microRNA-29 fine-tunes the expression of key FOXA2 ... · 1 microRNA-29 fine-tunes the expression...

1

microRNA-29 fine-tunes the expression of key FOXA2-activated lipid metabolism genes

and is dysregulated in animal models of insulin resistance and diabetes

Short running title: A role for miR-29 in hepatic lipid metabolism

C. Lisa Kurtz1,!

, Bailey C. E. Peck1,2,!

, Emily E. Fannin1, Carine Beysen

3, Ji Miao

4, Stuart R.

Landstreet5, Shengli Ding

6, Vandana Turaga

1, P. Kay Lund

6, Scott Turner

3, Sudha B. Biddinger

4,

Kasey C. Vickers5 and Praveen Sethupathy

1,2,*

1Department of Genetics, School of Medicine, University of North Carolina at Chapel Hill,

Chapel Hill, NC, USA

2Genetics and Molecular Biology Curriculum, University of North Carolina at Chapel Hill,

Chapel Hill, NC, USA

3KineMed, Inc., Emeryville, CA, USA

4Department of Pediatrics, Boston Children’s Hospital, Boston, MA, USA

5Department of Medicine, School of Medicine, Vanderbilt University, Nashville, TN, USA

6Department of Nutrition, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA

� These authors contributed equally to this work.

* Correspondence should be addressed to:

Praveen Sethupathy, Ph.D.

120 Mason Farm Rd.

5091 Genetic Medicine Bldg.

Chapel Hill, NC 27599-7264

Office: 919-966-6387

Fax: 919-843-4682

[email protected]

Word Count: 3092

Number of Figures: 5

of 55

For Peer Review Only

Diabetes

Diabetes Publish Ahead of Print, published online April 10, 2014

2

Abstract

microRNAs (miRNAs) have emerged as biomarkers of metabolic status, etiological factors in

complex disease, and promising drug targets. Recent reports suggest that miRNAs are critical

regulators of pathways underlying the pathophysiology of type 2 diabetes. In this study, we

demonstrate by deep sequencing and real time quantitative PCR that hepatic levels of Foxa2

mRNA and miR-29 are elevated in a mouse model of diet-induced insulin resistance. We also

show that Foxa2 and miR-29 are significantly up-regulated in the livers of Zucker Diabetic Fatty

(fa/fa) rats and that the levels of both returned to normal upon treatment with the insulin-

sensitizing agent Pioglitazone. We present evidence that miR-29 expression in human hepatoma

cells is controlled in part by FOXA2, which is known to play a critical role in hepatic energy

homeostasis. Moreover, we demonstrate that miR-29 fine-tunes FOXA2-mediated activation of

key lipid metabolism genes, including PPARGC1A, HMGCS2, and ABHD5. These results

suggest that miR-29 is an important regulatory factor in normal metabolism and may represent a

novel therapeutic target in type 2 diabetes and related metabolic syndromes.

of 55


Diabetes

3

Type 2 diabetes is characterized in part by resistance to insulin action in the liver and

other metabolic tissues(1). microRNAs (miRNAs) are widely recognized as important regulators

of a diverse array of biological processes(2), including metabolism(3). Recently, miRNAs have

also emerged as stable plasma biomarkers of physiologic and metabolic status(4; 5), etiological

factors in complex disease(6), and promising therapeutic targets(7; 8). miRNA-mediated gene

regulation occurs principally at the post-transcriptional level and has been the subject of intense

research over the past decade. Several miRNAs have been implicated in the pathobiology of a

variety of metabolic disorders, including type 2 diabetes(9), cardiovascular disease(10), and

obesity(11). Recently, we reported that miR-27b is a post-transcriptional regulatory hub in liver

lipid metabolism and is altered in dyslipidemia(12). Another group of studies demonstrated that

miR-33 modulates lipoprotein metabolism in mice(13-17) and non-human primates(18), as well

as insulin signaling in cultured human hepatocytes(19). And, most recently, both miR-103/107

and miR-802(20) were shown to regulate insulin sensitivity and glucose tolerance in mice(20;

21). These findings strongly support the notion that miRNAs are critical players in pathways that

underlie metabolic disease etiology, thus raising the possibility that miRNA-based therapy could

be relevant for type 2 diabetes and related metabolic syndromes.

miR-29 has been demonstrated to be an important regulator of numerous biological

processes, including neuronal maturation(22), fibrosis(23), hematopoiesis(24), replicative

senescence(25), and immune response(26). Our recent in silico work identified miR-29 as the

strongest candidate miRNA regulatory hub in the type 2 diabetes gene network(27). Other

groups have shown that miR-29 is highly responsive to glucose and may regulate beta cell

proliferation and insulin secretion(28; 29). We sought to investigate miR-29 in the liver, which

is a metabolic tissue of critical relevance to type 2 diabetes etiology.

of 55


Diabetes

4

In this study, we demonstrate that: (1) hepatic miR-29 and Foxa2 mRNA are significantly

up-regulated in two different animal models of insulin resistance; (2) the insulin-sensitizing drug

Pioglitazone corrects hepatic miR-29 and Foxa2 levels in the Zucker Diabetic Fatty (ZDF) rat

model of diabetes; (3) miR-29 levels in hepatocytes are controlled in part by the insulin-

regulated transcription factor FOXA2; and (4) miR-29 fine-tunes FOXA2-mediated regulation of

key lipid metabolism genes. Taken together, our findings implicate miR-29 as an important

regulatory factor for lipid homeostasis, and motivate future studies to investigate the utility of

miR-29 as a tissue biomarker of type 2 diabetes drug efficacy, as well as a potential therapeutic

target in metabolic syndromes.

Research Design and Methods

Animal studies

Female C57BL/6J mice were from a UNC Chapel Hill colony and started at 4 weeks of

age on high-fat diet (D01060502, 45% kcal from fat) or matched low-fat diet (D01060501, 10%

kcal from fat) (Research Diets, New Brunswick, NJ). Livers were isolated after 16 weeks of diet

and RNA was isolated using the Norgen Total RNA Purification kit (Thorold, ON, Canada).

Male Zucker Diabetic Fatty (ZDF) rats (Charles Rivers) were acclimated for two weeks and had

access to a standard chow diet (Lab Diet). Four weeks of Pioglitazone treatment (30 mg/kg/day)

started at 8 weeks of age. Blood was collected once per week during treatment in order to

measure glucose levels. Livers were isolated at 12 weeks of age and RNA was isolated using

TRiZol.

Cell culture

of 55


Diabetes

5

Huh7 cells (human hepatoma) were obtained from Dr. Stanley Lemon’s laboratory at

UNC Chapel Hill. Huh7 cells were maintained in 5 mM glucose DMEM (Sigma-Aldrich, St.

Louis, MO) supplemented with 10% FBS, 2 mM L-glutamine, 1 mM Na-pyruvate and 1X

NEAA (Invitrogen, Grand Island, NY), in 100 mm collagen 1 coated cell culture dishes (Becton-

Dickinson, Bedford, MA). For transfections, cells were split into 6 well collagen 1 coated plates

(Becton-Dickinson) to approximately 70-80% confluency, and allowed 24 hours to adhere. All

cells were cultured in a humidified incubator at 37oC and 5% CO2.

Transfection studies

Huh7 cells were plated on collagen 1 coated 6-well plates (Becton-Dickinson, Bedford,

MA) 1 day before transfection. At ~70-80% confluency, the cells were transfected with either 10

nM miRIDIAN hsa-miR-29a mimic (ThermoScientific; Waltham, MA), 10 nM mmu-miR-29a-

3p LNA inhibitor (Exiqon; Woburn, MA), or 100 nM ON-TARGET plus human siRNA against

FOXA2 (ThermoScientific; Waltham, MA) using either Dharmafect 4 (ThermoScientific;

Waltham, MA) or Lipofectamine 2000 (Life Technologies, Grand Island, NY) transfection

reagent. A human FOXA2 expression vector containing FOXA2 transcript variant 1 in the

pCMV6-XL5 plasmid (Origene, Rockville, MD) was transfected (1ug) using Dharmafect Duo

transfection reagent (ThermoScientific; Waltham, MA). Forty-eight hours after transfection, total

RNA was isolated from the cells using the Total RNA Purification Kit from Norgen (Thorold,

ON, Canada).

Small RNA sequencing analysis

Total RNA was extracted from mouse liver tissue using the Norgen total RNA

purification kit (Norgen; Thorold, ON, Canada). RNA quality was assessed by Agilent 2100

of 55


Diabetes

6

Bioanalyzer, and only very high quality samples with RNA Integrity Number (RIN) above 8.0

were considered further. Small RNA libraries (n=2 for each of HFD-fed and LFD-fed mice) were

generated using the Illumina TruSeq small RNA library preparation kit. These libraries were then

sequenced on the Illumina HiSeq 2000 platform (50 bp reads). miRNA and isomiR

identification and quantitation was performed as described previously(27).

Gene expression (RNA) analysis

Total RNA was isolated from cultured Huh7 cells or mouse liver tissue using the Total

RNA Purification kit (Norgen; Thorold, ON, Canada), and subject to DNase treatment using the

TURBO DNA-free kit (Applied Biosystems; Grand Island, NY). Complementary DNA (cDNA)

was synthesized using either the TaqMan microRNA Reverse Transcription kit (Applied

Biosystems; Grand Island, NY) or the High Capacity RNA to cDNA kit (Applied Biosystems;

Grand Island, NY) according to the manufacturer’s instructions. Real-time PCR amplification

was performed using TaqMan miRNA or gene expression assays in TaqMan Universal PCR

Master Mix (miRNA qPCR) or TaqMan Gene Expression Master Mix (gene expression qPCR)

on a BioRad CFX96 Touch Real Time PCR Detection system (Bio-Rad Laboratories, Inc.,

Richmond, CA). Reactions were performed in triplicate using either U6 (miRNA expression) or

RPS9 (gene expression) as the internal control. miRNA and mRNA levels were expressed as

relative quantitative values (RQVs). All TaqMan assays used in this study where purchased from

Applied Biosystems, Inc. (Grand Island, NY) and include: miR-29a (4427975, 002112), miR-

29b (4427975, 000412), miR-29c (444087, 000587), miR-15a (4427975, 000389), U6 (4427975-

001973), RPS9 (human – 4331182, Hs02339424_g1; mouse – 4331182, Mm00850060_s1),

ABHD5 (4331182, Hs01104373_m1), HMGCS2 (4331182, Hs00985427_m1), G6PC (human –

4331182, Hs00609178_m1; mouse – 4331182, Mm00839363_m1), PPARGC1A (4331182,

of 55


Diabetes

7

Hs01016719_m1), and FOXA2 (human – 4331182, Hs00232764_m1; mouse – 4331182,

Mm01976556_s1; rat – 4331182, Rn0145600_m1).

Western blotting

Protein was isolated forty-eight to seventy-two hours after transfection. RIPA buffer

(Sigma Aldrich, St. Louis, MO), supplemented with complete protease inhibitor (Roche,

Indianapolis, IN), phosphatase inhibitor (ThermoScientific, Waltham, MA), 100 mM PMSF in

100% isopropanol, 0.1% beta-mercaptoethanol (VWR International, Radnor, PA) and 1 M DTT

(Fisher Scientific, Pittsburgh, PA) was used to passively lyse adhered cells. The lysate was

collected and flash frozen before clarification by centrifugation. Protein concentration was

calculated using the Pierce® Microplate BCA Protein Assay Kit – Reducing Agent Compatible

(ThermoScientific, Waltham, MA) and run on an Any kDTM

Mini-Protean TGXTM

precast gel

(Bio-Rad; Hercules, CA). Transfer was conducted using Bio-Rad Midi Transfer Packs on the

Bio-Rad Trans-Blot® Turbo Blotting System. The membranes were blocked in 5% non-fat dry

milk (Sigma-Aldrich, St. Louis, MO) in TBST and probed with 1:800 anti-ABHD5 antibody

(Abnova, Cat# H00051099-M01, Taiwan) in 4% BSA (Applied Biosystems, Cat# AM2616) in

TBST. Goat anti-rabbit secondary antibody (Abcam, Cat# ab131366) was diluted 1:3,000 in 1%

milk/TBST. β-actin peroxidase (Sigma-Aldrich, St. Louis, MO, Cat# A3854) or GAPDH (Cell

Signaling; Danvers, MA, Cat# 8884s) diluted 1:40,000 in 1% milk/TBST were used as controls.

Signal was detected using the Amersham™ ECL™ Prime Western Blotting Detection Reagent

(GE Healthcare Life Sciences; Piscataway, NJ) following manufacturer instructions and exposed

using the LiCor C-DiGit Blot scanner (LiCor, Lincoln, NE). Signal intensity was determined by

densitometry using LiCor Biosciences Image Studio Software.

of 55


Diabetes

8

Reporter gene (Luciferase) assays

Human embryonic kidney 293T (HEK293T) cells were plated at 1x105 cells/mL for 24

hours prior to transient transfection using DharmaFect 4 and 500 ng/mL MT01 Firefly/Renilla

luciferase reporter with the entire 3’ UTR of HMGCS2 cloned immediately downstream of

Firefly luciferase (Genecopoeia). Cells were dual transfected with 10 nM of miR-29a mimic for

48 hours prior to cell lysis and dual luciferase assays (Genecopoeia). Site-directed mutagenesis

was completed using QuickChange II XL kits (Stratagene) and the following primers – Reverse

5'-agccgttgcaccgtcaggcacaggg-3' and Forward 5'-ccctgtgcctgacggtgcaacggct-3'. A 3 base deletion

was created in the middle of the predicted “seed” target site for miR-29

(…tgcctgacggtggtgcaacggctgatgga…).

Bioinformatics

ChIP-seq data for Foxa2 in mouse liver and islet were published previously(30).

Chromatin occupancy sites based on these ChIP-seq data were obtained directly from the lead

author of the study (Brad Hoffman, University of British Columbia). Candidate Foxa2 target

genes in mouse liver and islet were assembled by cross-referencing the chromosomal locations

of Foxa2 occupancy sites with gene promoter regions (defined as windows 5 kb upstream of

transcription start sites as annotated in the RefSeq database). The miR-29ab promoter region was

identified as recently described(31). Target site prediction for miR-29 was performed with

TargetScan 6.2 (downloaded from http://targetscan.org). Statistical enrichment of predicted miR-

29 target sites among Foxa2 target genes in the mouse liver and islet was assessed according to

our recently published method, mirHub(27), using the “non-network” mode and requiring a

predicted target site to be conserved among at least three mammalian species including mouse.

of 55


Diabetes

9

Results

Hepatic miR-29 is up-regulated in animal models of insulin resistance and is corrected by

treatment with the insulin-sensitizing drug Pioglitazone

To determine if hepatic miR-29 levels are altered in the insulin resistant state, we

investigated two different animal models of metabolic dysfunction. First, we studied female

C57BL/6J mice placed on a 16-week high-fat diet (HFD; 45% kcal from fat), which resulted in

significantly elevated (~1.8-fold, P < 0.001) fasting blood glucose levels relative to age-, gender-

, and strain-matched mice on low-fat diet (LFD; 10% kcal from fat) (Figure 1A). We performed

deep sequencing of liver small RNAs and found that miR-29b (~1.8-fold, P < 0.05) and miR-29c

(~1.9-fold, P < 0.001) were significantly elevated in HFD-fed mice (Figure 1B-C,

Supplementary Table 1), matching the fold increase in miR-802 (Figure 1B, Supplementary

Table 1), which was previously identified as a critical mediator of obesity-induced glucose

intolerance(20). To validate this finding, we performed real time quantitative PCR (RT-qPCR)

and confirmed that hepatic levels of miR-29 were significantly increased in HFD-fed mice

(Figure 1D).

Next, we examined the Zucker Diabetic Fatty (ZDF) fa/fa rat model, which closely

mimics human adult onset diabetes(32). We showed that, as expected, fasting blood glucose

levels were significantly elevated (~2.5-fold, P < 0.005) in 12-week old male obese fa/fa rats

compared to age- and gender-matched lean healthy littermates (Figure 2A). We then

demonstrated by RT-qPCR that hepatic miR-29a and miR-29c levels were significantly (P <

0.05) higher for the fa/fa rats compared to the lean littermate controls (Figure 2B). Strikingly, we

also observed that treatment with the insulin-sensitizing drug Pioglitazone for four weeks, which

of 55


Diabetes

10

markedly improved glycemia (Figure 2A), reduced hepatic miR-29 expression to levels

comparable to that of the lean controls (Figure 2B).

Hepatic miR-29 expression is controlled in part by the insulin-regulated transcription factor

FOXA2

To investigate the molecular mechanism(s) that mediate the up-regulation of miR-29 in

insulin resistance, we sought to identify hepatic transcription factors (TFs) regulated by insulin

signaling that could be involved in the control of miR-29 expression. First, we identified the

transcription start sites (TSS) of miR-29a/b-1 (chromosome 7) and miR-29b-2/c (chromosome 1)

in human hepatoma cells (HepG2) by analyzing chromatin data from ENCODE using our

previously described bioinformatic pipeline(31). This strategy revealed that the most proximal

active TSS for miR-29a/b-1 is ~36.5 kb upstream of the mature miR-29a sequence and for miR-

29b-2/c is ~20kb upstream of the mature miR-29c sequence. We scanned these regions for areas

of open chromatin and TF occupancy in HepG2 cells, as determined by ENCODE, and found

>10 binding sites for FOXA2 at the miR-29a/b-1 locus and 4 binding sites at the miR-29b-2/c

locus (Figure 3A). FOXA2 is negatively regulated by insulin(33; 34), and opposes insulin

action(35) by promoting hepatic lipid catabolism and fatty acid oxidation(36). To further support

the finding in HepG2 cells, we mined a recently published TF ChIP-seq dataset from adult

mouse liver(30) and detected Foxa2 chromatin occupancy at the mouse miR-29 promoter regions

(data not shown).

We next performed real time quantitative PCR and observed that hepatic Foxa2 mRNA

levels were increased in both HFD-fed mice (Figure 3B) and diabetic fa/fa rats (P < 0.05; Figure

3C). Moreover, as with miR-29 (Figure 3D), hepatic Foxa2 expression in the fa/fa rats returned

of 55


Diabetes

11

to that of the lean controls upon treatment with Pioglitazone (Figure 3C). To more directly

evaluate the potential for FOXA2 to regulate hepatic miR-29 levels, we performed siRNA-

mediated knockdown of FOXA2 in Huh7 cells. After 48 hours of siRNA treatment, FOXA2

mRNA was significantly reduced (P < 10-12

, Figure 3D). Under these conditions, we observed an

almost 2-fold down-regulation of miR-29a (P < 0.001), miR-29b (P < 0.05), and miR-29c (P <

0.01) (Figure 3D). We also transiently transfected Huh7 cells with a FOXA2 expression vector

(1 ug), which led to a ~172-fold up-regulation in FOXA2 mRNA levels (P < 0.05), and a

concomitant >2-fold increase in miR-29a (P < 0.05), miR-29b (P = 0.06), and miR-29c (P <

0.05). Collectively, these data suggest that the insulin-regulated FOXA2 is a transcriptional

activator of miR-29.

miR-29 fine-tunes FOXA2 mediated regulation of key hepatic lipid metabolism genes

Recent studies of gene regulatory networks (GRNs) indicate that coordinated regulation

by TFs and miRNAs confer robustness against environmental fluctuation(37). We assessed the

extent to which miR-29 is predicted to regulate Foxa2 gene targets in the liver. First, we

assembled a list of high-confidence hepatic target genes for Foxa2 from a published ChIP-seq

study in mouse liver (Methods). We then determined, using our previously published method

mirHub(27), that the Foxa2 mouse liver target gene set was significantly enriched for predicted

miR-29 target sites (Figure 4A). Notably, we did not observe this enrichment among Foxa2

target genes in the mouse pancreatic islet, in which the Foxa2 regulatory network is re-wired

relative to the liver(30) (Figure 4A). To evaluate further the predicted FOXA2-miR-29 feed-

forward circuit, we experimentally tested three specific instances of the circuit with the genes

HMGCS2, ABHD5, and PPARGC1A, which encode proteins that activate the enzymatic

breakdown of fat in the liver(38; 39). The mRNA levels of all three genes in Huh7 cells were

of 55


Diabetes

12

significantly (P < 0.01) increased by the miR-29a locked nucleic acid (LNA) inhibitor and

significantly (P < 0.05) reduced by the miR-29a mimic (Figure 4B). Consistent with this

observation, the protein levels of ABHD5 were also significantly (P < 0.05) up-regulated by the

miR-29a LNA inhibitor after 48 hours (Figure 4C). Also, to determine whether miR-29

regulation of HMGCS2 is mediated through the 3’ UTR, we performed a reporter gene assay

(Methods). Over-expression of the miR-29a mimic (100 nM) in HEK293T cells significantly

reduced (P < 0.01, ~65% loss) relative Firefly luciferase activity when the HMGCS2 3’ UTR was

inserted downstream of the Firefly reporter gene (Figure 4D). Moreover, targeted deletion (3 bp)

of the predicted miR-29 target site in the HMGCS2 3’ UTR substantially mitigated the repressive

effect of miR-29 on Firefly activity (Figure 4D). Finally, siRNA-mediated knockdown of

FOXA2 led to a significant (P < 0.01) decrease in the expression of HMGCS2, ABHD5, and

PPARGC1A (Figure 4E). The latter observation suggests that FOXA2 is the primary driver of

the expression levels of its target genes, whereas miR-29 serves as a feed-forward negative

modulator (Figure 5).

