Mc

YMa

b

c

d

e

f

g

h

a

ARRAA

KCEGScH

1

aehbrstc(fm

e

0d

Toxicology 282 (2011) 146–153

Contents lists available at ScienceDirect

Toxicology

journa l homepage: www.e lsev ier .com/ locate / tox ico l

odulation of steroidogenic gene expression and hormone synthesis in H295Rells exposed to PCP and TCP

anbo Maa,b, Chunsheng Liua, Paul K.S. Lamc, Rudolf S.S. Wud, John P. Giesyc,d,e,f,g,h,arkus Hecker f, Xiaowei Zhangf, Bingsheng Zhoua,∗

State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, ChinaGraduate School of the Chinese Academy of Sciences, Beijing 100039, ChinaDepartment of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, ChinaSchool of Biological Sciences, The University of Hong Kong, Hong Kong, ChinaDepartment of Veterinary, Biomedical Sciences, University of Saskatchewan, Saskatoon, CanadaToxicology Centre, University of Saskatchewan, Saskatoon, CanadaZoology Department, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi ArabiaDepartment of Zoology, and Center for Integrative Toxicology, Michigan State University, East Lansing, MI, USA

r t i c l e i n f o

rticle history:eceived 23 September 2010eceived in revised form 13 January 2011ccepted 31 January 2011vailable online 4 February 2011

eywords:hlorophenol

a b s t r a c t

Chlorophenols (CPs) have been suspected to disrupt the endocrine system and thus affect human andwildlife reproduction but less is known about the underlying mechanism. In this study, we investigatedthe effects of pentachlorophenol (PCP) and 2,4,6-trichlorophenol (TCP) on human adrenocortical carci-noma cell line (H295R). The H295R cells were exposed to environmentally relevant concentration (0.0, 0.4,1.1, 3.4 �M) of PCP and TCP for 48 h, and expression of specific genes involved in steroidogenesis, includingcytochrome P450 (CYP11A, CYP17, CYP19), 3ˇHSD2, 17ˇHSD4 and StAR was quantitatively measured usingreal-time polymerase chain reaction. The selected gene expressions were significantly down-regulated

ndocrine-disruptionene expressionteroid hormoneAMP295R

compared with those in the control group. Exposure to PCP and TCP significantly decreased production ofboth testosterone (T) and 17�-estradiol (E2). Furthermore, a dose-dependent decrease of cellular cAMPwas observed in H295R cells exposed to both PCP and TCP. A time-course study revealed that the observedselected steroidogenic gene expressions and protein abundance (StAR) are consistent with reduced cellu-lar cAMP concentrations. The results showed that PCP and TCP may inhibit steroidogenesis by disruptingcAMP signaling. The research indicates that H295R cells can be used as an in vitro model for endocrine

ophe

disruption assay for chlor

. Introduction

Pentachlorophenol (PCP) has been extensively used worldwides a pesticide and wood preservative. As a consequence, the globalnvironment is contaminated with PCP. Because of its relativelyigh hydrophobicity and environmental persistence, PCP is readilyioaccumulated (Reigner et al., 1993; ATSDR, 2001). Partial dechlo-ination of PCP can generate more toxic intermediate compoundsuch as 2,4,6-trichlorophenol (TCP) (Eker and Kargi, 2007). Due tohe toxicity of PCP and the fact that it is a probable human car-

inogen, some countries have banned or control the use of PCPBaynes et al., 2002), but other countries still use PCP to preventungal attacks on wood (Jensen, 1996). Hence PCP and its inter-

ediate compounds are still detected in the aquatic environment

∗ Corresponding author at: Institute of Hydrobiology, Chinese Academy of Sci-nces, Wuhan 430072, China. Tel.: +86 27 68780042; fax: +86 27 68780123.

E-mail address: bszhou@ihb.ac.cn (B. Zhou).

300-483X/$ – see front matter © 2011 Elsevier Ireland Ltd. All rights reserved.oi:10.1016/j.tox.2011.01.024

nols and the mechanism involvement of disturbing cAMP signaling.© 2011 Elsevier Ireland Ltd. All rights reserved.

(Bhattacharya et al., 1996; Chen and Parker, 2004; Hanna et al.,2004; Fernández Freire et al., 2005; Farhadi et al., 2009). PCP wasused in China during the 1970s to control schistosomiasis (Wanget al., 2008). For this reason greater concentrations of PCP (up to103.7 �g/L) were detected in Dongting Lake (Zheng et al., 2000). PCPwas banned in China as a pesticide in 1997 (Zha et al., 2006). How-ever, PCP is still used as a wood preservative (Zheng et al., 2000).Concentrations of PCP as great as 0.59 �g/L, 2,4-dichlorophenol asgreat as 20.0 �g/L and 2,4,6-trichlorophenol as great as 29.0 �g/Lwere observed in surface water of seven major watersheds andthree drainage areas of China (Gao et al., 2008). Due to their toxicityand adverse effects on humans and wildlife, the US EPA classifiedPCP, 2,4,6-trichlorophenol, 2,4-dichlorophenol as priority pollu-tants (Ramamoorthy and Ramamoorthy, 1997).

The results of previous studies have indicated that the toxiceffects of PCP are related to uncoupling of oxidative phosphory-lation in mitochondria and generation of reactive oxygen species(ROS) (Proudfoot, 2003; Dong and Jiang, 2009). Exposures toPCP affect the endocrine system of vertebrates and may lead to

Y. Ma et al. / Toxicology 28

F

du1Tspeah2taaem2iUaod2

ihcabunetecesonbe1f

ig. 1. Schematic representation of the steps involved in steroid hormone synthesis.

ysfunction of the immune system and disruption of normal sex-al, cognitive, physical and emotional development (O’Donoghue,985; Daniel et al., 1997; Yin et al., 2006; Zhang et al., 2008).he mechanisms of endocrine disruption caused by PCP have beentudied in vitro and in vivo. For example, PCP was shown to be aartial agonist for the estrogen receptor (ER) in the cellular prolif-ration of MCF-7 cells (Suzuki et al., 2001) and other estrogenicctivity, such as induction of vitellogenin (VTG) in the culturedepatocytes of male channel catfish (Dorsey and Tchounwou,004). Alternatively, the results of other studies have indicatedhat PCP did not exhibit estrogenicity, but rather was shown to benti-estrogenic in the yeast two-hybrid assay (Jung et al., 2004)nd in cultured goldfish hepatocytes (Zhao et al., 2006). In fish,strogenic activities (induction of VTG), and reproductive impair-ent have been reported in male Japanese medaka (Zha et al.,

006), while significantly more testosterone (T) was observedn the serum crucian carp exposed to PCP (Zhang et al., 2008).sing a recombinant yeast screen assay, a recent study showedntiestrogenic/antiandrogenic activity of PCP in cultured Xenopusocytes and inhibition of ovarian steroidogenesis, accompanied byecreased production of both progesterone and T (Orton et al.,009).

