Modified Method for Combined DNA and RNA Isolation From peanut and Other Oil Seeds Phat M. Dang and...
1
Modified Method for Combined DNA and RNA Isolation From peanut and Other Oil Seeds Phat M. Dang and Charles Y. Chen USDA-ARS, National Peanut Research Laboratory, Dawson, GA INTRODUCTION RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted plant selection and other genetic studies. We describe a modified method described by Li and Trick (2005) to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both DNA from RNA from the same seed tissues. RNA quality was evaluated using both spectrophometric analysis and agarose gel electrophoresis. Average ratios of 260/230 were above 2.0 indicating no contamination from phenolics and polysaccharides. RNA was shown to be suitable for RT-PCR based on Actin or 60S primer amplification and DNA was shown to have a single band on gel electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds. MATERIALS AND METHODS Plant materials Mature dry seeds were collected from soybean (Williams 82), sunflower (Hybrid 894), canola, oil radish, peanut (A-104, AP-4, AT-215, AT3085RO, C76-16, Exp27-1516, Exp3-1114, Florida 07, Flavor Runner 458, Georgia Green, Georgia 03L, Tifrunner, VC-2, and York) and were utilized for both RNA and DNA extraction. RNA/DNA isolation and quantitation Both RNA and DNA were isolated using a method utilizing guanidinium salt extraction buffer. For further purification, RNA was treated with DNase I (Ambion) and DNA was treated RNase (Ambion). Gel electrophoresis RNA samples were denatured and separated on a 1.2% agarose gel in MOPS buffer. DNA samples were separated on a 0.8% agarose gel in 1x TAE buffer. RT-PCR One microgram of total RNA was reverse transcribed with MMLV Reverse Transcriptase using oligo dT and resulting cDNAs were used as template for PCR reactions. Specific primers Actin_Fwd (5’-3’) CACATGCCATCCTTCGATTG and Actin_Rev (5’-3’) CCAAGGCAACATATGCAAGCT to produce a 150 bp PCR product. 60S(L19)_Fwd (5’-3’) AGAGGGAAGGTTTGGCTTGAC and 60s(L19)_Rev (5’-3’) CGGGAATTGGCCATGGA to produce a 60 bp PCR product. SUMMARY To facilitate transcript analyses and other genomic studies, the protocol we developed for DNA and RNA isolation from cultivated peanuts and other oil seeds yield high quality of DNA and RNA templates for PCR and RT-PCR reactions. This modified method that works for fresh, frozen, or dry seeds makes the technique more versatile and requires the same amount of time compared to other purification methods but significant improved quality and yield that is suitable for many genomic studies such as cDNA library construction, primer extension, subtractive hybridization, and genotyping for a mapping population. We expect that the utilization of this method will facilitate the improvement of automated high- throughput genomic techniques used in functional genomics studies of peanuts as well as in other oil seed crops. RNA/DNA EXTRACTION PROCEDURE 1.Place 10 mL of Solution I [100 mM Tris, 150 mM LiCl, 50 mM EDTA, 1.5% SDS, 2% PVP-40] in 40 mL conical tube, add 150 L of BME, and place on ice. Obtain liquid nitrogen and mortar and pestles. Weigh out 1 to 1.5 gram of seed. Grind seed in pre-chilled (with liquid nitrogen) mortar, grind thoroughly, place powder in Solution I, vortex to mix completely, and place on ice. 2.Add 0.5 volume (relative to starting buffer volume, 5 mL) of acid phenol, pH 4.3 to tube, mix thorough with vortexing or inversion for 5 minutes. 