Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences:...
Transcript of Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences:...
![Page 1: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/1.jpg)
GGF Summer School 24th July 2004, Italy
Middleware for in silico Biology
Professor Carole GobleUniversity of Manchesterhttp://www.mygrid.org.uk
![Page 2: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/2.jpg)
GGF Summer School 24th July 2004, Italy
Vision: CollaboratoryA collaboratory is
…a center without walls, in which the nation's researchers can perform their research without regard to geographical location, interacting with colleagues, accessing instrumentation, sharing data and computational resources, and accessing information in digital libraries
William Wulf, 1989U.S. National Science Foundation
![Page 3: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/3.jpg)
GGF Summer School 24th July 2004, Italy
Vision: The Grid
Grid computing has emerged as an important new field, distinguished from conventional distributed computing by its focus on large-scale resource sharing, innovative applications, and, in some cases, high-performance orientation...we [define] the "Grid problem”…as flexible, secure, coordinated resource sharing among dynamic collections of individuals, institutions, and resources - what we refer to as virtual organizations
From "The Anatomy of the Grid: Enabling Scalable Virtual Organizations" by Foster, Kesselman and Tuecke
![Page 4: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/4.jpg)
GGF Summer School 24th July 2004, Italy
Knowledge workers, fluid communities
• Capturing, generating, gathering, integrating, sharing, processing, analysing, weeding, cleaning, correlating, archiving, retiring knowledge
• Much of it not theirs & not of their creation
• Much of it destined for others
• Know-how as important as know-what
• Know-why, when, where, who as important
![Page 5: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/5.jpg)
GGF Summer School 24th July 2004, Italy
Roadmap• Part 1
– Application context• Part 2
– Architecture– Information and
Workflows– Semantics and
provenance• Part 3
– Wrap up
![Page 6: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/6.jpg)
GGF Summer School 24th July 2004, Italy
myGrid is an EPSRC funded UK eScience Program Pilot Project
Particular thanks to the other members of the Taverna project, http://taverna.sf.net
![Page 7: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/7.jpg)
GGF Summer School 24th July 2004, Italy
Application TestbedsGrave’s Disease• Simon Pearce and Claire Jennings, Institute of Human
Genetics School of Clinical Medical Sciences, University of Newcastle
• Autoimmune disease of the thyroid • Discover all you can about a gene: Affymetrix microarray
analysis, Gene annotation• Services from Japan, Hong Kong, various sites in UK
Williams-Beuren Syndrome• Hannah Tipney, May Tassabehji, Andy Brass, St Mary’s Hospital,
Manchester, UK• Microdeletion of 155 Mbases on Chromosome 7• Characterise an unknown gene: Gene alerting service, gene and
protein annotation • Services from USA, Japan, various sites in UK
Trypanosomiasis in cattle• Steve Kemp, University of Liverpool, UK• Annotation pipelines and Gene expression analysis Services
from USA, Japan, various sites in UK
![Page 8: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/8.jpg)
GGF Summer School 24th July 2004, Italy
Point, click, cut, paste
ID MURA_BACSU STANDARD; PRT; 429 AA.DE PROBABLE UDP-N-ACETYLGLUCOSAMINE 1-CARBOXYVINYLTRANSFERASEDE (EC 2.5.1.7) (ENOYLPYRUVATE TRANSFERASE) (UDP-N-ACETYLGLUCOSAMINEDE ENOLPYRUVYL TRANSFERASE) (EPT).GN MURA OR MURZ.OS BACILLUS SUBTILIS.OC BACTERIA; FIRMICUTES; BACILLUS/CLOSTRIDIUM GROUP; BACILLACEAE;OC BACILLUS.KW PEPTIDOGLYCAN SYNTHESIS; CELL WALL; TRANSFERASE.FT ACT_SITE 116 116 BINDS PEP (BY SIMILARITY).FT CONFLICT 374 374 S -> A (IN REF. 3).SQ SEQUENCE 429 AA; 46016 MW; 02018C5C CRC32;
MEKLNIAGGD SLNGTVHISG AKNSAVALIP ATILANSEVT IEGLPEISDI ETLRDLLKEIGGNVHFENGE MVVDPTSMIS MPLPNGKVKK LRASYYLMGA MLGRFKQAVI GLPGGCHLGPRPIDQHIKGF EALGAEVTNE QGAIYLRAER LRGARIYLDV VSVGATINIM LAAVLAEGKTIIENAAKEPE IIDVATLLTS MGAKIKGAGT NVIRIDGVKE LHGCKHTIIP DRIEAGTFMI
Slide courtesy of GSK
![Page 9: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/9.jpg)
GGF Summer School 24th July 2004, Italy
Life Sciences: knowledge generation
• Informational Science
• Large Scale• Distributed• No one organisation
owns it all• Integrating across
scales, models, types, communities
• Small groups drawing on pooled resources
![Page 10: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/10.jpg)
GGF Summer School 24th July 2004, Italy
Data deluge, processing bottleneck
1990 2000 2010
ESTs
Combinatorial Chemistry
Human Genome
PharmacogenomicsMetabolic Pathways
Computational Load
Genome Data
Moores Law
![Page 11: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/11.jpg)
GGF Summer School 24th July 2004, Italy
Union of lots of small experiments
...atcgaattccaggcgtcacattctcaattcca...billions
DNA sequencesalignments
MPMILGYWDIRGLAHAIRLLLEYTDSSYEEKKYT...
Proteinssequence
2º structure3º structure
Hundredthousands
Protein-ProteinInteractions
metabolismpathwaysreceptor-ligand
4º structuremillions
billions
Polymorphismand Variants
genetic variantsindividual patientsepidemiology
PhysiologyCellular biologyBiochemistryNeurobiologyEndocrinologyetc.
millions
millions
ESTsExpression patternsLarge-scale screens
Genetics and MapsLinkageCytogeneticClone-based
![Page 12: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/12.jpg)
GGF Summer School 24th July 2004, Italy
What data do I get?
• Descriptive as well as numeric
• Literature• Analogy/
knowledge-based
![Page 13: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/13.jpg)
GGF Summer School 24th July 2004, Italy
The bottleneck is not computationIts integration
![Page 14: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/14.jpg)
GGF Summer School 24th July 2004, Italy
Williams-Beuren Syndrome Microdeletion
**
Chr 7 ~155 Mb
~1.5 Mb7q11.23
GTF2I
RFC2
CYLN2
GTF2IRD1
NCF1
WBSCR1/E1f4H
LIMK1
ELN
CLDN4
CLDN3
STX1A
WBSCR18
WBSCR21
TBL2
BCL7B
BAZ1B
FZD9
WBSCR5/LAB
WBSCR22
FKBP6
POM121
NOLR1
GTF2IRD2
C-c
en
C-m
id
A-c
en
B-m
id
B-c
en
A-m
id
B-te
l
A-te
l
C-te
l
WBSCR14
WBS
SVAS
STA
G3
PMS2
L
Block A
FKB
P6T
POM
121
NO
LR1
Block C
GTF
2IP
NC
F1P
GTF
2IR
D2P
Block B
Patient deletions
CTA-315H11 CTB-51J22Gap
Physical Map
![Page 15: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/15.jpg)
GGF Summer School 24th July 2004, Italy
WBS Workflows:
GenBank Accession No
GenBank Entry
Seqret
Nucleotide seq (Fasta)
GenScanCoding sequence
ORFs
prettyseq
restrict
cpgreport
RepeatMasker
ncbiBlastWrapper
sixpack
transeq
6 ORFs
Restriction enzyme map
CpG Island locations and %
Repetative elements
Translation/sequence file. Good for records and publications
Blastn Vs nr, est databases.
