrng strains on agar medlum hoa been c o l ~ ~ l a t e d to the production of' HCU (gas

plinae) (Rlumer and llaat 20001. It haa also hczn further dcn~onstratcd that HCN is

inrolrrd in the inhibition u f energ) metabolism ~n crop plants by interfering in the

c?tochrome oxidatnc rzzplratron and thus dccrenac Ihr gm\+tli and yield of potato.

Kcsuitr of other inruttigations also hare revealed that cyanogenic pteudomonads could

~ l x , inh~blt thc growth of bcan and letrucc (.4lstrcim and Hums 1989; Kremcr and Souissi

2001 ). Ilence. IiCN producrng fluoretcent pseuJomonad stralns hare been grouped as

dcletcnous bacteria for plant yo\vth (Hakker and Schippers 1987).

Preqent in\estigatlon repons non-HC'Y producing broad-spectrum antagonistic

slralns. P. j l i r o r e s r ~ ~ i s PL1?3 and P, a?ruginosu PLJPa3. Production of siderophore.

pl~asphorous olubilizing en/)mes, ph)tohonnones and antiblotrcs evidently suggest the

p l ~ n t gro\bth promoting and antimicrobial potential of the stratns, P fluorcscenr IJL123

lrlii P uerugiriosa PIJPa3.

S e ~ e r s l strains of P. u o . u ~ ~ n o s o from clinical and agriciiltural soil samplcs hare

hecn idcnt~fxd (IsLrandi et al. 10x7; Bujscnh ct al. l90h. M a ~ r o d i et al. 2001) P.

,,i'riigrtioo $trains o f c l i ~ ~ i c a l origin h a \ ? heen dift'crcntiated from ertiinlnntental strains

due to their ah~lity to use paraffin as sole carhon 5ourcc (Xmits ct at. 2003). The rice

~llizusphcrc inhabiting ,train P. ucrugirioyu PIiPa? rcponed in thc present study did not

L I L I ~ I L C paraffin but cxhihitcd seberal platit gmuth promoting traits. In recent ycars. P.

ir~ric,~iiiostc \trams of plan1 rhlrosphcrz soil or ipn such as P, arrugiriow 7h'SKZ tiom

borle) rhi/osphcre and P. ui'riigiiioso PNAI ti0111 chtckpea rhilospherc have huen used

J, cli'ecti\e hiocontrol agcnts (Isuandi et al. 1987: Buysens ct al. 1096; Anjaiah er al.

!iIO;). In t h ~ s stud>. for the first time. I have reported P, ocrug~nosu PL Pa3 as a broad-

qpcitrum antagonistic strain with the production of ant~hiotic I'CN and groirth promoting

mctabolitcs.

In Lhe present investigauon for the first time. 1 have also reponcd a nobel dimer of

pIiena/,nr-1-carho~~lic acid by the srrntn P, fltiorc~s~.i'tis 1'1123. Experimental data

pioblded in this investigation firmly establish the dimcric nature of the antihiot~c. In the

IT-IR spcctrum the N-N bond during d i m e n ~ a t ~ o n hq phenarine-I-cahoxylic acid can

be inferred from the absurptton band at 1133.')4 c m ' (Socrates 2001). Both monomer and

di~ner of phenazlne-l-carboxylic acid showed sim~lar NMK spectra due to their

s>mmetrical nature. In earlier study (Gurusiddaiah et al. 1986) proton posttions were

rrroneously asslgncd to phcna/ine-l-carbouylic acid based on ID- 'H NMR spectra. In

(~,ls study, on the basis of 2D ] H - ' H DQF-('OSY and TOCSY spectra all the proton

ilgnalq u e r e unamb~guously assigned resulting in aqs~gning 8.05 ppm to 3-H. 8.36 ppm

1,) 6-li. 7.99 ppm to 7-11, 8.05 ppm to 8-11 and 8.30 ppm to 'J-H. The Ion field signal at

1i.h ppm was as~igned to carhoxylic proton In agreement u l th the earlier repon

~(;urussid~ah et al 1086).

Dimcr molecule can initially hrcak inro ~ t s monomeric const~tuents at hlph

~cmperdture posiibly due to cleavagc or the weak N-S bond as evidenced by the low

~,opl ing constants of the n~trogen bonds In the ' N N M R , l lius, thc obsenatlon of

\~inllar ~iielting polnt for monomer and dlmer phcnaz~~ic-I-carhoxylic acid (241°C to

243 ( ' ) 1s expected. Mass spectra ol'our sample showed qtrang evidencc for the existence

LIT dimeric sprcles. In the FAB-MS a ucll as ESI-MS (-,el in addltlon to the sibnal

r or responding to the mononizr species [m z 225. (M+H)]. a signal at m'z 44') ( 2 M t H )

cnrrespondlng to the d i n ~ c r ofphenaz~nc-I-carboxylic acid and glviny rise to fragments

conzspond~ng to the monomcr and its fragrncntat~o~i peak\ \bas ohsencd. ESI-MS also

rciealed peaks at ni:7 466 (hl+Nl lm) and m z 487 (MLK), funher showing the presence of

I I I C dinieric species. 1 he ti~nuation of daughter inns at m,7 449. 242 and 225 (M+H) from

the parent (m.2 466) is in order of dimer phenatine-I-carboxylic acid giuing rise to the

monomer along with one or t u n higher fragments. burtlicr. the appearance of two doublet

peaks In proton decoupled "N NMK, indicates the presence of t u o N-N bonds leading to

dlmeri~ation of phenazine-I-carhoxyl~c acid. All these experimental data confirmed the

ant~biotlc produced by p Jluorcscens PU23 as a dimer of phenazine-I-carbouylic acid.

'Thc most probable structure of d~rnel of' phena~ine-I-carbohylic acld was

~ ~ ~ n t i r m z d by molecular modcling studles. It u a a intcrestlng to note that the d e ~ i a t ~ o n

bctMeon the computed and the exper~mental hond diitances arc less than O.OSA, with the

Jicragc around 0.024. The structural plananty of this der~vat i \ r also prov~des additional

~mpctus and confidence to look at the dlmer resulta Sur bbhich experimental structural

~ C I J I I \ are not available. Confirniatlon 2 1 ~ 1 t h the acid functlonalitj separated by the

13rthcst \bas computed to be the most stahle arrangement for the dimer of phenar~ne-I -

cnrho\!lic acid. l l n l ~ h c the monomcr. the central pyazinc nng ofphcnanne ia puckered

hy --5O"in thu d ~ m e r . 1-his a l l o ~ s the nitrogen a t o m between each monomcr to gct

p~o\imal In the dimer, alheit at the cxpensr of losing the outcr aromatic stacklng

intrrxtlon to some extent. Thc h-N hond distance (-1.61.k) connecting the t u o

monomers is much longer rn I - ? , than the standard N-N sin& bond distance (-1.45.k)

i~h>en.cd In Ilterature. and lo that US hydrarlnc (-1.40A) computed at the B.?LYf"0-31Ci*

lsrel oS sophistication, No strong dek~ations Tor the ('-C bonds of the phenyl groups

ucrr ubacrbcd u h e n comparcd to the monomer.

I'he strong preference tbr the puckering of the pyazine molety in phenazine may

panly hc attributed to the presence of thc acid Sunctlonality In close proximlt). B y habing

a ppamidal arrangement around the n~trogen in 1-3. the lone pair electrons on the

nltrogen could now position ~tself to benefit from a stabillzing interaction with the

Pos~tively charged hydrogen on the acid group. This is clearly evidenced by the computed

panial atomlc charges on these atoms in I-! and comparing the same with that of the

n~ooomer. For instance. there IS a signtficanr decrease In the negatlvc charge on the

nfirogcn u hen the nionomer (-0.523e ) and dimer (--0.47e) potentials are constdercd.

In order to compare and class~fy the sequence of gene encoding the hiosynthes~s

,,I dimer of phena71ne-1-carboxylic acid in 1',/71roresrien~ P1123. thc coding sequence was

~omparcd with the known phcna/,~ne scquences in the database using RL?IS? search. The

wquoicc of phenaz~ne gene cluster of thc strain PL123 contained the genes, Ph;

1/3CL)L'I,'(; and revealed 99"'0 homology to P i luor i~s tms 2.7'). 88% to P. ilureofnc~ens

30-84 as \\ell P. chloronipl~is PC'I 1391 and 83'% ((7 i' (ierugirioru PA01

I he core hiosqnthetic pathway ofphenazinc is highly conserved (Dclaney ct al.

lO(l1i and sc\rral species of fluorescerit pseudomonads such as P. ,j7uorescens

IThomashov. et al. 1990). P, aureqfu<rcr~~ (Toohey et al. 1965) and P. i icrug~nosa

iFcrnande7 and Pi lam 1997) h a i e been reported for the production of more than one

plicna7ine. .4lthoogh d ~ f f c r m t phenaz~ncs ha\e been found a i t h the same bnucture. they

diller in the den\atl7at1on of the heteroc?clic core. Thcse modifications of heterocyclic

core largely determ~ne the phys~cal propertics of phenazincr and Influence their

ant~nlicrobial activ~ty against pathogens (Dclaney ct al. 2001 ).