Discussion

This study leveraged in vivo, in vitro, and in silico analyses to uncover a role for miR-29

as a potentially critical regulator of hepatic metabolic pathways. A prior study suggested that

miR-29 is significantly elevated in the livers of the diabetic mouse model db/db(40); however, to

our knowledge this result had not been validated in other models. We showed in this study that

liver miR-29 levels are elevated in two different animal models of metabolic dysfunction, and

notably, are returned to normal levels upon treatment with an insulin sensitizer, Pioglitazone, in

the ZDF diabetic rat. This finding signals the possibility that miRNAs could serve as tissue

biomarkers of drug efficacy in type 2 diabetes.

of 55


Diabetes

13

Two recent miRNA profiling studies reported that type 2 diabetes might be associated

with reduced levels of plasma miR-29(41; 42). We observe in this study that miR-29 is elevated

in the liver of animals with insulin resistance and diabetes. The apparent inverse correlation

between plasma and liver miR-29 levels in type 2 diabetes is intriguing. It is now widely

appreciated that miRNAs are stably present in circulation and are transported by a variety of

different types of extracellular vehicles (EVs), including exosomes and high-density

lipoproteins(43-47). Several studies have shown that numerous cell types secrete miRNAs,

which can then be loaded onto EVs and delivered to recipient cells with functional integrity(48-

50). However, the mechanisms that regulate intercellular miRNA transfer remain poorly

characterized and it represents a nascent but promising topic of research. Progress in this area

will be critical for understanding why liver miR-29 is elevated but plasma miR-29 is reduced in

type 2 diabetes. miR-29 is highly expressed in numerous metabolic tissues, including the

pancreatic islet(27; 51), and the relative contribution of each of these tissues to circulating miR-

29 remains to be determined and merits further investigation.

We also demonstrated in this study that hepatic miR-29 expression is likely controlled at

least in part by the insulin-regulated transcription factor, FOXA2, which contains >10 ChIP-seq

derived binding sites in human hepatoma cells at the miR-29ab genomic locus on chromosome 7

and 4 binding sites at the miR-29bc genomic locus on chromosome 1. The evaluation of the

combinatorial effect of these binding sites on miR-29 transcription is not trivial; however, it

certainly warrants further investigation in order to more definitively establish direct FOXA2-

mediated regulation of miR-29. Moreover, future studies in vivo should establish the extent to

which FOXA2 controls miR-29 during hepatic insulin resistance.

of 55


Diabetes

14

Finally, we showed that miR-29 serves as a dampener of FOXA2-mediated activation of

key lipid metabolism genes. For example, FOXA2 transcriptionally activates HMGCS2, which in

turn is directly repressed by miR-29. It has been postulated that such TF:miRNA regulatory

circuits, termed incoherent feed-forward loops, are likely important for noise buffering of gene

expression(37; 52; 53). Further detailed studies in vivo may help elucidate the physiological

importance of the FOXA2:miR-29 regulatory circuit in lipid homeostasis.

Overall, this study strongly suggests that miR-29 merits further investigation as a

candidate biomarker of metabolic status and drug efficacy, an etiological factor in type 2

diabetes, and a potentially important therapeutic target for a range of metabolic disorders.

of 55


Diabetes

15

Acknowledgements

Praveen Sethupathy is the guarantor of this work and, as such, had full access to all of

the data in the study and takes responsibility for the integrity of the data and the accuracy of the

data analysis. C.L.K. researched data and edited the manuscript. B.C.E.P. researched data and

edited the manuscript. E.E.F. researched data. C.B. researched data. S.D. researched data. V.T.

researched data. S.B. researched data. S.T. researched data. P.K.L. contributed to discussion.

K.C.V. researched data and contributed to the discussion. P.S. researched data, contributed to

discussion, and wrote the manuscript.

The authors would like to thank Michael Erdos of NIH, Samir Kelada and Jeanette

Baran-Gale of UNC Chapel Hill, and Jonathan Haldeman of Duke University for their helpful

suggestions regarding the study and the manuscript, Stanley Lemon of UNC Chapel Hill for

generously sharing Huh7 cells, and Brad Hoffman of the University of British Columbia for

sharing with us the chromatin occupancy sites for FOXA2 in mouse liver and islet based on a

previously published study. This work was supported in part by an R00 grant (DK091318-02)

from NIDDK/NIH (awarded to P.S.), a Pilot & Feasibility grant (NIDDK/NIH P30DK056350)

from the UNC Nutrition Obesity Research Center (awarded to P.S.), a UNC Genetics and

Molecular Biology T32 training grant (GM007092-39) from NIGMS/NIH and UNC IMSD

Fellowship through the Education Program grant (R25GM055336-13) from NIGMS/NIH

(awarded to B.C.E.P.), an R01 grant (RHL109650) from NHLBI/NIH (awarded to S.B.B.), a K99

grant (DK100539) from NIDDK/NIH (awarded to J.M.) a K22 grant (K22HL113039) from

NHLBI/NIH (awarded to K.C.V.), and a grant from the German Federal Ministry of Education

and Research awarded to the German Center for Diabetes Research (P.E.S.). We confirm that no

conflict of interest exists for any of the authors.

of 55


Diabetes

16

References

1. Kadowaki T: Insights into insulin resistance and type 2 diabetes from knockout mouse models.

The Journal of clinical investigation 2000;106:459-465

2. Bartel DP: MicroRNAs: target recognition and regulatory functions. Cell 2009;136:215-233

3. Kim W, Kyung Lee E: Post-transcriptional regulation in metabolic diseases. RNA biology

2012;9:772-780

4. Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, Pogosova-Agadjanyan EL, Peterson

A, Noteboom J, O'Briant KC, Allen A, Lin DW, Urban N, Drescher CW, Knudsen BS, Stirewalt

DL, Gentleman R, Vessella RL, Nelson PS, Martin DB, Tewari M: Circulating microRNAs as

stable blood-based markers for cancer detection. Proceedings of the National Academy of

Sciences of the United States of America 2008;105:10513-10518

5. Karolina DS, Tavintharan S, Armugam A, Sepramaniam S, Pek SL, Wong MT, Lim SC, Sum

CF, Jeyaseelan K: Circulating miRNA Profiles in Patients with Metabolic Syndrome. The

Journal of clinical endocrinology and metabolism 2012;97:E2271-2276

6. Couzin J: MicroRNAs make big impression in disease after disease. Science 2008;319:1782-

1784

7. van Rooij E, Purcell AL, Levin AA: Developing microRNA therapeutics. Circulation research

2012;110:496-507

8. Jackson AL, Levin AA: Developing microRNA therapeutics: approaching the unique

complexities. Nucleic acid therapeutics 2012;22:213-225

9. Fernandez-Valverde SL, Taft RJ, Mattick JS: MicroRNAs in beta-cell biology, insulin

resistance, diabetes and its complications. Diabetes 2011;60:1825-1831

10. Quiat D, Olson EN: MicroRNAs in cardiovascular disease: from pathogenesis to prevention

and treatment. The Journal of clinical investigation 2013;123:11-18

11. Williams MD, Mitchell GM: MicroRNAs in insulin resistance and obesity. Experimental

diabetes research 2012;2012:484696

12. Vickers KC, Shoucri BM, Levin MG, Wu H, Pearson DS, Osei-Hwedieh D, Collins FS,

Remaley AT, Sethupathy P: MicroRNA-27b is a regulatory hub in lipid metabolism and is

altered in dyslipidemia. Hepatology 2013;57:533-542

13. Rayner KJ, Suarez Y, Davalos A, Parathath S, Fitzgerald ML, Tamehiro N, Fisher EA,

Moore KJ, Fernandez-Hernando C: MiR-33 contributes to the regulation of cholesterol

homeostasis. Science 2010;328:1570-1573

14. Najafi-Shoushtari SH, Kristo F, Li Y, Shioda T, Cohen DE, Gerszten RE, Naar AM:

MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science

2010;328:1566-1569

15. Marquart TJ, Allen RM, Ory DS, Baldan A: miR-33 links SREBP-2 induction to repression

of sterol transporters. Proceedings of the National Academy of Sciences of the United States of

America 2010;107:12228-12232

16. Horie T, Ono K, Horiguchi M, Nishi H, Nakamura T, Nagao K, Kinoshita M, Kuwabara Y,

Marusawa H, Iwanaga Y, Hasegawa K, Yokode M, Kimura T, Kita T: MicroRNA-33 encoded

by an intron of sterol regulatory element-binding protein 2 (Srebp2) regulates HDL in vivo.

Proceedings of the National Academy of Sciences of the United States of America

2010;107:17321-17326

17. Rayner KJ, Sheedy FJ, Esau CC, Hussain FN, Temel RE, Parathath S, van Gils JM, Rayner

AJ, Chang AN, Suarez Y, Fernandez-Hernando C, Fisher EA, Moore KJ: Antagonism of miR-33

of 55


Diabetes

17

in mice promotes reverse cholesterol transport and regression of atherosclerosis. The Journal of

clinical investigation 2011;121:2921-2931

18. Rayner KJ, Esau CC, Hussain FN, McDaniel AL, Marshall SM, van Gils JM, Ray TD,

Sheedy FJ, Goedeke L, Liu X, Khatsenko OG, Kaimal V, Lees CJ, Fernandez-Hernando C,

Fisher EA, Temel RE, Moore KJ: Inhibition of miR-33a/b in non-human primates raises plasma

HDL and lowers VLDL triglycerides. Nature 2011;478:404-407

19. Davalos A, Goedeke L, Smibert P, Ramirez CM, Warrier NP, Andreo U, Cirera-Salinas D,

Rayner K, Suresh U, Pastor-Pareja JC, Esplugues E, Fisher EA, Penalva LO, Moore KJ, Suarez

Y, Lai EC, Fernandez-Hernando C: miR-33a/b contribute to the regulation of fatty acid

metabolism and insulin signaling. Proceedings of the National Academy of Sciences of the

United States of America 2011;108:9232-9237

20. Kornfeld JW, Baitzel C, Konner AC, Nicholls HT, Vogt MC, Herrmanns K, Scheja L,

Haumaitre C, Wolf AM, Knippschild U, Seibler J, Cereghini S, Heeren J, Stoffel M, Bruning JC:

Obesity-induced overexpression of miR-802 impairs glucose metabolism through silencing of

Hnf1b. Nature 2013;494:111-115

21. Trajkovski M, Hausser J, Soutschek J, Bhat B, Akin A, Zavolan M, Heim MH, Stoffel M:

MicroRNAs 103 and 107 regulate insulin sensitivity. Nature 2011;474:649-653

22. Kole AJ, Swahari V, Hammond SM, Deshmukh M: miR-29b is activated during neuronal

maturation and targets BH3-only genes to restrict apoptosis. Genes & development 2011;25:125-

130

23. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA,

Olson EN: Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in

cardiac fibrosis. Proceedings of the National Academy of Sciences of the United States of

America 2008;105:13027-13032

24. Han YC, Park CY, Bhagat G, Zhang J, Wang Y, Fan JB, Liu M, Zou Y, Weissman IL, Gu H:

microRNA-29a induces aberrant self-renewal capacity in hematopoietic progenitors, biased

myeloid development, and acute myeloid leukemia. The Journal of experimental medicine

2010;207:475-489

25. Martinez I, Cazalla D, Almstead LL, Steitz JA, DiMaio D: miR-29 and miR-30 regulate B-

Myb expression during cellular senescence. Proceedings of the National Academy of Sciences of

the United States of America 2011;108:522-527

26. Ma F, Xu S, Liu X, Zhang Q, Xu X, Liu M, Hua M, Li N, Yao H, Cao X: The microRNA

miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by

targeting interferon-gamma. Nature immunology 2011;12:861-869

27. Baran-Gale J, Fannin EE, Kurtz CL, Sethupathy P: Beta cell 5'-shifted isomiRs are candidate

regulatory hubs in type 2 diabetes. PloS one 2013;8:e73240

28. Bagge A, Clausen TR, Larsen S, Ladefoged M, Rosenstierne MW, Larsen L, Vang O,

Nielsen JH, Dalgaard LT: MicroRNA-29a is up-regulated in beta-cells by glucose and decreases

glucose-stimulated insulin secretion. Biochemical and biophysical research communications

2012;426:266-272

29. Pullen TJ, da Silva Xavier G, Kelsey G, Rutter GA: miR-29a and miR-29b contribute to

pancreatic beta-cell-specific silencing of monocarboxylate transporter 1 (Mct1). Molecular and

cellular biology 2011;31:3182-3194

30. Hoffman BG, Robertson G, Zavaglia B, Beach M, Cullum R, Lee S, Soukhatcheva G, Li L,

Wederell ED, Thiessen N, Bilenky M, Cezard T, Tam A, Kamoh B, Birol I, Dai D, Zhao Y,

Hirst M, Verchere CB, Helgason CD, Marra MA, Jones SJ, Hoodless PA: Locus co-occupancy,

of 55


Diabetes

18

nucleosome positioning, and H3K4me1 regulate the functionality of FOXA2-, HNF4A-, and

PDX1-bound loci in islets and liver. Genome research 2010;20:1037-1051

31. Sethupathy P: Illuminating microRNA Transcription from the Epigenome. Current genomics

2013;14:68-77

32. Yokoi N, Hoshino M, Hidaka S, Yoshida E, Beppu M, Hoshikawa R, Sudo K, Kawada A,

Takagi S, Seino S: A Novel Rat Model of Type 2 Diabetes: The Zucker Fatty Diabetes Mellitus

ZFDM Rat. Journal of diabetes research 2013;2013:103731

33. Wolfrum C, Besser D, Luca E, Stoffel M: Insulin regulates the activity of forkhead

transcription factor Hnf-3beta/Foxa-2 by Akt-mediated phosphorylation and nuclear/cytosolic

localization. Proceedings of the National Academy of Sciences of the United States of America

2003;100:11624-11629

34. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn

CR, Granner DK, Newgard CB, Spiegelman BM: Control of hepatic gluconeogenesis through

the transcriptional coactivator PGC-1. Nature 2001;413:131-138

35. Puigserver P, Rodgers JT: Foxa2, a novel transcriptional regulator of insulin sensitivity.

Nature medicine 2006;12:38-39

36. Wolfrum C, Stoffel M: Coactivation of Foxa2 through Pgc-1beta promotes liver fatty acid

oxidation and triglyceride/VLDL secretion. Cell metabolism 2006;3:99-110

37. Osella M, Bosia C, Cora D, Caselle M: The role of incoherent microRNA-mediated

feedforward loops in noise buffering. PLoS computational biology 2011;7:e1001101

38. Lord CC, Betters JL, Ivanova PT, Milne SB, Myers DS, Madenspacher J, Thomas G, Chung

S, Liu M, Davis MA, Lee RG, Crooke RM, Graham MJ, Parks JS, Brasaemle DL, Fessler MB,

Brown HA, Brown JM: CGI-58/ABHD5-derived signaling lipids regulate systemic inflammation

and insulin action. Diabetes 2012;61:355-363

39. Vila-Brau A, De Sousa-Coelho AL, Mayordomo C, Haro D, Marrero PF: Human HMGCS2

regulates mitochondrial fatty acid oxidation and FGF21 expression in HepG2 cell line. The

Journal of biological chemistry 2011;286:20423-20430

40. Pandey AK, Verma G, Vig S, Srivastava S, Srivastava AK, Datta M: miR-29a levels are

elevated in the db/db mice liver and its overexpression leads to attenuation of insulin action on

PEPCK gene expression in HepG2 cells. Molecular and cellular endocrinology 2011;332:125-

133

41. Zampetaki A, Kiechl S, Drozdov I, Willeit P, Mayr U, Prokopi M, Mayr A, Weger S,

Oberhollenzer F, Bonora E, Shah A, Willeit J, Mayr M: Plasma microRNA profiling reveals loss

of endothelial miR-126 and other microRNAs in type 2 diabetes. Circulation research

2010;107:810-817

42. Kong L, Zhu J, Han W, Jiang X, Xu M, Zhao Y, Dong Q, Pang Z, Guan Q, Gao L, Zhao J,

Zhao L: Significance of serum microRNAs in pre-diabetes and newly diagnosed type 2 diabetes:

a clinical study. Acta diabetologica 2011;48:61-69

43. Boon RA, Vickers KC: Intercellular transport of microRNAs. Arteriosclerosis, thrombosis,

and vascular biology 2013;33:186-192

44. Vickers KC, Remaley AT: Lipid-based carriers of microRNAs and intercellular

communication. Current opinion in lipidology 2012;23:91-97

45. Turchinovich A, Samatov TR, Tonevitsky AG, Burwinkel B: Circulating miRNAs: cell-cell

communication function? Frontiers in genetics 2013;4:119

46. Arroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard CC, Gibson DF, Mitchell PS, Bennett

CF, Pogosova-Agadjanyan EL, Stirewalt DL, Tait JF, Tewari M: Argonaute2 complexes carry a

of 55


Diabetes

19

population of circulating microRNAs independent of vesicles in human plasma. Proceedings of

the National Academy of Sciences of the United States of America 2011;108:5003-5008

47. Creemers EE, Tijsen AJ, Pinto YM: Circulating microRNAs: novel biomarkers and

extracellular communicators in cardiovascular disease? Circulation research 2012;110:483-495

48. Montecalvo A, Larregina AT, Shufesky WJ, Stolz DB, Sullivan ML, Karlsson JM, Baty CJ,

Gibson GA, Erdos G, Wang Z, Milosevic J, Tkacheva OA, Divito SJ, Jordan R, Lyons-Weiler J,

Watkins SC, Morelli AE: Mechanism of transfer of functional microRNAs between mouse

dendritic cells via exosomes. Blood 2012;119:756-766

49. Mittelbrunn M, Gutierrez-Vazquez C, Villarroya-Beltri C, Gonzalez S, Sanchez-Cabo F,

Gonzalez MA, Bernad A, Sanchez-Madrid F: Unidirectional transfer of microRNA-loaded

exosomes from T cells to antigen-presenting cells. Nature communications 2011;2:282

50. Vickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT: MicroRNAs are

transported in plasma and delivered to recipient cells by high-density lipoproteins. Nature cell

biology 2011;13:423-433

51. van de Bunt M, Gaulton KJ, Parts L, Moran I, Johnson PR, Lindgren CM, Ferrer J, Gloyn

AL, McCarthy MI: The miRNA profile of human pancreatic islets and beta-cells and relationship

to type 2 diabetes pathogenesis. PloS one 2013;8:e55272

52. Tsang J, Zhu J, van Oudenaarden A: MicroRNA-mediated feedback and feedforward loops

are recurrent network motifs in mammals. Molecular cell 2007;26:753-767

53. Siciliano V, Garzilli I, Fracassi C, Criscuolo S, Ventre S, di Bernardo D: miRNAs confer

phenotypic robustness to gene networks by suppressing biological noise. Nature communications

2013;4:2364

of 55


Diabetes

20

Figure Legends

Figure 1. Hepatic miR-29 levels are up-regulated in diet-induced insulin resistance in mice.

(A) Fasting blood glucose levels of C57BL/6J female mice on high-fat diet (HFD 16 weeks;

n=3) and matched low-fat diet (LFD 16 weeks; n=3) are shown. (B) miRNA expression levels

(RPMM, reads per million mapped reads) based on deep sequencing analysis of small RNAs

from the livers of HFD-fed (n=2) and LFD-fed (n=2) C57BL/6J female mice are shown. Each

circle represents a miRNA that is expressed at RPMM > 100 in at least one murine liver sample.