Amino Acid translation
epestfind
pepcoil
pepstats
pscan
Identifies PEST seq
Identifies FingerPRINTS
MW, length, charge, pI, etc
Predicts Coiled-coil regions
SignalPTargetPPSORTII
InterProPFAMPrositeSmart
Hydrophobic regions
Predicts cellular location
Identifies functional and structural domains/motifs
Pepwindow?Octanol?
ncbiBlastWrapper
URL inc GB identifier
tblastn Vs nr, est, est_mouse, est_human databases.Blastp Vs nr
RepeatMasker
Query nucleotide sequence ncbiBlastWrapper
Sort for appropriate Sequences only
Pink: Outputs/inputs of a servicePurple: Taylor-made servicesGreen: Emboss soaplab services Yellow: Manchester soaplab services Grey: Unknowns
RepeatMasker
Interoperability
![Page 16: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/16.jpg)
GGF Summer School 24th July 2004, Italy
The problem
Two major steps:• Extend into the gap: Similarity searches; RepeatMasker, BLAST• Characterise the new sequence: NIX, Interpro, etc…
• Numerous web-based services (i.e. BLAST, RepeatMasker)• Cutting and pasting between screens• Large number of steps• Frequently repeated – info now rapidly added to public databases• Don’t always get results• Time consuming• Huge amount of interrelated data is produced – handled in lab book and
files saved to local hard drive• Mundane• Much knowledge remains undocumented• Bioinformatician does the analysis
![Page 17: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/17.jpg)
GGF Summer School 24th July 2004, Italy
Classical Approach to the Bioinformatics
Data Analysis - MicroarrayImport microarray data to Affymetrix data Mining Tool, Run Analyses and select
Experiment Design to test HypothesesFind restriction sites and design primers by eye for genotyping experiments
Study Annotations for many different Genes
Select Gene and Visually examine SNPS lying within
![Page 18: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/18.jpg)
GGF Summer School 24th July 2004, Italy
The Graves’ Disease Scenario
Microarray dataStorage + analysis
Annotation Pipeline
Gene & SNPCharacterisation
Experimental Design
![Page 19: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/19.jpg)
GGF Summer School 24th July 2004, Italy
Experiment life cycle
Discovering and reusing
experiments and resources
Managing lifecycle, provenance and
results of experiments
Sharingservices &
experiments
Personalisation
Forming experiments
Executing and monitoring
experiments
The Grid is a technology; the scientist wants a solution.
![Page 20: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/20.jpg)
GGF Summer School 24th July 2004, Italy
Scientists…• …Experiment
• Can workflow be used as an experimental method?• How many times has this experiment been run?
• …Analyze• How do we manage the results to draw conclusions from
them?
• …Collaborate• Can we share workflows, results, metadata etc?
• …Publish• Can we link to these workflows and results from our papers?
• …Review• Can I find, comprehend and review your work?• How was that result derived?
![Page 21: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/21.jpg)
GGF Summer School 24th July 2004, Italy
![Page 22: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/22.jpg)
GGF Summer School 24th July 2004, Italy
Service Registration
![Page 23: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/23.jpg)
GGF Summer School 24th July 2004, Italy
Portal
![Page 24: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/24.jpg)
GGF Summer School 24th July 2004, Italy
![Page 25: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/25.jpg)
GGF Summer School 24th July 2004, Italy
![Page 26: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/26.jpg)
GGF Summer School 24th July 2004, Italy
![Page 27: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/27.jpg)
GGF Summer School 24th July 2004, Italy
Status reporting
![Page 28: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/28.jpg)
GGF Summer School 24th July 2004, Italy
![Page 29: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/29.jpg)
GGF Summer School 24th July 2004, Italy
![Page 30: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/30.jpg)
GGF Summer School 24th July 2004, Italy
Results displayed using Cinema
![Page 31: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/31.jpg)
GGF Summer School 24th July 2004, Italy
WBS Life Cycle• Wrap services as web services• Register them• Build a workflow using the services• Evolve the workflow• Run it over and over again in case
data has changed• Record results & provenance• Inspect and compare results &
provenance• Set up event notification to fire the
workflow• Set up a portal to run the workflow• Publish the workflow template in a
registry to share with the world
![Page 32: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/32.jpg)
GGF Summer School 24th July 2004, Italy
Delivering resultsWilliam-Beuren Syndrome • Cuts down the time taken to perform one pipeline from 2
weeks to 2 hours• Much more systematic collection and analysis. More
regularly undertaken. Less boring. Less prone to mistakes.
• Once notification installed won’t even have to initiate it.• Possible lead already found – but I can’t tell you.
• Benchmark: first run though of two iterations of workflows– Reduced gap by 267 693 bp at its centrmeric end– Correctly located all seven known genes in this region– Identified 33 of the 36 known exons residing in this location
![Page 33: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/33.jpg)
GGF Summer School 24th July 2004, Italy
Delivering results• Easy to get started with Taverna• Sharing happens
– IPR issues, and suspicions still abound• Network effect necessary and happens
• Managed the transition from generic middleware development to practical day to day useful services.
• Architecture is solid. • SOA – good idea
![Page 34: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/34.jpg)
GGF Summer School 24th July 2004, Italy
![Page 35: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/35.jpg)
GGF Summer School 24th July 2004, Italy
Virtual organisations
ServiceProviders
Bioinformaticians
BiologistsAnnotation providers
Tool & middleware developers
Service & PlatformAdministrators
Service InformationWorkflow
Registries mIRs Resources
Reuse
![Page 36: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/36.jpg)
GGF Summer School 24th July 2004, Italy
Collaborative e-Science• High level services for e-Science
experimental management;– Provenance– Event notification– Personalisation
• Sharing knowledge and sharing components– Scientific discovery is personal &
global.– Federated third party registries for
workflows and services– Workflow and service discovery for
reuse and repurposing
Registry
Register
Find
Annotate
![Page 37: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/37.jpg)
GGF Summer School 24th July 2004, Italy
Roadmap• Part 1
– Application context• Part 2
– Architecture– Information and
Workflows– Semantics and
provenance• Part 3
– Wrap up
![Page 38: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/38.jpg)
GGF Summer School 24th July 2004, Italy
Key Characteristics• Data Intensive, Up stream analysis• Pipelines - experiments as workflows (chiefly)• Adhoc exploratory investigative workflows for
individuals from no particular a priori community• Openness – the services are not ours.• Low activation energy, incremental take on• Foundations for sharing knowledge and sharing
experimental objects• Multiple stakeholders• Collection of components for assembly
![Page 39: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/39.jpg)
GGF Summer School 24th July 2004, Italy
Openness• Openness
– open source– open world of services– open extensible technology– open to wider eScience context– open to user feedback– open to third party metadata
![Page 40: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/40.jpg)
GGF Summer School 24th July 2004, Italy
Putting the user first User-driven end to end scenarios essentialWhole solution that fits with themUsers vs Machines (vs Interesting computer science)
– Mismatch for information needs• Scufl instead of BPEL/WSFL• Layers of Provenance• Service/workflow descriptions for PEOPLE not just machines• Bury complexity, increasingly simplify
– Bioinformaticans HARDLY EVER want to have their services automatically selected
• Except SHIMs, Replicas, User specified equivalences
Service providers and developers are users too!
![Page 41: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/41.jpg)
GGF Summer School 24th July 2004, Italy
In a nutshell• Bioinformatics toolkit• Open (Web) Services
– myGrid components and external domain services
– Publication, discovery, interoperation, composition, decommissioning of myGrid services
– No control or influence over domain service providers
• Metadata Driven– LSIDs, Common information model,
Ontologies, Semantic Web technologies
• Open extensible architecture– Assemble your own components– Designed to work together– Loosely coupled
Freefluo
WfEE
TavernaWfDE
ViewUDDIregistry
EventNotification
mIR
PedroSemanticDiscoveryFeta
Info.Model Soaplab
Gowlab
Gateway & CHEFPortal
LSID
HaystackProvenanceBrowser
![Page 42: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/42.jpg)
GGF Summer School 24th July 2004, Italy
Platform• Standards based• (Web) Service Oriented Architecture
– Publication, discovery, interoperation, composition, decommissioning of myGrid services
– Web services communication fabric– XML document types– LSIDs for identifying resources
• Implemented in Java using Axis and Tomcat– WS-I -> OGSA / WSRF
• Metadata driven– RDF-coded metadata– OWL-coded ontologies– Common information model
![Page 43: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/43.jpg)
GGF Summer School 24th July 2004, Italy
Stakeholders
myGrid users
biologists IS specialists
infrequentproblem specific bioinformaticians
tool builders
serviceprovider
systemsadministrators
bioinformaticstool builders
• Middleware for • Tool Developers • Bioinformaticians• Service Providers• Biologists are
indirectly supported by the portals and apps these develop.