Chemicals can cause endocrine disruption by either directnteraction with receptors or alter enzymes involved in steroidormone synthesis and metabolism. In the latter case, chemi-als can alter steroidogenic gene expression or enzyme activitiesnd have the potential to alter concentrations of hormones inlood and tissues (Hilscherova et al., 2004). In this regard, thetility of in vitro assay systems, the human adrenocortical carci-oma cells (H295R), has been developed for rapid screening ofndocrine disrupting potencies of chemicals or toxicants and iden-ification of novel mechanisms of endocrine disruption (Sandersont al., 2000; Gracia et al., 2006). H295R cells maintain physiologicalharacteristics of zonally undifferentiated fetal adrenal cells andxpress all genes involved in steroidogenesis (Fig. 1). Using thisystem, numerous studies have been conducted on the assessmentf endocrine disruption via affects of environmental contami-

ants, such as pesticides (Sanderson et al., 2002), polychlorinatediphenyls (PCBs) (Li and Wang, 2005), polybrominated diphenylthers (PBDEs) (Cantón et al., 2006; He et al., 2008; Song et al., 2008),H,1H,2H,2H-perfluoro-decan-1-ol (8:2 FTOH) (Liu et al., 2010),ungicide (Ohlsson et al., 2009), bisphenol A (Letcher et al., 2005),

2 (2011) 146–153 147

and various model chemicals (Zhang et al., 2005) on steroidogenicpathways.

Although several studies of the endocrine-modulating effectsof PCP have been conducted, the underlying mechanisms of theseeffects have remained largely unknown. Therefore, the purpose ofthis study was to assess the non-receptor mediated effects of pen-tachlorophenol (PCP) and 2,4,6-trichlorophenol (TCP) on H295Rcells. Expression of key genes involved in steroidogenesis, includingStAR (steroidogenic acute regulatory protein), CYP11A (cholesterolside-chain cleavage), 3ˇHSD2 (3�-hydroxysteroid dehydrogenase),CYP17 (steroid 17�-hydroxylase/17,20-lyase), CYP19 (aromatase)and 17ˇHSD4 (17�-hydroxysteroid dehydrogenase) were exam-ined. The production of two steroid hormones: T and E2 weremeasured. Since cAMP is an important secondary messenger tomodulate steroidogenic genes and steroid hormone biosynthesisin the human adrenal cortex (Sewer and Waterman, 2001; Stoccoet al., 2005), the role of cellular cAMP in regulation of steroidogenicpathway in H295R cells upon exposure to PCP and TCP was alsoinvestigated.

2. Materials and methods

2.1. Chemicals

Pentachlorophenol (PCP) (>99%, CAS No. 87-86-5) was purchased from Sigma (St.Louis, MO, USA). 2,4,6-Trichlorophenol (TCP) (100%, CAS No. 88-06-2) was purchasedfrom AccuStandard Inc. (New Haven, CT, USA). They were dissolved in dimethyl sul-foxide (DMSO), and were stored at 4 ◦C. LDH-Viability Assay Kit was purchased fromGenMed Scientifics Inc. (Washington, DC, USA). The SYBR Green PCR kit was pur-chased from Toyobo (Osaka, Japan). Enzyme-linked immunosorbent assay (ELISA)kits for T, E2 and cAMP were obtained from Cayman Chemical Company (Ann Arbor,MI, USA). All other chemicals used were of analytical grade.

2.2. Cell culture

The H295R cells were cultured in DMEM/F12 medium supplemented with of1% insulin-transferring sodium selenite plus Premix (ITS) (BD Bioscience, Bedford,USA), 2.5% Nu-Serum (BD Bioscience, Bedford, USA), 2.5% 100 U/mL of penicillin, and100 �g/mL of streptomycin. The cells were maintained at 37 ◦C in an atmosphere of5% CO2. The culture medium was changed every 2–3 days.

2.3. Experimental design

PCP and TCP were dissolved in DMSO as a stock solution, and the exposure andcontrol groups were received 0.1% DMSO. For the experiment of gene expressionand hormone measurement, the cells were grown in 12-well plates, and 2 mL of cellsuspension was added to each well. Quantification of cAMP was conducted in 6-wellcell culture plates with 2.5 mL of a cell suspension to each well. Experiments wereconducted with a density of 4 × 105 cells/mL. After 24 h, the cells were exposed to0.0, 0.4, 1.1, 3.4 �M for 48 h. The selected exposure concentration was based on themeasured concentration in the surface water (Zheng et al., 2000). Three wells wereused for each treatment and control as triplicates.

2.4. Cell viability assay

Cell viability was determined by measuring LDH activity by use of previouslydescribed methods (Arechabala et al., 1999). Briefly, H295R cells were seededinto 24-well plates (Corning Life Sciences, Corning, NY, USA) at a density of3 × 105 cells/mL. After culture for 24 h, cells were exposed to 0.0, 0.4, 1.1, 3.4 �M PCPor TCP for 48 h, the culture medium was removed. The LDH activity was assayed uti-lizing a commercial kit (GMS 10073, GenMed Scientifics Inc). The reduction of NADHwas recorded with a microplate reader (Molecular Device, M2) at 490 nm and roomtemperature. The LDH release was expressed as a percentage of the LDH releaseof the control. Three wells were used for each treatment and each treatment wastested in triplicate.

2.5. RNA isolation and quantitative real-time polymerase chain reaction

The procedures for RNA extraction and mRNA expression pattern analysis were

performed as described previously by Ding et al. (2007). Total RNA was isolatedwith the SV Total RNA Isolation system® (Promega, WI, USA) following the manu-facturer’s instructions. Total RNA concentration was assayed at 260 and 280 nm byusing a spectrophotometer (M2, Molecular Devices, CA, USA). The purity of the RNAin each sample was verified by determining the A260/A280 ratio and by confirming1.0 �g RNA on 1% agarose-formaldehyde gel electrophoresis with ethidium bromide

148 Y. Ma et al. / Toxicology 282 (2011) 146–153

Table 1Primer sequences for the quantitative reverse transcription-polymerase chain reaction.