Dashed blue lines represent 1.5-fold difference in expression between HFD-fed and LFD-fed

mice. (C) Relative levels (based on sequencing) of miR-29a, miR-29b, and miR-29c in the livers

of HFD-fed (n=2) and LFD-fed (n=2) C57BL/6J female mice are shown. (D) Relative levels

(based on RT-qPCR) of miR-29a, miR-29b, and miR-29c in the livers of HFD-fed (n=3) and

LFD-fed (n=3) C57BL/6J female mice are shown. P-values were calculated according to the one-

tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 2. Hepatic miR-29 levels are elevated in a rat model of diabetes and corrected by

treatment with the insulin-sensitizing drug Pioglitazone. (A & B) Fasting blood glucose

levels (A) and relative hepatic levels (based on RT-qPCR) of miR-29a, miR-29b, and miR-29c

(B) in 12-week old healthy male rats (n=8), Zucker Diabetic Fatty (ZDF) fa/fa male littermates

(n=11), and Pioglitazone-treated (4 weeks) ZDF fa/fa male rats (n=6) are shown. P-values were

calculated according to the one-tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01; ***, P

< 0.001.

of 55


Diabetes

21

Figure 3. FOXA2 regulates miR-29 expression. (A) FOXA2 occupancy in human hepatoma

cells (HepG2) at the miR-29ab and mir-29b-2/c genomic loci are shown (based on ENCODE

ChIP-seq data). LOC646329 represents the putative primary transcript of miR-29a and miR-29b-

1 on chromosome 7 and Pri-mir-29b-2 represents the putative primary transcript of miR-29b-2

and miR-29c on chromosome 1. (B) Relative levels of Foxa2 mRNA in the livers of C57BL/6J

female mice on high-fat diet (HFD 16 weeks; n=3) and matched low-fat diet (LFD 16 weeks;

n=3) are shown. (C) Relative levels of Foxa2 mRNA in the livers of 16-week old healthy male

rats (n=8), Zucker Diabetic Fatty (ZDF) fa/fa male littermates (n=11), and Pioglitazone-treated

(4 weeks) ZDF fa/fa male rats (n=6) are shown. (D) Effects of FOXA2-siRNA treatment (100

nM) in Huh7 cells on FOXA2 (mock, n=14; siRNA, n=13), miR-29a (mock, n=12; siRNA,

n=12), miR-29b and miR-29c (mock, n=10; siRNA, n=8) expression levels are shown. (E)

Effects of FOXA2 over-expression plasmid (1 ug) in Huh7 cells on FOXA2 (mock, n=6;

plasmid, n=5), miR-29a (mock, n=6; plasmid, n=5), miR-29b (mock, n=5; plasmid, n=4), and

miR-29c (mock, n=6; plasmid, n=5) are shown. All transfections were conducted in triplicate

and results were validated by at least two independent experiments. P-values were calculated

according to the two-tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01. ***, P < 0.001.

Figure 4. miR-29 fine-tunes FOXA2-mediated regulation of key lipid metabolism genes. (A)

Significant enrichment of predicted miR-29 target sites among FOXA2 bound genes in mouse

liver but not in mouse islet is shown. (B) Effects of the miR-29a mimic (10 nM) and the miR-29a

locked nucleic acid inhibitor (LNA, 10 nM) in Huh7 cells on the mRNA levels of FOXA2-bound

genes HMGCS2 (mimic, n=7; LNA, n=7), ABHD5 (mimic, n=8; LNA, n=6), and PPARGC1A

(mimic, n=7; LNA, n=7) are shown. (C) Effect of the miR-29a inhibitor (LNA, 10 nM) in Huh7

of 55


Diabetes

22

cells on protein levels of ABHD5 is shown (mock, n=3; LNA, n=3). (D) Effects of the miR-29a

mimic (100nM) in HEK293T cells on the relative activity of Firefly reporter constructs

containing either wild-type or mutated HMGCS2 3’ UTR are shown. Firefly activity was

normalized to Renilla activity. (E) Effects of FOXA2-siRNA treatment (100 nM) in Huh7 cells

on mRNA levels of HMGCS2 (mock, n=10; siRNA, n=9), ABHD5 (mock, n=10; siRNA, n=10),

and PPARGC1A (mock, n=8; siRNA, n=4) are shown. P-values were calculated according to the

two-tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 5. Schematic of the FOXA2:miR-29 regulatory circuit in the liver. A possible model

of FOXA2:miR-29 circuitry in the liver is shown. In the insulin resistant state, FOXA2 activity is

up-regulated, which in turn elevates miR-29 levels. FOXA2 drives the expression of genes

involved in lipid metabolism and miR-29 acts as a feed-forward fine-tuner of many of the same

genes.

of 55


Diabetes

Figure 1. Hepatic miR-29 levels are up-regulated in diet-induced insulin resistance in mice. (A) Fasting blood glucose levels of C57BL/6J female mice on high-fat diet (HFD 16 weeks; n=3) and matched low-fat diet (LFD 16 weeks; n=3) are shown. (B) miRNA expression levels (RPMM, reads per million mapped reads) based on

deep sequencing analysis of small RNAs from the livers of HFD-fed (n=2) and LFD-fed (n=2) C57BL/6J female mice are shown. Each circle represents a miRNA that is expressed at RPMM > 100 in at least one murine liver sample. Dashed blue lines represent 1.5-fold difference in expression between HFD-fed and

LFD-fed mice. (C) Relative levels (based on sequencing) of miR-29a, miR-29b, and miR-29c in the livers of HFD-fed (n=2) and LFD-fed (n=2) C57BL/6J female mice are shown. (D) Relative levels (based on RT-qPCR) of miR-29a, miR-29b, and miR-29c in the livers of HFD-fed (n=3) and LFD-fed (n=3) C57BL/6J female mice are shown. P-values were calculated according to the one-tailed unpaired Student’s t-test. *, P < 0.05; **,

P < 0.01; ***, P < 0.001. 109x261mm (72 x 72 DPI)

of 55


Diabetes

of 55


Diabetes

Figure 2. Hepatic miR-29 levels are elevated in a rat model of diabetes and corrected by treatment with the insulin-sensitizing drug Pioglitazone. (A & B) Fasting blood glucose levels (A) and relative hepatic levels

(based on RT-qPCR) of miR-29a, miR-29b, and miR-29c (B) in 12-week old healthy male rats (n=8), Zucker

Diabetic Fatty (ZDF) fa/fa male littermates (n=11), and Pioglitazone-treated (4 weeks) ZDF fa/fa male rats (n=6) are shown. P-values were calculated according to the one-tailed unpaired Student’s t-test. *, P <

0.05; **, P < 0.01; ***, P < 0.001. 187x70mm (72 x 72 DPI)

of 55


Diabetes

Figure 3. FOXA2 regulates miR-29 expression. (A) FOXA2 occupancy in human hepatoma cells (HepG2) at the miR-29ab and mir-29b-2/c genomic loci are shown (based on ENCODE ChIP-seq data). LOC646329

represents the putative primary transcript of miR-29a and miR-29b-1 on chromosome 7 and Pri-mir-29b-2

represents the putative primary transcript of miR-29b-2 and miR-29c on chromosome 1. (B) Relative levels of Foxa2 mRNA in the livers of C57BL/6J female mice on high-fat diet (HFD 16 weeks; n=3) and matched low-fat diet (LFD 16 weeks; n=3) are shown. (C) Relative levels of Foxa2 mRNA in the livers of 16-week old healthy male rats (n=8), Zucker Diabetic Fatty (ZDF) fa/fa male littermates (n=11), and Pioglitazone-

treated (4 weeks) ZDF fa/fa male rats (n=6) are shown. (D) Effects of FOXA2-siRNA treatment (100 nM) in Huh7 cells on FOXA2 (mock, n=14; siRNA, n=13), miR-29a (mock, n=12; siRNA, n=12), miR-29b and miR-29c (mock, n=10; siRNA, n=8) expression levels are shown. (E) Effects of FOXA2 over-expression plasmid (1 ug) in Huh7 cells on FOXA2 (mock, n=6; plasmid, n=5), miR-29a (mock, n=6; plasmid, n=5), miR-29b (mock, n=5; plasmid, n=4), and miR-29c (mock, n=6; plasmid, n=5) are shown. All transfections were conducted in triplicate and results were validated by at least two independent experiments. P-values were

of 55


Diabetes

calculated according to the two-tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01. ***, P < 0.001. 138x245mm (72 x 72 DPI)

of 55


Diabetes

Figure 4. miR-29 fine-tunes FOXA2-mediated regulation of key lipid metabolism genes. (A) Significant enrichment of predicted miR-29 target sites among FOXA2 bound genes in mouse liver but not in mouse

islet is shown. (B) Effects of the miR-29a mimic (10 nM) and the miR-29a locked nucleic acid inhibitor (LNA, 10 nM) in Huh7 cells on the mRNA levels of FOXA2-bound genes HMGCS2 (mimic, n=7; LNA, n=7), ABHD5 (mimic, n=8; LNA, n=6), and PPARGC1A (mimic, n=7; LNA, n=7) are shown. (C) Effect of the miR-29a inhibitor (LNA, 10 nM) in Huh7 cells on protein levels of ABHD5 is shown (mock, n=3; LNA, n=3). (D)

Effects of the miR-29a mimic (100nM) in HEK293T cells on the relative activity of Firefly reporter constructs containing either wild-type or mutated HMGCS2 3’ UTR are shown. Firefly activity was normalized to Renilla

activity. (E) Effects of FOXA2-siRNA treatment (100 nM) in Huh7 cells on mRNA levels of HMGCS2 (mock, n=10; siRNA, n=9), ABHD5 (mock, n=10; siRNA, n=10), and PPARGC1A (mock, n=8; siRNA, n=4) are

shown. P-values were calculated according to the two-tailed unpaired Student’s t-test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

212x206mm (72 x 72 DPI)

of 55


Diabetes

Figure 5. Schematic of the FOXA2:miR-29 regulatory circuit in the liver. A possible model of FOXA2:miR-29 circuitry in the liver is shown. In the insulin resistant state, FOXA2 activity is up-regulated, which in turn

elevates miR-29 levels. FOXA2 drives the expression of genes involved in lipid metabolism and miR-29 acts as a feed-forward fine-tuner of many of the same genes.

212x75mm (72 x 72 DPI)

of 55


Diabetes

miRNA HFD1 HFD2 Mean.HFD StDev LFD1 LFD2 Mean.LFD StDev2Ratio

HFD/LFD

mmu-mir-22-3p 98707.6 79959.1 89333.4 13257.2 49740.7 68103.6 58922.1 12984.5 1.5161

mmu-mir-192-5p 98494.1 78245.3 88369.7 14318.0 36784.5 33486.6 35135.6 2332.0 2.5151

mmu-mir-92a-1-3p 20202.7 18798.3 19500.5 993.0 21169.4 30198.4 25683.9 6384.4 0.7592

mmu-mir-122-5p 31218.5 26676.9 28947.7 3211.4 23830.0 29978.6 26904.3 4347.7 1.0760

mmu-mir-192-5p_+_1 45562.2 29238.6 37400.4 11542.5 16081.3 22648.1 19364.7 4643.4 1.9314

mmu-mir-148a-3p 33983.2 25526.2 29754.7 5980.0 14366.1 21358.3 17862.2 4944.2 1.6658

mmu-mir-143-3p 12533.9 8682.9 10608.4 2723.1 5750.7 20866.3 13308.5 10688.4 0.7971

mmu-mir-26a-2-5p 15432.3 10265.7 12849.0 3653.3 7328.9 13989.2 10659.0 4709.6 1.2055

mmu-mir-26a-1-5p 15397.4 10239.2 12818.3 3647.4 7309.7 13949.0 10629.3 4694.7 1.2059

mmu-mir-30a-5p 18849.1 16457.8 17653.4 1690.9 9319.1 13488.6 11403.8 2948.3 1.5480

mmu-mir-27b-3p 17357.4 7546.6 12452.0 6937.3 3974.1 12986.5 8480.3 6372.7 1.4683

mmu-mir-191-5p 8942.0 6861.9 7902.0 1470.8 5615.1 12637.5 9126.3 4965.6 0.8658

mmu-mir-10a-5p 12949.5 9192.2 11070.9 2656.8 5841.3 12434.1 9137.7 4661.8 1.2116

mmu-mir-99b-5p 3130.8 2251.9 2691.4 621.5 3187.0 10904.4 7045.7 5457.0 0.3820

mmu-mir-125a-5p 3697.9 2802.7 3250.3 632.9 3577.2 10828.5 7202.9 5127.4 0.4513

mmu-mir-21-5p 7502.2 6559.6 7030.9 666.5 3195.5 9347.7 6271.6 4350.3 1.1211

mmu-let-7f-2-5p 9000.4 6036.4 7518.4 2095.9 3745.2 8205.9 5975.5 3154.2 1.2582

mmu-mir-378-3p 6920.8 7175.9 7048.3 180.3 4883.2 7628.6 6255.9 1941.3 1.1267

mmu-mir-30d-5p 6215.8 5671.9 5943.9 384.6 4603.3 7301.6 5952.5 1908.0 0.9986

mmu-let-7f-1-5p 7679.4 5136.7 6408.1 1798.0 3171.0 6864.3 5017.7 2611.6 1.2771

mmu-mir-151-3p 3705.4 3421.0 3563.2 201.1 3522.5 6177.2 4849.9 1877.2 0.7347

mmu-mir-486-5p 9606.2 23077.0 16341.6 9525.3 13429.5 5934.8 9682.2 5299.6 1.6878

mmu-mir-3107-5p 9579.5 23005.5 16292.5 9493.6 13388.7 5920.0 9654.4 5281.2 1.6876

mmu-mir-10a-5p_+_1 5217.3 3677.0 4447.1 1089.2 2685.4 5860.0 4272.7 2244.8 1.0408