Brishane et al. (1987) reponed that the antimicrobial actwit): of monomeric

phmazine-I-carhoxylic acid (Gurusidda~ah et al. 1986) is limited to acidic pH and duc to

the formation of an inacti\,e carboxylate Ion, its ant~m~crohial activity is severely limited

In alkaline environment. Interestingly. the dinier of phena71ne-l-carbox).I1c a c ~ d reported

111 this In\'estigation exhlblted a novel broad-spectrum antim~crohial act~vity agalnst a

i i~de range of pathogcns of plant. animal and human ongin. Further, on analyzing the

ailt~hiot~c potential in vanous ac~dic and alkaline p l l conditions. it was found that the

dirnzr of phenazlne-1-carhoxylic acid is active in a n ldc range of a c i d ~ c and alkal~ne pH

uilvironment of 5.5 9.5. As reported hy Ch~n-,I-M'oeng et al. (1998). PC& 1s niore stable

I I I J ~ monomeric PC'A in alkallne pH. In this rtudy. thc no\el dlmcr of PC',\ hy P1'23

showed stability in alkaline p11 5.5-9.5. T h ~ s increases thc antim~crohial pi~tential of the

dimer of phena71nc-I-carhoxylic a c ~ d In acldlc arid alkaline apncultural soil environment

as \\ell in an~mal and human systum whercin the pH oS hody flulds is 7.6.

Apoptosls or pri~grammed cell death is a potential general niechan~sm probiding a

meclianirtic basis fbr the antiproliferati\e effccts of drug. Apoptosis 1s characterized by

cell chrinkage. chromat~n condensation. DN.4 thugmentation and thc activation of spccific

i)c~cnine proteaser. The anrlcanccr assays reicaled the cylotow~city of dimer of

pl~enaz~nc-I-carbouyl~c a c ~ d eicn In concentratio~~a as Ion a? 2 phl /mL through the

iilducrian of early apoptosis in lung cancer cells .4540 as indicatcd by the changes of

pllosphat~dyl serine on the cell mcmhranc due to anncxin'propidium iodide staining. T h ~ s

snt~hior~c has also been ohsenml to ~nducc nuclcar condensat~on in 4 4 9 cells u,hen

ircaicd ~ i t h a concentration of 5 phl , b i l i t y to induce apoptosis as ucll nuclear

condensation enhances the potential of d ~ m e r of phenarine-I-carhoxylic acid as a novel

anticancer drug.

Production of ant ib~ut~cs , siderophores, and IAA enhances the potential use of P.

~ltiorcrccn, PLJ23 and P. acr-yyi~rova f'UPa3 as biocontrol agents promoting plant ~ ~ o w t h

ii~tli reduccd disease inc~dencc. Bload-spectrum antimicrobial and antiproiiferat~ve

~SSects of dimer ofphenaz~ne-I-carhoxylic a c ~ d do suggest that ~t has unllmitcd potential

111 ags~cult~rre and mcdic~ne.

SUMMARY

CHAPTER 6

SUhlMARY

1 luorcscenl pseudomonad atralns. Pl12.3 and PliPa.7 rxhlb~tcd a broad-spcctrum

ol antimicrobial a c t i ~ ~ t y . On the has15 ofmorphological and hlochemical traits as \+ell the

IhX rRNA acquence homology. stralns PL123 and I'l'Pn? irers ta-ionomically Identified

:I, P.\'.\cuilonio~iu\~ /luoves<c~l\ and P, i~cr-irgrtrosn respccti\ely. Both stralns produced

li!dro~amate s~demphore, catalasc and phosphatase hut did not e i h i b ~ t plant ~nhibitory

t r~i t s iuch as pectinasc, cellulaue and H('N Bes1dr5, tlic strain I'lJPa! produccd the plant

y o h t i ~ hormone. 1A4.

.\ntihiotlcs produccd by P jiuoi-esccns PL23 and P, o r r u g i ~ i o ~ u PLIPa3 here

i~oldted and punficd using s i l~ca gcl column, preparatlic TLC. chromatotron and HPLC.

F h l analyaes rclealcd that thc purllied ant ib~ot~cs induccd scptation. deformation and

i!u~s of the fungal m > c c l ~ a and also aupprcssed sporulatiun.

Thc antibiotic produccd by the straln P I Pa3 u a s ldent~fied as phenazins-l-

carboxamlde (PCN) on thc basis of NblR and MS. Based on the proton decouplcd 'IN

N1IK. FT-IR and MSlMS of ESI-MS alialyses the ant~blotic produced by thc straln P112?

aas identified as a novel dimcr of phena~ine-I-carhoxyl~c acid. Thc structure of dimcr of

phcna71nr-I-carboxqlic acid has been proposed on the basis of free energy (AE) values

obtained from molecular modeling studies using Gaus~an 08.

Phenarine gene cluster (6.8-kh) ~ n x o l ~ e d In the blos)nthesls of'dimcr phenanne-

I-cnrhoxylic acid in the straln PU23 was delineated. Scqornce analyses re\ealcd that the

,.odlnf sequence of phenalinc cluster contamed the genes. PhzABCDEtG with 9D0%

h,,mology to P, jJunrrtcn> 2-79. 88% to P , aur~,ofuriolr 30-84 as well I' chiororuphis

p('Ll.391 and 83%) t o p . aeru,qtnosa PA01

Both PCN and dimer of phenaz~ne-I-carhoxyl~c a c ~ d e x h ~ b ~ t c d a broad-spectrum

untrmicroh~al actlvlty Llnl~ke the monomer. thc d ~ m e r ofphenaline-I -carbunylic acid by

tl~c strain 1'112 exhibited a novel antinncroh~al acti\lty at alkalinc pH upto 9.5

'\nt~canccr act~vity o f t h e dimcr nfphenarinc-l-~drho\!.lic acid at IOU conczntratlon of I

p\1 iras confirmed thorough MTT assa). Further analysca uslng acndinc orangeethidiun~

hiomids and annexln propidiun~ i o d ~ d r stalnlng reicalcd that the dimcr uf phena~inc-I -

cdrboxylic acid induccd an csrl!. apoptosis in lung cancer cells, ,1549.

Due to the potential of producing novsl antihiot~cs and plant growth promoting

rnctabolites. P. JI~torcsccris I'I'2.3 and I', uo.ii~yitrosu POPa.' identified in thc present

stud) can be used as hiofertili/cr and biocontrol agcnts in ag'iculture. Induction of early

apoptusls as well the nuclear condensation in lung cancer cells, A549 ev~dently suggests

the potential of dirner of phmaline-I-carboxylic acid as a no\el anticancer drug.

REFERENCES

REFERENCES

thhas, A. Morrisey, J . P., hlarquez. P. C. , Shrehan, W. 11.. Delany, I. R. and

O'Cara. F. 2002. C hararteri~ation of interacr~on bctlveen the tmnscr~ptional

repressor PhlI, and ~ t a h ~ n d ~ n g s ~ t e rt the phiA promoter in Psciidonionu~

jluor.esci~n~ F113. J . Bactcriol 184:3008 3016

ihdallah, %1. A. 1991. Pyxerdma and pacudohactins, p 13'1 -153. In Winkclmann. G.

(ed.). Iiandbook of hlrcrob~al Iron ('hclate\. (KC' press, Hoca Rarton. 1 I.. 1!Si\.

4ekerley. D. F.. Caradoc-Davies, T. T. and Lamont. I. L. 2003. Substrate specificity

oftlie non-r~hosomal pept~dc syntlietase IJ\dL) from Ps~~uduwio~i i~s urrugi~iosn. J .

Bactsr~ol. 185:2X41(-2x55.

-\l\trom. S . and Burns, R. C . 1989. ( 'yan~de product~on by rhizohacter~a as a poss~ble

rncchanlani ofplant grouth ~nhih~t ion . B ~ o l Fen. Si111a 7232-238.

\Itrrhul, S. F., Gish. W., Ililler. \V.. \l)ers, E. W. and Lipman, D. 3. 1990. Basic

local alr~mnient %arch tool. J Mol. Brol. ?15:40?410.

-\njaiah. V., Cornelis, P. and Koedam, N. 2003. Cfrcct of geno1)pe and root

colonl~ation in hiolog~cal c o ~ ~ t r o l of Firsuri~inl w ~ l t s in plgeonpra and ch~ckpea by

Psc,udomonus iierzrg~~iora PN.41. Can. 1. Mrcrohiol. 49:Xi-Y I.

tnkenbauer. R., Hanne. I.. F. and Cox, C . D. 1986. Mapping of mutations in

iu~cudowronas ueruginvvu dcfecti\c In pynerdrn product~on. J . Bacterial. 167:7-

11.