annotators
![Page 44: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/44.jpg)
GGF Summer School 24th July 2004, Italy
Collections of Tasks
Finding
Description ServiceDiscovery
Enactment
BuildingWorkflow
Provenance
Storage
DataManagement
Querying
DomainTasks Service
Providers
Bioinformaticians
Scientists
Annotation providers
![Page 45: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/45.jpg)
GGF Summer School 24th July 2004, Italy
Investigation = set of experiments + metadata
• Experimental design components
• Experimental instances that are records of enacted experiments
• Experimental glue that groups and links design and instance components
• Life Science IDs, URIs, RDF
![Page 46: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/46.jpg)
GGF Summer School 24th July 2004, Italy
Experimental entities
![Page 47: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/47.jpg)
GGF Summer School 24th July 2004, Italy
Web Service (Grid Service) communication fabricWeb Service (Grid Service) communication fabric
AMBITText Extraction
Service
Provenance Mgt Event NotificationService
e-Science Mediator
Feta Service & WFDiscovery
Information Repository
Ontology Mgt
Metadata Store
TavernaWorkbench
Haystack
Native Web Services
SoapLab
Web Portal
Legacy apps
UDDIRegistries
Ontologies
FreeFluo Workflow Enactment Engine
OGSA-DQPDistributed Query Processor
Bio
info
rmat
icia
nsTo
ol P
rovi
ders
Ser
vice
Pro
vide
rsA
pplicationsC
ore servicesE
xternal servicesmyGrid Service Stack
Views
Legacy apps
GowLab
LSID Launch pad
LSIDAuthority
![Page 48: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/48.jpg)
GGF Summer School 24th July 2004, Italy
Service stack
Tavernaworkbench
Web Service (Grid Service) communication fabricWeb Service (Grid Service) communication fabric
AMBITText Extraction
Service
Native Web Services
SoapLab
Legacy apps
App
sC
ore
serv
ices
Ext
erna
l se
rvic
es
Websites
GowLab
Web PortalLSID Launch Pad Haystack
e-Science Mediator
e-Science process patterns
Service & workflow discovery
Metadata management
Data management
e-Science event bus
Workflow enactment
!
!
!
!
![Page 49: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/49.jpg)
GGF Summer School 24th July 2004, Italy
20,000 feet
FreefluoWorkflowEngine
LSID Authority
UDDI
mIRmetadata
Store Service
Provenance andData browser
Haystack or Portal
Web services, local toolsUser interaction etc.
TavernaWorkbench
ViewService
SemanticDiscovery
& Registration
Event Notification Service
mIRdata
![Page 50: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/50.jpg)
GGF Summer School 24th July 2004, Italy
e-Science Mediator1. Application oriented: directly supports the e-
Scientist by: • providing pre-configured e-Science processes templates (i.e.
system-level workflows)• helping in capturing and maintaining context information (via the
information model) that is relevant to the interpretation and sharing of the results of the e-science experiments.
• Facilitating personalisation and collaboration
2. Middleware oriented: contributes to the synergy between myGrid services by:
• Acting as a sink for e-Science events initiated by myGrid components• Interpreting the intercepted events and triggering interactions with
other related components entailed by the semantics of those events• Compensating for possible impedance mismatches with other
services both in terms of data types and interaction protocols
![Page 51: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/51.jpg)
GGF Summer School 24th July 2004, Italy
Supporting the e-scientist
• Recurring use-cases can be captured
• Then corresponding process templates can be authored
• e-science mediator makes processes available to the user
launch semantic Search facility
Find WorkflowUse-case
Launch workflowEditor for selected WF
Enable MIR browser For storage with context
Find an interesting workflow for experiment
Create exp. Context for this user
Find WorkflowProcess
Examine and modify if necessary
Store to personal repositoryFor later re-use
![Page 52: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/52.jpg)
GGF Summer School 24th July 2004, Italy
• E-Science process templates maintained by the mediator can derive the GUI generation and interaction with the user
E-Science Mediator
GUI
![Page 53: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/53.jpg)
GGF Summer School 24th July 2004, Italy
Mediating between servicesExample: mediation during a workflow execution
E-Science Mediator
MIR
1: Execution started[*]3: intermediate process completed6: workflow completed
2: Establish experiment/user context[*]4: link process trace to context7: get WF results
[*]5: Store intermediate process trace8: Store WF results
WF Enactor
NotificationService
9: notify WF completion to subscribers
![Page 54: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/54.jpg)
GGF Summer School 24th July 2004, Italy
Simplified Architecture
MIRService Registry WF EnactorNotification
Service
E-Science Mediator Service
E-Science Mediator client-stubs
GUI (e-science workbench)
Con
text
pre
serv
ed v
ia
myG
ridIn
orm
atio
nM
odel
Client-side e-science
process logic
Server-side e-science
process logic
The The GridGrid
Client SideClient Side
![Page 55: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/55.jpg)
GGF Summer School 24th July 2004, Italy
Event notification Service• Publish/subscribe
model– Topic based (cf.
JMS topics, CORBA channels)
– Hierarchic topics– Persistent event
storage– Subscription leases– Federation for
scalability & reliability
– Event filtering
http://cvs.mygrid.org.uk/notification-stable/downloads
![Page 56: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/56.jpg)
GGF Summer School 24th July 2004, Italy
Portal toolkit for bioinformaticians
• Target application– Williams-Beuren Syndrome– Fixed set of workflows
• Extra myGrid portlets– Configurable– Workflow enactment– Workflow scheduling– Completion notification– Results browsing
• Based on CHEF & Jetspeed-1– Portlets for team collaboration
Portlet Container
InterfaceInterfaceInterface
Portlet PortletPortlet
![Page 57: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/57.jpg)
GGF Summer School 24th July 2004, Italy
Text Services
User Client
Medline Server (Sheffield)
Swissprot/Blast record
Workflow Server
WorkflowEnactment
ExtractPubMed Id
Get MedlineAbstract
Initial Workflow
Cluster Abstracts
Get Related Abstracts
Medline: pre-processed offline to extract biomedical terms + indexed
XScufl workflow definition+ parameters
Clustered PubMed Ids+ titles
PubMed Ids
PubMed Ids
Term-annotatedMedline abstracts
MedlineAbstracts
![Page 58: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/58.jpg)
GGF Summer School 24th July 2004, Italy
Roadmap• Part 1
– Application context• Part 2
– Architecture– Information and
Workflows– Semantics and
provenance• Part 3
– Wrap up
![Page 59: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/59.jpg)
GGF Summer School 24th July 2004, Italy
Information Model v2myGrid components form a loosely coupled systemAn Information Model for e-Science experiments
Based on CCLRC scientific metadata modelXML messages between services conform to the IMv2
1..*0..* uses
1
0..*
contains
10..*selected studies
0..*1method
0..*
0..*
acts in
10..*labBooks
scmInvestigator1 0..*has participants 10..* participates in
0..*
1
uses
method1 0..*has instances
AgenExperimentInst
LabBookV
+name:Stri+rule:String
SubjecObjec
Resources.Reso
+getId:URIString
ProgrammeReso
+name:String
<<Resource>>Study
+name:String+description:Stri+startTime:Date+endTime:DateT+status:String
Programm
<<Resource>>Operations.Ope
<<Resource>ExperimentDe
Investigat
<<Resource>>PeopleAndTeams.P
StudyRole
+roleName:Str+description:S
Agen<<Resource>
StudyParticip
Domain specific
Domain neutral
http://cvs.mygrid.org.uk/cgi-bin/viewcvs.cgi/mygrid/MIR/model/Nick Sharman, Nedim Alpdemir, Justin Ferris, Mark Greenwood, Peter Li, Chris Wroe, The myGrid Information Model, Proc UK e-Science 2nd
All Hands Meeting, Nottingham, UK 1-3 Sept 2004.
![Page 60: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/60.jpg)
GGF Summer School 24th July 2004, Italy
Information Model v2myGrid components form a loosely coupled systemAn Information Model for e-Science experiments
Based on CCLRC scientific metadata modelXML messages between services conform to the IMv2
Domain specific
Domain neutralResources and Ids
People, teams and organizations
Scientific data and the Life Science Identifier
Types, Identifier Types, Values and Documents
Provenance information
Annotation and Argumentation
Molecular BiologyBioinformatics
e-Science process, experimental methods
![Page 61: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/61.jpg)
GGF Summer School 24th July 2004, Italy
Layered Semantics• Domain Semantics layered on top of domain neutral but
scientific data model• Reducing the activation energy, lowering barriers of
entry.