mmu-let-7a-1-5p 4262.1 3573.0 3917.5 487.3 3162.3 5490.7 4326.5 1646.4 0.9055

mmu-let-7a-2-5p 4241.5 3542.8 3892.2 494.0 3127.3 5414.7 4271.0 1617.4 0.9113

mmu-mir-126-5p 10331.4 6151.2 8241.3 2955.8 3706.1 4980.7 4343.4 901.2 1.8974

mmu-let-7c-2-5p 3419.5 3462.4 3440.9 30.4 3691.6 4768.4 4230.0 761.4 0.8135

mmu-let-7c-1-5p 3189.4 3246.6 3218.0 40.5 3436.9 4480.4 3958.7 737.8 0.8129

mmu-mir-181a-1-5p 1608.5 1713.8 1661.1 74.5 1872.0 4300.0 3086.0 1716.9 0.5383

mmu-mir-181a-2-5p 1608.2 1713.8 1661.0 74.7 1871.8 4299.9 3085.9 1716.9 0.5383

mmu-mir-26b-5p 5801.4 3556.4 4678.9 1587.4 2460.4 4277.2 3368.8 1284.7 1.3889

mmu-let-7g-5p 5134.9 3324.5 4229.7 1280.1 2404.2 4195.4 3299.8 1266.6 1.2818

mmu-mir-100-5p 1617.9 1174.4 1396.2 313.6 1274.3 4103.4 2688.8 2000.4 0.5192

mmu-mir-16-1-5p 5071.7 4262.2 4666.9 572.4 2192.7 3260.4 2726.5 755.0 1.7117

mmu-mir-16-2-5p 5048.7 4243.9 4646.3 569.0 2174.5 3244.6 2709.5 756.7 1.7148

mmu-mir-151-5p 2143.7 1941.1 2042.4 143.2 1478.8 2959.6 2219.2 1047.1 0.9203

mmu-let-7b-5p 2307.8 2275.6 2291.7 22.8 2746.5 2950.6 2848.6 144.3 0.8045

mmu-mir-30e-5p 3027.0 2946.0 2986.5 57.3 1469.4 2160.4 1814.9 488.6 1.6455

mmu-let-7i-5p 959.2 1013.6 986.4 38.4 719.4 2102.5 1411.0 978.0 0.6991

of 55


Diabetes

mmu-mir-125b-1-5p 861.1 704.5 782.8 110.7 781.7 1982.5 1382.1 849.1 0.5664

mmu-mir-125b-2-5p 829.9 679.4 754.7 106.4 751.5 1912.2 1331.8 820.8 0.5666

mmu-let-7d-5p 1521.1 1293.7 1407.4 160.8 968.0 1908.6 1438.3 665.0 0.9785

mmu-mir-29a-3p 1629.1 1542.4 1585.8 61.3 1044.2 1890.8 1467.5 598.7 1.0806

mmu-mir-194-2-5p 2804.2 2045.9 2425.1 536.2 1130.9 1250.8 1190.8 84.8 2.0364

mmu-mir-126-3p 1410.7 1072.2 1241.5 239.4 662.2 1233.3 947.8 403.8 1.3099

mmu-mir-130a-3p 1133.8 966.7 1050.3 118.2 710.6 1126.5 918.5 294.1 1.1434

mmu-mir-30c-2-5p 1653.2 1461.1 1557.2 135.9 747.1 1112.8 929.9 258.6 1.6745

mmu-mir-30c-1-5p 1653.1 1461.0 1557.0 135.8 747.1 1112.6 929.9 258.4 1.6745

mmu-mir-182-5p 647.2 714.1 680.7 47.3 696.4 1108.8 902.6 291.6 0.7541

mmu-mir-423-3p 749.0 822.2 785.6 51.7 753.7 1102.3 928.0 246.5 0.8466

mmu-mir-25-3p 805.6 860.6 833.1 38.9 534.5 1081.6 808.1 386.9 1.0309

mmu-mir-92a-2-3p 631.1 662.9 647.0 22.5 652.8 1038.6 845.7 272.9 0.7651

mmu-mir-351-5p 651.7 658.5 655.1 4.8 635.3 1030.1 832.7 279.2 0.7867

mmu-mir-194-1-5p 2404.8 1608.0 2006.4 563.4 935.6 1010.0 972.8 52.6 2.0626

mmu-mir-142-5p_-_2 616.8 649.8 633.3 23.4 224.1 967.2 595.6 525.4 1.0633

mmu-mir-93-5p 595.4 588.6 592.0 4.8 383.4 924.2 653.8 382.3 0.9055

mmu-let-7d-3p 605.3 570.7 588.0 24.5 618.6 880.1 749.4 184.9 0.7846

mmu-mir-146a-5p 575.9 475.7 525.8 70.9 291.1 865.9 578.5 406.4 0.9089

mmu-mir-5115_-_1 429.2 1403.8 916.5 689.2 1597.8 767.2 1182.5 587.3 0.7750

mmu-mir-101b-3p 1739.9 1602.9 1671.4 96.8 731.2 765.2 748.2 24.0 2.2338

mmu-mir-5099_-_2 321.6 334.6 328.1 9.2 396.9 732.9 564.9 237.6 0.5808

mmu-mir-423-5p 620.4 466.2 543.3 109.0 381.8 727.1 554.5 244.2 0.9798

mmu-mir-99a-5p 508.2 379.8 444.0 90.8 329.0 724.2 526.6 279.4 0.8431

mmu-mir-31-5p 266.0 294.8 280.4 20.4 196.2 662.3 429.3 329.6 0.6532

mmu-mir-23b-3p 783.1 584.3 683.7 140.6 406.1 640.8 523.4 166.0 1.3063

mmu-mir-484 222.3 288.0 255.1 46.5 254.0 628.5 441.3 264.9 0.5782

mmu-mir-5115_-_6 293.2 1037.9 665.5 526.6 930.7 596.9 763.8 236.0 0.8713

mmu-mir-126-3p_+_1 722.0 573.0 647.5 105.4 338.9 593.4 466.2 180.0 1.3890

mmu-let-7e-5p 168.4 150.9 159.7 12.4 205.3 589.8 397.6 271.9 0.4016

mmu-mir-148b-3p 612.5 466.5 539.5 103.2 300.5 576.2 438.4 194.9 1.2308

mmu-mir-501-3p 213.1 189.3 201.2 16.8 206.1 558.9 382.5 249.5 0.5259

mmu-mir-199a-2-3p 150.5 100.6 125.6 35.3 88.6 555.6 322.1 330.2 0.3898

mmu-mir-27a-3p 274.8 147.5 211.2 90.0 73.2 546.6 309.9 334.7 0.6814

mmu-mir-199b-3p 147.0 98.6 122.8 34.2 86.6 544.6 315.6 323.9 0.3891

mmu-mir-199a-1-3p 147.0 98.6 122.8 34.2 86.6 544.6 315.6 323.9 0.3891

mmu-mir-744-5p 412.9 377.3 395.1 25.2 407.9 530.9 469.4 87.0 0.8418

mmu-mir-125b-1-5p_+_1 217.2 168.4 192.8 34.5 207.1 504.1 355.6 210.0 0.5422

mmu-mir-140-3p_+_1 345.9 372.1 359.0 18.6 242.5 492.5 367.5 176.8 0.9768

mmu-mir-125b-2-5p_+_1 216.0 166.8 191.4 34.7 205.0 489.7 347.4 201.3 0.5510

mmu-mir-127-3p 87.7 84.8 86.3 2.1 87.7 474.1 280.9 273.2 0.3071

of 55


Diabetes

mmu-mir-5115 308.6 923.2 615.9 434.6 2581.4 473.0 1527.2 1490.9 0.4033

mmu-mir-101b-3p_-_1 997.5 836.8 917.2 113.6 354.0 465.8 409.9 79.0 2.2375

mmu-mir-107-3p 775.9 604.9 690.4 120.9 397.8 459.9 428.8 43.9 1.6099

mmu-mir-103-2-3p 466.7 410.0 438.4 40.1 266.3 450.1 358.2 130.0 1.2238

mmu-mir-200b-3p 161.9 89.6 125.8 51.1 87.0 449.6 268.3 256.4 0.4687

mmu-mir-150-5p 90.3 128.6 109.5 27.0 120.6 442.3 281.4 227.5 0.3889

mmu-mir-103-1-3p 454.5 402.1 428.3 37.1 259.0 434.3 346.6 124.0 1.2356

mmu-mir-221-3p 300.8 282.5 291.6 13.0 225.7 411.1 318.4 131.1 0.9160

mmu-mir-23a-3p 243.7 170.1 206.9 52.0 127.8 408.5 268.2 198.5 0.7717

mmu-mir-186-5p 465.1 440.8 453.0 17.2 221.7 392.2 306.9 120.6 1.4758

mmu-mir-101a-3p 616.6 711.5 664.1 67.1 337.1 368.2 352.6 22.0 1.8832

mmu-mir-191-5p_+_1 227.1 183.5 205.3 30.8 150.4 364.9 257.7 151.6 0.7967

mmu-mir-30b-5p 478.6 476.0 477.3 1.8 219.5 359.5 289.5 99.0 1.6488

mmu-mir-5115_-_2 189.8 624.3 407.1 307.2 372.2 346.0 359.1 18.5 1.1335

mmu-mir-28-5p 281.2 268.3 274.8 9.1 205.4 337.7 271.6 93.5 1.0119

mmu-mir-320-3p 228.0 234.6 231.3 4.7 273.5 336.9 305.2 44.8 0.7579

mmu-mir-24-1-3p 272.1 228.8 250.5 30.6 142.5 323.2 232.9 127.8 1.0756

mmu-mir-24-2-3p 272.1 228.8 250.5 30.6 142.5 323.2 232.9 127.8 1.0756

mmu-mir-5105_+_8 442.5 400.4 421.5 29.8 297.8 322.8 310.3 17.7 1.3584

mmu-mir-140-3p 199.1 205.0 202.0 4.2 128.3 312.5 220.4 130.3 0.9165

mmu-mir-101a-3p_-_1 454.6 437.7 446.1 12.0 201.5 302.6 252.0 71.5 1.7702

mmu-mir-15a-5p 619.3 469.9 544.6 105.7 226.7 301.7 264.2 53.1 2.0615

mmu-mir-181c-5p 108.9 112.6 110.7 2.6 80.7 300.8 190.7 155.7 0.5805

mmu-mir-802-5p 544.0 399.0 471.5 102.6 168.8 292.7 230.7 87.6 2.0435

mmu-mir-30a-3p 331.4 244.0 287.7 61.9 193.8 291.9 242.8 69.4 1.1847

mmu-mir-5115_-_8 218.5 1049.8 634.2 587.8 2060.1 280.7 1170.4 1258.2 0.5418

mmu-mir-142-5p 116.5 226.7 171.6 77.9 76.6 267.2 171.9 134.8 0.9980

mmu-mir-378-3p_+_1 274.5 262.6 268.5 8.4 170.2 260.4 215.3 63.8 1.2471

mmu-mir-328-3p 177.9 184.3 181.1 4.5 188.8 259.3 224.1 49.9 0.8082

mmu-mir-5115_-_5 123.1 419.3 271.2 209.4 302.8 252.7 277.7 35.4 0.9764

mmu-mir-152-3p 286.1 191.8 238.9 66.7 147.6 242.1 194.8 66.8 1.2262

mmu-mir-203-3p 415.6 303.2 359.4 79.5 185.5 232.8 209.1 33.5 1.7186

mmu-mir-139-5p 141.4 146.1 143.7 3.4 159.0 232.6 195.8 52.1 0.7342

mmu-mir-5115_-_7 118.8 387.6 253.2 190.0 707.4 225.4 466.4 340.8 0.5429

mmu-mir-451 497.8 1456.3 977.1 677.8 373.0 223.4 298.2 105.8 3.2769

mmu-mir-30a-3p_+_1 266.9 195.0 231.0 50.9 152.5 220.3 186.4 47.9 1.2393

mmu-mir-1839-5p 167.5 138.4 152.9 20.5 98.8 217.3 158.1 83.8 0.9676

mmu-mir-34a-5p 49.6 35.9 42.7 9.7 20.8 212.4 116.6 135.5 0.3666

mmu-mir-652-3p 65.9 96.6 81.3 21.7 95.6 206.1 150.9 78.1 0.5385

mmu-mir-676-3p 112.0 102.9 107.4 6.4 120.7 199.4 160.1 55.6 0.6711

mmu-mir-98-5p 248.0 170.3 209.2 54.9 105.1 198.3 151.7 66.0 1.3788

of 55


Diabetes

mmu-mir-214-3p 32.1 30.1 31.1 1.4 34.5 198.2 116.4 115.8 0.2672

mmu-mir-195-5p 73.9 56.9 65.4 12.0 44.5 194.4 119.4 106.0 0.5474

mmu-mir-425-5p 156.0 155.1 155.5 0.6 91.8 193.1 142.4 71.7 1.0922

mmu-mir-203-3p_+_1 374.7 235.2 305.0 98.6 141.1 190.1 165.6 34.6 1.8419

mmu-mir-340-5p 243.9 227.8 235.9 11.3 105.7 188.9 147.3 58.8 1.6011

mmu-mir-29a-3p_-_1 115.6 104.7 110.2 7.7 79.2 187.6 133.4 76.6 0.8258

mmu-mir-22-3p_+_1 278.3 225.0 251.6 37.7 133.0 184.1 158.6 36.2 1.5870

mmu-mir-214-3p_-_1 23.2 18.9 21.0 3.1 26.3 183.7 105.0 111.4 0.2001

mmu-mir-149-5p 26.5 25.2 25.8 0.9 19.0 182.8 100.9 115.8 0.2560

mmu-mir-15b-5p 74.2 103.5 88.9 20.7 67.3 178.3 122.8 78.5 0.7236

mmu-mir-5109_+_5 120.4 314.2 217.3 137.0 409.7 171.8 290.8 168.3 0.7472

mmu-mir-30c-2-3p 156.3 139.6 148.0 11.8 145.0 164.7 154.8 13.9 0.9555

mmu-mir-532-5p 92.0 100.2 96.1 5.8 60.9 163.7 112.3 72.7 0.8556

mmu-mir-497-5p 43.8 38.3 41.1 3.8 30.3 160.2 95.3 91.9 0.4309

mmu-mir-342-3p 74.8 65.4 70.1 6.6 35.4 159.4 97.4 87.7 0.7192

mmu-mir-181b-2-5p 66.0 57.8 61.9 5.8 59.3 159.0 109.2 70.5 0.5671

mmu-mir-145-5p 93.5 86.6 90.0 4.9 89.1 158.1 123.6 48.8 0.7282

mmu-mir-143-3p_-_1 94.8 63.8 79.3 21.9 45.5 152.8 99.2 75.8 0.7996

mmu-mir-181b-1-5p 62.6 54.2 58.4 5.9 55.9 151.1 103.5 67.3 0.5645

mmu-mir-146b-5p 52.2 34.1 43.2 12.9 21.2 150.3 85.8 91.3 0.5031

mmu-mir-30e-3p 229.4 150.0 189.7 56.1 109.9 148.4 129.1 27.3 1.4690

mmu-mir-148a-5p 123.9 155.5 139.7 22.3 90.2 147.7 119.0 40.6 1.1739

mmu-mir-92b-3p 24.2 18.0 21.1 4.4 24.2 146.2 85.2 86.3 0.2481

mmu-mir-199a-1-5p 29.7 32.6 31.1 2.0 25.2 143.2 84.2 83.4 0.3697

mmu-mir-199a-2-5p 29.7 32.6 31.1 2.0 25.2 143.2 84.2 83.4 0.3697

mmu-mir-122-3p 206.0 173.0 189.5 23.3 109.7 143.0 126.3 23.5 1.5003

mmu-mir-30a-5p_+_1 196.8 172.4 184.6 17.3 95.6 140.6 118.1 31.8 1.5632

mmu-mir-802-3p 140.5 112.3 126.4 19.9 64.7 138.2 101.4 51.9 1.2458

mmu-mir-361-5p 126.0 104.3 115.2 15.4 80.1 137.7 108.9 40.7 1.0577

mmu-mir-29c-3p 242.7 236.7 239.7 4.3 115.7 133.7 124.7 12.7 1.9220

mmu-mir-222-3p 79.9 86.9 83.4 4.9 68.3 131.7 100.0 44.9 0.8339

mmu-mir-92a-1-3p_+_1 74.1 76.4 75.3 1.6 74.3 128.3 101.3 38.2 0.7427

mmu-mir-574-3p 85.0 72.7 78.8 8.7 65.0 122.2 93.6 40.4 0.8423

mmu-mir-17-5p 78.6 63.1 70.9 11.0 43.0 119.1 81.0 53.8 0.8747

mmu-mir-5115_-_3 62.8 202.4 132.6 98.7 150.0 115.8 132.9 24.2 0.9979

mmu-mir-183-5p 44.6 51.7 48.1 5.0 66.7 112.9 89.8 32.6 0.5360

mmu-mir-671-3p 78.4 74.3 76.4 2.9 62.7 108.8 85.8 32.6 0.8903

mmu-mir-28-3p 93.6 80.3 86.9 9.5 67.6 107.4 87.5 28.1 0.9942

mmu-mir-10a-5p_-_1 93.8 69.9 81.8 16.8 43.1 105.2 74.1 44.0 1.1041

mmu-mir-5109_+_4 70.1 180.7 125.4 78.2 293.4 104.7 199.1 133.4 0.6301

mmu-mir-122-3p_+_1 184.5 168.2 176.3 11.5 93.9 103.2 98.6 6.6 1.7886

of 55


Diabetes

mmu-mir-423-3p_-_1 72.9 76.0 74.5 2.2 78.8 98.7 88.8 14.1 0.8389

mmu-mir-1839-5p_+_1 63.2 49.8 56.5 9.5 31.5 95.6 63.5 45.3 0.8892

mmu-mir-200a-3p 44.4 30.9 37.6 9.5 19.7 94.5 57.1 52.9 0.6592

mmu-mir-301a-3p 62.6 52.2 57.4 7.4 32.4 93.8 63.1 43.5 0.9093

mmu-mir-145-3p 62.3 53.9 58.1 5.9 33.9 92.3 63.1 41.3 0.9216

mmu-mir-326-3p 31.1 36.9 34.0 4.1 37.8 91.9 64.9 38.2 0.5237

mmu-mir-151-3p_-_1 39.4 43.4 41.4 2.8 50.3 91.2 70.7 29.0 0.5851

mmu-mir-322-5p 124.2 86.0 105.1 27.0 44.5 90.8 67.6 32.8 1.5540

mmu-mir-331-3p 40.6 46.7 43.7 4.3 54.9 88.9 71.9 24.0 0.6070

mmu-mir-1247-5p 149.0 93.5 121.3 39.3 174.7 86.1 130.4 62.7 0.9300

mmu-mir-20a-5p 57.6 58.2 57.9 0.4 29.5 85.7 57.6 39.7 1.0049

mmu-mir-132-3p 21.6 20.0 20.8 1.1 16.3 83.1 49.7 47.2 0.4186

mmu-mir-181a-2-3p_-_3 29.0 23.3 26.1 4.0 24.1 81.1 52.6 40.3 0.4970

mmu-mir-5109_+_3 58.1 143.6 100.9 60.5 219.8 80.8 150.3 98.3 0.6710

mmu-mir-5109_-_2 47.2 114.5 80.8 47.6 148.7 76.6 112.7 51.0 0.7175

mmu-mir-223-3p 37.6 36.5 37.1 0.7 17.7 75.9 46.8 41.2 0.7918

mmu-mir-5109_-_1 72.2 92.7 82.4 14.5 163.5 73.4 118.4 63.7 0.6960

mmu-mir-199a-2-3p_-_1 16.5 11.1 13.8 3.8 10.5 73.1 41.8 44.3 0.3301