Anto. R. J., Maliekal, T. T. and Karunagaran, D. 2000. L-929 cells harhonng

ectopically expressed KelA realst curcumln-induced apoptosis. J . Blol. C'hem.

275: 15601-15604.

,Mima. K., Imanaka. H.. Kousaka, M., Fukuda. 4. and Tamura, G. 1961

Pyrrolnitrin. a neu antibiotic substance. produced by Pscudomonus. A p e . Blol.

Chsm. 28:575-576.

i r i n ~ a , K., Kakinuma, A. and Tamura, G. 1968. Surfacttn. a crystalline peptidolipld

surfactant produced by Nrirrlius ruhirlrs. isolutlon, character~zation and its

inhibition of fibrin clot formation. Biuchem. Blophys. Res. Commun. 31:488-

104.

Atlau, R. M. 1993 In Parks. L. C (rd.1 IlandbooL of 'Mtcrohiological Media. CRC Press,

Boca Ratton, FL. I S 4 .

Bahker, A. W. and Schipperr. B. IOS'. blicrobial cyanldc productton In the rhizosphere

in relation to potato ylcld reduction and P<~~udomotrus spp-mediated plant growth-

stimulation. Soil Biol. Biochem. 19:45 1 4 5 7 .

Bangera. hl. C , and 'l'homasha~v, I.. S. 1096. ('haracter17ation of a genomic locus

needed required for ~ynthesis of the antib~otic 2.4-d~acet)Iphlor~iglucinol by the

hiologlcal control ayent Pst~udornonas ,flirores~cns Q?-87. Mol. Plant-Microbe

Interact. 9:83 9 0 .

Bano. N, and klusarrat. J. 2003. Charactcn7ation of a neur hi~udorrionas ueruginosu

stratn N J - 15 as a potentla1 bincontrol agent. Cum. klicrobiol. 46:?24-328.

Barrett, E. L., Solanes R. E., Tang. J. S. and Palleroni, K. J. 1986. Pseudornonus

Jluorescens biovar V. Its resolution Into distinct component groups and the

relationship of these groups to other P jluurcscerrs biovars to P puri(1u and to

psychrophilic pseudomonads associated u ~ t h food spolldge. J . Gen. Microhiol.

132:2709-2721

Bax. A. and Davis, D. G. 1985. MLb.V-17 based two-dlmens~onal homonuclear

magneti7atlon transfer spectroscopy. J. blapn. Reson. 65:?55 360.

Bennett. I.. Broom, N. J. P., Cassels, R., Elder, J. S., Masson, N. D. and O'Hanlon,

P. J. 1999. Synthesis and ant~hacterial properties of /?-diketone acrylate

hioisosteroa of pscudomonic acid .4. Hioorg. Med. C'iiem. Lett. 9:18471852.

Blumer. C., Heeh. S., P r s ~ i . G. and Haas. D. 1999. Global Gac.4-steered control of

cyanide and cxopratcasc productio~i in I'\eui!umvnus f l u u ~ c s c n ~ s in\olvcs

specific ribosome hindlng sites. Proc. hatl . Acad. Sci. IiSA 96:13073 1307R.

Klumer. C . and Haas. D. 2000 \lcchan~sm, ropulut~un. and ecological rolc of bacterial

c g n i d e hio\gnthcsis. Arch. M~crobiol. 173: 1 7 0 17 i .

Bossis, F,.. Lemanceau. P.. 1.atour. S. and Gardan. 1.. 2000. Thc taxonomy of

Prc~u~fonio~ius j7uovcsci~ns and P.\rir~!r~niuria.s plr/ido: current status and need for

revision. Agrononi~e 20:s 1-63

Bric. J . R1.. Bostock, R. M, and Silverstone, S. E. 1991. Rapid in situ assay [or

indoleacetic acld production by hackria imniohil17ed on nitmcellulose mcmhranr.

Appl. E n \ ~ r o n . Microbiol. 57535-538.

Brishane, P. G., Janik, 1.. J.. Tate, R1. E. and Warren, R. F. 0. 1087. Revised

structure for the phenarine antihiotic fiom Ps~lriiomonus j7uoresco11s, 2-79.

Antimicrob. Agents. Chemother. 31:1967-1971.

Krorrn, M.E. 1974. Seed and root hacterizatlon. Ann. Rev. Phytopathol. 12:181 -197.

Budzikiewicz H. 1993. Secondary metahol~tes from fluorescent pseudomonads. FEMS

Microhiol. Ecol. 104:209-228.

Hu!sens. S., Heungena, K., Poppe, J. a n d Hofte, 11. 1906. In\olvement of pyochelln

and pyovcrdln in suppression of Pylhium-induced damping-off' of tomato by

Preu(lomonns urruginosu 7NSK2. .4ppl. Emiron. Microbiol. 62:Xhs-871

Campbell. R., Rennick, A. a n d Coe, S. K. A. M. 1980. Antagon~sm and siderophore

production by biocontrol agents. plrnt & ~ o w t h promoting organlsmi. and the

general rhizosphere popolatlon. pp 179-1 88. In. Iron. siderophores and plant

disenaes. S\\inhurt~c. T. K (Ed.). Plenum press. \ e a York.

Carcanague. D. R. 1907. Ko\cl der~vatlves of psrudomonic acld. Bioory. Med. Chem.

I.ctt. 7:2XO5-2808.

Carruthers, F. L.. Shurnthomas, T. Conner. A. J , and Mahanty. H. K. 1995. Ihe

sibmificance of ant~biotic production hy I'scu(1ornottas aureofiicio~s PA117-2 for

biological of Pi i l~roph~hor~i mcglhprzr.mn root rot of asparagus. Plant and Soil

1 7 0 3 3 9 341.

(.attelan. A. J., Har t r l , P. G . and Fuhrrnann. J. J. 11109 Screening for plant growth

promotmg rhiiobacteria in promote earl) sokbcan growth. So11 Sci. Soc. Am. J .

63: 1670- 1680.

Chsng, P. C, a n d Blackwood. A. C. 1969. S~multaneous production o f threc phenarine

plgrnents by Prcudomonirs aet-qqitrosu Can. J . Microbiol. 72:581 -583.

('hang, C. J., Floss, H. G., Hook, D. J., hlabe. J. A,. Manni, P. E., Martin, L. I,.,

Schroder. K. a n d Shieh, T. L. 1981. The biosynthesis of the antihiot~c

pyrrolnitrin by Pseudomonus aurcoficret~s. J . Antibiot. 24:555- 556.

Chatterjee, A., Valasubramanian, R., Vachani, .4., Rlau, W-L., Gnanarnanickam, S.

S. and Chatterjee, A. K. 1996. R~ologtcal control of rice diseases uith

Pseu(iomonus jluorescens 7-14: isolation of ant mutants altered in antibiotic

production, cloning uf ant' DNA and an evaluation of a role for antibiotic

production in the control of blast and sheath blight. Biological Control 7:185-

105.

Cl~in-A-Woeng. T. F. C., Bloemberg, G . V., Van der Bij, A. J. , Van der Drift, K. M.

G. M., Schripse-ma, J., Kroon. B., Scheffer, R. J.. Keel, C., Bakker, P. 4. H.

Ll., Tichy. H.. de Bruijn, F. J., Thoniaa-Oates, J. E. and I.ugtenherg, B. J. J.

1098. Hiocontrol hy phena~ine-I-carboxan~ide-producing Pscudumorzur

chloruruphis PCLl391 of tomato roo: rot cduscd by firsririirni o.~.rporum f. sp.

riidicis-/r.cuprrsici. Mol. Plant-Microbe Inturact. 11:1069 1077.

Chin-,A-Woeng. T. F. C. 2000. Molecular basis of b~ocontrol of tomato foot and root rot

hy Pscuiio~nonus ch/oruruplris strain PC'I.1391. I'h.D, thes~s. Ilnl\ersily of

Lcidcn. Lcidcn. The Netherlands.

Colyer, P. D. and Mount, Ll. S. I984 Bacter~ratioi~ of' potatoes hith Ps~utiomonus

putidu and 11s Influence on postharvest soft rot diseases. Plant Dis. 68:703-706.

(orhell, V. A. and Loper. .I. E. 1995. A global regulator of secondary metabolite

production in P s c u ~ ~ u m o l l u . ~ j l u o ~ ' ~ ~ ~ ~ ~ r i s Pf-5. J . Bacteriol. 177:623M236.