Workflow metadata
Provenance metadataService Metadata
Data Metadata
Syntax
Domain SemanticsOntologies
WorkflowOGSA-DQP
FormatXSD typesMIME types
Experiment SemanticsIMv2
![Page 62: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/62.jpg)
GGF Summer School 24th July 2004, Italy
Experimental entities
1..*0..* uses
1
0..*
contains
0..*1method method
1 0..*has instances
0..*
0..*researchFocus
0..*
1
uses
10..*1
0..*
initiat
10..*labBooks
scmInvestigato1 0..has participants
selected studies
<<Resource>>Operations.Operatio
Annotation.SemanticConce
SubjectObject
Resources.Resourc
+getId:URIString
ProgrammeResourc
+name:String
<<Resource>>Study
+name:String+description:String+startTime:DateTime+endTime:DateTime+status:String
AgentExperimentInstanc
Investigation
<<Resource>>ExperimentDesig
Programme
LabBookView
+name:String+rule:String
![Page 63: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/63.jpg)
GGF Summer School 24th July 2004, Italy
View over the MIR
![Page 64: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/64.jpg)
GGF Summer School 24th July 2004, Italy
Life Science IDs• Each database on the web has:
– Different policies for assigning and maintaining identifiers, dealing with versioning etc.
– Different mechanism for retrieving an item given an ID.
• Life Science IDs designed to harmonise the retrieval of data.
• Emerging standard for bioinformatics– I3C, OMG Life Sciences Group, W3C
• Defines:– URN for life science resources– SOAP (and other) interfaces for LSID assignment,
T. Clark, S. Martin & T. Liefeld: Globally distributed object identification for biologicalknowledge bases, Briefings in Bioinformatics Vol 5 No 1 pp 59-70, March 2004
![Page 65: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/65.jpg)
GGF Summer School 24th July 2004, Italy
What is an LSID?urn:lsid:AuthorityID:NamespaceID:ObjectID:[
RevisionID]
urn:lsid:ncbi.nlm.nig.gov:GenBank:T48601:2urn:lsid:ebi.ac.uk:SWISS-PROT.accession:P34355:3
urn:lsid:rcsb.org:PDB:1D4X:22
• LSID Designator: A mandatory preface that notes that the item being identified is a life science-specific resource
• Authority Identifier: An Internet domain owned by the organization that assigns an LSID to a resource
![Page 66: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/66.jpg)
GGF Summer School 24th July 2004, Italy
LSID Properties
• Unique authority for each identifier• Multiple resolution services, supporting:
– Data retrieval – data immutable: data returned for a given LSID must always be the same
• caches
– Metadata retrieval – mutable and resolver-specific
• annotation services. More on this in Part 4
• Resolution discovery service– Implemented over DNS/DDNS (Optional)
• Authority commitment: must alwaysmaintain an authority at e.g. pdb.org that can point to data and metadata resolvers.
![Page 67: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/67.jpg)
GGF Summer School 24th July 2004, Italy
How is data retrieved?
Application
LSID client
1. Get me info for:urn:lsid:pdb.org:1AFT
PDB Authority@ pdb.org
PDB Data resolver
PDB Metadata resolver
PDB database
2. Where can I get data and metadata for urn:lsid:pdb.org.1AFT
2. Get me the data and metadata for:urn:lsid:pdb.org:1AFT
![Page 68: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/68.jpg)
GGF Summer School 24th July 2004, Italy
LSID Components• IBM built client and
server implementations in Perl, Java, C++
• Straightforward to wrap an existing database as a source of data or metadata
• Client simple to use• LSID Launchpad
adds LSID resolution to Internet Explorer
http://www-124.ibm.com/developerworks/oss/lsid/
![Page 69: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/69.jpg)
GGF Summer School 24th July 2004, Italy
Use within myGrid• Needed an identifier for our own
experimental resources– workflows, experiments, new data results etc
• All and everything identified with LSIDs• LSID saves us having to invent our own
conventions and code.• Can pass references to data around and be
reassured the other party will know how to resolve that reference
• Resolution services:– Data: myGrid Information Repository (MIR)– Metadata: myGrid Metadata Store (RDF-based)
![Page 70: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/70.jpg)
GGF Summer School 24th July 2004, Italy
Information Access
Metadata Store
Data store
LSID interface
LSID aware client
Query
RDF aware client
Taverna/Freefluo
MIRMetadata Store
RDF MIRData store
XML
Publish interface
data
metadata
XML aware client
Query
![Page 71: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/71.jpg)
GGF Summer School 24th July 2004, Italy
EnactorServices
LSID AssigningService
Store plug-in
Metadata plug-in MetadataStore
mIR
Workflowdesign User
context
LSID MetadataResolver
LSID DataResolver
LSIDAuthority
Client application
Metadata
Data
LSIDs
Requests
1. Data sent/ received from services
2. New LSIDsassigned to data
3. Data / Metadata stored
4. Data and metadata retrieved
LSID Assignment
![Page 72: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/72.jpg)
GGF Summer School 24th July 2004, Italy
• Every entry has Dublin Core provenance attributes
• Every entry can have (multiple) ontology expressions
• Multiple mIRs
Information Storage• The MIR data store• Stores experimental
components– Workflow specs as
XML Scufl docs– Data, XML notes– Types: XML docs,
Relational
![Page 73: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/73.jpg)
GGF Summer School 24th July 2004, Italy
Metamodel for Types• Necessary to identify the type and format
of each datum of interest so that it can (only) be input to type-compatible viewers, services and workflows.
• Can’t fix this – working in an open world. There are many established, de facto and locally preferred types & formats. Define common bio-types a fool’s errand.
![Page 74: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/74.jpg)
GGF Summer School 24th July 2004, Italy
Intermediate Results
![Page 75: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/75.jpg)
GGF Summer School 24th July 2004, Italy
• Taverna/FreefluoWfEE agnostic about the data flowing through it.
• As objects progress through tagged with terms from ontologies, free text descriptions and MIME types, and which may contain arbitrary collection structures.
• Using the metadata hints we can locate and launch pluggable view
Results Management
![Page 76: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/76.jpg)
GGF Summer School 24th July 2004, Italy
![Page 77: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/77.jpg)
GGF Summer School 24th July 2004, Italy
Results Amplification
One input
Many outputs
• Automated annotation workflows produce lots of heterogeneous data
• The workflows changed how scientist works.
• Before: analyse results as go along• After: all results, all the analysis, in one
go• Intermediate results management and
associated provenance management essential
• Domain specific visualisation
![Page 78: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/78.jpg)
GGF Summer School 24th July 2004, Italy
![Page 79: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/79.jpg)
GGF Summer School 24th July 2004, Italy
Domain Services• Native WSDL Web
services– DDBJ, NCBI BLAST,
PathPort• BioMOBY Web services
– Single function stereotype• Wrapped legacy services
– Stateful interaction stereotype
– One button wrapping– SoapLab for command-line
tools– GowLab for screen scraped
web pages
For each applicationCreateJobRunWaitForGetResultsDestroy
![Page 80: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/80.jpg)
GGF Summer School 24th July 2004, Italy
Domain Services• Lots of them ~ 300• Open world: we don’t own them• Many produce text not numbers• Many are unique, single site• Need lots of genuine redundant
replica services• Unreliable and unstable
– Research level software– Reliant on other peoples servers
• Services in the wild rare -significant time to wrapapplications as web services (licensing, installation,
Domain Services in WBS
• Repeatmasker• NCBI_BLAST• Modified BLAST• GenScan• PSORTII• iPSORT• TargetP• Various EMBOSS
services• InterProScan• BLAST2• NIX• TESS• TWINSCAN• Alibaba2
![Page 81: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/81.jpg)
GGF Summer School 24th July 2004, Italy
Can you guess what it is yet?
![Page 82: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/82.jpg)
GGF Summer School 24th July 2004, Italy
SHIM Services
Main Bioinformatics Applications
Main Bioinformatics
Services
Main Bioinformatics
Application
Main Bioinformatics
Application
SHIM Services
• Explicitly capturing the process
• Unrecorded ‘steps’ which aren’t realised until attempting to build something
• Services that enable domain services to fit together
![Page 83: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/83.jpg)
GGF Summer School 24th July 2004, Italy
• Freefluo workflow enactment engine–Processor & event observer pluginsupport
• Taverna development and execution environment
–Workbench, workflow editor, tool plug-in support
• http://taverna.sourceforge.net• Simple conceptual unified flow language (XScufl) wraps up units of
Workflow development and enactment
![Page 84: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/84.jpg)
GGF Summer School 24th July 2004, Italy
tree structure explorer
graphical diagram
Results in enactor invocation window
service palette shows a range of operations which can be used in the composition of a workflow
![Page 85: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/85.jpg)
GGF Summer School 24th July 2004, Italy
Workflow environment• Taverna API acts as an
intermediate layer between user level applications and workflow enactors such as
FreeFluo.• Includes object models using
a standard MVC design for both workflow definitions and
data objects within a workflow • Implicit iteration and data flow
• Data sets and nested flows• Configurable failure handling
• Life Science ID resolution
![Page 86: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/86.jpg)
GGF Summer School 24th July 2004, Italy
Scufl-Taverna-FreeFluo• SCUFL - Simple Conceptual
Unified Flow Language• Started with WSFL …
SCUFL provides a much higher level view on workflows, and therefore simpler and more user-focused.