mmu-mir-146a-5p_-_1 31.2 30.9 31.0 0.2 16.0 72.2 44.1 39.7 0.7026

mmu-mir-199a-1-3p_-_1 16.2 11.0 13.6 3.7 10.5 71.9 41.2 43.4 0.3299

mmu-mir-199b-3p_-_1 16.2 11.0 13.6 3.7 10.5 71.9 41.2 43.4 0.3299

mmu-mir-872-5p 65.9 48.5 57.2 12.3 31.0 70.1 50.6 27.6 1.1315

mmu-mir-1843-5p 93.6 95.0 94.3 1.0 53.6 68.3 61.0 10.4 1.5474

mmu-mir-181d-5p 21.2 21.4 21.3 0.1 18.5 66.4 42.4 33.9 0.5014

mmu-mir-455-3p 38.8 35.9 37.4 2.1 68.2 66.3 67.3 1.4 0.5559

mmu-mir-27b-3p_-_1 59.8 26.1 43.0 23.8 17.8 66.3 42.0 34.3 1.0224

mmu-mir-155-5p 7.4 5.5 6.5 1.4 5.3 65.6 35.5 42.6 0.1821

mmu-mir-322-3p 80.8 61.8 71.3 13.4 48.3 65.1 56.7 11.9 1.2572

mmu-mir-21-3p 19.6 24.8 22.2 3.7 13.3 64.5 38.9 36.2 0.5706

mmu-mir-421-3p 54.7 51.5 53.1 2.2 31.8 59.2 45.5 19.4 1.1670

mmu-mir-10b-5p 124.1 63.1 93.6 43.2 66.3 57.9 62.1 6.0 1.5073

mmu-mir-429-3p 30.6 14.0 22.3 11.7 12.3 57.4 34.8 31.9 0.6399

mmu-mir-221-5p 32.6 24.0 28.3 6.0 23.8 57.2 40.5 23.7 0.6987

mmu-mir-125b-2-3p 45.0 41.2 43.1 2.7 19.1 56.3 37.7 26.3 1.1438

mmu-mir-215-5p 2006.4 85.2 1045.8 1358.5 164.5 56.0 110.3 76.7 9.4852

mmu-mir-106b-5p 40.0 46.2 43.1 4.4 19.3 54.0 36.6 24.6 1.1777

mmu-mir-5105_+_7 61.7 71.1 66.4 6.6 60.3 52.3 56.3 5.6 1.1785

mmu-mir-122-5p_+_4 34.1 35.9 35.0 1.3 33.6 51.8 42.7 12.8 0.8195

mmu-mir-541-5p 11.3 8.8 10.1 1.8 6.1 50.6 28.4 31.5 0.3551

mmu-mir-24-2-5p 33.9 36.3 35.1 1.7 18.0 50.1 34.1 22.7 1.0307

mmu-let-7d-3p_+_1 35.4 35.1 35.3 0.3 36.2 49.9 43.0 9.7 0.8192

of 55


Diabetes

mmu-mir-5109_-_3 23.3 56.1 39.7 23.2 122.3 49.5 85.9 51.5 0.4625

mmu-mir-378-5p 41.9 43.6 42.8 1.2 38.2 49.3 43.8 7.8 0.9767

mmu-mir-22-5p 54.9 44.3 49.6 7.5 22.7 49.2 36.0 18.7 1.3790

mmu-mir-92a-1-5p 14.6 12.3 13.5 1.6 17.4 48.7 33.0 22.1 0.4077

mmu-mir-674-3p 37.0 33.8 35.4 2.2 25.3 48.4 36.8 16.3 0.9618

mmu-mir-30e-5p_+_1 71.4 67.8 69.6 2.5 36.3 46.4 41.4 7.1 1.6812

mmu-mir-199a-2-3p_+_1 15.3 11.1 13.2 3.0 8.0 46.0 27.0 26.9 0.4873

mmu-mir-874-3p 27.4 34.0 30.7 4.7 39.4 45.9 42.7 4.6 0.7193

mmu-mir-5109_+_7 20.2 38.6 29.4 13.0 122.5 45.6 84.1 54.4 0.3495

mmu-mir-126-3p_-_1 34.8 40.3 37.6 3.9 26.8 45.2 36.0 13.0 1.0436

mmu-mir-1249-3p 28.6 29.0 28.8 0.3 34.8 44.5 39.7 6.9 0.7253

mmu-mir-199a-1-3p_+_1 14.2 10.1 12.2 2.9 7.4 43.7 25.6 25.6 0.4765

mmu-mir-199b-3p_+_1 14.2 10.1 12.2 2.9 7.4 43.7 25.6 25.6 0.4765

mmu-mir-1948-3p 54.0 37.0 45.5 12.0 27.7 43.5 35.6 11.2 1.2770

mmu-mir-5109_+_8 19.6 47.3 33.5 19.5 84.2 42.5 63.3 29.4 0.5283

mmu-mir-1843b-5p_-_1 34.4 34.7 34.6 0.2 25.6 42.0 33.8 11.6 1.0226

mmu-mir-335-5p 40.7 36.3 38.5 3.1 16.8 41.5 29.2 17.5 1.3198

mmu-mir-151-5p_-_1 18.4 14.4 16.4 2.8 17.7 40.7 29.2 16.3 0.5620

mmu-mir-183-5p_+_1 12.1 11.7 11.9 0.3 16.3 38.0 27.1 15.4 0.4378

mmu-mir-144-3p 84.8 191.4 138.1 75.4 53.7 37.6 45.7 11.4 3.0244

mmu-mir-106b-3p 15.3 27.1 21.2 8.3 19.7 37.2 28.5 12.4 0.7454

mmu-mir-122-5p_+_3 28.6 26.0 27.3 1.8 28.4 36.5 32.5 5.7 0.8410

mmu-mir-339-3p 13.8 15.4 14.6 1.1 16.1 36.4 26.2 14.4 0.5570

mmu-mir-3096b-5p 4.8 4.7 4.7 0.0 8.5 36.0 22.2 19.5 0.2128

mmu-mir-194-2-3p 40.3 39.1 39.7 0.9 43.7 35.4 39.6 5.8 1.0038

mmu-mir-151-3p_-_2 18.0 18.5 18.3 0.3 14.1 35.3 24.7 15.0 0.7391

mmu-mir-1198-5p 27.2 28.6 27.9 0.9 26.5 34.5 30.5 5.6 0.9144

mmu-mir-141-3p 24.4 16.8 20.6 5.4 9.9 34.5 22.2 17.4 0.9276

mmu-mir-212-5p 4.3 6.5 5.4 1.5 6.5 34.2 20.3 19.6 0.2655

mmu-mir-151-3p_+_1 19.6 20.0 19.8 0.3 20.9 33.9 27.4 9.2 0.7239

mmu-mir-335-3p 23.0 20.8 21.9 1.5 12.6 33.3 22.9 14.7 0.9558

mmu-mir-1981-3p 35.3 23.8 29.5 8.1 17.3 33.3 25.3 11.3 1.1677

mmu-mir-5115_+_1 25.9 81.7 53.8 39.4 166.6 33.1 99.8 94.4 0.5390

mmu-mir-361-3p 20.1 20.1 20.1 0.0 16.0 32.1 24.1 11.4 0.8360

mmu-mir-10a-5p_+_2 30.7 23.3 27.0 5.2 14.1 32.1 23.1 12.7 1.1704

mmu-mir-128-1-3p 22.2 18.6 20.4 2.5 11.1 31.5 21.3 14.5 0.9566

mmu-mir-375-3p 107.4 45.1 76.2 44.0 88.7 31.3 60.0 40.5 1.2708

mmu-mir-23b-3p_+_1 37.0 26.9 32.0 7.1 23.8 31.0 27.4 5.1 1.1659

mmu-mir-21-5p_-_1 20.0 18.9 19.4 0.7 9.2 31.0 20.1 15.4 0.9674

mmu-mir-140-3p_+_2 21.9 23.3 22.6 1.0 14.4 30.8 22.6 11.6 1.0017

mmu-mir-144-5p 90.0 165.6 127.8 53.4 50.8 30.5 40.6 14.4 3.1455

of 55


Diabetes

mmu-mir-339-5p 8.2 12.8 10.5 3.3 13.2 29.8 21.5 11.8 0.4879

mmu-mir-3096-5p_+_1 4.0 3.1 3.6 0.6 6.8 29.6 18.2 16.1 0.1972

mmu-let-7b-3p 31.6 25.2 28.4 4.5 28.0 28.8 28.4 0.6 0.9982

mmu-mir-26a-1-5p_+_1 23.8 14.1 19.0 6.8 12.8 28.8 20.8 11.3 0.9127

mmu-mir-26a-2-5p_+_1 23.8 14.1 19.0 6.8 12.8 28.8 20.8 11.3 0.9127

mmu-mir-19b-2-3p 27.5 37.6 32.6 7.1 16.9 28.8 22.9 8.4 1.4248

mmu-mir-365-2-3p 42.4 39.7 41.0 1.9 23.1 28.1 25.6 3.5 1.6007

mmu-mir-365-1-3p 42.3 39.6 40.9 1.9 23.0 28.0 25.5 3.6 1.6065

mmu-mir-101b-3p_+_1 50.3 43.7 47.0 4.7 21.4 27.9 24.6 4.7 1.9059

mmu-mir-19b-1-3p 25.8 36.8 31.3 7.8 16.3 27.7 22.0 8.0 1.4258

mmu-mir-192-5p_-_1 85.2 71.1 78.2 9.9 34.0 27.5 30.7 4.6 2.5428

mmu-mir-224-5p 7.3 2.5 4.9 3.4 2.6 27.4 15.0 17.5 0.3250

mmu-mir-30c-1-3p 26.3 19.1 22.7 5.1 19.4 27.1 23.2 5.4 0.9759

mmu-mir-320-3p_+_1 14.6 13.7 14.1 0.7 17.9 26.9 22.4 6.3 0.6321

mmu-mir-185-5p 38.7 27.4 33.0 7.9 21.6 26.6 24.1 3.5 1.3715

mmu-mir-5105_+_6 15.8 60.2 38.0 31.4 67.3 26.0 46.6 29.2 0.8149

mmu-mir-411-5p 6.8 5.9 6.3 0.6 4.8 25.9 15.4 14.9 0.4129

mmu-mir-99b-5p_+_1 6.0 5.0 5.5 0.7 7.8 25.7 16.7 12.7 0.3284

mmu-mir-5115_-_4 8.9 40.6 24.7 22.4 29.0 25.4 27.2 2.5 0.9095

mmu-mir-145-3p_-_1 16.2 13.6 14.9 1.8 9.2 25.1 17.2 11.3 0.8691

mmu-mir-212-3p 2.8 3.8 3.3 0.7 3.3 24.8 14.0 15.2 0.2325

mmu-mir-122-5p_+_1 16.3 13.9 15.1 1.7 13.4 24.5 18.9 7.9 0.7986

mmu-mir-187-3p 17.3 18.8 18.0 1.1 11.6 24.5 18.1 9.1 0.9985

mmu-mir-532-3p 11.0 13.2 12.1 1.6 11.0 24.3 17.6 9.4 0.6844

mmu-mir-122-5p_+_6 17.4 17.0 17.2 0.3 17.5 24.1 20.8 4.7 0.8256

mmu-mir-22-3p_-_1 28.5 24.4 26.5 2.9 14.7 24.0 19.4 6.6 1.3657

mmu-mir-193b-3p 5.6 7.1 6.4 1.1 11.3 23.9 17.6 8.9 0.3629

mmu-mir-125b-1-3p 5.5 6.3 5.9 0.6 5.5 23.6 14.6 12.8 0.4048

mmu-mir-802-5p_+_1 33.8 30.7 32.2 2.1 14.6 23.3 18.9 6.1 1.7028

mmu-mir-214-5p 3.4 3.8 3.6 0.3 3.0 23.3 13.1 14.3 0.2768

mmu-mir-122-5p_+_2 16.8 12.3 14.5 3.2 10.9 22.1 16.5 7.9 0.8814

mmu-mir-338-3p 27.2 20.6 23.9 4.6 12.3 21.8 17.1 6.7 1.3999

mmu-let-7d-5p_-_1 16.5 15.2 15.8 0.9 9.9 21.7 15.8 8.4 1.0014

mmu-mir-582-3p_+_1 0.7 0.0 0.3 0.5 0.0 21.5 10.8 15.2 0.0306

mmu-mir-142-3p_+_3 10.1 17.4 13.8 5.2 8.5 21.5 15.0 9.2 0.9205

mmu-mir-130b-3p 11.0 13.1 12.0 1.5 6.4 21.2 13.8 10.5 0.8707

mmu-mir-1981-5p 17.0 15.2 16.1 1.3 15.0 20.8 17.9 4.1 0.8987

mmu-mir-5115_+_3 15.1 44.3 29.7 20.7 42.8 20.5 31.7 15.7 0.9387

mmu-mir-872-3p 17.6 17.1 17.4 0.3 9.0 20.5 14.7 8.2 1.1773

mmu-mir-192-3p 35.5 37.0 36.2 1.1 20.3 20.0 20.2 0.2 1.7968

mmu-mir-27b-5p 14.5 10.6 12.6 2.8 8.5 20.0 14.2 8.1 0.8815

of 55


Diabetes

mmu-mir-361-3p_+_1 13.3 12.6 13.0 0.5 11.7 19.5 15.6 5.5 0.8306

mmu-mir-322-3p_-_2 24.6 17.2 20.9 5.2 13.1 19.4 16.2 4.5 1.2863

mmu-mir-1843-5p_+_1 17.5 20.9 19.2 2.4 11.1 18.9 15.0 5.5 1.2791

mmu-mir-122-5p_+_5 11.6 10.1 10.8 1.1 11.4 18.9 15.1 5.3 0.7148

mmu-let-7g-5p_-_1 21.0 13.1 17.0 5.5 12.4 18.8 15.6 4.6 1.0926

mmu-mir-142-3p 10.3 16.0 13.1 4.0 5.3 18.8 12.1 9.5 1.0859

mmu-mir-26b-3p 14.6 12.0 13.3 1.9 10.1 18.7 14.4 6.1 0.9235

mmu-mir-200b-3p_+_1 5.2 4.2 4.7 0.7 3.8 18.7 11.3 10.5 0.4178

mmu-mir-1843b-5p 17.4 20.5 19.0 2.1 11.1 18.6 14.8 5.3 1.2775

mmu-mir-3096b-5p_-_1 4.1 3.9 4.0 0.2 7.3 18.5 12.9 7.9 0.3117

mmu-mir-350-5p 6.7 7.9 7.3 0.9 11.1 18.4 14.7 5.1 0.4939

mmu-mir-674-5p 10.9 10.3 10.6 0.4 11.6 18.4 15.0 4.8 0.7091

mmu-mir-345-5p_-_1 15.3 20.3 17.8 3.5 12.3 18.2 15.3 4.2 1.1702

mmu-mir-5109_-_4 8.9 22.9 15.9 9.9 49.7 18.0 33.9 22.4 0.4705

mmu-mir-125a-5p_+_1 4.9 3.1 4.0 1.3 5.8 17.9 11.8 8.6 0.3408

mmu-mir-17-3p 8.0 10.3 9.2 1.6 7.0 17.0 12.0 7.1 0.7642

mmu-mir-184-3p 6.1 6.9 6.5 0.6 9.2 16.6 12.9 5.3 0.5009

mmu-mir-10a-3p 16.7 11.1 13.9 4.0 7.2 16.6 11.9 6.7 1.1689

mmu-mir-411-5p_-_1 5.9 4.1 5.0 1.2 2.9 16.6 9.7 9.8 0.5129

mmu-mir-34c-5p 2.8 2.9 2.9 0.0 2.4 16.4 9.4 9.9 0.3043

mmu-mir-1843b-3p_-_1 11.5 15.1 13.3 2.6 10.1 16.4 13.2 4.5 1.0029

mmu-mir-142-5p_-_3 11.1 11.8 11.5 0.5 4.3 16.1 10.2 8.4 1.1204

mmu-mir-92a-1-3p_+_2 7.2 5.7 6.4 1.0 8.6 15.8 12.2 5.1 0.5282

mmu-mir-1964-3p 7.5 6.3 6.9 0.8 6.8 15.5 11.2 6.2 0.6193

mmu-mir-511-3p 16.6 11.9 14.2 3.3 10.5 15.4 13.0 3.5 1.0983

mmu-mir-324-5p 5.5 8.1 6.8 1.9 7.9 15.4 11.7 5.3 0.5815

mmu-mir-1843b-5p_-_2 16.7 14.5 15.6 1.6 11.5 15.3 13.4 2.7 1.1660

mmu-mir-148a-3p_+_1 18.9 14.8 16.8 2.9 9.3 15.3 12.3 4.2 1.3684

mmu-mir-99b-3p 3.6 5.0 4.3 1.0 4.9 15.3 10.1 7.3 0.4249

mmu-mir-664-3p 15.3 14.1 14.7 0.8 9.8 14.9 12.3 3.7 1.1895

mmu-mir-30d-3p 19.4 16.9 18.1 1.7 9.5 14.8 12.1 3.7 1.4934

mmu-mir-128-2-3p 10.7 9.9 10.3 0.5 6.4 14.7 10.6 5.9 0.9740

mmu-mir-5105_-_2 10.9 14.2 12.5 2.4 36.7 14.6 25.6 15.6 0.4891

mmu-mir-5105_-_8 12.0 16.9 14.5 3.5 38.8 14.2 26.5 17.5 0.5457

mmu-mir-374-5p 16.8 12.7 14.8 2.9 8.7 14.0 11.3 3.8 1.3048

mmu-mir-324-3p_+_2 7.9 9.1 8.5 0.8 9.8 13.9 11.9 2.9 0.7173

mmu-mir-434-3p 4.4 3.9 4.1 0.3 3.0 13.8 8.4 7.7 0.4938

mmu-mir-5115_+_4 8.8 28.4 18.6 13.8 33.4 13.6 23.5 14.0 0.7925

mmu-mir-195-3p 4.6 5.2 4.9 0.5 6.2 13.6 9.9 5.2 0.4938

mmu-mir-29b-2-3p 19.0 21.9 20.5 2.0 8.9 13.5 11.2 3.3 1.8240

mmu-mir-3096-5p 3.1 2.5 2.8 0.4 5.0 13.4 9.2 6.0 0.3076

of 55


Diabetes

mmu-mir-5109_-_5 7.3 19.8 13.6 8.8 31.4 13.2 22.3 12.9 0.6087

mmu-mir-223-5p 1.9 2.8 2.4 0.7 1.5 13.0 7.2 8.2 0.3244

mmu-mir-101c_-_1 13.0 21.7 17.4 6.2 9.8 13.0 11.4 2.2 1.5223

mmu-mir-29b-1-3p 18.2 21.5 19.9 2.3 8.9 12.9 10.9 2.9 1.8222

mmu-mir-100-5p_+_1 3.6 3.6 3.6 0.0 2.8 12.7 7.8 7.0 0.4662

mmu-mir-5109_+_2 8.4 20.0 14.2 8.2 32.8 12.6 22.7 14.3 0.6253

mmu-mir-140-5p 11.8 12.9 12.3 0.8 4.5 12.5 8.5 5.6 1.4504

mmu-mir-455-5p 16.9 14.3 15.6 1.8 12.6 12.2 12.4 0.3 1.2611

mmu-mir-342-5p 3.8 4.3 4.0 0.3 3.3 12.1 7.7 6.2 0.5212

mmu-mir-210-3p 11.9 12.9 12.4 0.7 7.5 12.0 9.8 3.2 1.2669

mmu-mir-342-3p_+_2 3.4 5.3 4.3 1.3 1.9 11.9 6.9 7.1 0.6260

mmu-mir-122-5p_-_1 12.4 9.8 11.1 1.9 10.4 11.8 11.1 1.0 1.0028

mmu-mir-106b-3p_-_2 3.9 7.5 5.7 2.5 5.2 11.7 8.4 4.6 0.6732

mmu-mir-5115_+_5 7.9 25.6 16.7 12.6 34.4 11.4 22.9 16.3 0.7298

mmu-mir-30a-5p_+_2 13.8 11.1 12.5 1.9 7.6 11.4 9.5 2.7 1.3077

mmu-mir-30b-3p 7.4 6.7 7.1 0.5 5.9 11.1 8.5 3.7 0.8330

mmu-mir-5109_+_1 5.4 13.1 9.3 5.4 35.6 11.0 23.3 17.4 0.3973

mmu-mir-1947-5p 9.5 9.5 9.5 0.0 4.9 11.0 7.9 4.3 1.1956

mmu-mir-5109_-_6 7.9 18.5 13.2 7.5 31.3 10.9 21.1 14.4 0.6256

mmu-mir-5105_+_1 7.3 17.7 12.5 7.4 29.2 10.9 20.0 12.9 0.6247

mmu-mir-340-3p 13.4 12.9 13.2 0.3 5.2 10.9 8.0 4.1 1.6431

mmu-mir-5105_+_5 7.7 19.3 13.5 8.2 17.4 10.8 14.1 4.7 0.9574

mmu-mir-142-3p_+_1 4.3 7.6 5.9 2.4 2.8 10.6 6.7 5.6 0.8837

mmu-mir-10b-5p_+_1 19.1 9.1 14.1 7.1 13.9 10.5 12.2 2.4 1.1570

mmu-mir-152-5p 8.7 13.0 10.9 3.1 6.4 10.5 8.4 2.9 1.2849

mmu-mir-582-3p 0.0 0.0 0.0 0.0 0.0 10.5 5.2 7.4 0.0000

mmu-mir-193-3p 17.7 20.1 18.9 1.7 12.6 10.4 11.5 1.6 1.6482

mmu-mir-1843-3p 8.5 9.1 8.8 0.4 9.2 10.4 9.8 0.9 0.9017

mmu-mir-1843-5p_-_1 13.7 15.1 14.4 1.0 9.9 10.3 10.1 0.3 1.4269

mmu-mir-5109_-_8 6.2 13.5 9.8 5.1 20.2 10.2 15.2 7.1 0.6492