Cunliffe. H. E., hlerriman, 7. R. and I,amont, I. I,. 1995. Cloning and characterization

of pi,d,Y, a gene required for pyoverdine synthesis In Ps'seudomonas ueruginosu:

PvdS is probably an alternative sigma factor. J. Bacteriol. 177:2744-2750.

Cuppels, D. A., Howell, C. R.. Stipanovic, R. D., Stoessl, A. and Stothers, J. B. 1986.

Biosynthesis of pyoluteorin: a mixed polyketide-tncarboxyl~c acid cycle origln

demonstrated by [ l , 2 - " ~ ~ ] acetate incorporation. Z. Naturforsch. 41 5 3 2 535

Defapo, G., Berling, C. H., Burger, U., Haas, D., Kahr , C., Keel, C., Yoisard, C.,

Wir thner , P, and Wuthrich, B. 1990. Suppression of hlack root rot of tobacco

and other root dlseases by strains of Ps?ccuiiornonur fluorerceni.: potential

applications and mechamsms, p. 93-08. In tiornhy. D.. Cook. R. J . , llenis. Y.,

KO. W. H.. I<ovlril. A. D.. Schippers. B. and Scott. P. K. (ed 1, Biologlcnl control

of sa~l -home plant pathogens. CAB Intemationai. Oxon. Cnited Klngdom.

Delang, S. M.. Rlavrodi D. V.. Bonsall, R. F. and Thomashow, L. S. 2001. phzO, a

gene for hlosyltheais of hydrorylated phenazine compounds in Pseudon~unus

uurcqfiicicw< 30.84. J . Racteriol 183:318 327.

Demanpe, P.. Wendenbaum. S., I.inget, C., Bateman, A,, MacLeod. J., Dell, 4,

Albrecht. A. 11. and .Abdallah. hl. -2, l9XO. heiillotnontls siderophores:

Structures and p h ~ s ~ c o c h e m ~ c a l propcnlrs of p y o ~ e r d ~ n s and related peptides.

1 7 4 9 5 98.

Dowling, D. N. a n d O'Gara, F. lY94. Mcwholites of P~eudon~onus involved in the

hiocontrol oi'plant d~scase. Trends Hiotechnoi. 12:133 141.

Duff>, B. K., a n d Defago. G . 1YY7. Zlnc Imprwes hiocontrol of Fusanum crown and

root rot of tomato hq Psrudornonu~ fluoresccn!, and represses thc production of

pathogen metabolites inh~hitory to hacrerlal a n t ~ h i o t ~ c hiosynthrsis.

Phptopathology 87:1250 1257.

Duffy. B. K.. a n d Defago, G . 1999. bnv~ronmental factors modulating antibiotic and

siderophore hios)mthesis by Pseudumoniis fluoresrens biocontrol strains. Appl.

Envlron. Microbial. 65:2429-2438.

1)nivedi. D. and Juhri, B. N. 2003. Antifungals from fluorescent pseudomonads:

Blosynthesis and regulation, Curr. Sci. 85:1603 - 1703.

Earhar t , C. F. 1496. Uplakc and metabolism of iron and molybdenum. p. 1075- 1090.

In: Neldhardt K. (cd.) Es(hcrichiu and Suimo~~cllu: Cellular and molecular

hlology (2"" ed.). A. S. M. press, Washington. I). (..

Elander, R. P., Mabe, J . A., Hamill, R. H. a n d Gorman, hl. 1968. Metabolism of

tryptopllans by Ps~~tr(i~imonm uureo/c~creris. \ ' I . Production of pymlni tnn by

hrlectcd P ~ e u i l n m o ~ z o ~ spccies. Appl. Mlcrobiol. 16:753 758.

Ellis. R. J., Timma-Wilson. T. M. and Bailel. >I. J. 2000. Identification of consened

tralts in tluorescent pseudomonads w ~ t h antifungal activity. Environ. Microblol.

2:274 284.

El-Sayed, A. K., Hothersall. J. Cooper. S. RI. . Stephens, E. Simpson, T. .J. a n d

Thomas. C. 11. 2003 ('haracten~atlon oS the mupirocin hzosynthe~ls gcne cluster

from P.seu~1ornonii.i /7uorcs(r~1i N('1MH 1 0 8 6 . (.hem. Hiol. 10:410 130.

Fenton, A. M.. Stephens, P. \I., Cronley , J., O'Callaghen. M. a n d O'Gara. F. 1992.

Explo~tatiun ot' gene(>) ~nvolved III 2.4-d~acetylphloroglucinol h~osynthesis to

confer a neu hlocontrol capability to a Prr!rrIomonar strain. Appl, tnviron.

Microb~ol. 58:3873-3878.

Fernandez, R. 0. a n d Pizzaro, R. A. 1907. Iligh-perfmmance liquid chromatographic

analys~s of Preudomonu.r acrugr~~usa phenazines. J . Chromat. A 771:99 104.

Friedheim, E. A. H. and .l.lichaelis. 1931. Potentiometric study of pyocyanine. J . Biol.

Chem. 91355-368.

Friedheim. E. A. H. 1Y34. I he effects of pyocyaninc on the respiration of some normal

tissues and tumors. Biuchem. J . 28:173-179.

Fusaki, kl., Tsuchiya, F., hlaeda, K. and Kamiya, T. 1958. Cyanomycln. a new

ant~biotlc. J . n t ~ h i o t . her. A 11:143 149.

Gerard, J.. I,lo?d, R.. Barsh!. T.. Haden. P.. Kelly, >I. T. and Andersen. R. J . 1997.

Massetolides A-H. antimycohactenal cyclic depsipept~des produced by t\vo

pseudomonads isolated from marlne habitat,. J . Nat. Prod. 60:223 229

Goldman, G . H.. Hayes, C . and Harman. C. E. 1994. hlolecular and cell biology of

biocuntrol b) Triciiotlcrmu spp. 'Trends B~ut~.chnol. l2 :478182.

Gordon, S. A. and Weber, R. P. 1951. Colorimctr~c estimation of Indoleacetic a c ~ d .

Plant Physiol. 26:I1J2 195.

Gurusiddaiah. S., Winanard. L. D.. Burger D, and Graham, S. 0. 1979. Pantom)cln:

a neu antiniicroblal antlbiotic. Mgcolog~ca 71:103118.

Curusiddaiah, S., \\eller, D. \I., Sarkar, A. and Cook R. J . 1986 Character~zat~on of

an a n t ~ h ~ o t ~ c produccd hy n strain of P.\eurIorno~lor f l i i u r c s c ~ ~ ~ s l n h ~ b ~ t o r y to

C;ururniit:~iom~ri~~ 71-ilniiriis la r . iriitci and P L ~ ~ I U I I I spp Ant~rn~crob. Agents

Chcrnothcr 29:48X 105.

Gutterson, N.. Ziegle, J. S.. Warren, G. J . and Layton, T. J. 198.8. tienetlc

determinants for thc catabol~te induction of antibiotic biospthesia In

P.seu~iornonusJiior~~~~'cns HV37a. .I. Bactenol. 170:38&!85.

Hamdan, H., H'eller. D. \1. and Thomashon, L. S. 1091. Relative importance of

fluorescent siderophores and other factors in biological control of

(;ucurnun!iorn~ces grt~rnlrlis var. Iriiici by Pseiidomo1lus~7uorrsr~ns 2-79 and h14-

80R. Appl. Enuron. M~crohiol. 57:327%3277.

Hamill, R. L., Elander, R. P., hlabe, J. A. and Gorman, M. 1967. Metabolism of

trbptophan hq Pscirdomonas uuri~o/ircicnr. V. Conversion of trqptophan to

p)~rolni tnn . ?\ntlm~crob. Agents C'hemother. 1967:388 396.

Hamill, R. I.., Elander. R. P.. Mahe. J . A. and Gorman, \I. 1970. Metabolism of

trptophan by Pseu(Ioio,nonuh uurcufu<ierrs. 111. Productior~ of' substituted

p y r o l n ~ t n n \ lion1 t rq~tophan analogues. Appl. Micrub~ol. 19:72 1-725.

Hammer, P. E.. Hill. D. S., [.am. S. T., van Pee. K. H. and 1,igon. J. M. 1997, Four

pencs from f'.~rudo~norrt~r fluorcsce~is that encode thc biosynthesis of pyrrolnitrin.

Appl knvlron. Ilicrohiol. 63:2117-2154.

Hammer, P. E.. Burd, W.. Hill, D. S., L.igon, J . 31. and van Pee, li H. 1999.

Conservation o E ihc pyrrolnitnn blosynthetic gene cluster among SIX pyrolnltrin-

producing strain?. FLhlS Mlcrobiol. I.ett. 180:?9-44.

liarrison, L. A.. Letrendre. L.. Kovace\ich, P.. Pierson, E. A. and Weller, D. R I .

