Micetalk November 2013
-
Upload
ashish-chakraborty -
Category
Documents
-
view
222 -
download
6
description
Transcript of Micetalk November 2013
Rs. 100 Rs. 100
Volume IV Issue 11 November 2013 60 pagesA DDP Publication
Rs. 100
Fairmont Jaipur
Publisher & Editor
Editor-in-Chief
Desk Editor
Correspondent
Photographer
Design
Advertising
Advertisement Designer
Production Manager
Circulation Manager
MUMBAI: Advertising
SanJeet
Deepa Sethi
Neelam Singh
Neha Oberoi
Simran Kaur
Pooja Kalra
Gunjan Sabikhi Geetika Pathak Shovan Kanungo Udit Pandey Yogita Bhurani
Vikas Mandotia Nitin Kumar Aarushi Agrawal
Anil Kharbanda
Ashok Rana
Harshal Ashar
DDP Publications Private Limited
New Delhi: 72, Todarmal Road, New Delhi 110001, IndiaTel: +91 11 41669575, 41669576 Fax: +91 11 41669577E-mail: [email protected]
Mumbai: 504 Marine Chambers, 43 New Marine Lines, Mumbai 400 020, IndiaTel: +91-22-22070129, 22070130Fax: +91-22-22070131E-mail: [email protected]
UAE: P.O. Box: 9348, Sharjah, UAETel: +971 6 5528954, Fax: +971 6 5528956E-mail: [email protected]
All information in MICEtalk is derived from sources, which we consider reliable. Information is passed on to our readers without any responsibility on our part. The contents of this publication contain views of authors and are not the views of DDP Publications.
Similarly, opinions/views expressed by any party in abstract and/or in interviews are not necessarily shared/do not necessarily reflect any opinion of DDP Publications. All rights reserved throughout the world. Reproduction strictly prohibited. Material appearing in MICEtalk cannot be reproduced in whole or in part without prior written permission. The same rule applies when there is a copyright or the article is taken from another publication. Publications reproducing material either in part or in whole, without permission would face legal action.
Editorial enquiries and enquiries concerning the reproduction of articles should be emailed to [email protected], advertising and circulation enquiries should be e-mailed to [email protected]
The publisher assumes no responsibility for returning unsolicited material nor is he responsible for material lost or damaged in transit. Any material submitted to MICEtalk will not be returned. The publisher reserves the rights to refuse, withdraw, amend or otherwise deal with all advertisements without explanation. All advertisements must comply with the Indian Advertisements Code as well as the Advertisements Code of South Asia. The publisher will not be liable for any damage or loss caused by the late publication, error or failure or advertisement or editorial to appear.
MICEtalk is printed, published, edited and owned by SanJeet, printed at Cirrus Graphics Pvt. Ltd., B-62/14, Phase – II, Naraina Industrial Area, New Delhi-110028 and published at 72, Todarmal Road, New Delhi-110001
6 MICEtalk November 2013
Dear Reader,
With the weather getting cooler and more pleasant and the
fall of the rupee against the greenback, India is actually seeing
a rise in tourism figures, especially for MICE, not only from
international destinations but also domestically. Corporate
houses are preferring to travel for their events within the
country rather than flying to distant shores at the cost of
much larger bucks, due to the exchange rate. It’s a big point
for discussion… read our Let’s Talk section.
MICEtalk spoke to some of the Indian destination
management companies and tourism industry leaders about
their opinion on expectations of today’s clients and the
advantages and disadvantages of MICE events held in India.
We bring you their opinions in the cover story of this issue.
When you talk about India, Yoga cannot be far behind. With
the popularity of India’s wellness and spiritual tourism growing
at a very healthy rate, Zambhala is a unique Yoga festival
being organised in Goa in December.
And if you have to travel far, then let’s go all the way to
Australia and New Zealand. Both the countries are putting
great efforts to building the MICE infrastructure and making
incentive travel more exciting. And now with Air India flying
the Dreamliner to Australia since August 2013, it has become
easier for MICE and incentive groups to reach these countries
conveniently.
We also have our experts tell us the right way to shake
hands at a business event, and be more systematic while
travelling… On that note I wish you all Happy Reading!
Deepa Sethi
reader’s PAGE
to the editor...“MICEtalk is a magazine that is developing its focus on technology and social media with great intent. And since here, at Internet Moghul, it has always been our belief that technology and social media are the leading trends for the MICE industry, we enjoy the magazine and the Tech Talk articles and have even contributed to them.”
Cheers Avijit
Avijit Arya, Chief Mogul, Internet Moguls
8
36
Facts
MICE CountryAustralia
MICE InitiativeMelbourne lures MICE travellers
Let’s TalkDollar fluctuation makes India more
attractive for MICE
Incentive TalkIncentives Galore in New Zealand
Domestic MICEKochi
Your’s OfficiallyReem Khokhar, Regional Manager,
VisitEngland
Event TalkMITT, Russia
Expert TalkLife Management
Hotel TalkITC Grand Chola, Chennai
Etiquette Talk
Tips for the Right Handshake
TechnologyProviding exhibitors with revenue generating leads
Movements
Events
Cover StoryProfiling India as a MICE destination
contents24
40
12
48
‘Thailand CONNECT’ campaign to boost MICE tourismThe Thailand Convention and Exhibition Bureau
(TCEB) unveiled ‘Thailand CONNECT, a global
marketing campaign for corporate buyers and
meetings organisers to promote Thailand as a
premier MICE destination. The campaign will
focus on three key aspects – diversity of Thai
destinations, unrivalled business opportunities,
and the high quality of Thailand’s MICE
professionals.
It is accompanied by a number of specific
promotional packages that will extend financial
support to MICE events and delegates attending
MICE events in Thailand, depending on their
country of origin and duration.