• Simple – relies upon an inherently connected environment to reduce the
tit f i f ti
![Page 87: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/87.jpg)
GGF Summer School 24th July 2004, Italy
Scufl• Conceptual – one
Processor in a SCUFL workflow maps as far as is possible to one conceptual operation as viewed by a non expert user– Wrap up stateful
service interactions into custom Processor implementations
– Lowers the barrier
Freefluo Workflow Enactor Core
Scufl languageparser
Processor Processor
WebService
Soaplab
Processor
LocalApp
Processor
Enactor
TavernaWorkbench
Processor
BioMOBY
![Page 88: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/88.jpg)
GGF Summer School 24th July 2004, Italy
Scufl• Unified Flow
Language – SCUFL does not dictate how the workflow is to be enacted, it is inherently declarative in intent.
• Can potentially be translated to other workflow languages.
• Can be arbitrarily abstract any given
Freefluo Workflow Enactor Core
Scufl languageparser
Processor Processor
WebService
Soaplab
Processor
LocalApp
Processor
Enactor
TavernaWorkbench
Processor
BioMOBY
![Page 89: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/89.jpg)
GGF Summer School 24th July 2004, Italy
• One input, three outputs and eight processors.
• All the processors are labeled top to bottom with input ports, processor name and output ports.
• All the processors here are standard WSDL-described standard web services except for
![Page 90: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/90.jpg)
GGF Summer School 24th July 2004, Italy
![Page 91: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/91.jpg)
GGF Summer School 24th July 2004, Italy
Enactor
Workflowscript
Failure policy
Alternates list
Metadatatemplate
MIRData Store
MIRMetadata
Store
LSIDLSID + Data
LSIDs + Metadata
ExternalData Store
LSID
Data
Services
Event Notification
Service
Invocation + Data
Events
Service Discovery
Workflow In and Outs
![Page 92: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/92.jpg)
GGF Summer School 24th July 2004, Italy
Fault tolerance• Failure of workflow
engine– P2P architecture– XML serialisation– Checkpointing
• Failure of services or network– User defined retry
policy– Alternate replicas– Alternate list
• Automatic choices for domain services
Alternate Processor
Retry, delay and backoff configuration
![Page 93: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/93.jpg)
GGF Summer School 24th July 2004, Italy
scheduled andwaiting for data
dataready
typesmatch data mismatchcan
iterate
invoking
success
complete
constructingiterator
error timeout
retriesleft
alternateavailable
service failure
creatingalternateprocessor
aborted
aborted
doneiterating
invoking withimplicit iteration
successerror timeout
adding item to result data set
retriesleft
aborted
instantiation error
waiting toretry
waiting toretry
allowpartials
Fault tolerance
![Page 94: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/94.jpg)
GGF Summer School 24th July 2004, Italy
Status reporting
![Page 95: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/95.jpg)
GGF Summer School 24th July 2004, Italy
Whither BPEL?
• Focus: scripting simple request/response services vs. choreographing business processes
• Complexity: Scufl is simple enough for bioinformaticians to develop workflows
• Generality: Extensible processor support vs. Web Services only
• Provenance generation
![Page 96: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/96.jpg)
GGF Summer School 24th July 2004, Italy
What needs to be done
• Free-standing web service• Long-running workflows
– Computationally-intensive services– Access to a reliable high performance BLAST service
that reflects NCBI Blast – NCBioGrid? • Scalability
– Large documents – data staging• Debugging environment – services / workflows
are brittle.• Interactivity
– Version 1 had user proxy as an actor– The Original Process split into 3 steps:
• Identification of candidate overlapping nucleotide sequences• Characterisation of nucleotide sequence
![Page 97: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/97.jpg)
GGF Summer School 24th July 2004, Italy
OGSA-DQP• Used in Grave’s
Disease• Uses OGSA-DAI
data access services to access individual data resources.
• A single query to access and join data from more than one OGSA-DAI wrapped data resource.
• Supports orchestration of computational as
http://www.ogsa-dai.org.uk/dqp
![Page 98: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/98.jpg)
GGF Summer School 24th July 2004, Italy
Roadmap• Part 1
– Application context• Part 2
– Architecture– Information and
Workflows– Semantics and
provenance• Part 3
– Wrap up
![Page 99: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/99.jpg)
GGF Summer School 24th July 2004, Italy
Finding and selecting services
Activation energy gradientUnregistered services• Scavenging• URLs and Soaplab endpoints
– IntrospectionRegistered services• Word-based searching• Semantic annotation for later
discovery and (re)use by friends and strangers in your VO (Part 3)
Drag and drop services onto Taverna workbench
![Page 100: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/100.jpg)
GGF Summer School 24th July 2004, Italy
Registry View Service• Registry• Third party registries• Third party services• Third party annotation
(RDF)• Views over federated
registries• UDDI interfaces
extended with RDF• Federated views
– Updated via Notification Service
– Personalized based on Annotation
• Authorisation and IPR
![Page 101: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/101.jpg)
GGF Summer School 24th July 2004, Italy
Semantic discovery• User chooses services• A common ontology is
used to annotate and query any myGrid object including services.
• Discover workflows and services described in the registry via Taverna.
• Look for all workflows that accept an input of semantic type nucleotide sequence
• Aim to have semantic discovery over public view on the Web.
![Page 102: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/102.jpg)
GGF Summer School 24th July 2004, Italy
Workflow and service annotation
• Adding structured metadata to a workflow registration to enable others to discover and reuse it more effectively. E.g. what semantic type of input does it accept.
![Page 103: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/103.jpg)
GGF Summer School 24th July 2004, Italy
Can you guess what it is yet?
![Page 104: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/104.jpg)
GGF Summer School 24th July 2004, Italy
Service Registrationhttp://pedro.man.ac.uk
![Page 105: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/105.jpg)
GGF Summer School 24th July 2004, Italy
Semantic Discovery• Drag a workflow
entry into the explorer pane and the workflow loads.
• Drag a service/ workflow to the scavenger window for inclusion into the workflow
![Page 106: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/106.jpg)
GGF Summer School 24th July 2004, Italy
myGrid and Semantics• Workflow and service discovery
– Prior to and during enactment– Semantic registration
• Workflow assembly– Semantic service typing of inputs and outputs
• Provenance of workflows and other entities• Experimental metadata glue• Use of RDF, RDFS, DAML+OIL/OWL
– Instance store, ontology server, reasoner– Materialised vs at point of delivery reasoning.
• myGrid Information Model
![Page 107: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/107.jpg)
GGF Summer School 24th July 2004, Italy
Annotation
Registryplug-in
Taverna WorkbenchRegistry
(Personalised View)
PedroAnnotation tool
Ontology Store
Vocabulary
Others
WSDLSoap-
lab
ServiceProviders
Description extraction
Ontologists
Registry
Registry
Interface Description
Annotation/description
Annotation providers
![Page 108: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/108.jpg)
GGF Summer School 24th July 2004, Italy
Annotation
Storeplug-in
Taverna Workbench
PedroAnnotation tool
Annotation providers
Ontology Store
Vocabulary
Ontologists
Annotation/description
mIR
HaystackProvenance
Browser
Scientists
![Page 109: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/109.jpg)
GGF Summer School 24th July 2004, Italy
Taverna WorkbenchRegistry
(Personalised View)
Registry
Ontology Store
Vocabulary OthersWSDL
Soap-lab
ServiceProviders
Ontologists
Registryplug-in
Registry
Registry
FetaSemantic Discovery
FreeFluoWfEE
WorkflowExecution
Bioinformaticians
mIRStore data &metadata
invoking
Fetaplug-in
![Page 110: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/110.jpg)
GGF Summer School 24th July 2004, Italy
Layered Semantics• Domain Semantics layered on top of domain neutral but
scientific data model• Reducing the activation energy, lowering barriers of
entry.