Gene name Sense primer (5′–3′) Antisense primer (5′–3′) Product length (bp)

�-Actin CACCTTCCAGCCTTCCTTCC AGGTCTTTGCGGATGTCCAC 100CYP11A GAGATGGCACGCAACCTGAAG CTTAGTGTCTCCTTGATGCTGGC 137StAR GTCCCACCCTGCCTCTGAAG CATACTCTAAACACGAACCCCACC 168

sa

sbt152a54Rt

b(gtawatortmtr

2

2aoi1dimd1e

2

(v4(ltd1wsc

2h

ssc

human StAR antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). Followingprimary antibody incubation the membrane was washed and incubated with ahorseradish peroxidase-conjugated anti-mouse antibody (Santa Cruz BiotechnologyInc.). The secondary antibody was diluted (1:2000) in skim milk blocking solution.The immunoblot analysis was performed using the AmershanmTM ECL Plus Western

3ˇHSD2 TGCCAGTCTTCATCTACACCAGCYP17 AGCCGCACACCAACTATCAGCYP19 AGGTGCTATTGGTRCATCTTGCTC17ˇHSD4 TGCGGGATCACGGATGACTC

taining. Purified RNA was used immediately for reverse transcription (RT) or storedt −80 ◦C until analysis.

Synthesis of cDNA was performed by use of the Superscript first-strand synthesisystem® (Invitrogen, CA, USA). Briefly, total RNA (2 �g) was combined with 0.5 �g ofiotinylated oligo (dT)12–18 and 0.5 mM deoxynucleotide triphosphate nucleotides,hen diethylpyrocarbamate (DEPC)-treated water was added to a final volume of0 �L. Samples were denatured at 65 ◦C for 5 min and then incubated on ice formin. Reverse transcription was performed using 9 �L of a master mix containing:�L of 10× RT buffer, 4 �L of 25 mM MgCl2, 1 �L of RNase OUT (40 U/L; Invitrogen),nd 2 �L of RNase-free H2O. The mixtures were incubated at 42 ◦C for 2 min, then0 U of SuperScript II RT (Invitrogen) were added. The reaction was incubated at2 ◦C for 50 min and then inactivated by heating at 70 ◦C for 15 min. Finally, 1 �L ofNase H (2 U/L) was added to each tube and incubated at 37 ◦C for 20 min to digesthe RNA.

Quantitative real-time polymerase chain reaction (q-RT-PCR) was performedy using the SYBR Green PCR kit (Toyobo, Tokyo, Japan) and an ABI 7300 SystemPerkinElmer Applied Biosystems, CA, USA). The primer sequences of the selectedenes were previously published (Ding et al., 2007) and are given (Table 1). Thehermal cycle for the q-RT-PCR procedure was as follows: samples were denaturedt 95 ◦C for 10 min, followed by 40 cycles of denaturation at 95 ◦C for 15 s, annealingith extension for 1 min at 60 ◦C, and a final cycle of 95 ◦C for 15 s, 60 ◦C for 1 min,

nd 95 ◦C for 15 s. Melting curve analyses were performed after the 60 ◦C stage ofhe final cycle to differentiate between desired PCR products and primer–dimmerr DNA contaminants. Q-RT-PCR reactions were performed in triplicate and alsoepeated three times. For quantification of PCR results, the Ct (the cycle at whichhe fluorescence signal is first significantly different from background) was deter-

ined for each reaction. The expression profile of the target gene was normalized tohe corresponding �-actin mRNA content. Fold change in mRNA expression of theelevant genes was analyzed by the 2−��CT method (Livak and Schmittgen, 2001).

.6. Hormone measurements

Hormone extraction method was based on previously described (Hecker et al.,006). After 48 h exposure, culture medium was transferred to an Eppendorf tubend stored at −80 ◦C until quantification of hormones. Frozen medium was thawedn ice, the 500 �L culture medium was extracted twice with 2.5 mL diethyl ethern glass tubes, and phase separation was achieved by centrifugation at 2000 × g for0 min. Solvent was evaporated under a stream of nitrogen, and the residue wasissolved in 250 �L. ELISA buffer from Cayman Chemical Company and was either

mmediately measured or frozen at −80 ◦C for later analysis. Hormones in cultureedium were measured by competitive ELISA using the manufacturer’s recommen-

ations (Cayman Chemical Company, Ann Arbor, MI; testosterone [Cat # 582701],7�-estradiol [Cat # 582251]). Extracts of culture medium were diluted 1:2 forstradiol, and 1:75 for testosterone prior to use in the ELISA assay.

.7. Cyclic AMP measurements

Intracellular concentrations of cAMP were determined using a commercial ELISACat # 581001, Cayman Chemical Company, MI, USA) according to the protocol pro-ided by the manufacturer. Briefly, after H295R cells were exposed to chemicals for8 h, the culture medium was removed and the cells were washed with 0.9% NaClPBS was not used because phosphate interferes with the immunoassay). Cells wereysised for 20 min in 300 �L of 0.1 M HCl at room temperature; cells were scraped offhe surface with a cell scraper and the mixture was dissociated by pipetting up andown until the suspension was homogenous. Then the lysate was transferred to a.5 mL plastic vial, vortexed, and centrifuged at 1000 × g for 10 min. The supernatantas diluted 1:2 with the assay buffer provided by the kit and underwent all other

teps, including an acetylation step according to the instructions of the supplier.AMP was quantified by comparing to an external standard curve.

.8. Time-course response of cAMP, StAR gene expression, protein abundance and

ormone levels

The steroidogenic acute regulatory (StAR) protein is a central regulator interoidogenesis (Sewer and Waterman, 2001). To evaluate the involvement of cAMPignaling in the steroidogenic pathway, TCP (3.4 �M) was exposed to the H295Rells and the time-course response of cAMP concentrations, StAR gene expression

TTCCCAGAGGCTCTTCTTCGTG 95TCACCGATGCTGGAGTCAAC 134TGGTGGAATCGGGTCTTTATGG 128GCCACCATTCTCCTCACAACTC 121

and protein abundance were further investigated. The intracellular concentrationsof cAMP and the StAR gene expression were measured at 6, 12, 24, and 48 h andWestern blotting analysis was performed at 12, 24 and 48 h exposure. The hormone(T and E2) levels were quantified at 12, 24, and 48 h exposure.