1993. Pur~t ica t~on of an antibiotic elTcctibe against G~umannorniccs gruminis

bar. rr~iici produced by a b~ocontrol agenl. Pse~~riornonus a~ireofaciens. So11 Blol.

Blochem. 25:215-221

Hassan, H. 41, and Fridovich, 1. 1978. Supcrox~de radical and the oxygen enhancement

of the toxicity ofparaquat in Eschenchlu roli. J . Bio. Chem. 253:8143-8148.

Hassan, H. M. and Fridovich, 1. 1979. lntracellular production of superoxide radical

and of hydrogen perox~de by redox active compounds. Arch. Biochem. B~ophys.

196:385 195.

Hassan, H. hl. and Fridovich. 1. 1980. Mechan~sm of thc antihlot~c actton of

pyocyaninz. J . Bacterial. 141:156-163.

Herbert, R. B., Holliman, J. H. and Sheridan, J. B. 15176. Rtosynthests of mtcrobial

phenaz~nes: ~ncorpuration of sh~klmic acid. Tetrahedron [.en. 8:639 642.

Hohaus. K.. Altrnann, A., Burd, W., Fischer, I.. Hammer, P. E.. Hill. D. S., Ligon. J.

h1. and van Pee. K. H. 1997. hAl)ll-dependent halog,enascs are more llkely to

he ln~olvcd in halonletabol~tr btosy~thcsli than haloperox~dascs. Angsw. C'hem.

In(. F.d. Engllsh 36:2012-2013.

Hohnadel. D.. Haas, D. and Xleyer, J. XI. 1980. Mapplng of mutattons affecting

pyo\.erdine prodoction In Pse~rdonlonos ui,rirgirrosa. FkMS Microbial. Lett.

36: 19.5 199.

Hollstein, (I., hlock. D. L., Sibhitt, R. R., Roisch, C . and Lingens, F. 1978.

lncorpurat~on ofahlk~rn~c acid into iodimn. Ictrahedmn Lett. 33:2'187-2990.

Homrna. Y. and Suzui, T. 1989. Role of ant~hiotic production in suppression of radish

damping-off hq seed hacter~zation with Psc*uiiomonas repucia. Ann. Phytopathol.

Sac. .Ipn. 55643 652.

Howell, C. R. and Stipanovic, R. D. 1980. Supprcsslon of Pl'riiium uliimum Induced

damping-off cotton seedlings by t'scudon~onas fluor~~scens and its antibiotic

pyoluteonn. Phytopathology. 70:712-715.

Iswandi, A., Bossier, P., Vandenabeele, J. and Verstraete, W. 1987. Effect of seed

inoculation with the rhi~opseudomonas strain 7NSK2 on the root microflora of

maize (Zeo m q s ) and barley (Hordeum vrrlgare). Biol. Fen. Soils 3 : l j 3158 .

.lames, D. W. and Gutterson. h. 1. 1986. Multiple antibiotics produced by

P~cudomonur /7uore?ims HV37a and thelr differentla1 reguiatlon hy glucose.

Appl. Env~ron. Mlcrob~ol. 52:l 183-1 189.

.lamisiewicz, W., Yourman. I.., Roitman. J. and Mahoney, V. 1991. Posthanest

control o f b l u c mold and grey mold of apples and pears by dip treatment with

p)noinitr~n. a rnetahol~te of Prrudomo~ias ceprrcin. Plant 13s. 75:49(!494.

Kanner, D., Cerber. 2. \. and Bartha. R. IWX. Pattern of phenazine plbment

production by a stram of Psi,udomotio$ ricriry~noso 1. Bactenol. 134:690-692.

katz, E. and Demain. 4. L. IL)77. I hc pept~ds ant~blotlc of Rocillus: chemistry.

hlogencs~s and posslhle funct~ons Hacterloi. Re\. 41:44"1474.

Keel, C., Wirthner, P., Oherhansli, T.. Voisard. C.. Burger, (I., Haas. D, and Defago.

G . 1900. Pseudomonads as antagonists of plant pathogen? In the rhirosphere: role

of the ant~hiutlc 2.4-diacctylphiorogluc~nol In the suppression of black root rot of

tobaccn. Symbiosis 9327-341,

Keel. C.. Srhnider. U.. Xlaurhofer, 31. Voisnrd, C., I>a\ille, J., Burger, P., Wirthner,

P.. Haas. D., and Defago. C. 19'22. Supprcss~on of root d~seases by

Pseudomona~ jlr~o,a,sicns C'H.20: Importance of thc bacterial secondary

rnetabohte. 2.4-d~acetylphlorogluc~nol. Mol. Plant-hlicrobe Interact. 5:C13.

King, E. 0.. W a r d , R1. I(. and Raney, D. 8. 1954. Tb%o simple media for demonstration

ofpyocyanin and fluorescein. J . Lab. Clin. Med. 44:301307.

Kirner, S.. Hammer, P. E.. Hill, D. S.. Altmann, A., Fischer, I., Weislo, L. J.,

Lanahan, XI.. van Pee, K. H. and Ligon, J. M. 1998. Functions encoded by

p ) v o l n ~ t n n bios)nthctic gene, from P.\eui/i~monos ,/7uoresrcn~. J . Hacteriol.

180:1939 1943.

lileinkauf, H. and \on Dohren, H. 1990. Sonnbosomal biosynthes~s of pept~de

antih~otics. kur. J . Blochem. 192:l 1 5 .

kloepper. J . W., I.eong, J., Teintze. >I. and Schroth, hl. N. 1980. Psrudornonus

s~derophorcs: a mechan~sm explain~ng d ~ ~ c a c c suppressive soils. C'urr. Microhiol.

4 3 1 7 320.

liochi. M.. Weiss. D. \V.. Pugh. L. H. and Gruupe, V. I O j l . Vlscosin a new antih~otic.

Hacter~ol Proc. .I. 1 :29-30.

Kraus. J . and Loper. J . E. 1'195. C'haracter~zntlon LIT a genonilc region rcquired for

product~un of thc nnl~h~ot ic pyolutcorin by thc biological control agent

Pseuilun~onu~,fluor(i~s~r~~s Pf-5, Appl. En\~ron. M~crohiol. 61:84')-854.

liremer. R. J. and Souisqi, T. 2001. C y n l d e production hy rhizohactena and potential

for Yuppresslon o f ~ e e d sccdling groutli. C'urr. Microh~ol. 43:182 186.

I amont. I . L., Beare. P. 4., Ochrner. I .. \. astl, A. 1. and \ a d , I f . 1.. 2002

Siderophoru-med~ated signaling regulates virulence factor product~on in

Pseuilomonos ircrugino,ii. Proc. Natl. Picad Sci. LI. S. A. 99:7072-7077.

Lamont, I. 1.. and Martin, L. W. 2003. Identification and charactcnration of novel

pyoverdine synthesis gcnes in Pscuilomorias ot~nrginosir. Microbiology 149:833-

842.

Latifi, A., Wilson M. K., Foglino, hl., Bycroft. B. W.. Stewart. G. S. A. B.,

Lazdunski. A. and Williams, P. 1995. Multiple homologues of LuxR and Lux1

control exprcs51on of virulence detenn~nants and secondary metabolites through

q ~ ~ o r u m sensing in Pseudomonu~ orruginosu PAOI. Mol. V~crohiol. 17533-343,

I.aville. J., Blumer. C.. von Schroetter, C., Gaia, V.. Defago, G., Keel, C. and Haas,

D. 1998. Chnracter~zat~on of the hrliAHC gene cluster encodlng hydrogen cyan~de

sbnthase and anaerob~c rcgulatlon by AI\R in the stnctly aerobic b~ocontrol agent

Pseudomonas.~luorescrnj ('HAO. .I. Bacterlol. 180:3187-3 196.

Leach, J. E., Rhoades. M. I... Vera Cruz, C . M.. White. F. F.. Men. T. W. and

Leung. H. 1992. A%e\\mmt of genetlc d ~ v e r s ~ t y and population structure of

.\iirrihomonos ot?:uc, p i , onzut. u ~ t h a repetline DNA clement. Appl. Emiron.

M~croblol. 58:2188-210.5.

I.rhoux. D. E.. Sanvchagrin, F, and l.e\r,que. R. C. 20fl(l. Cienomlcs of the 35-khpud

locus and analysis ofno\e l pi,dl.lK g c ~ ~ c s impl~cated in pyo\crdinc hiosqnthcars in

P.~cuiiot~?onur afrugitiosu. I'FMS \l~cmhiol. I .ett. 190: 141-146.

I.eisinger, T, and Ilargraff, R. 1979. Secondary metahohtes of fluorescent

pseudomondds. Microbiul. Ke\. 43:422 112.