Workflow metadata
Provenance metadataService Metadata
Data Metadata
Syntax
Domain SemanticsOntologies
WorkflowOGSA-DQP
FormatXSD typesMIME types
Experiment SemanticsIMv2
![Page 111: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/111.jpg)
GGF Summer School 24th July 2004, Italy
Operation
name, descriptiontaskmethodresourceapplication
Service
namedescriptionauthororganisation
Parameter
name, descriptionsemantic typeformattransport typecollection typecollection format
Model of services
WSDL based Web service
WSDL basedoperation
Soaplab servicebioMoby serviceworkflow
hasInput
hasOutput
Local Java code
subclasssubclass
![Page 112: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/112.jpg)
GGF Summer School 24th July 2004, Italy
Bioinformatics ontology
Web serviceontology
Task ontology
Publishingontology
Informatics ontology
Molecularbiology ontology
Organisationontology
Upper levelontology
Service Ontology Suiteparameters: input, output, precondition, effectperforms_taskuses-resourceis_function_of Inspired by DAML-S
Current work: Joint development on an Open Biological OntologiesBioService Ontology. http://obo.sourceforge.net/
![Page 113: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/113.jpg)
GGF Summer School 24th July 2004, Italy
Workflow metadataThree stages in lifecycle:
1. Workflow creation• Service discovery
2. Workflow resolution• Service selection
3. Workflow harmonization• Reconciling parameters• Format transformations• Invocation and
harmonization
getSomeResults(job)Getting output data
run(job)Running the job
set_query_sequence(query, job)
simpleSearch(program, database, query)
Setting input data
set_database(database, job)
Configuring the service
createEmptyJob()n/aCreating a job
Soaplab BLAST service
DBJ BLAST service
Stage of invocation
![Page 114: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/114.jpg)
GGF Summer School 24th July 2004, Italy
BLASTBLASTBLASTservice
Sequence similarity
search
createJob()
setProgram()
run()
getResults()
setDatabase()
setE_value()
blastQuery()
or
IBM Life Sciences service
SOAPLAB service
Task Service class Specific services
Classes of servicesDomain “semantic”“Unexecutable”“Potentials”
Instances of servicesBusiness “operational”“Executable”“Actuals”
Tiered specifications
![Page 115: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/115.jpg)
GGF Summer School 24th July 2004, Italy
Stratified metadata• Service Type and Class (OWL)
• Service Instance (RDF)
![Page 116: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/116.jpg)
GGF Summer School 24th July 2004, Italy
Seven types of service metadata
Conceptual
Configuration
Operational
Provenance
Invocation model
Interface
Data format
![Page 117: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/117.jpg)
GGF Summer School 24th July 2004, Italy
Service and Workflow registration
• Description scheme
• RDFS & DAML+OIL / OWL ontologies of services & biology
• Based on DAML-S• Reasoning over
OWL descriptions• Query over RDF• Aim to have
semantic discovery over public view on the web.
Workflow registryentry
OperationalDescriptionsCost, QoS
Access rights…
OperationalDescriptionsCost, QoS
Access rights…
WorkfllowExecutive Summary
DescriptionsInputs,
Outputs,Tasks,
Component resources
Syntacticdescriptions
e.g. MIME types
Invokable Interface descriptions
e.g. XML data types
Invokable Interface descriptions
e.g. XML data types
ConceptualdescriptionsConceptual
descriptions
RDF
OWL
OWL/RDF
RDF Store
stored
encoded
ScuflURI
ProvenanceDescriptions
Authors, creation date,
institution…
ProvenanceDescriptions
Authors, creation date,
institution…
WSDL
Workflow registration allows peer review and publication of e-Science methods.
![Page 118: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/118.jpg)
GGF Summer School 24th July 2004, Italy
Reflections• Multiple
descriptions, multiple interfaces– Users needs – Machine needs
• The dimensions of Service Class substitution– Biologists choose experimentally meaningful services
and do not want “semantically similar” substitutions; only substituting one instance for another
– Experimentally neutral “glue” services that can be substituted are comparatively few
![Page 119: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/119.jpg)
GGF Summer School 24th July 2004, Italy
Reuse and Repurposing• Describing for reuse is challenging
– Reuse depends on semantic descriptions and these are costly to produce
– Describing for someone else’s benefit– Reuse by multiple stakeholders
• Licensing workflows for reuse.• Authorisation models• But reuse does happen!• Metadata pays off but it needs a network
effect and there is a cost.
![Page 120: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/120.jpg)
GGF Summer School 24th July 2004, Italy
So far, Using Concepts• Controlled vocabulary for advertisements
for workflows and services• Indexes into registries and mIR
– Semantic discovery of services and workflows– Semantic discovery of repository entries
• Type management for composition– Semantic workflow construction: guidance
and validation• Navigation paths between data and
knowledge holdings– Semantic “glue” between repository entries– Semantic annotation and linking of workflow
provenance logs
![Page 121: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/121.jpg)
GGF Summer School 24th July 2004, Italy
Provenance
Experiments being performed repeatedly, at different site, different time, by different users or groups;
Scientists
In silico experiments:
A large repository of records about experiments!!•verification of data;• “recipes” for experiment designs;• explanation for the impact of changes;• ownership;• performance of services;• data quality;
![Page 122: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/122.jpg)
GGF Summer School 24th July 2004, Italy
Provenance Web
serviceInvocation1
serviceInvocation2
data1
data2 data3
data4
Process provenance
WSDL
Data provenanceOrganisation provenance
dataAnother
Knowledge provenance
GenomicProject
![Page 123: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/123.jpg)
GGF Summer School 24th July 2004, Italy
Representing links
• Identify each resource– Life science identifier: URI with associated
data and metadata retrieval protocols.– Understanding that underlying data will not
change
urn:lsid:taverna.sf.net:datathing:45fg6 urn:lsid:taverna.sf.net:datathing:23ty3
![Page 124: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/124.jpg)
GGF Summer School 24th July 2004, Italy
Representing links II
• Identify link type– Again use URI– Allows us to use RDF infrastructure
• Repositories• Ontologies
urn:lsid:taverna.sf.net:datathing:45fg6 urn:lsid:taverna.sf.net:datathing:23ty3
http://www.mygrid.org.uk/ontology#derived_from
![Page 125: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/125.jpg)
GGF Summer School 24th July 2004, Italy
Provenance Pyramid
Knowledge Level
Organisation Level
Data Level
Process Level
![Page 126: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/126.jpg)
GGF Summer School 24th July 2004, Italy
Workflow run
Workflow design
Experiment design
Project
Person
Organisation
Process
Service
Event
Data item
Data itemData item
data derivation e.g. output data derived from input data
knowledge statementse.g. similar protein sequence to
instanceOf
partOf componentProcesse.g. web service invocation of BLAST @ NCBI
componentEvente.g. completion of a web service invocation at 12.04pm
runBye.g. BLAST @ NCBI
run for
Organisation level provenance Process level provenance
Data/ knowledge level provenance
User can add templates to each workflow process to determine links between data items.