Western blotting analysis was performed as previously described (Liu et al.,2010). Briefly, the H295R cells were seeded in 6-well plates (Corning Life Sciences).After exposure to TCP (0, 3.4 �M), the cells were lysed and the protein content wasdetermined. In total, 50 �g cytoplasmic protein were denatured, electrophoresedand transferred onto a polyvinylidene difluoride (PVDF) membrane. The transfer-ring efficiency was evaluated for equal protein in each lane using a reversible dye(PIERCE, IL, USA). The membrane was blocked and blots were probed with an anti-

Fig. 2. Expression of mRNA steroidogenic genes in H295R cells exposed to 0.0, 0.4,1.1 or 3.4 �M of pentachlorophenol (PCP) (A) or 2,4,6-trichlorophenol (TCP) (B) for48 h. Mean ± SEM of three replicates. Significance of the difference between thecontrol and exposure groups is indicated by *p < 0.05, **p < 0.01.

Y. Ma et al. / Toxicology 282 (2011) 146–153 149

F .4, 1.1C 1.1 oM ween

Bt5

2

ioamte

3

3

sT

3

sw1wo

ig. 3. Concentrations of testosterone (T) in media of H295R cells exposed to 0.0, 0oncentrations of 17�-estradiol (E2) in media of H295R cells exposed to 0.0, 0.4,ean ± SEM of three replicate samples.*p < 0.05 indicates significant difference bet

lotting Detection System (GE Healthcare, Baie-d’Urfe, QC, Canada). The quantifica-ion of the relative expression of StAR enzyme was performed by using BandScan.0 software. Three replicates were used in each experiment.

.9. Statistical analysis

The normality of the data was checked using the Kolmogorov–Smirnov test, andf necessary, data was log-transformed to approximate normality. The homogeneityf variances was analyzed by Levene’s test. The differences in the data were evalu-ted by use of a one-way analysis of variance (ANOVA) test followed by a Tukey’sultiple range tests using SPSS 13.0 (SPSS, Chicago, IL, USA). The criterion for statis-

ical difference was set at p < 0.05. All values were expressed as the mean ± standardrror (SEM).

. Results

.1. Cell viability

None of the concentrations of neither PCP nor TCP caused anytatistically significant leakage of LDH from cells (data not shown).his result is consistent with no change in viability of the cells.

.2. Gene-expression profile

PCP caused statistically significant down-regulation of all the

teroidogenic genes tested (Fig. 2A). Expression of the StAR geneas significantly down-regulated 1.3-, 1.3- and 1.7-fold by 0.4,

.1 and 3.4 �M PCP, respectively (Fig. 2A). Expression of CYP11Aas significantly inhibited in a concentration-dependent manner

f 1.5-, 1.7-, and 2.2-fold (Fig. 2A). Expression of 3ˇHSD2 was down-

or 3.4 �M (A) pentachlorophenol (PCP) or (B) 2,4,6-trichlorophenol (TCP) for 48 h.r 3.4 �M (C) pentachlorophenol (PCP) or (D) 2,4,6-trichlorophenol (TCP) for 48 h.exposure groups and the corresponding control.

regulated 2.9- and 3.0-fold and expression of CYP17 mRNA wasdown-regulated 1.6- and 2.0-fold by 1.1 and 3.4 �M PCP. Down-regulation of CYP19 (1.4-fold) and 17ˇHSD4 (1.7-fold) was observedin cells exposed to the greater concentration of 3.4 �M PCP (Fig. 2A).

Expression of StAR was significantly down-regulated 1.9- and2.5-fold by 1.1 and 3.4 �M TCP (Fig. 2B). CYP11A and 3ˇHSD2 weredown-regulated 1.4- and 2.4-fold in cells exposed to the greaterconcentration of TCP. Expression of CYP19 was down-regulated6.1- and 7.0-fold and expression of 17ˇHSD4 mRNA was down-regulated 3.2- and 4.0-fold by 1.1 and, 3.4 �M TCP, respectively(Fig. 2B). Expression of CYP17 mRNA was not significantly alteredby either concentration of TCP (Fig. 2B).

3.3. Hormone production

Concentrations of both T and E2 were affected by exposure toPCP or TCP. Concentrations of T were 18% and 31% less in mediaof cells exposed to 1.1 or 3.4 �M PCP, respectively (Fig. 3A). Con-centrations of T were 18%, 21% and 31% less in the media of cellsexposed to 0.4, 1.1, or 3.4 �M TCP, respectively (Fig. 3B). Concentra-tions of E2 were 12% less in the medium of cells exposed to 3.4 �MPCP, while 0.4 and 1.1 �M PCP exposure caused no statistically sig-nificant effects on E2 production (Fig. 3C). E2 concentration wasreduced 15% when cells were exposed to 3.4 �M TCP (Fig. 3D).

3.4. Cellular cAMP levels

Both PCP and TCP caused a reduction in concentration ofcAMP relative to that in control cells. PCP caused a concentration-

150 Y. Ma et al. / Toxicology 2

Fig. 4. Concentrations of cAMP in H295R cells exposed to 0.0, 0.4, 1.1 or 3.4 �Mpft

difc(dtt(

3a

bT2(asbwa2(tw(

T was due, at least in part, to reduced expression of these genes.

entachlorophenol (PCP) (A) or 2,4,6-trichlorophenol (TCP) (B) for 48 h. Mean ± SEMrom three replicate samples. *p < 0.05 and **p < 0.01, significant differences betweenreatments and control.

ependent reduction in concentration of cAMP. The reductionsn cAMP relative to that of the controls were 16%, 23%, and 37%or 0.4, 1.1, 3.4 �M PCP, respectively, with the effect statisti-ally significant at only the greatest concentration of 3.4 �M PCPFig. 4A). TCP also caused a statistically significant, concentration-ependent and lesser concentration of cAMP relative to that ofhe controls. cAMP concentrations were 23%, 49% and 53%, lesshan that of controls for the three concentrations, respectivelyFig. 4B).