mmu-mir-5105_-_3 7.7 7.3 7.5 0.2 25.4 10.1 17.8 10.8 0.4222

mmu-mir-143-5p 3.5 3.5 3.5 0.0 4.7 10.0 7.4 3.8 0.4734

mmu-mir-25-5p 3.3 4.1 3.7 0.5 4.5 10.0 7.2 3.8 0.5080

mmu-mir-125b-2-3p_-_2 6.7 8.0 7.3 0.9 4.4 10.0 7.2 3.9 1.0168

mmu-mir-24-1-3p_+_1 4.4 3.8 4.1 0.4 3.2 9.8 6.5 4.7 0.6297

mmu-mir-24-2-3p_+_1 4.4 3.8 4.1 0.4 3.2 9.8 6.5 4.7 0.6297

mmu-mir-27b-3p_+_1 6.1 4.1 5.1 1.4 2.1 9.8 5.9 5.5 0.8640

mmu-mir-148b-5p 9.7 10.2 9.9 0.4 6.4 9.7 8.0 2.4 1.2385

mmu-mir-32-5p 14.6 10.6 12.6 2.8 4.7 9.7 7.2 3.5 1.7497

mmu-mir-181c-3p 3.8 3.6 3.7 0.1 1.7 9.6 5.7 5.6 0.6601

mmu-mir-455-3p_+_1 16.4 12.1 14.3 3.1 24.8 9.5 17.2 10.8 0.8308

of 55


Diabetes

mmu-mir-345-3p 8.5 7.5 8.0 0.7 6.4 9.5 8.0 2.2 1.0018

mmu-mir-142-5p_+_1 3.4 8.3 5.9 3.5 2.2 9.5 5.8 5.1 1.0052

mmu-mir-5115_+_2 4.4 20.8 12.6 11.6 62.7 9.5 36.1 37.7 0.3484

mmu-mir-671-5p 6.7 6.4 6.5 0.2 4.3 9.3 6.8 3.5 0.9579

mmu-mir-486-3p 13.4 28.3 20.8 10.6 17.0 9.2 13.1 5.5 1.5915

mmu-mir-5105_+_3 9.4 13.7 11.5 3.0 23.0 9.0 16.0 9.9 0.7198

mmu-mir-200c-3p 8.5 4.4 6.5 2.9 5.2 9.0 7.1 2.7 0.9110

mmu-mir-125a-3p 3.0 2.3 2.6 0.5 4.7 8.9 6.8 3.0 0.3880

mmu-let-7c-2-3p 11.5 10.5 11.0 0.7 4.5 8.8 6.6 3.1 1.6477

mmu-let-7a-1-3p 11.5 10.4 10.9 0.8 4.5 8.8 6.6 3.1 1.6469

mmu-mir-194-2-5p_-_1 19.4 13.0 16.2 4.5 8.9 8.8 8.8 0.1 1.8378

mmu-mir-148a-5p_-_1 7.9 8.4 8.1 0.4 5.5 8.8 7.1 2.3 1.1385

mmu-mir-205-5p 2.6 1.8 2.2 0.6 2.1 8.8 5.4 4.7 0.4006

mmu-mir-5109_-_7 6.1 18.6 12.3 8.8 21.8 8.7 15.3 9.3 0.8072

mmu-mir-486-5p_+_2 13.3 34.2 23.8 14.8 20.0 8.7 14.4 8.0 1.6526

mmu-mir-378-3p_-_1 9.4 5.3 7.3 2.9 4.5 8.6 6.5 2.9 1.1245

mmu-mir-664-5p 6.3 7.0 6.6 0.5 5.2 8.5 6.8 2.4 0.9719

mmu-mir-425-3p_-_1 7.6 5.9 6.7 1.2 4.9 8.2 6.6 2.4 1.0234

mmu-let-7i-3p 2.0 3.5 2.8 1.0 4.5 8.2 6.3 2.6 0.4371

mmu-mir-3102-3p 0.9 0.9 0.9 0.0 1.5 8.1 4.8 4.6 0.1829

mmu-mir-874-5p 5.0 5.3 5.2 0.2 4.7 8.0 6.4 2.3 0.8160

mmu-mir-5105_+_2 6.8 14.3 10.5 5.3 24.4 7.9 16.2 11.7 0.6518

mmu-mir-423-3p_+_1 5.0 4.9 5.0 0.1 4.9 7.8 6.4 2.0 0.7817

mmu-mir-151-3p_+_2 4.9 3.8 4.3 0.8 4.0 7.8 5.9 2.7 0.7285

mmu-mir-5109_+_6 4.6 10.0 7.3 3.8 21.5 7.7 14.6 9.7 0.4999

mmu-mir-322-3p_-_1 10.3 6.2 8.3 2.9 4.7 7.7 6.2 2.1 1.3250

mmu-mir-186-5p_+_1 8.2 7.0 7.6 0.9 3.2 7.7 5.5 3.2 1.3884

mmu-mir-3096b-5p_+_1 1.0 1.5 1.3 0.4 2.9 7.5 5.2 3.3 0.2429

mmu-mir-181a-1-3p 7.6 7.5 7.5 0.1 3.5 7.4 5.5 2.8 1.3760

mmu-mir-676-5p 7.5 7.9 7.7 0.3 2.6 7.3 5.0 3.3 1.5543

mmu-mir-3057-5p 5.4 3.9 4.7 1.0 7.9 7.2 7.6 0.5 0.6143

mmu-mir-181a-1-5p_+_1 2.8 2.3 2.6 0.3 2.5 7.2 4.8 3.4 0.5345

mmu-mir-181a-2-5p_+_1 2.8 2.3 2.6 0.3 2.5 7.2 4.8 3.4 0.5345

mmu-mir-700-3p 2.5 2.6 2.6 0.1 2.9 7.1 5.0 3.0 0.5164

mmu-mir-30d-5p_+_1 5.8 3.1 4.4 1.9 3.7 7.0 5.4 2.4 0.8288

mmu-mir-99a-5p_-_1 4.3 4.3 4.3 0.1 3.2 7.0 5.1 2.7 0.8436

mmu-mir-130a-3p_+_1 4.0 6.0 5.0 1.5 3.3 7.0 5.1 2.6 0.9726

mmu-mir-330-3p_+_1 5.2 4.4 4.8 0.5 4.2 6.8 5.5 1.8 0.8702

mmu-mir-320-3p_+_2 3.7 2.6 3.2 0.8 4.2 6.8 5.5 1.9 0.5807

mmu-mir-96-5p 4.0 4.4 4.2 0.3 3.8 6.8 5.3 2.1 0.7894

mmu-mir-5117-3p_-_4 2.3 2.6 2.5 0.3 3.2 6.7 5.0 2.5 0.4956

of 55


Diabetes

mmu-mir-345-5p 4.5 4.8 4.7 0.2 3.2 6.7 4.9 2.5 0.9479

mmu-mir-500-3p 3.1 3.9 3.5 0.6 3.1 6.7 4.9 2.5 0.7184

mmu-mir-30e-3p_+_1 11.6 7.1 9.4 3.2 5.3 6.7 6.0 1.0 1.5687

mmu-mir-3105-3p 10.4 9.2 9.8 0.9 4.4 6.5 5.4 1.5 1.8009

mmu-mir-547-3p 3.2 2.3 2.8 0.6 2.4 6.5 4.5 2.9 0.6242

mmu-mir-1948-3p_+_1 6.8 3.4 5.1 2.4 4.0 6.4 5.2 1.7 0.9819

mmu-mir-5126_-_1 2.6 4.8 3.7 1.5 10.3 6.4 8.3 2.8 0.4414

mmu-mir-324-3p 1.6 2.9 2.2 1.0 3.7 6.4 5.0 1.9 0.4454

mmu-mir-877-5p 3.7 3.1 3.4 0.4 3.3 6.4 4.8 2.2 0.6978

mmu-mir-18a-5p 3.8 5.1 4.5 0.9 1.9 6.4 4.1 3.2 1.0886

mmu-mir-450a-1-5p 7.2 5.8 6.5 1.0 4.5 6.3 5.4 1.3 1.2063

mmu-mir-450a-2-5p 7.2 5.2 6.2 1.5 4.5 6.3 5.4 1.3 1.1470

mmu-mir-511-5p_-_1 3.9 3.3 3.6 0.4 3.0 6.3 4.6 2.3 0.7762

mmu-mir-3096-5p_+_2 0.6 1.1 0.9 0.3 2.0 6.2 4.1 2.9 0.2104

mmu-mir-1843b-3p_-_3 4.0 6.0 5.0 1.4 3.0 6.2 4.6 2.3 1.0999

mmu-let-7e-3p 1.9 2.1 2.0 0.2 2.7 6.2 4.4 2.5 0.4581

mmu-let-7f-1-3p 7.8 6.7 7.2 0.8 3.8 6.1 4.9 1.6 1.4652

mmu-mir-200b-5p 2.0 0.8 1.4 0.9 0.7 6.0 3.4 3.8 0.4209

mmu-mir-15b-3p 5.9 7.4 6.7 1.0 2.4 5.9 4.1 2.5 1.6092

mmu-mir-5122_-_1 3.9 3.0 3.4 0.6 4.6 5.8 5.2 0.9 0.6592

mmu-mir-22-3p_+_2 9.3 3.7 6.5 4.0 3.8 5.8 4.8 1.4 1.3455

mmu-mir-542-3p 6.7 6.3 6.5 0.3 2.9 5.8 4.4 2.1 1.4916

mmu-mir-330-5p 4.8 5.1 4.9 0.2 3.2 5.8 4.5 1.9 1.1025

mmu-let-7c-1-5p_-_1 3.0 3.6 3.3 0.4 4.0 5.8 4.9 1.2 0.6718

mmu-mir-129-1-5p 1.1 0.9 1.0 0.1 1.4 5.8 3.6 3.1 0.2788

mmu-mir-29a-3p_+_5 2.9 2.7 2.8 0.1 2.3 5.7 4.0 2.4 0.6930

mmu-mir-129-2-5p 1.1 0.9 1.0 0.1 1.4 5.7 3.6 3.0 0.2822

mmu-mir-145-3p_-_2 4.0 2.2 3.1 1.3 1.5 5.7 3.6 3.0 0.8740

mmu-let-7f-2-5p_-_1 5.5 3.9 4.7 1.1 2.1 5.6 3.8 2.5 1.2221

mmu-mir-21-3p_+_1 3.8 4.1 3.9 0.2 1.6 5.6 3.6 2.8 1.0855

mmu-mir-5105_-_7 4.3 5.4 4.9 0.8 11.2 5.5 8.4 4.0 0.5819

mmu-mir-192-5p_+_2 9.3 4.8 7.0 3.2 4.8 5.5 5.2 0.5 1.3661

mmu-mir-345-3p_-_1 4.4 4.8 4.6 0.3 3.8 5.5 4.7 1.2 0.9894

mmu-mir-210-5p 4.0 3.3 3.6 0.5 3.3 5.5 4.4 1.6 0.8315

mmu-mir-125b-2-3p_-_3 2.5 2.8 2.7 0.2 2.0 5.5 3.7 2.5 0.7158

mmu-mir-127-3p_-_1 0.8 0.0 0.4 0.6 0.9 5.5 3.2 3.2 0.1217

mmu-mir-5105_+_4 2.5 4.7 3.6 1.5 7.7 5.4 6.5 1.6 0.5566

mmu-mir-219-1-3p 4.1 3.9 4.0 0.2 2.6 5.4 4.0 2.0 1.0044

mmu-let-7c-1-5p_+_1 2.5 2.9 2.7 0.3 2.5 5.4 3.9 2.1 0.6863

mmu-mir-5099_-_1 2.2 2.1 2.1 0.1 4.0 5.3 4.7 0.9 0.4592

mmu-mir-486-5p_-_1 8.5 25.7 17.1 12.1 13.6 5.2 9.4 5.9 1.8236

of 55


Diabetes

mmu-mir-3068-3p 3.4 4.1 3.7 0.5 2.0 5.2 3.6 2.3 1.0244

mmu-mir-700-5p 2.0 3.2 2.6 0.9 1.5 5.2 3.4 2.6 0.7673

mmu-mir-132-5p_+_1 1.7 1.6 1.7 0.0 1.0 5.2 3.1 3.0 0.5342

mmu-let-7c-2-5p_+_1 2.7 3.1 2.9 0.3 2.5 5.2 3.9 1.9 0.7564

mmu-mir-298-5p 1.6 1.1 1.3 0.3 1.3 5.2 3.3 2.7 0.4024

mmu-mir-28-3p_+_1 2.0 2.6 2.3 0.4 1.8 5.1 3.5 2.4 0.6703

mmu-mir-93-3p 2.3 2.7 2.5 0.3 1.6 5.1 3.4 2.5 0.7429

mmu-mir-21-3p_+_2 1.7 2.1 1.9 0.2 1.3 5.1 3.2 2.7 0.5864

mmu-mir-5105_-_6 3.5 4.4 4.0 0.6 8.9 5.1 7.0 2.7 0.5711

mmu-mir-362-5p 1.8 1.6 1.7 0.1 1.6 5.1 3.4 2.4 0.5126

mmu-mir-346-5p 0.0 0.9 0.4 0.6 1.2 5.1 3.1 2.8 0.1374

mmu-mir-222-3p_-_1 3.0 2.6 2.8 0.3 2.3 4.9 3.6 1.8 0.7824

mmu-mir-673-5p 1.0 0.0 0.5 0.7 0.8 4.9 2.9 2.9 0.1671

mmu-mir-582-5p 0.0 0.0 0.0 0.0 0.0 4.9 2.4 3.5 0.0000

mmu-mir-143-3p_+_3 2.5 2.2 2.3 0.2 1.5 4.9 3.2 2.4 0.7430

mmu-mir-29a-3p_+_4 5.1 4.4 4.8 0.5 3.4 4.8 4.1 1.0 1.1634

mmu-mir-152-5p_+_1 3.6 5.5 4.5 1.3 3.4 4.7 4.1 0.9 1.1182

mmu-mir-99a-5p_+_4 5.8 3.1 4.4 1.9 2.1 4.7 3.4 1.8 1.2986

mmu-mir-18a-3p 2.2 3.6 2.9 0.9 1.1 4.7 2.9 2.6 0.9938

mmu-mir-191-3p 3.1 1.4 2.3 1.2 0.9 4.7 2.8 2.7 0.8065

mmu-mir-130b-5p 1.3 1.3 1.3 0.0 0.9 4.7 2.8 2.7 0.4511

mmu-mir-5105_-_4 3.7 4.3 4.0 0.5 5.9 4.6 5.3 0.9 0.7561

mmu-mir-3068-3p_+_1 4.9 4.1 4.5 0.5 1.4 4.6 3.0 2.3 1.4899

mmu-mir-223-3p_+_1 1.7 2.0 1.8 0.2 1.3 4.6 2.9 2.3 0.6301

mmu-mir-1968-5p 4.8 5.2 5.0 0.3 4.2 4.5 4.4 0.3 1.1439

mmu-mir-1843b-3p_-_2 4.1 3.3 3.7 0.6 2.2 4.5 3.4 1.6 1.0820

mmu-mir-7a-1-5p 10.5 6.8 8.6 2.6 2.1 4.5 3.3 1.7 2.5913

mmu-mir-3107-5p_-_1 7.2 22.9 15.1 11.1 11.9 4.5 8.2 5.2 1.8488

mmu-mir-30e-5p_+_2 6.5 6.0 6.3 0.4 2.8 4.5 3.6 1.2 1.7251

mmu-mir-19a-3p 6.0 7.2 6.6 0.9 2.3 4.4 3.4 1.5 1.9733

mmu-mir-144-3p_-_1 9.0 23.3 16.1 10.2 6.5 4.4 5.5 1.5 2.9561

mmu-mir-23a-3p_-_1 2.3 1.8 2.1 0.4 1.5 4.4 2.9 2.0 0.6986

mmu-mir-181a-2-3p_-_4 0.0 0.0 0.0 0.0 0.0 4.4 2.2 3.1 0.0000

mmu-mir-409-5p 0.0 0.0 0.0 0.0 0.0 4.4 2.2 3.1 0.0000

mmu-mir-5105_-_1 3.3 7.3 5.3 2.8 14.7 4.3 9.5 7.3 0.5565

mmu-mir-338-5p 2.9 1.9 2.4 0.7 2.7 4.3 3.5 1.1 0.6836

mmu-mir-5099_+_3 2.4 1.8 2.1 0.4 2.0 4.3 3.1 1.6 0.6590

mmu-mir-148a-3p_+_2 8.0 5.3 6.7 1.9 3.1 4.2 3.7 0.8 1.8184

mmu-mir-1839-3p 5.5 5.5 5.5 0.0 2.2 4.2 3.2 1.4 1.7209

mmu-mir-425-3p 3.2 2.1 2.7 0.8 2.2 4.2 3.2 1.4 0.8297

mmu-mir-7a-2-5p 9.8 6.5 8.2 2.3 1.9 4.2 3.1 1.6 2.6591

of 55


Diabetes

mmu-mir-99b-5p_-_1 0.0 0.8 0.4 0.6 1.7 4.2 3.0 1.8 0.1326

mmu-mir-434-5p 0.7 0.9 0.8 0.2 0.7 4.2 2.5 2.5 0.3212

mmu-mir-339-3p_+_2 1.4 1.6 1.5 0.1 1.3 4.1 2.7 2.0 0.5639

mmu-mir-1964-3p_-_1 1.9 1.8 1.9 0.0 2.9 4.0 3.5 0.8 0.5340

mmu-mir-501-3p_+_1 1.8 0.0 0.9 1.3 1.9 4.0 3.0 1.5 0.3011

mmu-mir-574-5p 2.8 1.8 2.3 0.7 0.0 4.0 2.0 2.8 1.1501

mmu-mir-5099_+_1 2.2 1.8 2.0 0.2 2.1 4.0 3.1 1.3 0.6584

mmu-mir-1306-5p_+_2 1.4 2.6 2.0 0.9 2.8 3.9 3.4 0.8 0.5936

mmu-mir-126-5p_+_1 8.5 5.1 6.8 2.4 2.8 3.9 3.4 0.8 2.0150

mmu-mir-30c-2-3p_+_1 3.4 3.1 3.2 0.2 2.8 3.9 3.4 0.8 0.9630

mmu-mir-199b-5p 0.0 0.0 0.0 0.0 0.6 3.9 2.3 2.3 0.0000

mmu-mir-582-5p_+_1 0.0 0.0 0.0 0.0 0.0 3.9 1.9 2.7 0.0000

mmu-mir-92a-2-3p_+_1 2.7 2.3 2.5 0.3 2.7 3.7 3.2 0.7 0.7734

mmu-mir-22-3p_+_4 5.0 3.2 4.1 1.3 2.6 3.7 3.2 0.8 1.2997

mmu-mir-99a-3p 3.5 4.8 4.2 0.9 4.3 3.7 4.0 0.4 1.0474

mmu-mir-187-5p 2.2 2.1 2.1 0.1 2.9 3.7 3.3 0.6 0.6546

mmu-mir-450b-5p 6.0 3.8 4.9 1.6 1.4 3.7 2.5 1.6 1.9205

mmu-mir-702 2.5 0.8 1.6 1.2 1.3 3.7 2.5 1.7 0.6529

mmu-mir-5102_-_3 3.5 2.8 3.2 0.5 15.3 3.7 9.5 8.2 0.3350

mmu-mir-5099 1.2 2.0 1.6 0.6 2.8 3.6 3.2 0.6 0.5118

mmu-mir-31-3p 1.6 2.3 1.9 0.5 0.7 3.6 2.2 2.0 0.8854

mmu-mir-379-5p 0.0 0.0 0.0 0.0 0.0 3.6 1.8 2.5 0.0000

mmu-mir-877-3p 2.6 3.3 3.0 0.5 2.0 3.6 2.8 1.1 1.0603

mmu-mir-3107-5p_+_2 5.8 14.6 10.2 6.2 8.2 3.6 5.9 3.3 1.7257

mmu-mir-148a-3p_-_1 4.4 2.9 3.7 1.1 2.0 3.5 2.8 1.1 1.3322

mmu-mir-21-5p_+_1 2.7 2.6 2.6 0.1 1.0 3.5 2.3 1.8 1.1560

mmu-mir-136-3p_-_1 1.7 1.4 1.5 0.3 0.0 3.5 1.8 2.5 0.8783

mmu-mir-5105_-_5 1.1 3.9 2.5 2.0 3.8 3.4 3.6 0.3 0.6883

mmu-mir-5117-5p 0.8 0.0 0.4 0.6 1.3 3.4 2.4 1.5 0.1783

mmu-mir-362-3p 1.6 2.3 1.9 0.5 1.0 3.4 2.2 1.7 0.8593

mmu-mir-378b_-_1 3.4 3.9 3.7 0.3 1.9 3.4 2.6 1.0 1.3947

mmu-mir-193-5p 4.3 4.6 4.5 0.2 4.0 3.3 3.7 0.5 1.2166

mmu-mir-30d-3p_+_1 6.7 4.8 5.8 1.4 2.4 3.3 2.9 0.7 1.9941

mmu-mir-190-5p 6.4 3.7 5.0 1.9 1.5 3.3 2.4 1.3 2.0702

mmu-mir-211-5p 0.9 0.0 0.4 0.6 0.7 3.3 2.0 1.9 0.2240

mmu-mir-181b-2-5p_+_1 0.7 1.2 1.0 0.3 1.2 3.3 2.3 1.5 0.4258

mmu-let-7f-1-5p_-_1 3.1 2.2 2.7 0.6 1.3 3.3 2.3 1.4 1.1469

mmu-mir-652-3p_+_1 0.0 0.0 0.0 0.0 1.2 3.3 2.2 1.4 0.0000

mmu-mir-99b-5p_+_4 1.4 1.2 1.3 0.1 1.1 3.3 2.2 1.5 0.5947

mmu-mir-470-5p 1.0 0.0 0.5 0.7 0.8 3.3 2.0 1.7 0.2369

mmu-mir-143-3p_+_1 2.9 1.1 2.0 1.3 0.0 3.3 1.6 2.3 1.2281

of 55


Diabetes

mmu-mir-194-2-3p_+_1 4.4 2.6 3.5 1.3 3.8 3.2 3.5 0.5 0.9917

mmu-mir-1943-5p_+_1 1.7 1.8 1.8 0.1 2.5 3.2 2.8 0.5 0.6232

mmu-mir-3073b-3p 1.4 1.7 1.6 0.2 2.1 3.2 2.6 0.8 0.6008

mmu-mir-29a-3p_+_6 2.3 1.8 2.1 0.4 1.9 3.2 2.5 0.9 0.8144

mmu-mir-871-3p 0.8 1.6 1.2 0.5 1.7 3.2 2.4 1.0 0.5007

mmu-mir-350-3p 2.3 2.6 2.5 0.2 1.1 3.2 2.1 1.5 1.1649

mmu-mir-212-5p_+_1 0.0 0.0 0.0 0.0 1.1 3.2 2.1 1.5 0.0000

mmu-mir-191-3p_+_1 2.9 1.8 2.4 0.7 1.6 3.1 2.3 1.1 1.0131

mmu-mir-5115_+_6 2.2 7.0 4.6 3.3 7.0 3.0 5.0 2.8 0.9247

mmu-mir-744-3p 4.6 3.9 4.3 0.5 2.4 3.0 2.7 0.4 1.5710

mmu-mir-222-5p 2.0 2.0 2.0 0.0 1.2 3.0 2.1 1.3 0.9698

mmu-mir-134-5p 0.0 0.0 0.0 0.0 0.0 3.0 1.5 2.1 0.0000

mmu-mir-30a-5p_+_8 3.2 3.9 3.5 0.5 1.3 3.0 2.1 1.2 1.6433

mmu-mir-181b-1-5p_+_1 0.7 1.0 0.8 0.2 1.0 3.0 2.0 1.4 0.4133

mmu-mir-7a-1-3p 5.0 3.3 4.2 1.2 1.5 2.9 2.2 1.0 1.9161