![Page 127: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/127.jpg)
GGF Summer School 24th July 2004, Italy
19747251 AC005089.3831Homo sapiens BAC
clone CTA-315H11 from 7, complete sequence15145617 AC073846.6
815Homo sapiens BAC
clone RP11-622P13 from 7, complete sequence15384807 AL365366.20
46.1Human DNA sequence
from clone RP11-553N16 on chromosome 1, complete sequence7717376 AL163282.2
44.1Homo sapiens
chromosome 21 segment HS21C08216304790 AL133523.5
44.1Human chromosome
14 DNA sequence BAC R-775G15 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence34367431 BX648272.1
44.1Homo sapiens mRNA;
cDNA DKFZp686G08119 (from clone DKFZp686G08119)5629923 AC007298.17
44.1Homo sapiens 12q22
BAC RPCI11-256L6 (Roswell Park Cancer Institute Human BAC Library) complete sequence34533695 AK126986.1
44.1Homo sapiens cDNA
FLJ45040 fis, clone BRAWH302048620377057 AC069363.10
44.1Homo sapiens
chromosome 17, clone RP11-104J23, complete sequence4191263 AL031674.1
44.1Human DNA sequence
from clone RP4-715N11 on chromosome 20q13.1-13.2 Contains two putative novel genes, ESTs, STSs and GSSs, complete sequence17977487 AC093690.5
44.1Homo sapiens BAC
clone RP11-731I19 from 2, complete sequence17048246 AC012568.7
44.1Homo sapiens
chromosome 15, clone RP11-342M21, complete sequence14485328 AL355339.7
44.1Human DNA sequence
from clone RP11-461K13 on chromosome 10, complete sequence5757554 AC007074.2
44.1Homo sapiens PAC
clone RP3-368G6 from X, complete sequence4176355 AC005509.1
44.1Homo sapiens
chromosome 4 clone B200N5 map 4q25, complete sequence2829108 AF042090.1
44.1Homo sapiens
chromosome 21q22.3 PAC 171F15, complete sequence
>gi|19747251|gb|AC005089.3| Homo sapiens BAC clone CTA-315H11 from 7, complete sequenceAAGCTTTTCTGGCACTGTTTCCTTCTTCCTGATAACCAGAGAAGGAAAAGATCTCCATTTTACAGATGAGGAAACAGGCTCAGAGAGGTCAAGGCTCTGGCTCAAGGTCACACAGCCTGGGAACGGCAAAGCTGATATTCAAACCCAAGCATCTTGGCTCCAAAGCCCTGGTTTCTGTTCCCACTACTGTCAGTGACCTTGGCAAGCCCTGTCCTCCTCCGGGCTTCACTCTGCACACCTGTAACCTGGGGTTAAATGGGCTCACCTGGACTGTTGAGCG
urn:lsid:taverna:datathing:15
..BLAST_Report
rdf:type
urn:lsid:taverna:datathing:13
..similar_sequences_to
.. nucleotide_sequence
rdf:type
service invocation
..created_by
workflow invocation
workflow definition
experiment definition
project
person
group
service description
organisation
..described_by
..run_during
..invocation_of
..part_of
..works_for
..part_of
..part_of
..author
..author
..run_for
A B
..masked_sequence_of
..filtered_version_of
Relationship BLAST report has with other items in the repository
Other classes of information related to BLAST report
Provenance tracking
• Automated generation of this web of links
• Workflow enactor generates– LSIDs– Data derivation links– Knowledge links– Process links– Organisation links
![Page 128: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/128.jpg)
GGF Summer School 24th July 2004, Italy
Haystack (IBM/MIT)GenBank
record
Portion of the Web of
provenance
Managing collection of
sequences for review
![Page 129: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/129.jpg)
GGF Summer School 24th July 2004, Italy
![Page 130: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/130.jpg)
GGF Summer School 24th July 2004, Italy
Reflections• Visualisation of results usually domain
specific• Provenance browsing and querying needs
to fit with that visualisation• Generic graphical presentation limited to
small, low complexity result sets• Layered provenance for different purposes
and different stakeholders– Detailed process for debugging and usage
statistics for QoS– Data and Knowledge for the Scientist
• Migration with data objects
![Page 131: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/131.jpg)
GGF Summer School 24th July 2004, Italy
Map of Context
Literature relevant to provenance
study or data in this workflow
OWL Ontologiesmapping between objects
ExperimentNotes
Interlinking graph of the workflow that generates the provenance logs
Web page of people who has related interests as the owner of the workflow
Provenance record of a workflow run
RDF
HTML
XML
XML
PDFLSID
XML
LSID
URI
![Page 132: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/132.jpg)
GGF Summer School 24th July 2004, Italy
Provenance metadata• Outside objects
– RDF store
• Within objects– LSID metadata.
LSID metadata
URI LSID
LSID URI
![Page 133: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/133.jpg)
GGF Summer School 24th July 2004, Italy
Linked Provenance ResourcesThe subsumed
concepts
The subsuming concepts
Link to the log annotated with more general concept
Link to the log annotated with more specific concept
![Page 134: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/134.jpg)
GGF Summer School 24th July 2004, Italy
Generating Links
The generated Link to related provenance
document
The concept
The name of the data
![Page 135: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/135.jpg)
GGF Summer School 24th July 2004, Italy
SemanticsOntology-aided
workflow construction
Ontology-aided workflow
construction
• RDF-based service and data registries
• RDF-based metadata for ALL experimental components
• RDF-based provenance graphs
• OWL based controlled vocabularies for database content
• OWL based integration of experiment
RDF-based semantic mark up of results, logs, notes, data
entries
RDF-based semantic mark up of results, logs, notes, data
entries
![Page 136: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/136.jpg)
GGF Summer School 24th July 2004, Italy
Role of Ontologies
Composing and validating workflows and service compositions & negotiations
Describing & Linking Provenance records
Change & event Notification topics
Ontologies
Resource annotations
Service & resource registration & discovery
Schema mediation
Controlling contents of metadata and dataKnowledge-based guidance
and recommendation
Service matching and provisioning
Help
![Page 137: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/137.jpg)
GGF Summer School 24th July 2004, Italy
RDF in a nutshell• Resource Description Framework• W3C candidate recommendation
(http://www.w3.org/RDF)• Graphical formalism ( + XML syntax +
semantics)– for representing metadata– for describing the semantics of information in a
machine- accessible way• RDFS extends RDF with “schema vocabulary”,
e.g.:– Class, Property– type, subClassOf, subPropertyOf– range, domain
• Statements are <subject, predicate, object> triples:
Ian UlihasColleague
![Page 138: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/138.jpg)
GGF Summer School 24th July 2004, Italy
W3C Web Ontology language OWL
• The Ontology Language de jour
• Continuum of expressivity– Concepts, roles, individuals,
axioms– From simple frames to
description logics– Sound and complete formal
semantics• Supports reasoning to infer
classification– Based on the SHIQ description
logic • Eas(ier) to extend and evolve
d l i
http://www.w3.org/TR/2004/REC-owl-features-20040210/
![Page 139: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/139.jpg)
GGF Summer School 24th July 2004, Italy
A pioneer of the…
The Semantic Grid is an extension of the current Grid in which information and services are given well-defined and explicitly represented meaning, better enabling computers and peopleto work in cooperation
Semantics in and on the Grid
![Page 140: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/140.jpg)
GGF Summer School 24th July 2004, Italy
The semantics of knowledge
• Semantic Grids– Grids and Grid middleware that makes
use of semantics for its installation, deployment, running etc.
– I.e. Semantics IN the Grid FOR the Grid.
• Knowledge Grids– A virtual knowledge base derived by
using the Grid resources, in the same spirit as a data grid is a virtual data resource and a compute grid a virtual computer. Knowledge Grids include services for knowledge mining. I e Semantics ON the Grid arising from
![Page 141: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/141.jpg)
GGF Summer School 24th July 2004, Italy
Roadmap• Part 1
– Application context• Part 2
– Architecture– Information and
Workflows– Semantics and
provenance• Part 3
– Wrap up
![Page 142: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/142.jpg)
GGF Summer School 24th July 2004, Italy
Key Characteristics• Data Intensive, Up stream analysis• Pipelines - experiments as workflows (chiefly)• Adhoc exploratory investigative workflows for
individuals from no particular a priori community• Openness – the services are not ours.• Low activation energy, incremental take-on• Foundations for sharing knowledge and sharing
experimental objects• Multiple stakeholders• Collection of components for assembly
![Page 143: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/143.jpg)
GGF Summer School 24th July 2004, Italy
Discovering and reusing
experiments and resources
Managing lifecycle, provenance and
results of experiments
Sharingservices &
experiments
Personalisation
Forming experiments
Executing and monitoring
experiments
Soaplab
![Page 144: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/144.jpg)
GGF Summer School 24th July 2004, Italy
Putting the user first User-driven end to end scenarios essentialWhole solution that fits with themUsers vs Machines (vs Interesting computer science)
– Mismatch for information needs• Scufl instead of BPEL/WSFL• Layers of Provenance• Service/workflow descriptions for PEOPLE not just machines• Bury complexity, increasingly simplify
– Bioinformaticans HARDLY EVER want to have their services automatically selected
• Except SHIMs, Replicas, User specified equivalences
Service providers and developers are users too!
![Page 145: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/145.jpg)
GGF Summer School 24th July 2004, Italy
Security• Single sign-on to myGrid services• Credentials mapping to external services (though most
are open and free)• Policy-driven authorization• Solutions?
– PERMIS, Shibboleth, WS-Security, XACML, SAML– FAME/PERMIS, SAM
![Page 146: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/146.jpg)
GGF Summer School 24th July 2004, Italy
Reuse• Describing for reuse is challenging
– Reuse depends on semantic descriptions and these are costly to produce
– Describing for someone else’s benefit– Reuse by multiple stakeholders
• Licensing workflows for reuse.• Authorisation models• But reuse does happen!• Other genomic disorders (e.g. sick cows)• Metadata pays off but it needs a network effect
and there is a cost.
![Page 147: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/147.jpg)
GGF Summer School 24th July 2004, Italy
Personalisation• Dynamic creation of personal data sets.• Personal views over repositories.• Personalisation of workflows. • Personal notification • Annotation of datasets and workflows.• Personalisation of service descriptions – what I think the
service does.