.5. Time-course response of cAMP, StAR gene expression, proteinbundance and hormone levels

In the control group, the cellular cAMP levels remained sta-le during the exposure period (Fig. 5A). Exposure to 3.4 �MCP decreased cellular cAMP levels at 6, 12, 24 or 48 h by 15%,1%, 31.8% and 40.4%, respectively, compared with the controlFig. 5A). The StAR gene expression was down-regulated at 12, 24,nd 48 h by 1.2-, 1.5- and 3.2-fold, respectively (Fig. 5B). Expo-ure to 3.4 �M TCP also down-regulated StAR protein expressiony 1.3- and 2.7-fold after 24 and 48 h, respectively, comparedith the control (Fig. 5C and D). Concentrations of T were 49%

nd 30% less in media of the cells exposed to 3.4 �M TCP at4 and 48 h, respectively, relative to the correspondence control

Fig. 5E). There were no significant differences in the E2 concen-rations upon exposure to 3.4 �M TCP at 12 and 24 h (Fig. 5F),hile concentrations of E2 were 20% less in media at 48 h exposure

Fig. 5F).

82 (2011) 146–153

4. Discussion

The mechanism by which PCP decreased production of the twosteroid hormones (T and E2) is consistent with down-regulationof gene expressions of enzymes involved in their production.Down-regulation of gene expression of steroidogenic enzymeswas associated with decreased cellular cAMP content, which isconsistent with regulation of steroidogenesis networks via cAMP-dependent signaling.

The statistically significant down-regulation of StAR, CYP11A,CYP17 gene expressions caused by PCP and TCP could result inchanges in steroid hormones. The protein encoded by the StARgene plays a key role in the acute regulation of steroid hormonesynthesis, while CYP11A1 catalyzes the first step in steroid hor-mone biosynthesis which forms pregenolone through side chaincleavage of cholesterol, thus potentially affecting the levels ofall adrenal steroid hormones. The CYP17 enzyme functions astwo different catalysts steroid 17�-hydroxylase and 17,20-lyaseand is responsible for the production of dehydroepiandrosterone(DHEA), which is synthesized in the adrenal gland of humans (Chenet al., 2004). Inhibition of CYP17 would result in less formationof 17�-OH-prognnolone and 17�-OH-pregesterone, suppressionof DHEA activity, and ultimately suppression of production ofandrostenedione. Therefore, inhibition of CYP11A and CYP17 geneexpression observed in this study could lead to non-selectiveinhibition of other cytochrome P450 enzymes and affect steroido-genesis, which could result in less synthesis of weaker androgens,such as DHEA and consequently affect production of T and E2.Inhibition of E2 secretion has been shown to be due to inhi-bition of CYP17 when human luteinizing granulosa cells weretreated with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (Moranet al., 2003). Some PBDEs and their derivatives, including hydroxylbrominated diphenylethers (OH-BDEs) and methoxylated bromi-nated diphenylethers (MeO-BDEs) can inhibit CYP17 activity inH295R cells (Cantón et al., 2006).

The 3ˇ-HSD is responsible for the oxidation and isomerizationof 5-ene-3�-hydroxy steroids to the corresponding 4-ene-3-ketosteroids, which is a required step in biosynthesis of not onlyandrogens and estrogens but also of mineralocorticoids and glu-cocorticoids (Labrie et al., 1992; Mason, 1993). In humans, twoclosely related types of 3ˇ-HSD (3ˇ-HSD1 and 3ˇHSD2) have beenidentified and 3ˇHSD2 is exclusively expressed in the adrenal cor-tex and gonads (Mason et al., 1997). Since the 3ˇHSD family isrequired for the biosynthesis of all classes of steroid hormones,down-regulation of 3ˇHSD2 is consistent with the decrease inconcentration of T being partially the result of decrease produc-tion of up-stream hormones, such as 17�-OH-progesterone, DHEA.Prochloraz significantly inhibited the expression of 3ˇHSD2, whichwas correlated down-regulation of steroidogenesis (Ohlsson et al.,2009).

17ˇHSD enzyme catalyzes the final step of sex steroid biosyn-thesis, which controls estrogen and androgen concentrations.Exposure to PCP inhibits steroidogenesis, accompanied by adecrease in production of T in cultured Xenopus oocytes (Ortonet al., 2009). While there are no reports of PCP affecting steroido-genesis in H295R cells, tribromophenol (TBP) has been reportedto modulate 3ˇHSD2 and CYP17 involved in steroid synthesis ofH295R cells (Ding et al., 2007). Exposure of zebrafish to TBP sig-nificantly down-regulated expression of 3ˇHSD2, 17ˇHSD4, CYP17and decreased concentration of T in plasma of females (Deng et al.,2010). The authors speculated that the decreased concentration of

Taken together, these results suggest that PCP and TCP decreasedmRNA expression and act at the level of gene transcription.

Aromatase (CYP19) catalyzes the final and rate-limiting step inconversion of androgen to estrogen (Hilscherova et al., 2004). Var-

Y. Ma et al. / Toxicology 282 (2011) 146–153 151

Fig. 5. Time-course of cellular cAMP concentration at 3, 6, 12, 24, and 48 h (A); StAR gene expressions (B); representative Western blotting of abundance of StAR enzymesf relato to 0.0s l. Meab

ic2ia2icu

rom control and 3.4 �M exposed cells for 12, 24 and 48 h (C); quantification of thef testosterone (T) (E) and 17�-estradiol (E2) (F) in media of H295R cells exposedtatistical significant differences between exposure group with corresponding controetween treatments and control.

ous fungicides are known to inhibit aromatase activity in H295Rells (Mason et al., 1987; Ayub and Levell, 1988; Vinggaard et al.,000; Cantón et al., 2005). It has been hypothesized that the abil-

ty of various chemicals to alter the activity of CYP19 represents

potential mechanism of endocrine disruption (Sanderson et al.,

002). For example, pesticides such as imazalil and prochloraznhibit CYP19. Since this is the enzyme that controls the rate ofonversion of androgens into estrogens, in the study reportedpon here, the significant decrease in expression CYP19 mRNA

ive expression of StAR enzyme in control and treatment group (D); concentrations, or 3.4 �M 2,4,6-trichlorophenol (TCP). Student’s t-test was performed to indicaten ± SEM from three replicate samples. *p < 0.05 and **p < 0.01, significant differences

in H295R cells is likely the reason for decreased synthesis ofE2.

cAMP is an important secondary messenger that stimulatessteroid hormone biosynthesis in the human adrenal cortex (Sewer

and Waterman, 2001; Stocco et al., 2005). Most steroidogenicgenes, including StAR, CYP11A, CYP11B, CYP17 and CYP21 are cAMP-dependent (Sewer and Waterman, 2001). 3ˇHSD2 in H295R cellscan be induced in H295R cells by stimulation of cAMP (Martinand Tremblay, 2005). In the study reported upon here, concentra-