mmu-mir-29a-5p 2.8 3.0 2.9 0.2 1.3 2.9 2.1 1.2 1.3709

mmu-mir-342-5p_+_1 1.1 1.6 1.4 0.4 1.2 2.9 2.1 1.2 0.6574

mmu-let-7f-2-5p_+_5 1.7 1.3 1.5 0.3 1.1 2.9 2.0 1.3 0.7598

mmu-mir-139-3p 1.3 1.6 1.5 0.2 1.8 2.8 2.3 0.7 0.6354

mmu-mir-5117-3p_-_6 0.0 1.0 0.5 0.7 1.2 2.8 2.0 1.2 0.2500

mmu-mir-511-3p_+_1 1.4 1.6 1.5 0.1 1.0 2.8 1.9 1.3 0.7743

mmu-mir-337-5p_+_3 0.0 0.0 0.0 0.0 0.0 2.8 1.4 2.0 0.0000

mmu-mir-300-3p 0.0 0.0 0.0 0.0 0.0 2.8 1.4 2.0 0.0000

mmu-mir-3073b-5p 3.2 2.2 2.7 0.7 1.3 2.8 2.1 1.0 1.3055

mmu-mir-467d-5p 1.3 0.0 0.6 0.9 0.7 2.8 1.7 1.5 0.3643

mmu-mir-503-3p_-_1 2.2 1.4 1.8 0.5 2.3 2.7 2.5 0.3 0.7091

mmu-mir-335-3p_-_1 3.7 2.6 3.1 0.7 1.6 2.7 2.2 0.8 1.4348

mmu-mir-1839-5p_-_1 2.0 2.1 2.1 0.0 1.6 2.7 2.2 0.8 0.9488

mmu-mir-331-3p_+_1 1.3 2.2 1.7 0.7 1.5 2.7 2.1 0.9 0.8246

mmu-mir-29b-1-5p 1.3 1.5 1.4 0.1 1.2 2.7 1.9 1.1 0.7293

mmu-mir-25-3p_+_1 1.2 1.1 1.2 0.0 0.0 2.7 1.4 1.9 0.8511

mmu-mir-125b-1-5p_+_4 1.2 1.4 1.3 0.1 0.9 2.7 1.8 1.2 0.7084

mmu-mir-33-5p 4.7 4.3 4.5 0.2 3.0 2.7 2.8 0.3 1.5839

mmu-mir-99b-5p_+_3 1.5 0.0 0.7 1.1 0.8 2.7 1.8 1.3 0.4271

mmu-mir-125b-2-5p_+_4 1.2 1.1 1.2 0.0 0.9 2.6 1.7 1.2 0.6599

mmu-mir-203-5p 3.7 2.5 3.1 0.8 1.8 2.6 2.2 0.5 1.3990

mmu-mir-320-3p_-_1 1.2 1.0 1.1 0.1 1.6 2.6 2.1 0.7 0.5288

mmu-mir-5121_+_1 2.2 1.1 1.7 0.7 1.2 2.6 1.9 1.0 0.8783

mmu-mir-409-3p_-_1 0.0 0.0 0.0 0.0 0.0 2.6 1.3 1.8 0.0000

mmu-mir-5105 3.3 3.1 3.2 0.1 13.8 2.5 8.2 8.0 0.3940

mmu-mir-185-3p 1.7 1.4 1.5 0.3 1.5 2.5 2.0 0.7 0.7717

of 55


Diabetes

mmu-mir-664-5p_-_1 2.2 2.6 2.4 0.3 1.1 2.5 1.8 1.0 1.3182

mmu-mir-214-3p_-_2 0.0 0.0 0.0 0.0 0.0 2.4 1.2 1.7 0.0000

mmu-mir-29c-5p_+_2 2.4 3.6 3.0 0.9 1.8 2.4 2.1 0.4 1.4273

mmu-mir-598-3p 1.6 1.8 1.7 0.2 1.7 2.4 2.1 0.5 0.8138

mmu-mir-351-3p_+_1 1.0 0.9 0.9 0.0 1.7 2.4 2.1 0.5 0.4594

mmu-mir-10a-5p_+_3 2.1 1.1 1.6 0.7 1.1 2.4 1.7 0.9 0.9059

mmu-mir-677-5p_-_1 1.1 0.9 1.0 0.1 1.1 2.4 1.7 0.9 0.5735

mmu-mir-497-5p_+_1 0.8 0.0 0.4 0.6 0.0 2.4 1.2 1.7 0.3243

mmu-mir-363-3p 0.0 0.0 0.0 0.0 0.0 2.4 1.2 1.7 0.0000

mmu-mir-409-3p 0.0 0.0 0.0 0.0 0.0 2.4 1.2 1.7 0.0000

mmu-let-7f-1-5p_+_5 1.5 0.9 1.2 0.4 0.9 2.4 1.6 1.1 0.7397

mmu-let-7c-2-5p_+_5 1.0 1.2 1.1 0.1 0.9 2.4 1.7 1.0 0.6879

mmu-mir-5102_-_6 2.3 2.5 2.4 0.1 28.6 2.4 15.5 18.5 0.1551

mmu-let-7a-1-5p_+_5 1.5 1.7 1.6 0.1 1.1 2.4 1.7 0.9 0.9171

mmu-mir-5109 1.2 2.8 2.0 1.1 5.7 2.3 4.0 2.4 0.5013

mmu-mir-378-3p_+_2 2.8 1.4 2.1 1.0 1.9 2.3 2.1 0.3 0.9776

mmu-mir-503-3p 2.5 2.6 2.5 0.1 1.9 2.3 2.1 0.3 1.1956

mmu-mir-99b-5p_+_2 0.0 0.0 0.0 0.0 1.0 2.3 1.6 1.0 0.0000

mmu-mir-421-3p_+_1 1.7 1.8 1.8 0.0 0.0 2.3 1.2 1.6 1.5180

mmu-mir-501-3p_+_2 0.0 0.0 0.0 0.0 0.0 2.3 1.2 1.6 0.0000

mmu-mir-322-5p_-_1 1.7 1.0 1.4 0.5 1.2 2.2 1.7 0.8 0.8082

mmu-mir-188-5p 0.9 0.9 0.9 0.0 1.0 2.2 1.6 0.9 0.5698

mmu-mir-542-5p 1.3 1.6 1.4 0.2 0.8 2.2 1.5 1.0 0.9353

mmu-mir-3082-3p_+_1 1.2 1.6 1.4 0.3 0.7 2.2 1.5 1.1 0.9342

mmu-mir-5114 0.0 0.0 0.0 0.0 0.0 2.2 1.1 1.6 0.0000

mmu-let-7c-1-5p_+_5 1.0 1.2 1.1 0.1 1.0 2.2 1.6 0.9 0.7006

mmu-let-7a-2-5p_+_5 1.4 1.7 1.6 0.2 1.1 2.2 1.6 0.8 0.9554

mmu-mir-103-2-3p_+_2 1.2 1.4 1.3 0.1 0.9 2.2 1.5 0.9 0.8400

mmu-mir-103-1-3p_+_2 1.2 1.2 1.2 0.0 0.8 2.2 1.5 1.0 0.8017

mmu-mir-122-3p_-_2 3.4 2.6 3.0 0.6 1.7 2.1 1.9 0.3 1.5399

mmu-mir-3082-3p 1.4 1.4 1.4 0.0 1.6 2.1 1.9 0.4 0.7565

mmu-mir-423-5p_+_2 1.6 1.8 1.7 0.2 0.9 2.1 1.5 0.9 1.0924

mmu-mir-5102_-_5 2.0 3.1 2.5 0.8 15.3 2.1 8.7 9.3 0.2903

mmu-mir-92a-1-3p_-_1 1.0 0.8 0.9 0.1 0.8 2.1 1.5 0.9 0.6003

mmu-let-7c-1-5p_+_3 0.8 1.3 1.1 0.4 1.6 2.1 1.9 0.3 0.5705

mmu-mir-26b-5p_+_1 2.5 0.8 1.6 1.2 0.9 2.1 1.5 0.8 1.0955

mmu-mir-215-5p_+_1 11.8 5.9 8.9 4.2 2.9 2.1 2.5 0.6 3.5993

mmu-mir-671-3p_-_1 0.0 0.0 0.0 0.0 1.1 2.1 1.6 0.7 0.0000

mmu-mir-1955-5p 0.7 1.0 0.8 0.2 0.7 2.1 1.4 0.9 0.6011

mmu-mir-5107_-_1 0.0 0.0 0.0 0.0 0.0 2.1 1.0 1.5 0.0000

mmu-mir-540-3p 0.0 0.0 0.0 0.0 0.0 2.1 1.0 1.5 0.0000

of 55


Diabetes

mmu-let-7c-2-5p_+_3 0.8 1.5 1.1 0.4 1.6 2.0 1.8 0.3 0.6313

mmu-mir-3473d_+_1 2.0 2.3 2.1 0.2 1.6 2.0 1.8 0.3 1.1783

mmu-mir-150-3p 0.0 0.0 0.0 0.0 0.8 2.0 1.4 0.8 0.0000

mmu-mir-23a-3p_+_1 1.3 1.1 1.2 0.2 0.0 1.9 1.0 1.4 1.2542

mmu-mir-345-5p_+_2 1.4 2.1 1.8 0.5 1.5 1.9 1.7 0.3 1.0497

mmu-mir-183-3p_+_1 1.0 0.9 0.9 0.1 1.3 1.9 1.6 0.4 0.5735

mmu-mir-142-3p_+_2 0.7 1.4 1.0 0.5 0.0 1.9 0.9 1.3 1.0841

mmu-mir-142-5p_-_1 0.0 1.3 0.6 0.9 0.0 1.9 0.9 1.3 0.6783

mmu-mir-24-2-3p_-_1 0.9 0.0 0.4 0.6 0.0 1.8 0.9 1.3 0.4711

mmu-mir-24-1-3p_-_1 0.9 0.0 0.4 0.6 0.0 1.8 0.9 1.3 0.4711

mmu-mir-5102_-_1 2.7 2.3 2.5 0.3 4.5 1.8 3.1 1.9 0.8071

mmu-mir-677-5p 1.3 1.2 1.2 0.0 1.3 1.8 1.5 0.4 0.8026

mmu-mir-136-5p 0.7 0.0 0.4 0.5 0.0 1.8 0.9 1.3 0.3992

mmu-mir-423-3p_-_2 0.0 0.0 0.0 0.0 0.0 1.8 0.9 1.3 0.0000

mmu-mir-5114_-_1 0.0 0.0 0.0 0.0 0.0 1.8 0.9 1.3 0.0000

mmu-mir-125b-1-3p_-_1 0.0 0.0 0.0 0.0 0.0 1.8 0.9 1.3 0.0000

mmu-let-7a-2-5p_-_1 1.2 1.4 1.3 0.2 1.3 1.8 1.5 0.3 0.8393

mmu-mir-101b-3p_+_2 3.9 2.9 3.4 0.6 2.1 1.7 1.9 0.2 1.7983

mmu-mir-674-5p_+_1 0.0 0.9 0.5 0.7 1.7 1.7 1.7 0.0 0.2709

mmu-mir-99a-5p_+_3 2.2 0.9 1.5 0.9 1.2 1.7 1.4 0.4 1.0500

mmu-mir-101a-5p_+_1 1.9 2.8 2.4 0.7 1.0 1.7 1.4 0.5 1.7124

mmu-mir-1948-5p_+_1 4.9 2.8 3.9 1.5 0.9 1.7 1.3 0.5 2.9065

mmu-mir-143-3p_-_2 0.9 0.0 0.4 0.6 0.9 1.7 1.3 0.6 0.3424

mmu-mir-125a-5p_+_2 0.0 0.0 0.0 0.0 0.9 1.7 1.3 0.6 0.0000

mmu-mir-28-5p_-_1 1.0 0.9 1.0 0.1 0.8 1.7 1.3 0.7 0.7762

mmu-let-7a-2-5p_+_6 1.0 0.0 0.5 0.7 0.7 1.7 1.2 0.7 0.3999

mmu-let-7a-1-5p_+_6 0.8 0.0 0.4 0.6 0.7 1.7 1.2 0.7 0.3504

mmu-mir-100-5p_+_3 1.1 0.0 0.6 0.8 0.0 1.7 0.9 1.2 0.6636

mmu-mir-140-3p_+_4 1.1 0.0 0.5 0.8 0.0 1.7 0.9 1.2 0.6287

mmu-mir-378-5p_+_1 1.5 1.4 1.4 0.1 1.2 1.7 1.4 0.3 1.0106

mmu-mir-3068-3p_+_2 3.9 2.8 3.4 0.7 3.2 1.6 2.4 1.1 1.4094

mmu-mir-351-3p 0.9 1.3 1.1 0.3 1.8 1.6 1.7 0.1 0.6319

mmu-mir-137-3p 2.9 2.1 2.5 0.5 1.6 1.6 1.6 0.0 1.5337

mmu-mir-101b-5p_+_1 0.8 1.6 1.2 0.6 1.6 1.6 1.6 0.0 0.7719

mmu-mir-3073b-3p_-_1 0.9 1.0 0.9 0.1 1.1 1.6 1.4 0.4 0.6963

mmu-mir-802-3p_+_1 2.2 2.8 2.5 0.4 0.7 1.6 1.2 0.6 2.0918

mmu-mir-210-3p_-_1 1.4 1.4 1.4 0.0 0.7 1.6 1.2 0.6 1.1881

mmu-mir-467d-5p_-_1 0.6 0.0 0.3 0.4 0.7 1.6 1.2 0.6 0.2669

mmu-mir-3068-5p 0.0 1.1 0.5 0.8 0.7 1.6 1.1 0.7 0.4645

mmu-mir-10a-3p_+_1 1.0 0.8 0.9 0.1 0.0 1.6 0.8 1.2 1.0683

mmu-let-7c-2-5p_+_4 0.7 0.8 0.8 0.0 0.7 1.6 1.2 0.6 0.6464

of 55


Diabetes

mmu-let-7a-1-5p_-_1 1.4 1.3 1.3 0.1 1.3 1.6 1.4 0.2 0.9211

mmu-mir-133a-2-3p 0.9 0.0 0.5 0.7 1.1 1.6 1.3 0.4 0.3560

mmu-mir-133a-1-3p 0.9 0.0 0.5 0.7 1.1 1.6 1.3 0.4 0.3560

mmu-mir-5099_+_4 0.0 0.0 0.0 0.0 0.9 1.6 1.2 0.5 0.0000

mmu-mir-455-3p_-_2 1.1 2.6 1.8 1.0 2.2 1.5 1.9 0.5 0.9765

mmu-mir-26a-2-3p 2.9 1.3 2.1 1.2 1.3 1.5 1.4 0.2 1.4968

mmu-mir-101a-5p 1.8 1.9 1.9 0.1 1.2 1.5 1.3 0.3 1.3866

mmu-mir-674-5p_-_1 1.0 0.8 0.9 0.2 1.0 1.5 1.3 0.4 0.6995

mmu-mir-21-5p_+_4 0.0 0.9 0.5 0.7 0.9 1.5 1.2 0.5 0.3816

mmu-mir-23b-3p_-_1 1.2 1.0 1.1 0.1 0.7 1.5 1.1 0.6 0.9924

mmu-mir-200a-5p 0.0 0.0 0.0 0.0 0.7 1.5 1.1 0.6 0.0000

mmu-mir-148a-3p_+_4 2.2 1.3 1.7 0.7 0.0 1.5 0.8 1.1 2.2650

mmu-mir-23b-3p_+_3 1.0 1.1 1.1 0.0 0.0 1.5 0.8 1.1 1.3700

mmu-mir-93-5p_+_1 1.1 0.9 1.0 0.2 0.0 1.5 0.8 1.1 1.2901

mmu-mir-5117-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.5 0.8 1.1 0.0000

mmu-mir-181d-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.5 0.8 1.1 0.0000

mmu-mir-431-5p 0.0 0.0 0.0 0.0 0.0 1.5 0.8 1.1 0.0000

mmu-let-7c-1-5p_+_4 0.7 0.0 0.3 0.5 0.6 1.5 1.1 0.6 0.3029

mmu-let-7f-2-5p_+_1 1.8 0.9 1.4 0.6 0.8 1.5 1.1 0.5 1.1826

mmu-let-7f-2-5p_+_6 1.5 0.8 1.2 0.5 0.0 1.5 0.7 1.1 1.5464

mmu-mir-27b-3p_+_4 2.0 0.0 1.0 1.4 0.0 1.5 0.7 1.0 1.3506

mmu-mir-29c-5p 1.8 1.3 1.5 0.4 1.0 1.5 1.2 0.3 1.2367

mmu-mir-3076-3p 1.0 0.9 1.0 0.1 0.9 1.5 1.2 0.4 0.8208

mmu-mir-133a-2-3p_+_1 0.8 0.0 0.4 0.6 0.8 1.5 1.1 0.5 0.3569

mmu-mir-133a-1-3p_+_1 0.8 0.0 0.4 0.6 0.8 1.5 1.1 0.5 0.3569

mmu-mir-122-3p_-_1 1.5 1.3 1.4 0.2 0.8 1.5 1.1 0.5 1.2368

mmu-mir-106b-3p_-_1 0.0 1.0 0.5 0.7 0.8 1.5 1.1 0.5 0.4432

mmu-mir-140-3p_+_3 1.6 1.4 1.5 0.1 0.0 1.5 0.7 1.0 2.0438

mmu-mir-187-3p_-_1 0.9 1.1 1.0 0.2 0.0 1.5 0.7 1.0 1.3967

mmu-mir-143-3p_+_2 0.8 0.0 0.4 0.6 0.0 1.5 0.7 1.0 0.5548

mmu-mir-3061-3p 0.7 0.0 0.3 0.5 0.0 1.5 0.7 1.0 0.4520

mmu-mir-125b-2-5p_+_2 0.7 0.0 0.3 0.5 0.0 1.5 0.7 1.0 0.4520

mmu-mir-125b-1-5p_+_2 0.7 0.0 0.3 0.5 0.0 1.5 0.7 1.0 0.4520

mmu-mir-381-3p 0.0 0.0 0.0 0.0 0.0 1.5 0.7 1.0 0.0000

mmu-mir-410-3p 0.0 0.0 0.0 0.0 0.0 1.5 0.7 1.0 0.0000

mmu-let-7a-2-5p_+_3 1.1 0.9 1.0 0.2 1.0 1.4 1.2 0.3 0.8409

mmu-let-7f-1-5p_+_1 1.6 0.8 1.2 0.6 0.7 1.4 1.0 0.5 1.1312

mmu-mir-29b-2-3p_-_1 2.5 1.4 1.9 0.7 0.0 1.4 0.7 1.0 2.7518

mmu-mir-29b-1-3p_-_1 2.5 1.4 1.9 0.7 0.0 1.4 0.7 1.0 2.7518

mmu-mir-455-3p_-_1 1.1 1.1 1.1 0.0 2.4 1.4 1.9 0.7 0.6092

mmu-let-7a-1-5p_+_3 1.1 0.9 1.0 0.2 1.0 1.4 1.2 0.3 0.8714

of 55


Diabetes

mmu-mir-669c-5p 0.8 1.0 0.9 0.2 0.8 1.4 1.1 0.4 0.8214

mmu-mir-505-5p 1.1 1.4 1.3 0.2 0.7 1.4 1.0 0.5 1.2558

mmu-mir-27b-5p_-_1 1.1 0.0 0.5 0.8 0.0 1.4 0.7 1.0 0.7859

mmu-mir-191-5p_+_5 0.7 0.0 0.4 0.5 0.0 1.4 0.7 1.0 0.5239

mmu-mir-132-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.4 0.7 1.0 0.0000

mmu-let-7f-2-5p_+_3 1.0 1.1 1.1 0.0 0.0 1.3 0.7 0.9 1.6133

mmu-mir-365-2-5p_-_1 2.4 2.0 2.2 0.3 1.6 1.3 1.5 0.2 1.5011

mmu-mir-676-3p_+_1 0.0 1.2 0.6 0.9 0.9 1.3 1.1 0.3 0.5505

mmu-mir-1948-3p_-_1 1.6 1.7 1.6 0.1 0.8 1.3 1.1 0.3 1.5289

mmu-mir-296-5p 0.0 1.6 0.8 1.1 0.8 1.3 1.0 0.4 0.7541

mmu-mir-672-5p 0.0 0.0 0.0 0.0 0.7 1.3 1.0 0.4 0.0000

mmu-mir-340-5p_-_1 2.2 1.0 1.6 0.8 0.7 1.3 1.0 0.4 1.6140

mmu-mir-22-3p_+_3 1.4 1.3 1.4 0.1 0.0 1.3 0.6 0.9 2.1126

mmu-mir-21-5p_+_5 1.0 0.9 1.0 0.1 0.0 1.3 0.6 0.9 1.5335

mmu-mir-148b-5p_+_1 0.0 0.9 0.5 0.7 0.0 1.3 0.6 0.9 0.7185

mmu-mir-125a-5p_+_4 0.7 0.0 0.4 0.5 0.0 1.3 0.6 0.9 0.5821

mmu-mir-92b-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.3 0.6 0.9 0.0000

mmu-mir-26a-2-5p_+_4 1.6 0.0 0.8 1.1 0.8 1.3 1.0 0.3 0.7891

mmu-mir-26a-1-5p_+_4 1.6 0.0 0.8 1.1 0.8 1.3 1.0 0.3 0.7891

mmu-mir-501-5p 0.0 0.0 0.0 0.0 0.0 1.3 0.6 0.9 0.0000

mmu-mir-187-3p_+_1 0.8 1.0 0.9 0.1 1.1 1.2 1.1 0.1 0.8004

mmu-mir-148a-3p_+_3 3.7 0.0 1.9 2.6 1.1 1.2 1.1 0.1 1.6210

mmu-mir-1934-5p 0.0 1.1 0.5 0.8 0.8 1.2 1.0 0.3 0.5363

mmu-mir-365-2-5p 2.4 1.0 1.7 1.0 0.8 1.2 1.0 0.3 1.7057

mmu-mir-3082-3p_+_2 1.6 0.8 1.2 0.5 0.8 1.2 1.0 0.3 1.1767

mmu-mir-26a-1-5p_+_3 1.6 0.0 0.8 1.1 0.7 1.2 1.0 0.3 0.8303

mmu-mir-26a-2-5p_+_3 1.6 0.0 0.8 1.1 0.7 1.2 1.0 0.3 0.8303

mmu-mir-421-3p_+_4 1.0 0.0 0.5 0.7 0.7 1.2 1.0 0.3 0.5283

mmu-mir-615-3p 0.0 0.0 0.0 0.0 0.7 1.2 1.0 0.3 0.0000

mmu-mir-28-3p_-_1 0.7 0.9 0.8 0.1 0.7 1.2 0.9 0.4 0.8800

mmu-mir-16-2-3p 1.1 2.0 1.5 0.6 0.0 1.2 0.6 0.8 2.5563

mmu-mir-16-1-3p 0.7 1.4 1.0 0.4 0.0 1.2 0.6 0.8 1.7239

mmu-mir-190b-5p 0.8 0.8 0.8 0.0 0.0 1.2 0.6 0.8 1.3500

mmu-mir-32-3p 1.4 0.0 0.7 1.0 0.0 1.2 0.6 0.8 1.1976

mmu-mir-192-5p_+_5 1.1 0.0 0.5 0.8 0.0 1.2 0.6 0.8 0.8982

mmu-mir-200b-3p_+_2 1.0 0.0 0.5 0.7 0.0 1.2 0.6 0.8 0.8483

mmu-let-7e-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.2 0.6 0.8 0.0000