1.eoni. L. Ciervo. A,, Orsi. V. and Yisca. P. 1Y9h. Iron-regulated transcription of the

p ~ r l A genc in Psrui ior~ot~us (icrir~itio~ti: effect of Fur and PvdS on promoter

ac t i \~ ty . I. Baclcnol. 1789299-2313.

Levy, I?.. Gough. F. J., Berlin, D. K.. Guiann. P. W. and Smith. J. T. 1992. Inhibition

of S~pror iu trirwi and other phptopathogen~c f u n g ~ and bacteria by Pseudornonas

,fluor~scens and its antibiotics. Plant Pathol. 41535-341.

I.ively. D. H., Gorman, XI., Haney, M. E. and l a b e . J. 4. 1966. Metabolism of

tryptophan? by l'scudomonas (~ureofucicns. I. Biorpnthesia oC pyrrolnitrin.

.4ntimicroh. Agents Chemother. 1966:402-469.

Lugtenberg. B. J. J. a n d Dekliers, 1.. C. 1909. What makes Pseudunroni~s bactena

rhimsphere competent'! Env~ron. Microblol. 1 : 9 ~ 1 3 .

Ilaidack, 6. L.. Olsen. G. J.. L.arson, N.. Ovrrheek, R.. RlcCaughey. M. J. a n d

R'oese, C. R. 1997. I h e KIIP (Kihosomal Datahasc P~ojec t ) . Xuclclc A c ~ d s Kes.

25:lU1> I l l ,

Martin. L. L., Chang, C. J. and Floss. H. G . 1072. .4 "C nuclear magnetic resonance

study on the biosyntheslh of pyrolnirnn thm tr~ptophan by P~putlomonas. J. Am.

C'hen~. Soc. 94:X1)42-8944.

\laurhofer. R1.. Keel, C., Schnider, ll., Viosard, C.. Haas, D. and Defago. G . 1992.

Influence of enhanced anuhiotic production In P.\~udomonas ,fluorercens strain

CHAO on ~ t s dlsedsc ?upprrssibc capacit). I'hqtopatholngy 82:19&195.

\laurhofrr. XI., Keel. C, Haas, D. and Defapo, G. 1993. Pyoluteorin production by

P ~ t ~ u ~ l o n i u n o Jluorcsc~~ns strain CHAO is involved in the suppresslon of Pythlum

damping-offof cress hut not cucumber. bur, I. P l a n a h o . 100:221 ~ 2 3 2 .

\ laurhofer, %I.. Keimmann. C.. Sch~m~dli-Sacherer. P.. Ileeb. S.. Hars. D. and Defago,

G. 1998. Salicilic acld blospthetic genes expressed in Pseudomonosfluort~scens

s t ra~n P3 improve the induction of systemic resistance in tobacco against tobacco

necrosis virus. Phytopathology 88:678-684.

\lavrudi. D. V., Ksenzenko, V. N.. Bonsall, R. F., Cook, R. J., Boronin, A. 51. and

Thoma%how, I,. S. 1908. A seven gene locus for synthesis uf phenarine-l-

carboxyl~c acid by Pseudomuni~sfluuresrens 2-79. i. Bactenol. 180:2541 2548.

Jlarrodi, D. V., Bonsall, R. F., Delaney. S. M., Soule, $1. J.. Phillips. G. and Thomashon,

I.. S. 2001 Functional analysis of genes for bios)nthcsis of pyocyanin and phcnar~ne-

I-carbowam~de froni Pscudomunu~ uerlrgirioso PAOI. J . Hacteriol. 183:6454-6465.

\lazzola, hl.. Cook R. J.. Thomaahon. L. S.. Ueller. D. hl. and Pierson, I.. S. 1092.

C'ontributlon of phznazine antibiotic hlocynthesis to thc ecological competencc of

fluorescent pseudoinonadr In soil habitats. Appl. En\iron. Microhiol. 58:2616-

2624.

\IcDonald, %I., Ilavrodi, D. V., Thoma~hen , L. S. and Floss. H. G . 2OU1. Phenazine

hiorynthcsis in Psiudonlonos ,fluor~rcois: tlranchpo~nt from the pnmary

shlklmate hiosynthetlc pathxay and role of phcna~1ne-l.6-dlcarhox)~l1c acid. J.

.4m. C'hem. Soc. 123:9459-9460,

CleMorran, B. J., hlerriman. M. E., Rombel, 1. T. and Lamont I. L. 1996.

Characterl~at~on ol'lhe pl11L gene xhich is required for pyoverdine sjnthesis in

Psciidomonas uerugi~tosu. Genc 176:55 59.

\lc%lorran, B. J.. Kumara, H. %I. C. S., Sullivan, K. and Lamont, I. L. 2001.

Invol\enient of transform)lase enryme In siderophorc synthesis in Pseudomonus

urmgrnosu. Microbiulogy 117: 15 37-1 524.

Ilerriman, T. R., Merriman, M. E. and Lamont, I. L. 1995. Nucleotide sequence of

pvdD. a pyoverd~ne bioiynthetrc gene from Psrudomonas ucmginosa: P\dD has

similarity in pcptide synthetases. J . Hactenol. 177:252-258.

hlew, T. W. and Rossales. A. 31. 1986. Bacteri7ation of rice plants fur control of sheath

bl~ght causcd by Rhi:ononia solani. Phytopathology 76:1260-1264.

Ileyer. J . M. and Stintzi. A. 1998. Iron mclabolisrn and siderophores in Pseu~lomonas

and related species p. 201-243. In: Montle. '1'. C'. (ed.) Psw?rlion~onas

(Bacteriology handbooks 10) Plenum Publishing, New York

lleyer. J . M. 2000. PyoIerdines: pigments, s~derophores and potcnt~al taxonomic

markers oftluorescent Pscuilo~no~ios spccier Arch. Microhiol. 174:135 1 4 2 .

l leyer, .I. M.. Geoffrey. V. A., Baida, N.. Gardan, L., Izard, D.. Lemanceau, P..

Achouak. W, and Palleroni. S. J. 2002 Sldcruphore t l y n g . a pouerful tool for

the ~dent~fication of fluorescent and nonfluorcscent pseudomonads. Appl.

Fnvlron. Microb~ol. 68:?745-2753.

lliller. J . H. 1974. Lxpcriments in molecular genetlca 2"" ed. Cold Spnng Harbor

Laboratory Culd Sprlng Harbor. NY.

hlorikawa, hl., Hirata, Y. and Imanaka, T. 2000. A study on the structure-function

relationship of l~popcpt~de b~osurfactants. Biochem. Biophys Actd. 1488:211

218.

hlorrison, 11. M., Seo. E. T., Howie. J . k. and Saw?er. D. T. 1978. Flavln model

systemb. 1. The clectrochemistr) of I-h>drox)phenaz~ne and pyocyanlne in

aprot~c solvents. 1. Am. ('hem. Soc. 100:207-211

Morrison, M. M. and Sawyer, D. T. 1978, Flayin model systems. 2. Pyocyanine

complexes of divalent manganese. iron, nickel, copper and zinc In dimethyl

sulfoxide. J. Am. Chem. Soc. 100:211-213.

lortishire-Smith. R. J.. Nutkins, J. C., Packman. L. C., Brodey, C . L.. Rainey, P.

B.. Johnson, K , and Williams. D. H. 1991. Detern~lnation of the structure of an

cx~racellular peptide produced by the mushroom saprotroph P.~euOomonas

ri,ilrrans. I etrahedron 47:3045-3654.

Xielsen, M. N. and Snrensen, J. 1999. Chitinoly~ic actiblty of Pseudonzonus/luoresrer~s

~solates from barely and sugar bcct rh~~osphere. FFMS Microb~ol. tcol . 30:217-

227.

Yiel~en, T. H., Christophersen. C.. Anthoni. I;. and Serensen. J. 1999.

\'isco~lnamidc. a neu cyclic deps~pepude 1~1th surfactant and antifungal

propenles produced b! Psc,udvrriotlar /liiorr~ircns DK54. J . Appl. Microbiol.

86:8%OO.

R'ielsen, T. H., Thrane, C.. Christophersen, C., .Anthoni. I.. and Serensen. J. 2000.

Structure, product~on charactenst~cs and fungal antagonism of tensln-a new

antifungal cyclic iipopcptlde from P~cirdoniunas jluorcstens strain96.578. J .

Appl. Microhiol. 89:0'12 1001.

hielsen, T. H.. Sarensen. D.. Tohiasen, C.. .Andemen, J. B., Christophersen, C.,

Givskov. M. and Serensen. J. 2002. Antlhiotic and h~owrfactant properties of

cyclic lipopeptides produced hy fluorescent P.seudomor~as spp, from the sugar

beet rhizosphere. Appl. En~iron. Microblol. 68:311 h-3123.

bishikimi, M., Rao, N. and Yagi, K. 1972. The occurrence of superoxide anion in the

reaction of reduced phenazine methosulfate and molecular oxygen. Biochem.