1 logy 2

torsia(Scet1afgatr(tpnrwdTtmcta

oicf2wwimtwo

C

A

(pCDbfK

R

A

52 Y. Ma et al. / Toxico

ion of cAMP in H295R cells was significantly less and expressionf several key steroidogenic genes was down-regulated. Thisesult is consistent with cellular cAMP regulating steroidogene-is. This is consistent with the observation that several chemicals,ncluding triazines, atrazine, vinclozolin, flavonoid and methylx-nthine, can modulate steroidogenesis through the cAMP pathwaySanderson et al., 2000, 2002, 2004; Hilscherova et al., 2004;uzawa and Ingraham, 2008). For example, treatment of H295Rells with forksolin, an inducer of cAMP resulted in greater 3ˇHSD2xpression (Hilscherova et al., 2004). In addition, co-exposureo 3-methyl-4-nitrophenol and cAMP significantly up-regulated7ˇHSD4 expression in H295R cells (Furuta et al., 2008). This islso consistent with cAMP modulating steroidogenesis. This studyurther examined whether the inhibitory effects of CPs on steroido-enesis (including decreased mRNA expression, protein abundancend hormone levels) resulted from the reduction of cAMP. Among ofhese enzymes involvement of steroidogenesis, steroidogenic acuteegulatory (StAR) protein is a central regulator in steroidogenesisSugawara et al., 2006). Therefore, StAR was selected for testing theime-course response of cAMP, gene expression, and the enzymerotein levels upon H295R exposure to TCP. cAMP content was sig-ificantly decreased by 31.8% and 40.4% at 24 and 48 h exposure,espectively, and StAR gene expression and protein abundance asell as hormone levels were all decreased, which indicates that theecrease in cellular cAMP may lead to inhibition of steroidogenesis.his result is consistent with those of the previous study reportinghat a decrease in cellular cAMP level significantly inhibited StAR

RNA, protein and testosterone production in primary rat Leydigells exposed to perfluorododecanoic acid (Shi et al., 2010). Takenogether, we propose that PCP and TCP may alter steroidogenesisnd hormone via modulating cAMP signaling in H295R cells.

In summary, we have shown that PCP and TCP affect productionf T and E2 in H295R cells. These effects are probably mediated bynhibition of the steroidogenic enzymes via decreased cellular con-entration of cAMP. Other regulatory factors, such as steroidogenicactor 1 (SF-1) can regulate steroidogenic gene expression (Li et al.,004; Sugawara et al., 2006) and thus future studies that investigatehether SF-1 modulates expression of these steroidogenic genesill provide new insights into the underlying mechanisms. Further

n vivo investigation to elucidate the effects of the gene and hor-one levels and reproduction is warranted. In addition, evaluating

he effects of mixture of chlorophenols in vitro and then combiningith in vivo study will provide more comprehensive information

f an impact on homeostasis and organism health.

onflict of interest

The authors declare no conflict of interest.

cknowledgements

This work was supported by Chinese Academy of SciencesKZCX2-YW-Q02-05), the NSFC of China (20890113), the FEBLroject (2008FBZ10) and a Discovery Grant from the NSERC ofanada (326415-07), and a grant from the Western Economiciversification Canada (6578 and 6807). Prof. Giesy was supportedy the Canada Research Chair program and an at-large Chair Pro-essorship at the Department of Biology and Chemistry and Stateey Laboratory in Marine Pollution, City University of Hong Kong.

eferences

rechabala, B., Coiffard, C., Rivalland, P., Coiffard, L.J., de Roeck-Holtzhauer, Y., 1999.Comparison of cytotoxicity of various surfactants tested on normal human fibro-blast cultures using the neutral red test, MTT assay and LDH release. J. Appl.Toxicol. 19, 163–165.

82 (2011) 146–153

ATSDR, 2001. Toxicological Profile for Pentachlorophenol. Agency for Toxic Sub-stances and Disease Registry, Public Health Service, U.S. Department of Healthand Human Services, Atlanta, p. 316.

Ayub, M., Levell, M.J., 1988. Structure–ctivity relationships of the inhibition of humanplacental aromatase by imidazole drugs including ketoconazole. J. SteroidBiochem. 31, 65–72.

Baynes, R.E., Brooks, J.D., Mumtaz, M., Riviere, J.E., 2002. Effect of chemical interac-tions in pentachlorophenol mixtures on skin and membrane transport. Toxicol.Sci. 69, 295–305.

Bhattacharya, S.K., Yuan, Q., Jin, P., 1996. Removal of pentachlorophenol fromwastewater by combined anaerobic–erobic treatment. J. Hazard Mater. 49,143–154.

Cantón, R.F., Sanderson, J.T., Letcher, R.J., Bergman, A., van den Berg, M., 2005.Inhibition and induction of aromatase (CYP19) activity by brominated flameretardants in H295R human adrenocortical carcinoma cells. Toxicol. Sci. 88,447–455.

Cantón, R.F., Sanderson, T., Nijmeijer, S., Bergman, Å., Letcher, R.J., Van den Berg, M.,2006. In vitro effects of brominated flame retardants and metabolites on CYP17catalytic activity: a novel mechanism of action? Toxicol. Appl. Pharmacol. 216,274–281.

Chen, C., Parker Jr., C.R., 2004. Adrenal androgens and the immune system. Semin.Reprod. Med. 22, 369–377.

Chen, Y., Chen, H., Xu, Y., Shen, M., 2004. Irreversible sorption of pentachlorophenolto sediments: experimental observations. Environ. Int. 30, 31–37.

Daniel, V., Huber, W., Bauer, K., Opelz, G., 1997. Impaired in vitro lymphocyteresponses in patients with elevated pentachlorophenol (PCP) blood levels. Arch.Environ. Health 50, 148–149.

Deng, J., Liu, C., Yu, L., Zhou, B., 2010. Chronic exposure to environmental levels oftribromophenol impairs zebrafish reproduction. Toxicol. Appl. Pharmacol. 243,87–95.

Ding, L., Murphy, M.B., He, Y., Xu, Y., Yeung, L.W.Y., Wang, J., Zhou, B., Lam, P.K.S., Wu,R.S.S., Giesy, J.P., 2007. Effects of brominated flame retardants and brominateddioxins on steroidogenesis in H295R human adrenocortical carcinoma cell line.Environ. Toxicol. Chem. 26, 764–772.