![Page 148: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/148.jpg)
GGF Summer School 24th July 2004, Italy
Standards• By tapping into (defacto) standards (LSID, RDF,
WS-I) and communities we can leverage others results and tools– Haystack, Pedro, Jena, CHEF/Sakai.
• The Grid standards are confusing and volatile– The choice of vanilla Web Services was good.– We didn’t jump to OGSI. We won’t jump to WSRF
until its necessary.• And workflow standards have been untimely.
![Page 149: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/149.jpg)
GGF Summer School 24th July 2004, Italy
Where is the WSRF?
There isn’t any – vanilla Web Services
![Page 150: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/150.jpg)
GGF Summer School 24th July 2004, Italy
Computational processes• Most service are quick pipes• Long running services
– Gene expression clustering service in Hong Kong• parking the data at a URL & notification through polling or
email (GridFTP, event notification, data staging!
– Integrative Biology e-Science pilot follow-on to include simulation services
– High throughput BLAST with NCBI update profile• Stateful interactions
![Page 151: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/151.jpg)
GGF Summer School 24th July 2004, Italy
Observations• Show stoppers for practical adoption are not technical
showstoppers– Can I incorporate my favourite service?– Can I manage the results?
• Service providers are a bottleneck• For every user dedicate a technologist.• Caution against technology push.• Rapid prototyping, deployment, feedback crucial.
![Page 152: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/152.jpg)
GGF Summer School 24th July 2004, Italy
Grid Computing trajectory
CPU scavenging
CPU intensive workload Grid as a utility, data Grids, robust infrastructure Intra-company, intra community
e.g. Life Science Grid
Sharing standard scientific process and data, sharing of common infrastructure
Between trusted partners
Sharing of apps and know-howWith controlled set of unknown clients
Virtual organisations with dynamic access to unlimited resources
For all
time
cost
![Page 153: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/153.jpg)
GGF Summer School 24th July 2004, Italy
AcknowledgementsAn EPSRC funded UK eScience Program Pilot Project
Particular thanks to the other members of the Taverna project, http://taverna.sf.net
![Page 154: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/154.jpg)
GGF Summer School 24th July 2004, Italy
myGrid PeopleCore• Matthew Addis, Nedim Alpdemir, Tim Carver, Rich Cawley, Neil Davis, Alvaro
Fernandes, Justin Ferris, Robert Gaizaukaus, Kevin Glover, Carole Goble, Chris Greenhalgh, Mark Greenwood, Yikun Guo, Ananth Krishna, Peter Li, Phillip Lord, Darren Marvin, Simon Miles, Luc Moreau, Arijit Mukherjee, Tom Oinn, Juri Papay, Savas Parastatidis, Norman Paton, Terry Payne, Matthew PokockMilena Radenkovic, Stefan Rennick-Egglestone, Peter Rice, Martin Senger, Nick Sharman, Robert Stevens, Victor Tan, Anil Wipat, Paul Watson and Chris Wroe.
Users• Simon Pearce and Claire Jennings, Institute of Human Genetics School of
Clinical Medical Sciences, University of Newcastle, UK• Hannah Tipney, May Tassabehji, Andy Brass, St Mary’s Hospital, Manchester,
UK• Steve Kemp, Liverpool, UKPostgraduates• Martin Szomszor, Duncan Hull, Jun Zhao, Pinar Alper, John Dickman, Keith
Flanagan, Antoon Goderis, Tracy Craddock, Alastair HampshireIndustrial • Dennis Quan, Sean Martin, Michael Niemi, Syd Chapman (IBM)• Robin McEntire (GSK)Collaborators• Keith Decker
![Page 155: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/155.jpg)
GGF Summer School 24th July 2004, Italy
http://www.mygrid.org.uk
Tutorialhttp://twiki.mygrid.org.uk/twiki/bin/view/Mygrid/NeSCmyGridTutorial
![Page 156: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/156.jpg)
GGF Summer School 24th July 2004, Italy
Publications• P Lord, C Wroe, R Stevens, CA Goble, S Miles, L Moreau, K Decker, T
Payne, J Papay, Semantic and Personalised Service Discovery in Proceedings IEEE/WIC International Conference on Web Intelligence / Intelligent Agent Technology Workshop on "Knowledge Grid and Grid Intelligence" October 13, 2003, Halifax, Canada.
• J Zhao, CA Goble, M Greenwood, C Wroe, R Stevens Annotating, linking and browsing provenance logs for e-Science in 1st Semantic Web Conference (ISWC2003) Workshop on Retrieval of Scientific Data, Florida, USA, October 2003
• C Wroe, R.D. Stevens, CA Goble, A Roberts, M Greenwood A suite of DAML+OIL ontologies to describe bioinformatics web services and data. International Journal of Cooperative Information Systems. Special issue on Bioinformatics and Biological Data Management 12(2):197-224, 2003.
• C Wroe, CA Goble, M Greenwood, P Lord, S Miles, L Moreau, J Papay, T Payne Experiment automation using semantic data on a bioinformatics Grid, IEEE Intelligent Systems, Jan/Feb 2004
• J Zhao, C Wroe, CA Goble, R Stevens, D Quan, M Greenwood, Using Semantic Web Technologies for Representing e-Science Provenance in Proc 3rd International Semantic Web Conference ISWC2004, Hiroshima, Japan, 9-11 Nov 2004.
• C Wroe, P Lord, S Miles, J Papay, L Moreau, C Goble Recycling Services and Workflows through Discovery and Reuse to appear in Proceedings UK e-Science All Hands Meeting Nottingham, UK, 1-3 September, 2004.
![Page 157: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/157.jpg)
GGF Summer School 24th July 2004, Italy
Publications• T Oinn, M Addis, J Ferris, D Marvin, M Senger, M Greenwood, T Carver, K
Glover, Matthew R. Pocock, A Wipat, P Li. Taverna: A tool for the composition and enactment of bioinformatics workflows accepted for Bioinformatics Journal, 16 June 2004
• T. Oinn, M. Addis, J. Ferris, D. Marvin, M. Greenwood, C. Goble, A. Wipat, P. Li, T. Carver Delivering Web Service Coordination Capability to Users In Thirteenth International World Wide Web Conference (WWW2004) pp. 438-439, New York, May 2004.
• M Addis, J Ferris, M Greenwood, D Marvin, P Li, T Oinn and A WipatExperiences with eScience workflow specification and enactment in bioinformatics, Proceedings of UK e-Science All Hands Meeting 2003, pages 459-467
• M.N. Alpdemir, A. Mukherjee, N.W. Paton, P. Watson, A.A.A. Fernandes, A. Gounaris and J. Smith Service-based Distributed Querying on the Grid in the Proceedings of the First International Conference on Service Oriented Computing, 15-18, December 2003 Trento, Italy. Springer.
• J. Smith, A. Gounaris, P. Watson, N.W. Paton, A.A.A. Fernandes and RizosSakellariou Distributed Query Processing on the Grid in International Journal of High Performance Computing Applications, Volume 17, Issue 04,November 2003
![Page 158: Middleware for in silico Biology · GGF Summer School 24th July 2004, Italy Life Sciences: knowledge generation • Informational Science • Large Scale • Distributed • No one](https://reader033.fdocuments.us/reader033/viewer/2022043017/5f39f6343c241b3d711ce289/html5/thumbnails/158.jpg)
GGF Summer School 24th July 2004, Italy
Publications• R. Stevens, H.J. Tipney, C. Wroe, T. Oinn, M. Senger, P. Lord, C.A. Goble, A. Brass
and M. Tassabehji Exploring Williams-Beuren Syndrome Using myGrid to appear in Proceedings of 12th International Conference on Intelligent Systems in Molecular Biology, 31st Jul-4th Aug 2004, Glasgow, UK.
• C.A. Goble, S. Pettifer, R. Stevens and C. Greenhalgh Knowledge Integration: In silico Experiments in Bioinformatics in The Grid: Blueprint for a New Computing Infrastructure Second Edition eds. Ian Foster and Carl Kesselman, 2003, Morgan Kaufman, November 2003.
R. Stevens, A. Robinson, and C.A. Goble myGrid: Personalised Bioinformatics on the Information Grid in proceedings of 11th International Conference on Intelligent Systems in Molecular Biology, 29th June–3rd July 2003, Brisbane, Australia, published Bioinformatics Vol. 19 Suppl. 1 2003, pp302-304.