3. Add 0.5 volume of Chloroform:Isoamyl alcohol (CI, 24:1) to tube, mix thorough for 5 minutes, centrifuge at 13,000xg for 10 minutes, transfer supernatant (top layer) to fresh 40 mL tube. Be sure to note transferred volume. 4. Add 1 volume of Solution II [(2 M guanidine thiocyanate, 0.5 M sodium citrate, 1.5 M ammonium acetate), pH to 5.2, then add 1% lauryol sulfate], mix by gentle inversion, place at room temp for 10 minutes with occasional inversion. After 10 min, add 0.5 volume Phenol:Chloroform:Isoamyl alcohol (PCI, 25:24:1, neutral pH), mix for 5 minutes, centrifuge at 13,000xg for 10 minutes. Transfer supernatant (top layer) to a fresh 40 mL tube. Be sure to note transferred volume. 5. Add 0.55 volume (relative to transferred volume) 1.2 M NaCl, mix by inversion, then add 0.66 volume isopropanol, mix, place on ice in refrigerator for 1 hour, centrifuge at 13,000xg at 4 o C for 15 minutes, discard liquid, wash pellet with 2 mL of 70% ice cold ethanol, centrifuge for 5 minutes, remove liquid, dry for 15 minutes, resuspend in 2 mL DEPC-treated water. 6. Add 1 volume 4 M LiCl, mix, place on ice in refrigerator for at least 1 hr or overnight, centrifuge at 13,000xg for 15 minutes. Transfer supernatant to a fresh 40 mL tube for DNA isolation and retain tube with pellet for RNA isolation. For RNA: wash RNA pellet with 2 mL 70% ethanol, centrifuge at 13,000xg 5 minutes, discard ethanol and dry pellet, resuspend in 750 L of DEPC water. Store at -20 o C. For DNA: add 1 volume (relative to transferred volume) isopropanol, invert at least five time or until DNA precipitates, centrifuge at A- 104 AP- 4 AT- 215 AT3085R O C76- 16 Exp27- 1516 Exp3- 1114 Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunne r VC- 2 Yor k 28S 18S A- 104 AP- 4 AT- 215 AT3085R O C76- 16 Exp27- 1516 Exp3- 1114 Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunne r VC- 2 Yor k Soybea n Sunflowe r Canol a Oil radish Peanu t # Sam ple ID C oncentration U nit A 260 A 280 260/280 260/230 Type 1 Soybean 483.3 ng/µl 9.667 5.113 1.89 1.78 DNA 2 Sunflow er 323.4 ng/µl 6.468 3.524 1.84 1.87 DNA 3 Canola 256.5 ng/µl 5.13 2.791 1.84 1.71 DNA 4 O il R adish 231.1 ng/µl 4.623 2.48 1.86 1.53 DNA 5 Peanut 128.3 ng/µl 2.565 1.396 1.84 2.2 DNA Nanodrop Readings Oil Seeds Genomic DNA Soybea n Sunflowe r Canol a Oil radish Peanu t 28S 18S # Sam ple ID C oncentration U nit A 260 A 280 260/280 260/230 Type 1 Soybean 475.6 ng/µl 11.89 5.713 2.08 2.17 RNA 2 Sunflow er 486.2 ng/µl 12.156 5.856 2.08 2.17 RNA 3 Canola 451 ng/µl 11.274 5.441 2.07 2.17 RNA 4 O il R adish 405.9 ng/µl 10.148 4.933 2.06 2.08 RNA 5 Peanut 487.2 ng/µl 12.179 6.046 2.01 2.07 RNA Oil Seeds RNA 60 bp Soybea n Sunflowe r Canol a Oil radish Peanu t No RT Control 60S (L19) PCR # Sam ple ID C oncentration U nit A 260 A 280 260/280 260/230 Type 1 A-104 468.9 ng/µl 11.722 5.752 2.04 2.04 RNA 2 AP-4 479.4 ng/µl 11.984 5.893 2.03 2.05 RNA 3 AT-215 463.6 ng/µl 11.589 5.74 2.02 2.02 RNA 4 AT3085R O 468.1 ng/µl 11.701 5.682 2.06 2.13 RNA 5 C 76-16 446.8 ng/µl 11.171 5.423 2.06 2.10 RNA 6 Exp27-1516 401.4 ng/µl 10.035 5.015 2.00 2.01 RNA 7 Exp3-1114 374.5 ng/µl 9.364 4.695 1.99 1.97 RNA 8 Florida 07 471.8 ng/µl 11.794 5.835 2.02 2.04 RNA 9 FlavorR unner458 416.8 ng/µl 10.421 5.215 2.00 2.01 RNA 10 G eorgia G reen 487.2 ng/µl 12.179 6.046 