B~ophys. Res. Commun. 46:849-854.

Notz. R., [Ilaurhofer. 'M., Schnider, LI., Duffy, B. K., Haas. D and Defago, G. 2001.

Blotic faclors affecting expression of the 2.4-diacet)lphloroglucin~~l b~osymthesis

gene ph1.4 in Pseudomonas ,fluore\ccns hiocontn)l strain C'IIAO in the

rhl~oaphcrc. Phytopathology 91:873-881

Nonak-Thompson, B., Could, S. J.. Kraus, J , and Loper. J . E. 1991. Production of

2.4-d~acctylphloroglucinol by the biocontrol agent Pscutiotnot~usjl~rorescrns Pf 5 .

Can. J . Mlcrobiol. 40: 1061 1060.

howah-l'hompson, B.. Could. S. J . and Loper. J . E. 1907. lduntiticatlon and sequence

analysis of the genes encoding a pol!kstidc vynthase rcqu~red for ploluteonn

hiosynthesls In P,curlomotias j I u o r < ~ s ~ ~ i ~ n s Pf-5. Gene 204:17-24.

Vowak-Thompson, B.. Chane), N., Wing, J. S.. Could, S. J . and Loper, J. E. lY99.

('haracterlratlon of the pyolutconn biosynthet~c gcne cluster of Pseu(1omonas

fluori,s<ms Pi's. J . Bacterial. 181:2166-21?3

Oshorne, L. D. and Robson, 4. D. 1092. Duration of zinc uptake inhibition by

chlorolbrni ~n uheat. .Auat. J . Apri. Keb. 43:1109-1174.

O'Sulliuan. D. J . and O'Cara, F. 1992, Iralts of fluore,cent P.wlidomonas spp.

~nvol\.ed in supresslon of plant root pathogens. Microhlol. Re\. 56:662-076.

Patten. C. 1.. and Click, B. R. 2002. Role of Pse~rdonionas puri(1u indoleacet~c acid in

development of the host plant root system. Appl. Environ. Microhiol. 683795-

3801.

Pfender, W. F., Kraus, J . and Loper, J . E. 1993. A genomic region fronl Pseudomonos

fluorcscens Pf-5 required for pyrrolnitrin production and inhibition of fi,re~iophora

rritici-rupcnrrs in wheat slraw. Ph)$opathology 83:12231228.

Piantini, U., Sorensen, 0. W. and Ernst. R. R. 1982. Multiple Quantum F~lters for

Elucidating NMR Coupling Networks. J . Am. Chem. Soc. 104:6800-6801

Pierron. 1.. S. and Thomashow, L. S. 10'12. Cloning of hetcrologous expression of

phenazine hiosynthesis locus tiom Pseutiomo~lus uirreuJacicns 30--81. Mol. I'lant-

Microhe Interact. 53:330-~339.

Pihovskaya, R. I . 1948. Mohil~zation of phosphorou~ In soil in connection wlth v~ta l

actnit) of some microbial specles. M~krohiulop~ya 17:363-370

Poppe, K., Taraz. K. and Budrikienicz. H. 1987. P y o ~ e r d ~ n type s~derophores Srom

Ps~~iriomotius /luorr,scr~~!.r. Tetrahedron 13:??61-2272.

Reddi, T. K., Khudiakov. Y. P. and Borovhov, A. V. 1969. Ps~udomono~JIirorrscens

w a n 26.0, produc~ng ph~lotoxlc suhstancca. Mlcrobiulogiya 38:909-9 13.

Romhel, I. T. and Lamont, I . L. 1992. DNA homology between siderophore genes from

fluorescent pseodumonads, i. Gen. Mlcrohlol 138:lXl 187.

Romhel. 1. T., IllcIllorran, B. J , and Lamont. 1. I.. 1995, ldcntiiication of a DNA

seqrlznce motif rrquired fiir expression of ~ron-regulated gcnes In pseudomonads.

Mol. Gen. Genet. 246:519528.

Rosales, 4. ILI., Thomashon, L. S., Cook, R. J . and Mew. T. W. 1995. Isolation and

Identification of' ant~fungai metahol~te produced by rice associated antagonistic

Pseudomunas spp. Phbtopathology 85: I028 1032.

Rovira, A. D. and McDonald, H. J. 1986. Effects of the herbicide chlorosulfuron on

Rhi:ocionio bare patch and take-all of barely and wheat. Plant Dis. 70:879-882.

Sacherer, P., Defago. G and Haas, D. 1994. tstracellular protease and phosphollpase C

are controlled by global regulatory gene gucrl In the biocontrol strain

Psrurlomonos /luorcsrcns CIIAO. FEMS Mlcrobiol. Lett. 116: 155-160.

Sakthivel, N. and Gnanamanickam, S . S. 1987. Evaluat~on of Ps<,utlornonu.~

jluoresrcns for supprcsslon of sheath-rot disease and for enhancement of gram

yields in rlce ( O w n coriva L) Appl. En\iron. Microhiol. 53:2056- 2059.

Sakthivel, S., hlortensen, C. N. and \lathur, S. B. 2001. Dctertion of Xunihomo,~ils

on-ne pv. ori_nc in aniticiallq inoculated dnd naturally ~nfected nce secds and

plant? by rnolccular techniques. Appl. Uicroblirl, Blotechnol. 56:435441

Sambrook. J.. Fritsch, E. F. and hlaniatis, T. 1989. Molecular cloning: a laboratory

manual, 2" ed. (.old Spring Harbor Laboratorb Press. Cold Spring Hardor. NY.

Sarniguet. A., Kraus, J.. Henkels. M. D.. Xluehlchen, A. M. and Loper, J. E. 1995.

The slgma Factor 0' affects antlhlotlc production and biological control actl\.lty of

Pse~rilon~orias /7uorr,,rens Pi-5. Proc. Natl. Acad. Sci. LS.4 92: 1 2 2 5 5 12259.

Fchnider. I]., Keel. C., Blumer, C.. Troxler, J . Defago, G, and Haas. D. 1995

Ampl~f ica t~on of house-kecping sigma factor In P.ie~rilomunasjluorf~irens C'HAC)

enhances antib~otic production and improies blocontrol abilities. J . Bacterial.

1775387-5392.

Schnider, U., Seematter. A., Maurhofer, M.. Blumer, C., Duff!, B.. Gigot-Bonnefoy,

C., Reimmann, C., Notz. R., Defago, C., Haas, D. and Keel, C. 2000

Autoinduction of 2,4-d~acetylphlorogiucinol biosqnthes~s in the biocontrol agent

Pseuiiomoniis j7uorescms CHAO and repression by the bacterial metabolite,

salicylate and pyolutcorin. J . Ractcnol. 182:1215-1225.

Shanahan, P., O'Sullivan, D. J.. Simpson, P.. Glennon, J. D. a n d O'Gara. F. 1992.

Isolation of 2,4-d~acetylphloroglucinol from a fluorescent pscudomonad and

investigation of physiological parameters Influencing its product~on. Appl.

Fnriron. M~crobiol 58:353-358.

Shanahan, P.. Glennon. J. D.. Crowley, J. J. Donnelly. D. F. and O'Gara. F. 1'193.

Liquid chromatok~aphic assa) for microhially dcnvcd phloroglucinol antih~otics

tbr estahlish~ng the biosynthet~c route to production. and the facturs affecting t h e ~ r

regulauon Anal. C h ~ m . "icta 272271 2 7 7 .

Smihert. R. \I. a n d Krieg. N. R. ILJY4. In .Meliloiis fur general rind mulerular B~olu@

ed. (icrhardt. P.R.G.. Murray. E.. Wood, 1V.A. and Kneg K R. pp. 607-654.

American Society fbr Microbrology. iVashington. DC.

Smirnov, V. V. a n d Kiprianova. E. A. 1990. Bacteria of P~eudornoiias genus. p 100

I l I . hauko\,a Dimika. Kie\. Llkralnr.

Sniits. T. H. M., Witholt B, and Beilen. J. B. V. 2003. Functional charactcri7ation of

gcnes ~nvolved in alkaline oxidation b) i-'sc~iilon!u~ios iieruginosu. Anton. Lccuw.

Int. J . 84: 19.1 200.

Socrates G. 2001. Organic nitrogen compounds. p 191-197. In Infrared and Raman

characterjstic group fiequcncies OTd ed.). John Wile). and Sons Ltd., Chrchester,

England.

Serensen. D., Nielsen. T. H., Christophersen, C.. Serensen, J. and Gajhede, M. 2001.

Cyclic llpoundecapeptide amphisin from Pseil(1urnonas sp. Strain DSS73. Acta

Crystallogr. Sect. C Cryst. Stmet. Commun. 57:1123-1124.