mmu-mir-132-5p 0.0 0.0 0.0 0.0 0.0 1.2 0.6 0.8 0.0000

mmu-mir-425-3p_-_2 0.0 0.0 0.0 0.0 0.0 1.2 0.6 0.8 0.0000

mmu-let-7f-1-5p_+_3 0.9 0.0 0.4 0.6 0.0 1.2 0.6 0.8 0.7394

mmu-mir-21-5p_+_6 1.0 1.2 1.1 0.1 0.0 1.2 0.6 0.8 1.9188

of 55


Diabetes

mmu-let-7d-5p_+_3 0.0 0.0 0.0 0.0 0.0 1.1 0.6 0.8 0.0000

mmu-mir-3107-3p 1.0 2.1 1.6 0.8 1.7 1.1 1.4 0.4 1.1330

mmu-mir-196b-5p 1.3 1.4 1.3 0.1 1.5 1.1 1.3 0.3 0.9920

mmu-mir-1981-3p_+_1 2.2 1.7 1.9 0.3 1.2 1.1 1.2 0.1 1.6602

mmu-let-7b-5p_+_5 0.0 1.2 0.6 0.9 1.1 1.1 1.1 0.0 0.5560

mmu-mir-193b-3p_+_1 0.0 0.0 0.0 0.0 1.0 1.1 1.1 0.1 0.0000

mmu-let-7g-3p_+_1 0.8 1.8 1.3 0.7 0.8 1.1 1.0 0.2 1.3435

mmu-mir-222-3p_-_2 0.0 0.8 0.4 0.6 0.0 1.1 0.6 0.8 0.7015

mmu-mir-30a-5p_+_4 1.1 0.0 0.5 0.8 0.0 1.1 0.6 0.8 0.9673

mmu-mir-26a-2-5p_+_2 1.1 0.0 0.5 0.8 0.0 1.1 0.6 0.8 0.9673

mmu-mir-3060-3p_+_2 1.0 0.0 0.5 0.7 0.0 1.1 0.6 0.8 0.9135

mmu-mir-30a-5p_+_5 1.0 0.0 0.5 0.7 0.0 1.1 0.6 0.8 0.8598

mmu-mir-106a-5p 0.7 0.0 0.4 0.5 0.0 1.1 0.6 0.8 0.6717

mmu-mir-129-1-3p 0.7 0.0 0.4 0.5 0.0 1.1 0.6 0.8 0.6448

mmu-mir-5122_+_8 0.0 0.0 0.0 0.0 0.0 1.1 0.6 0.8 0.0000

mmu-mir-132-3p_+_2 0.0 0.0 0.0 0.0 0.0 1.1 0.6 0.8 0.0000

mmu-mir-122-5p_+_7 1.0 0.9 1.0 0.1 0.7 1.1 0.9 0.3 1.0683

mmu-mir-92a-1-3p_+_4 0.0 0.0 0.0 0.0 0.0 1.1 0.5 0.8 0.0000

mmu-mir-490-3p 0.0 0.0 0.0 0.0 0.0 1.1 0.5 0.8 0.0000

mmu-let-7c-2-5p_+_6 0.8 0.0 0.4 0.6 0.0 1.1 0.5 0.7 0.7741

mmu-let-7c-2-5p_-_1 0.7 0.8 0.8 0.1 0.0 1.0 0.5 0.7 1.4933

mmu-mir-148a-3p_+_5 2.0 0.8 1.4 0.9 0.8 1.0 0.9 0.1 1.5178

mmu-mir-425-5p_+_1 1.1 1.8 1.5 0.5 0.7 1.0 0.9 0.2 1.6665

mmu-mir-16-1-5p_+_1 0.8 1.4 1.1 0.4 0.0 1.0 0.5 0.7 2.0986

mmu-mir-30a-5p_+_7 1.4 1.1 1.3 0.2 0.0 1.0 0.5 0.7 2.4443

mmu-mir-338-5p_-_2 1.5 1.1 1.3 0.3 0.0 1.0 0.5 0.7 2.4917

mmu-mir-301b-3p 0.0 0.8 0.4 0.6 0.0 1.0 0.5 0.7 0.7945

mmu-mir-191-5p_+_2 1.2 0.0 0.6 0.8 0.0 1.0 0.5 0.7 1.1643

mmu-mir-26a-1-5p_+_2 1.1 0.0 0.5 0.8 0.0 1.0 0.5 0.7 1.0479

mmu-mir-592-5p_+_1 1.0 0.0 0.5 0.7 0.0 1.0 0.5 0.7 0.9897

mmu-mir-664-3p_+_2 1.0 0.0 0.5 0.7 0.0 1.0 0.5 0.7 0.9314

mmu-mir-223-3p_-_1 0.8 0.0 0.4 0.6 0.0 1.0 0.5 0.7 0.8150

mmu-mir-326-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-5122_+_1 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-100-5p_-_1 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-330-3p 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-485-3p_+_1 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-5102_-_4 1.6 1.5 1.5 0.1 6.3 1.0 3.6 3.7 0.4230

mmu-let-7a-1-5p_+_4 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-let-7a-2-5p_+_4 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-let-7f-1-5p_+_6 0.9 0.8 0.8 0.1 0.0 1.0 0.5 0.7 1.7169

of 55


Diabetes

mmu-mir-151-5p_+_1 1.0 1.2 1.1 0.1 0.7 1.0 0.8 0.2 1.3634

mmu-mir-296-3p 0.0 0.0 0.0 0.0 0.0 1.0 0.5 0.7 0.0000

mmu-mir-122-5p_-_2 0.9 0.0 0.4 0.6 0.9 0.9 0.9 0.0 0.4851

mmu-mir-99a-5p_+_5 1.6 0.9 1.3 0.5 0.7 0.9 0.8 0.2 1.5788

mmu-mir-130a-3p_-_1 1.3 1.4 1.3 0.0 0.0 0.9 0.5 0.7 2.8292

mmu-mir-664-5p_+_1 0.9 1.4 1.1 0.3 0.0 0.9 0.5 0.7 2.3846

mmu-mir-16-2-5p_+_1 0.8 1.4 1.1 0.4 0.0 0.9 0.5 0.7 2.2893

mmu-mir-130a-3p_+_4 0.0 1.1 0.6 0.8 0.0 0.9 0.5 0.7 1.2059

mmu-mir-29b-2-5p 0.7 1.1 0.9 0.2 0.0 0.9 0.5 0.7 1.8926

mmu-mir-100-5p_+_4 0.9 0.8 0.8 0.1 0.0 0.9 0.5 0.7 1.7817

mmu-mir-30d-5p_+_2 0.9 0.0 0.5 0.7 0.0 0.9 0.5 0.7 0.9844

mmu-let-7c-1-5p_+_6 0.8 0.0 0.4 0.5 0.0 0.9 0.5 0.7 0.8044

mmu-mir-744-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-455-3p_-_3 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-221-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-351-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-223-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-5117-3p_-_7 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-218-1-5p 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-382-5p 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.7 0.0000

mmu-mir-5102_-_8 0.6 0.8 0.7 0.1 4.4 0.9 2.7 2.5 0.2624

mmu-mir-16-2-5p_-_1 0.0 1.4 0.7 1.0 0.0 0.9 0.5 0.6 1.5397

mmu-mir-191-5p_+_7 1.0 1.2 1.1 0.2 0.0 0.9 0.5 0.6 2.4068

mmu-let-7f-2-5p_+_4 1.1 0.9 1.0 0.1 0.0 0.9 0.5 0.6 2.1471

mmu-mir-27a-3p_-_1 0.7 0.0 0.3 0.5 0.0 0.9 0.5 0.6 0.7651

mmu-mir-187-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.6 0.0000

mmu-mir-34b-5p 0.0 0.0 0.0 0.0 0.0 0.9 0.5 0.6 0.0000

mmu-let-7g-5p_+_6 0.8 0.0 0.4 0.6 0.0 0.9 0.4 0.6 0.9329

mmu-mir-20b-5p 0.0 0.0 0.0 0.0 0.0 0.9 0.4 0.6 0.0000

mmu-mir-1940 1.0 0.0 0.5 0.7 1.5 0.9 1.2 0.5 0.4052

mmu-let-7f-2-3p 7.0 5.7 6.4 0.9 3.3 0.0 1.7 2.4 3.8095

mmu-mir-5102_-_2 1.0 1.2 1.1 0.1 3.1 0.0 1.6 2.2 0.6846

mmu-mir-5102_-_7 0.7 0.9 0.8 0.2 2.8 0.0 1.4 2.0 0.5912

mmu-mir-486-5p_-_2 1.7 3.8 2.8 1.4 2.5 0.0 1.2 1.8 2.2158

mmu-mir-28c_-_1 3.0 3.1 3.1 0.1 2.4 0.0 1.2 1.7 2.5175

mmu-mir-5102_+_8 0.0 0.0 0.0 0.0 2.0 0.0 1.0 1.4 0.0000

mmu-mir-1247-3p 2.3 0.0 1.1 1.6 1.9 0.0 1.0 1.4 1.1739

mmu-mir-215-3p 14.5 1.2 7.9 9.4 1.8 0.0 0.9 1.2 8.9372

mmu-mir-5126 0.0 0.9 0.4 0.6 1.6 0.0 0.8 1.1 0.5440

mmu-mir-33-3p 2.2 1.1 1.7 0.8 1.6 0.0 0.8 1.1 2.1288

mmu-mir-375-3p_-_1 1.3 0.0 0.6 0.9 1.5 0.0 0.7 1.0 0.8650

of 55


Diabetes

mmu-mir-1943-5p 1.0 0.9 0.9 0.1 1.2 0.0 0.6 0.9 1.5442

mmu-mir-1247-5p_-_1 0.8 0.0 0.4 0.6 1.2 0.0 0.6 0.8 0.7284

mmu-mir-486-5p_+_1 0.9 1.6 1.3 0.5 1.1 0.0 0.5 0.8 2.2903

mmu-mir-3107-5p_+_1 0.9 1.6 1.3 0.5 1.0 0.0 0.5 0.7 2.4251

mmu-mir-1843-3p_-_3 0.0 0.0 0.0 0.0 1.0 0.0 0.5 0.7 0.0000

mmu-mir-128-1-5p 0.8 0.9 0.8 0.0 1.0 0.0 0.5 0.7 1.7449

mmu-mir-328-3p_-_1 0.8 0.7 0.8 0.0 1.0 0.0 0.5 0.7 1.5731

mmu-mir-375-3p_+_1 1.0 0.0 0.5 0.7 1.0 0.0 0.5 0.7 0.9886

mmu-mir-3105-5p 0.0 0.0 0.0 0.0 1.0 0.0 0.5 0.7 0.0000

mmu-mir-139-3p_+_3 0.0 0.9 0.4 0.6 0.9 0.0 0.5 0.6 0.9386

mmu-let-7b-5p_-_1 0.0 0.8 0.4 0.6 0.9 0.0 0.5 0.6 0.8604

mmu-mir-5102_+_1 0.8 0.0 0.4 0.6 0.9 0.0 0.5 0.6 0.8568

mmu-mir-1948-5p 1.3 1.2 1.2 0.1 0.9 0.0 0.4 0.6 2.8027

mmu-mir-383-5p 1.7 1.2 1.5 0.4 0.8 0.0 0.4 0.6 3.4724

mmu-mir-5126_+_1 0.0 0.0 0.0 0.0 0.8 0.0 0.4 0.6 0.0000

mmu-mir-1968-5p_-_2 1.4 1.2 1.3 0.1 0.8 0.0 0.4 0.6 3.4044

mmu-mir-351-3p_+_2 0.0 0.0 0.0 0.0 0.8 0.0 0.4 0.6 0.0000

mmu-mir-351-5p_+_1 0.0 0.0 0.0 0.0 0.7 0.0 0.4 0.5 0.0000

mmu-mir-30d-5p_+_6 0.0 0.0 0.0 0.0 0.7 0.0 0.4 0.5 0.0000

mmu-mir-15a-3p 1.0 1.2 1.1 0.1 0.7 0.0 0.3 0.5 3.3409

mmu-mir-486-3p_-_2 0.0 0.9 0.4 0.6 0.7 0.0 0.3 0.5 1.2799

mmu-mir-328-3p_+_1 0.0 0.8 0.4 0.6 0.7 0.0 0.3 0.5 1.1732

mmu-mir-201-5p 1.7 0.0 0.8 1.2 0.7 0.0 0.3 0.5 2.5164

mmu-mir-30c-1-3p_+_1 0.9 0.0 0.4 0.6 0.7 0.0 0.3 0.5 1.3481

mmu-mir-30d-5p_+_5 0.0 0.0 0.0 0.0 0.7 0.0 0.3 0.5 0.0000

mmu-mir-27a-5p 0.0 0.0 0.0 0.0 0.7 0.0 0.3 0.5 0.0000

mmu-mir-144-5p_+_1 1.4 1.7 1.5 0.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-29c-3p_+_4 1.3 1.6 1.4 0.3 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26b-5p_-_1 0.8 1.6 1.2 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-219-1-5p 0.9 1.5 1.2 0.4 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1933-3p 1.4 1.2 1.3 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-16-2-5p_+_5 1.3 1.2 1.3 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-192-5p_-_2 2.0 1.2 1.6 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-192-3p_-_1 0.0 1.2 0.6 0.9 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-16-1-5p_+_5 1.3 1.2 1.2 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3073-3p 0.9 1.1 1.0 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-802-5p_-_1 2.7 1.0 1.8 1.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-16-1-3p_-_1 0.0 1.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-486-5p_+_3 0.9 1.0 1.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-98-3p 1.5 0.9 1.2 0.4 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10a-5p_+_5 1.4 0.9 1.2 0.4 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-26a-2-5p_-_1 1.2 0.9 1.1 0.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-126-5p_-_1 0.0 0.9 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30a-5p_-_1 1.1 0.9 1.0 0.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-203-3p_-_1 1.0 0.9 0.9 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-17-5p_-_1 0.8 0.9 0.8 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-137-3p_+_1 0.8 0.9 0.8 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-295-3p 0.8 0.9 0.8 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-186-5p_-_1 0.0 0.9 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-22-3p_+_5 1.0 0.8 0.9 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-101c_-_2 0.7 0.8 0.7 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-2-3p_+_2 1.0 0.8 0.9 0.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-1-3p_+_2 1.0 0.8 0.9 0.2 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-374-3p_-_7 1.0 0.8 0.9 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-98-3p_+_1 0.8 0.8 0.8 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10a-3p_-_1 0.8 0.8 0.8 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3107-5p_+_3 0.7 0.8 0.7 0.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-126-5p_+_2 3.5 0.0 1.8 2.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-194-1-3p 2.3 0.0 1.2 1.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-148a-3p_+_7 1.8 0.0 0.9 1.3 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1843-5p_-_2 1.8 0.0 0.9 1.3 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-126-3p_+_2 1.8 0.0 0.9 1.3 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-203-3p_+_2 1.5 0.0 0.8 1.1 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3082-3p_-_1 1.4 0.0 0.7 1.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26b-5p_+_2 1.3 0.0 0.7 0.9 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-126-5p_+_3 1.2 0.0 0.6 0.8 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-505-3p 1.1 0.0 0.5 0.8 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-191-5p_+_3 1.1 0.0 0.5 0.8 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30c-1-5p_-_1 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30c-2-5p_-_1 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-7a-1-3p_+_1 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-101b-3p_-_2 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-27b-3p_+_2 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-676-5p_+_1 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-15a-5p_-_1 1.0 0.0 0.5 0.7 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1960 0.9 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-802-3p_-_1 0.9 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26b-5p_+_3 0.9 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1948-5p_-_1 0.9 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26a-1-5p_-_1 0.9 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-29c-3p_+_2 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7g-5p_+_1 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-let-7f-1-5p_+_4 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-192-5p_-_3 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26a-1-5p_-_3 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-203-3p_-_2 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-28c_-_3 0.8 0.0 0.4 0.6 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-101b-3p_+_4 0.8 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-16-2-5p_+_4 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-16-1-5p_+_4 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-107-5p 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10a-5p_+_4 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7g-5p_-_2 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1843-3p_-_2 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1955-3p 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30a-5p_+_6 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-338-3p_+_1 0.7 0.0 0.4 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-151-5p_-_2 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10a-3p_-_2 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30d-5p_-_1 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-29c-5p_+_1 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-30a-5p_+_3 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-378b 0.7 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7e-5p_-_1 0.6 0.0 0.3 0.5 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-21-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-155-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-133a-1-3p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7c-2-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-9-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3970_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-323-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-452-5p_-_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-329-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7b-5p_+_6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-504-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-215-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-668-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1306-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-191-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200b-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-5p_+_4 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-375-3p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-760-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-193b-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7a-2-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181a-1-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-708-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-615-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-341-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-141-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3074-1-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-133b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-467e-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-380-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-141-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-377-3p_-_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-341-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200b-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-378-3p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-378-3p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-409-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-5117-3p_-_8 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-124-3-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181b-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-1-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7d-5p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3058-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1843b-3p_-_4 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7i-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-194-1-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181a-2-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-124-2-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181c-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181c-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-5117-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-490-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-205-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-183-5p_+_7 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-421-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-467e-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-183-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-382-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-495-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3074-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-138-1-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1a-2-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-141-5p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-490-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7c-1-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200a-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-20a-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-467c-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-127-3p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-9-3-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-667-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-214-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-153-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-384-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-411-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-218-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1224-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-329-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-668-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-300-3p_+_4 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-124-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-23b-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-127-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-5117-3p_-_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7e-5p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-455-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-154-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1983 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-369-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-143-3p_+_4 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10a-5p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-299-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-127-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-673-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200c-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7i-5p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1a-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-130b-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-483-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-7b-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-26a-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-487b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-708-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-363-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-147-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-760-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3102-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-449a-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-434-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-129-2-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-218-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-23a-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-369-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-5p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-429-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-215-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-375-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-543-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-204-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-133b-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-21-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-1-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-429-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-34b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-19a-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-488-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-28-3p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-182-5p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-376a-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-138-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-1-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-1-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1199-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200b-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-5117-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-10b-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-708-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-5p_+_4 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7f-2-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-433-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-770-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-490-3p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-200c-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-127-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-7a-2-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-204-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-485-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-5122 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-3p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-383-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-376b-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-103-2-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-370-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-125a-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-376c-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-378-3p_+_6 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-2-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-92a-1-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7i-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3572_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-147-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7i-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-214-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-679-5p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3099-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-379-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-877-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-485-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-145-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-496-3p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-125a-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-143-3p_+_5 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

mmu-mir-141-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7f-1-5p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-136-3p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-181c-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-196a-2-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-9-1-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-125a-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-666-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-376b-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-1-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-24-2-5p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-3074-1-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7b-5p_+_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-485-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-141-5p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-143-3p_-_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-485-5p_-_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-133a-2-3p_+_2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7d-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-136-3p 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-1306-3p_-_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-136-5p_-_3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-541-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-mir-182-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

mmu-let-7a-1-5p_+_1 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 #DIV/0!

of 55


Diabetes

microRNA-29 fine-tunes the expression of key FOXA2 ... · 1 microRNA-29 fine-tunes the expression...

Documents

Transcript of microRNA-29 fine-tunes the expression of key FOXA2 ... · 1 microRNA-29 fine-tunes the expression...