2.01 2.07 RNA 11 G eorgia 03L 456.9 ng/µl 11.424 5.648 2.02 2.00 RNA 12 Tifrunner 428.6 ng/µl 10.714 5.32 2.01 1.95 RNA 13 VC -2 435 ng/µl 10.875 5.438 2.00 2.05 RNA 14 York 469.3 ng/µl 11.732 5.772 2.03 2.00 RNA Peanut RNA # Sam ple ID C oncentration U nit A 260 A 280 260/280 260/230 Type 1 A-104 175.1 ng/µl 3.501 1.947 1.8 2.02 DNA 2 AP-4 81.6 ng/µl 1.633 0.885 1.84 2.07 DNA 3 AT-215 229.1 ng/µl 4.583 2.503 1.83 2.13 DNA 4 AT3085R O 267.7 ng/µl 5.355 2.924 1.83 2.30 DNA 5 C 76-16 163.5 ng/µl 3.269 1.783 1.83 2.08 DNA 6 Exp27-1516 146.7 ng/µl 2.934 1.601 1.83 2.28 DNA 7 Exp3-1114 264.8 ng/µl 5.296 2.883 1.84 2.33 DNA 8 Florida07 181 ng/µl 3.621 1.983 1.83 2.34 DNA 9 FlavorR unner458 145.5 ng/µl 2.91 1.603 1.81 1.97 DNA 10 G eorgia G reen 130 ng/µl 2.599 1.421 1.83 2.16 DNA 11 G eorgia 03L 125 ng/µl 2.499 1.369 1.83 1.99 DNA 12 Tifrunner 268.5 ng/µl 5.371 2.935 1.83 2.29 DNA 13 VC -2 134.4 ng/µl 2.687 1.449 1.85 2.25 DNA 14 York 163.1 ng/µl 3.263 1.831 1.78 1.90 DNA Peanut DNA 150 bp A- 104 AP- 4 AT- 215 AT3085R O C76- 16 Exp27- 1516 Exp3- 1114 Florida 07 Flavor Runner 458 Georgia Green Georgia 03L Tifrunne r VC- 2 Yor k No RT Control Actin PCR Nanodrop Readings Nanodrop Readings Nanodrop Readings
-
Upload
gloria-johnston -
Category
Documents
-
view
213 -
download
0
Transcript of Modified Method for Combined DNA and RNA Isolation From peanut and Other Oil Seeds Phat M. Dang and...
Modified Method for Combined DNA and RNA IsolationFrom peanut and Other Oil Seeds
Phat M. Dang and Charles Y. Chen
USDA-ARS, National Peanut Research Laboratory, Dawson, GAINTRODUCTION
RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted plant selection and other genetic studies. We describe a modified method described by Li and Trick (2005) to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both DNA from RNA from the same seed tissues. RNA quality was evaluated using both spectrophometric analysis and agarose gel electrophoresis. Average ratios of 260/230 were above 2.0 indicating no contamination from phenolics and polysaccharides. RNA was shown to be suitable for RT-PCR based on Actin or 60S primer amplification and DNA was shown to have a single band on gel electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.
MATERIALS AND METHODS
Plant materialsMature dry seeds were collected from soybean (Williams 82), sunflower (Hybrid 894), canola, oil
radish, peanut (A-104, AP-4, AT-215, AT3085RO, C76-16, Exp27-1516, Exp3-1114, Florida 07, Flavor Runner 458, Georgia Green, Georgia 03L, Tifrunner, VC-2, and York) and were utilized for both RNA and DNA extraction.
RNA/DNA isolation and quantitationBoth RNA and DNA were isolated using a method utilizing guanidinium salt extraction buffer. For
further purification, RNA was treated with DNase I (Ambion) and DNA was treated RNase (Ambion).
Gel electrophoresisRNA samples were denatured and separated on a 1.2% agarose gel in MOPS buffer. DNA samples
were separated on a 0.8% agarose gel in 1x TAE buffer.
RT-PCROne microgram of total RNA was reverse transcribed with MMLV Reverse Transcriptase using oligo
dT and resulting cDNAs were used as template for PCR reactions.
Specific primersActin_Fwd (5’-3’) CACATGCCATCCTTCGATTG and Actin_Rev (5’-3’)
CCAAGGCAACATATGCAAGCT to produce a 150 bp PCR product.60S(L19)_Fwd (5’-3’) AGAGGGAAGGTTTGGCTTGAC and 60s(L19)_Rev (5’-3’)
CGGGAATTGGCCATGGA to produce a 60 bp PCR product.