Dong, Y., Jiang, S., 2009. Induction of oxidative stress and apoptosis by pen-tachlorophenol in primary cultures of Carassius carassius hepatocytes. Comp.Biochem. Physiol. 150C, 179–185.

Dorsey, W.C., Tchounwou, P.B., 2004. Pentachlorophenol-induced cytotoxic mito-genic, and endocrine-disrupting activities in channel catfish, Ictalurus punctatus.Int. J. Environ. Res. Public Health 1, 90–99.

Eker, S., Kargi, F., 2007. 2,4,6-Trichlorophenol containing wastewater treatmentusing a hybrid-loop bioreactor system. J. Environ. Eng. 133, 340–345.

Farhadi, K., Farajzadeh, M.A., Matin, A.A., Hashemi, P., 2009. Dispersive liquid–liquidmicroextraction and liquid chromatographic determination of pentachlorophe-nol in water. Cent. Eur. J. Chem. 7, 369–374.

Fernández Freire, P., Labrador, V., Pérez Martín, J.M., Hazen, M.J., 2005. Cytotoxiceffects in mammalian Vero cells exposed to pentachlorophenol. Toxicology 210,37–44.

Furuta, C., Noda, S., Li, C., Suzuki, A.K., Taneda, S., Watanabe, G., Taya, K., 2008.Nitrophenols isolated from diesel exhaust particles regulate steroidogenic geneexpression and steroid synthesis in the human H295R adrenocortical cell line.Toxicol. Appl. Pharmacol. 229, 109–120.

Gao, J., Liu, L., Liu, X., Zhou, H., Huang, S., Wang, Z., 2008. Levels and spatialdistribution of chlorophenols 2,4-dichlorophenol, 2,4,6-trichlorophenol, andpentachlorophenol in surface water of China. Chemosphere 71, 1181–1187.

Gracia, T., Hilscherova, K., Jones, P.D., Newsted, J.L., Zhang, X., Hecker, M., Higley,E.B., Sanderson, J.T., Yu, R.M., Wu, R.S., Giesy, J.P., 2006. The H295R system forevaluation of endocrine-disrupting effects. Ecotoxicol. Environ. Saf. 65, 293–305.

Hanna, K., de Brauer, C., Germain, P., Chovelon, J.M., Ferronato, C., 2004. Degradationof pentachlorophenol in cyclodextrin extraction effluent using a photocatalyticprocess. Sci. Total Environ. 332, 51–60.

He, Y., Murphy, M.B., Yu, R.M., Lam, M.H., Hecker, M., Giesy, J.P., Wu, R.S., Lam, P.K.,2008. Effects of 20 PBDE metabolites on steroidogenesis in the H295R cell line.Toxicol. Lett. 176, 230–238.

Hecker, M., Newsted, J.L., Murphy, M.B., Higley, E.B., Jones, P.D., Wu, R., Giesy, J.P.,2006. Human adrenocarcinoma (H295R) cells for rapid in vitro determination ofeffects on steroidogenesis: hormone production. Toxicol. Appl. Pharmacol. 217,114–124.

Hilscherova, K., Jones, P.D., Gracia, T., Newsted, J.L., Zhang, X., Sanderson, J.T., Yu,R.M.K., Wu, R.S.S., Giesy, J.P., 2004. Assessment of the effects of chemicals onthe expression of ten steroidogenic genes in the H295R cell line using real-timePCR. Toxicol. Sci. 81, 78–89.

Jensen, J., 1996. Chlorophenols in the terrestrial environment. Rev. Environ. Contam.Toxicol. 146, 25–51.

Jung, J., Ishida, K., Nishihara, T., 2004. Anti-estrogenic activity of fifty chemicalsevaluated by in vitro assays. Life Sci. 74, 3065–3074.

Labrie, F., Simard, J., Luu-The, V., Belanger, A., Pelletier, G., 1992. Struc-ture, function and tissue-specific gene expression of 3�-hydroxysteroiddehydrogenase/5-ene-4-ene isomerase enzymes in classical and peripheralintracrine steroidogenic tissues. J. Steroid Biochem. Mol. Biol. 43, 805–826.

Letcher, R.J., Sanderson, J.T., Bokkers, A., Giesy, J.P., van den Berg, M., 2005. Effectsof bisphenol A-related diphenylalkanes on vitellogenin production in mal carp(Cyprinus carpio) hepatocytes and aromatase (CYP19) activity in human H295adrenocortical carcinoma cells. Toxicol. Appl. Pharmacol. 209, 95–104.

Li, L., Chang, Y., Wang, C., Tsai, F., Jong, S., Chung, B., 2004. Steroidogenic factor 1differentially regulates basal and inducible steroidogenic gene expression and

logy 28

L

L

L

M

M

M

M

M

O

O

O

PR

R

S

S

S

Y. Ma et al. / Toxico

steroid synthesis in human adrenocortical H295R cells. J. Steroid Biochem. Mol.Biol. 91, 11–20.

i, L., Wang, P., 2005. PCB126 induces differential changes in androgen, cortisol, andaldosterone biosynthesis in human adrenocortical H295R cells. Toxicol. Sci. 85,530–540.

iu, C., Zhang, X., Chang, H., Jones, P., Wiseman, S., Naile, J., Hecker, M., Giesy, J.P.,Zhou, B., 2010. Effects of fluorotelomer alcohol 8:2 FTOH on steroidogenesis inH295R cells: targeting the cAMP signaling cascade. Toxicol. Appl. Pharmacol.247, 222–228.

ivak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2−��CT method. Methods 25, 402–408.

artin, L.J., Tremblay, J.J., 2005. The human HSD3B2 promoter is a novel targetfor the immediate early orphan nuclear receptor nur77 in steroidogenic cells.Endocrinology 146, 861–869.

ason, J.I., Carr, B.R., Murry, B.A., 1987. Imidazole antimycotics: selective inhibitorsof steroid aromatization and progesterone hydroxylation. Steroids 50, 179–189.

ason, J.I., 1993. The 3�-hydroxysteroid dehydrogenase gene family of enzymes.Trends Endocrinol. Metab. 4, 199–203.

ason, J.I., Keeney, D.S., Bird, I.M., Rainey, W.E., Morohashi, K., Leers Sucheta,S., Melner, M.H., 1997. The regulation of 3�-hydroxysteroid dehydrogenaseexpression. Steroids 62, 164–168.

oran, F.M., VandeVoort, C.A., Overstreet, J.W., Lasley, B.L., Conley, A.J., 2003. Molec-ular target of endocrine disruption in human luteinizing granulosa cells by 2,3,7,8-tetrachlorodibenzo-p-diox: inhibition of estradiol secretion due to decreased17alpha-hydroxylase/17,20-lyase cytochrome P450 expression. Endocrinology144, 467–473.