Stanier, R. Y., Palleroni, N. J , and Doudoroff, M. 1966. The aerobic pseudomonads a

taxonomic study. J . Cien. Microbial. 43:159-217.

Stevans, A. M., Dolan, K. M, and Greenherg, E. P. 1994. Synergist~c blndlng of the

I/ihrtojircho.r Lux R transcnptlonal activator domain and RN.4 poljnierase to

lux promoter region. Proc. Natl. Acad. SCI. I SA 91:12619-12623.

Stintzi, A,. Cornelia, P.. Hohnadel. D.. Meker. J . .\I., Dean, C., Poole. K..

Kourambas, S. and Krishnapillai. \. 1996. Novel pqovcrd~ne b~os)nthesis

gene($) of P.rrirdon~ona uci.ugtr!orii PAO. \licrobiolog) 142: 11 81 1 1 9 0

Stintzi. A., Juhnson. Z.. Stonehouse. .\I.. Ochsner. l'., hleyer. J. hl., \ a d , M. L. a n d

Poole, K. 1999. The p1.c gene cluster of heudonronus uerufiriosu: role tn

sqnthcsis of thc pyoverdine chromophore and rcfulat~on by PtvR and P\dS. J.

Bactrrlol. 181:11 181124.

Thomashow, L. S., Reller. D. \I.. Bonsall, R. F. and Pierson I.. S. 1900. Production

of thc antibiotic phena~ine I -carboxylic a c ~ d b) fluorescent Pseircbmorms specles

In the rhitosphere ofuheat . hppl. Eni~ron. Microhiol. 56:908-912.

Thomashow, I.. S. and Weller. D. \I. 1'195. ( 'urnnt conccpts In the usc of introduced

bacteria for biological d~seasz control: mechanisms and ant~fungal metabol~tes,

pp. 187-235. Irr Stacey, ti, and Kcen. N. (ed.). Plant-M~crobe Interactions. Vol. 1.

Chapman 8: Hall. Ne\\ York.

Thomashow, 1,. S. and Weller, D. \I. 1988. Role of a phenazine antibiotic from

P,~eudornoniisfluorescens in biological control of Gaeumunnorn~ces grurnrnis var.

tririri. J . Bacterial. 170:3499-.3508.

Thrane, C.. Olson. S., Nielsen, T. H, and Sarensen, J. 1999. The use of vital

fluorescent probes fnr the detection of stress in the fungi Pl'lhiunl uitimum and

Khizocronia soluni challcngcd w~th visco~lnaniide from Psru~lon~onas~uorescens

DK54. FkMS Microhlol. Ecol. 30:ll-23.

Thrane, C. , Nielsen, 11. h., Nielsen, T. H., Olsson, S. and Sorensen. J. 2000.

Viscosinamide-producing Pseu~iomonas jluorrrcr~ns [)It54 exert? a h~ocontrol

effect on Pi'thrum ultim~ini In sugar heat rhirurphcre. FEMS Microbiol. Fcnl.

33139 146.

Thrane. C., [Vielsen. 41. U.. Sorensen. J. and Olsson. S. 2001. Pscudtiniunus

fluor~sccnr I)K54 reduces sclerorla fomlat~on, biomass de\elopmcnt, and disease

incidence of Rhrzoctonr~ stiiuni causlng damping-off in sugar hrct. Mlcroh. Ecol.

42:438445.

Tombolini R.. vander Gaag, D. J., Gerhardson, B. and Jansson J. K. 1999.

Colon17ation pattern uT thz hlocontrol straln P.~c~udomonus chlororuphis MA342

on harely seeds visualized hy uslng green tluorescent protein. 4ppl. Emiron.

Microbiol. 65:3674-3680.

Toohe). J. l., helson, C. D. and Krotkov, G . 1965. Isolation and ldentificat~on of two

phenannzs from a stram of Pseii~lon~onu~ riurrofurrrtir. Can. J . Botany 43:1055-

1062.

Tsuda. M., Migazaki, H. and Nakazawa. T. 1995. Genetic and phys~cal mapplng of

genes in\.olved in pyoverdin production in Pseudomonos aeruglnosa PAOI. J .

Bacterial. 177:42343 I .

Turner. J. M. a n d Messenger. A. J. 1986. Occurrence, biochemistry and physiology of

phenazine plgmcnl production. Adv. Mlcrub. Physlol. 2 7 2 1 1 275

\'an Loon, L. C., BaLker, P. A. H. M. a n d Pieterse, C, hl. J. 1998. System~c resistance

induced by rhi~osphere hacterla. .4nnu. Rev. Phytopathol. 36:45?483.

Van Pee. K. H.. Salcher, 0. and Lingens, F. 1980. Formation of pyrroln~trin and 3-(2'-

a1nmno-3'-chlorophcnyl)p~~roIe from i-chlorotryptophan. .4ngea.. C'hem. Int. Ed.

Engl 19:828

\ a n Pee. K. H. IYYh. B~os).nthcs~s of hnlopcnatcd metabolltca hy hacteria. Annu. Rcv.

Mlcrohlol. 50:375-3')').

Vnnittanakom, K. and Loeffler, W. 1986. Fmplr in A nuicl ant~fungdl lipopeptide

antibiotic produced by Bar~llils s~~hriiis F-29-3. J , i2ntihlot. 39:XXX-901.

\'elusam\. P., Defago, G., Thomashon. I.. S. and Cnanamanicliam. S. S. 2004. Role

of 2.4-d~acet~lphloroglucinol (DAPG) filr plant d i ~ e a s e control: its Importance to

rlce hacter~al b l~ght suppression In India. pp. 182-191 in U~otechnological

Approaches to the Integrated Management u i Crop Diseares. C. I). h4ayec et al

(eds). Uaya Publishing House. New Delhi.

Vincent. M. h., Harrison, L. A,, Brackin, J. hl., Kovacevich, P. A.. Mukerji , P.,

Weller. D. M. and Pierson, E. A. 1991. Cienetlc analysis of the antifungal

activlty of a soilborne Pseu(lomonus aurcoluocris strain. .4ppl. Environ.

Microbiol. 57:2928-2934.

Vineet, M. N., Harrison, L. A,, Brackin, J. M., Kovacevich, P. A., Mukherji , P.

Weller, D. M. a n d Pierson, E. A. 1991. Genetic analysis of the anifungal activity

of a soilhome Pseu(l(~mona.r aureq2ner is strain. Appl. Fnvrron. M~crobloi.

57:2928-2934.

Visca, P., Cieno. A. and Orsi. N. 1994. Cloning and nuclcot~de sequence of thepi,iiA

gcne encoding the pyo\'erdine hlosynthetlc enzyme L-omithine ~ ' - ~ ~ x ~ ~ e n a s e in

Pscurlomo~~us aeruginosa. J . Bactenol. 176:1128 1 1 4 0 .

Voisard. C., Rella, M. and Haas. D. 1988. Conjugative transfer of plasmld RPI to

rsuiates of Pscuiiorr~onns,~luorcscc~n~ i s ticllltatcd bq certain large RPI deletions.

FFUS Mlcn~biol. 1.ett. 5 5 9 13.

Weisburg, W. G., Barns, S. 21, and Lane, D. J. 1991. 16s ribuhomal DNA

ampllticntron for phylogenetic study J . Bacterrol. 173:697-703.

Weller. D. $1, and Cook. R. J. 1983. Suppressron of take-all of uheat hy secd

treatments uith fluorescent pseudomonads. Ph)topatliolugy 73:463469.

\Yeller. D. hf.. Zhang. B. X. and Cook, R. J. 1985. Application o f a raprd screening test

li)r sclectlun ofhactcna suppressl\c to take all of ahcat. Plant Dis. 69:710 713.

Whistler, C. A., Carbell. N. A., Sarniguet, A.. Ream, W. and I.oper, J. E. 1948. The

two component regulators GacS and CiacA Influence accuniulation of the

stat~onary-phase srgma factor o' and the stress response in P s e ~ l d ~ ~ n i o n a r

j'uore\ccns Pf-5. J . RacterioI. 180:66!5 6641.

Wilson, hl. J., .Vchlorran, B. J. and I,arnont, I. L. 2001. Analysis of promoters

recognized by P\dS, an extra-cqtoplasrnic iiinction sigma factor protein from

Ai~udnmonas uerugrnosa. J . Bactenol. 183:2151- 2155.

Wood, D. \V. and Piersun, L. S. 1996. The Phzl gene of P~euilomunur aureojucicns 3U-

84 is responsible for a diffusible slgnal required for phena~ine antlhiotic

production. Gene 128:Xl 86.

Zhuu, P.. Mocek, It.. Seisel, B. and Floss. H. G. 1992. B~osynthesis of pqrroinitr~n.

lncorporat~on of "C ''u douhle-labeled 1)- and L-rryptophan. J . Basic M~crobiol.

32:200 214.