SUMMARYTo facilitate transcript analyses and other genomic studies, the protocol we developed for DNA and RNA isolation from cultivated
peanuts and other oil seeds yield high quality of DNA and RNA templates for PCR and RT-PCR reactions. This modified method that works for fresh, frozen, or dry seeds makes the technique more versatile and requires the same amount of time compared to other purification methods but significant improved quality and yield that is suitable for many genomic studies such as cDNA library construction, primer extension, subtractive hybridization, and genotyping for a mapping population. We expect that the utilization of this method will facilitate the improvement of automated high-throughput genomic techniques used in functional genomics studies of peanuts as well as in other oil seed crops.
RNA/DNA EXTRACTION PROCEDURE
1. Place 10 mL of Solution I [100 mM Tris, 150 mM LiCl, 50 mM EDTA, 1.5% SDS, 2% PVP-40] in 40 mL conical tube, add 150 L of BME, and place on ice. Obtain liquid nitrogen and mortar and pestles. Weigh out 1 to 1.5 gram of seed. Grind seed in pre-chilled (with liquid nitrogen) mortar, grind thoroughly, place powder in Solution I, vortex to mix completely, and place on ice.
2. Add 0.5 volume (relative to starting buffer volume, 5 mL) of acid phenol, pH 4.3 to tube, mix thorough with vortexing or inversion for 5 minutes.
3. Add 0.5 volume of Chloroform:Isoamyl alcohol (CI, 24:1) to tube, mix thorough for 5 minutes, centrifuge at 13,000xg for 10 minutes, transfer supernatant (top layer) to fresh 40 mL tube. Be sure to note transferred volume.
4. Add 1 volume of Solution II [(2 M guanidine thiocyanate, 0.5 M sodium citrate, 1.5 M ammonium acetate), pH to 5.2, then add 1% lauryol sulfate], mix by gentle inversion, place at room temp for 10 minutes with occasional inversion. After 10 min, add 0.5 volume Phenol:Chloroform:Isoamyl alcohol (PCI, 25:24:1, neutral pH), mix for 5 minutes, centrifuge at 13,000xg for 10 minutes. Transfer supernatant (top layer) to a fresh 40 mL tube. Be sure to note transferred volume.
5. Add 0.55 volume (relative to transferred volume) 1.2 M NaCl, mix by inversion, then add 0.66 volume isopropanol, mix, place on ice in refrigerator for 1 hour, centrifuge at 13,000xg at 4oC for 15 minutes, discard liquid, wash pellet with 2 mL of 70% ice cold ethanol, centrifuge for 5 minutes, remove liquid, dry for 15 minutes, resuspend in 2 mL DEPC-treated water.
6. Add 1 volume 4 M LiCl, mix, place on ice in refrigerator for at least 1 hr or overnight, centrifuge at 13,000xg for 15 minutes. Transfer supernatant to a fresh 40 mL tube for DNA isolation and retain tube with pellet for RNA isolation. For RNA: wash RNA pellet with 2 mL 70% ethanol, centrifuge at 13,000xg 5 minutes, discard ethanol and dry pellet, resuspend in 750 L of DEPC water. Store at -20oC. For DNA: add 1 volume (relative to transferred volume) isopropanol, invert at least five time or until DNA precipitates, centrifuge at 13,000xg 5 minutes, wash DNA pellet with 2 mL 70% ethanol, centrifuge at 13,000xg 5 minutes, discard supernatant, dry pellet, resuspend in 750 L of 10 mM Tris, pH 7.5. Quantify both RNA and DNA using spectrophotometer.