’Donoghue, J.L., 1985. In: O’Donoghue, J.L. (Ed.), Neurotoxicity of Industrial andCommercial Chemicals, vol. 2. CRC Press, Boca Raton, FL, pp. 99–120.

hlsson, A., Ullerås, E., Oskarsson, A., 2009. A biphasic effect of the fungicideprochloraz on aldosterone, but not cortisol, secretion in human adrenal H295Rcells—underlying mechanisms. Toxicol. Lett. 191, 174–180.

rton, F., Lutz, I., Kloas, W., Routledge, E.J., 2009. Endocrine disrupting effects ofherbicides and pentachlorophenol: in vitro and in vivo evidence. Environ. Sci.Technol. 43, 2144–2150.

roudfoot, A.T., 2003. Pentachlorophenol poisoning. Toxicol. Rev. 22, 3–11.amamoorthy, S., Ramamoorthy, S., 1997. Chlorinated Organic Compounds in the

Environment. Regulatory and Monitoring Assessment. Lewis Publishers, BocaRation.

eigner, B.G., Bois, F.Y., Tozer, T.N., 1993. Pentachlorophenol carcinogenicity: extrap-olation of risk from mice to humans. Hum. Exp. Toxicol. 12, 215–225.

anderson, J.T., Seinen, W., Giesy, J.P., van den Berg, M., 2000. 2-Chloro-s-triazineherbicides induce aromatase (CYP19) activity in H295R human adrenocorticalcarcinoma cells: a novel mechanism for estrogenicity? Toxicol. Sci. 54, 121–127.

anderson, J.T., Boerma, J., Lansbergen, G.W.A., Van den Berg, M., 2002. Inductionand inhibition of aromatase (CYP19) activity by various classes of pesticides inH295R human adrenocortical carcinoma cells. Toxicol. Appl. Pharmacol. 182,44–54.

anderson, J.T., Hordijk, J., Denison, M.S., Springsteel, M.F., Nantz, M.H., Van den Berg,M., 2004. Induction and inhibition of aromatase (CYP19) activity by natural and

2 (2011) 146–153 153

synthetic flavonoid compounds in H295R human adrenocortical carcinoma cells.Toxicol. Sci. 82, 70–79.

Sewer, M.B., Waterman, M.R., 2001. Insights into the transcriptional regula-tion of steroidogenic enzymes and StAR. Rev. Endocr. Metab. Disord. 2,269–274.

Shi, Z., Feng, Y., Wang, J., Zhang, H., Ding, L., Dai, J., 2010. Perfluorododecanoicacid-induced steroidogenic inhibition is associated with steroidogenic acuteregulatory protein and reactive oxygen species in cAMP-stimulated leydig cells.Toxicol. Sci. 114, 285–294.

Song, R., He, Y., Murphy, M.B., Yeung, L.W., Yu, R.M., Lam, M.H., Lam, P.K., Hecker,M., Giesy, J.P., Wu, R.S., Zhang, W., Sheng, G., Fu, J., 2008. Effects of fifteen PBDEmetabolites, DE71, DE79, and TBBPA on steroidogenesis in the H295R cell line.Chemosphere 71, 1888–1894.

Stocco, D.M., Wang, X., Jo, Y., Manna, P.R., 2005. Multiple signaling pathways reg-ulating steroidogenesis and steroidogenic acute regulatory protein expression:more complicated than we thought. Mol. Endocrinol. 19, 2647–2659.

Sugawara, T., Sakuragi, N., Minakami, H., 2006. CREM confers cAMP responsivenessin human steroidogenic acute regulatory protein expression in NCI-H295R cellsrather than SF-1/Ad4BP. J. Endocrinol. 191, 327–337.

Suzawa, M., Ingraham, H.A., 2008. The herbicide atrazine activates endocrine genenetworks via non steroidal NR5A nuclear receptors in fish and mammalian cells.PLoS one 3, e2117.

Suzuki, T., Ide, K., Ishida, M., 2001. Response of MCF-7 human breast cancer cells tosome binary mixtures of oestrogenic compounds in vitro. J. Pharm. Pharmacol.53, 1549–1554.

Vinggaard, A.M., Hnida, C., Breinholt, V., Larsen, J.C., 2000. Screening of selectedpesticides for inhibition of CYP19 aromatase activity in vitro. Toxicol. In Vitro14, 227–234.

Wang, X., Li, Y., Dong, D., 2008. Sorption of pentachlorophenol on surficial sediments:the roles of metal oxides and organic materials with co-existed copper present.Chemosphere 73, 1–6.

Yin, D., Gu, Y., Li, Y., Wang, X., Zhao, Q., 2006. Pentachlorophenol treatmentin vivo elevates point mutation rate in zebrafish p53 gene. Mutat. Res. 609,92–101.

Zha, J., Wang, Z., Schlenk, D., 2006. Effects of pentachlorophenol on the reproductionof Japanese medaka (Oryzias latipes). Chem. Biol. Interact. 161, 26–36.

Zhang, M., Yin, D., Kong, F., 2008. The changes of serum testosterone level and hepaticmicrosome enzyme activity of crucian carp (Carassius carassius) exposed to asublethal dosage of pentachlorophenol. Ecotoxicol. Environ. Saf. 71, 384–389.

Zhang, X., Yu, R.M., Jones, P.D., Lam, G.K., Newsted, J.L., Gracia, T., Hecker, M.,Hilscherova, K., Sanderson, T., Wu, R.S., Giesy, J.P., 2005. Quantitative RT-PCRmethods for evaluating toxicant-induced effects on steroidogenesis using theH295R cell line. Environ. Sci. Technol. 39, 2777–2785.

Zhao, B., Yang, J., Liu, Z., Xu, Z., Qiu, Y., Sheng, G., 2006. Joint anti-estrogenic effectsof PCP and TCDD in primary cultures of juvenile goldfish hepatocytes usingvitellogenin as a biomarker. Chemosphere 65, 359–364.

Zheng, M., Zhang, B., Bao, Z., Yang, H., Xu, X., 2000. Analysis of pentachlorophenolfrom water, sediments, and fish bile of Dongting Lake in China. Bull. Environ.Contam. Toxicol. 64, 16–19.