A-
104
AP
-4
AT
-215
AT
3085RO
C76-16
Exp27-1516
Exp3-1114
Florida
07
Flavor R
unner 458
Georgia G
reen
Georgia
03L
Tifrunner
VC
-2
York
28S18S
A-
104
AP
-4
AT
-215
AT
3085RO
C76-16
Exp27-1516
Exp3-1114
Florida
07
Flavor R
unner 458
Georgia G
reen
Georgia
03L
Tifrunner
VC
-2
York
Soybea
n Sunflow
er
Canol
a
Oil
radish
Pean
ut
# Sample ID Concentration Unit A260 A280 260/280 260/230 Type1 Soybean 483.3 ng/µl 9.667 5.113 1.89 1.78 DNA2 Sunflower 323.4 ng/µl 6.468 3.524 1.84 1.87 DNA3 Canola 256.5 ng/µl 5.13 2.791 1.84 1.71 DNA4 Oil Radish 231.1 ng/µl 4.623 2.48 1.86 1.53 DNA5 Peanut 128.3 ng/µl 2.565 1.396 1.84 2.2 DNA
Nanodrop Readings
Oil Seeds Genomic DNA
Soybea
n Sunflow
er
Canol
a
Oil
radish
Pean
ut
28S18S
# Sample ID Concentration Unit A260 A280 260/280 260/230 Type1 Soybean 475.6 ng/µl 11.89 5.713 2.08 2.17 RNA2 Sunflower 486.2 ng/µl 12.156 5.856 2.08 2.17 RNA3 Canola 451 ng/µl 11.274 5.441 2.07 2.17 RNA4 Oil Radish 405.9 ng/µl 10.148 4.933 2.06 2.08 RNA5 Peanut 487.2 ng/µl 12.179 6.046 2.01 2.07 RNA
Oil Seeds RNA
60 bp
Soybea
n Sunflow
er
Canol
a
Oil
radish
Pean
ut
No R
T
Control
60S (L19) PCR
# Sample ID Concentration Unit A260 A280 260/280 260/230 Type1 A-104 468.9 ng/µl 11.722 5.752 2.04 2.04 RNA2 AP-4 479.4 ng/µl 11.984 5.893 2.03 2.05 RNA3 AT-215 463.6 ng/µl 11.589 5.74 2.02 2.02 RNA4 AT3085RO 468.1 ng/µl 11.701 5.682 2.06 2.13 RNA5 C76-16 446.8 ng/µl 11.171 5.423 2.06 2.10 RNA6 Exp27-1516 401.4 ng/µl 10.035 5.015 2.00 2.01 RNA7 Exp3-1114 374.5 ng/µl 9.364 4.695 1.99 1.97 RNA8 Florida 07 471.8 ng/µl 11.794 5.835 2.02 2.04 RNA9 Flavor Runner 458 416.8 ng/µl 10.421 5.215 2.00 2.01 RNA
10 Georgia Green 487.2 ng/µl 12.179 6.046 2.01 2.07 RNA11 Georgia 03L 456.9 ng/µl 11.424 5.648 2.02 2.00 RNA12 Tifrunner 428.6 ng/µl 10.714 5.32 2.01 1.95 RNA13 VC-2 435 ng/µl 10.875 5.438 2.00 2.05 RNA14 York 469.3 ng/µl 11.732 5.772 2.03 2.00 RNA
Peanut RNA
# Sample ID Concentration Unit A260 A280 260/280 260/230 Type1 A-104 175.1 ng/µl 3.501 1.947 1.8 2.02 DNA2 AP-4 81.6 ng/µl 1.633 0.885 1.84 2.07 DNA3 AT-215 229.1 ng/µl 4.583 2.503 1.83 2.13 DNA4 AT3085RO 267.7 ng/µl 5.355 2.924 1.83 2.30 DNA5 C76-16 163.5 ng/µl 3.269 1.783 1.83 2.08 DNA6 Exp27-1516 146.7 ng/µl 2.934 1.601 1.83 2.28 DNA7 Exp3-1114 264.8 ng/µl 5.296 2.883 1.84 2.33 DNA8 Florida07 181 ng/µl 3.621 1.983 1.83 2.34 DNA9 Flavor Runner 458 145.5 ng/µl 2.91 1.603 1.81 1.97 DNA
10 Georgia Green 130 ng/µl 2.599 1.421 1.83 2.16 DNA11 Georgia 03L 125 ng/µl 2.499 1.369 1.83 1.99 DNA12 Tifrunner 268.5 ng/µl 5.371 2.935 1.83 2.29 DNA13 VC-2 134.4 ng/µl 2.687 1.449 1.85 2.25 DNA14 York 163.1 ng/µl 3.263 1.831 1.78 1.90 DNA
Peanut DNA
150 bp
A-
104
AP
-4
AT
-215
AT
3085RO
C76-16
Exp27-1516
Exp3-1114
Florida
07
Flavor R
unner 458
Georgia G
reen
Georgia
03L
Tifrunner
VC
-2
York
No R
T
Control
Actin PCR
Nanodrop Readings
Nanodrop Readings
Nanodrop Readings