Malaysia expecting Unique Venue by 2015The Golden Bridge – a future icon in recognition
of Sarawak’s 50th Golden Jubilee Year, is set to be
a potential unique venue for cocktail parties and
themed events for that value-added experience
Sarawak has to offer. Named Golden Bridge in
recognition of Sarawak’s 50th Golden Jubilee Year of
independence from British rule, it measures 400m
long and looms 12m above the water. The S-shape
structural design was inspired by the meandering
rivers in the state.
Rail Europe’s mobile app acts as a travel guideRail Europe has launched a new mobile app
which is available on Android and iOS platforms.
One of its striking features is the ‘Station Guide’
which contains details of over 70 stations on
the Rail Europe network. It also comes with
a map that’s linked to Google Maps or Apple
Plan, which makes navigation easier. Its best
feature is a section for FAQs and help. If a
passenger (Indian) posts a question in Europe,
it immediately connects to the Indian Support
Centre for further assistance.
Madame Tussauds Museum to open in Beijing in 2014China will have its fourth Madame Tussauds
waxwork museum open next year in central
Beijing, close to Tiananmen Square. The attraction
will include a range of Chinese and international
celebrities from the worlds of sport, politics,
movies and TV, with no ropes or barriers
separating guests from the figures.
FA
CT
S
facts
‘China Products Exhibition’ in Mumbai to boost trading opportunitiesThe 11th edition of ‘China Products
(Mumbai, India) Exhibition’ will take
place from November 26–28, 2013 at
the Bombay Convention and Exhibition
Centre, Goregaon (East), Mumbai, India.
This unique trade expo showcases more
than 40 industries and will have an added
attraction in the form of a Hong Kong
Trade Development Council (HKTDC)
pavilion where companies from Hong
Kong will showcase their products.
Providing complimentary business
matching services, the Exhibition assists
Indian businesses in meeting their
future business partners from China and
Hong Kong.
facts
FA
CT
SRevolution in Event CommunicationsMarketingConnect is an integrated marketing
automation solution, designed to utilise event and
attendee behaviour information gathered from
other GenieConnect tools to generate relevant &
personalised content, which is then channelled
through attendee communications channels like
email, in app and push messages. This allows event
organisers to send highly targeted and relevant
information to attendees to maximise engagement
throughout the entire event life cycle.
Perfect Meeting Package by HiltonHilton Bandung launched two innovative,
exciting and carbon-neutral corporate events
programmes that creatively incorporate the
destination into the programmes. For the Perfect
Balance Meeting package, Hilton Bandung has
hitched one end of this initiative to Bandung
Treetop, a team-spirit and corporate bonding
specialist offering adrenaline-charged zip-line
flights, obstacles courses, tests of strength and
gravity-defying Tarzan leaps through the lush
rainforest and cool dense woodlands of Bandung.
Sydney to host the AYTE in 2014Sydney has been chosen as the host destination
for the 2014 Australian Youth Tourism Exchange
(AYTE). Held over three days from May 20-
22, 2014, Sydney will host the event for the
second time. The event includes scheduled
workshop appointments between distributors
and suppliers, networking events and post-
event familiarisations. In addition to AYTE, the
annual Australian Backpacker & Youth Industry
Conference (ABYIC) will be held in conjunction
with the event.
‘Work Now, Stay Later’ offer by Starwood HotelsStarwood Hotels & Resorts, one of the world’s largest
luxury and upper-scale hotel, launches its latest
meetings offer ‘Work Now, Stay Later’ with over
200 participating Starwood hotels in Asia-Pacific
valid until December 31, 2013 for meetings uptill
March 31, 2014.
As part of this promotion, members of the Starwood
Preferred Planner (SPP) will get one free night’s stay
to be credited to their accounts, for every 50 room
nights that they book. This is in addition to the
Starpoints® they will earn through revenue generated
by the Group booking.
10 MICEtalk November 2013
as a MICE destinationProfilingNeha Oberoi
India
Much has been said in the last couple of years and in our previous issues about the great potential of MICE in a country and how it helps boost the economy. In this issue, we are focussing on India, the promise it carries and the severity of the challenges it faces. Read on…
The commerce of MICE holds a lot
of allure for any country. Going
just by the ballpark figures, a single
person travelling for business purposes
spends approximately 5 times more than
a leisure traveller.
Fairmont Jaipur
cover story
MICEtalk November 2013 13
cover story
Right: India Expo Centre, Greater Noida
Incentive destinations in IndiaAnup Nair, President, Site India Chapter, opines, “There are separate segments that
constitute MICE. If it’s a large Meeting, Conference or Event, the bigger cities (with good
flight connections) and sometimes even smaller ones may be selected. It is the purpose
and objective of the event that will dictate this. The situation with Incentives is different.
The places we promote for incentives are where ‘experiences’ can be delivered and a ‘wow’
impact created. The most popular destinations are the Golden Triangle (Delhi, Agra and
Jaipur) and also other regions in Rajasthan – Samode, Neemrana, Jodhpur, and of course,
Udaipur. Incentive trips to Kerala are very regular and Mumbai and Goa are also quite
popular. Bangalore, Chennai and Mahabalipuram are also on the circuit, but not
that common.”
Expectations from a venueThe Indian MICE industry comes with dynamic business opportunities and splendid venues for events,
exhibitions, conferences and meetings. Evidently, the travel industry is thriving due to a phenomenal rise in
MICE activities.
While talking about India’s MICE industry, Sudeep Sarcar, General Manager,
India Exposition Mart Ltd, shares, “We are witnessing the emergence of new destinations
within the country. We are also seeing second-tier cities developing quickly and attracting
MICE business from major cities such as Mumbai and Delhi. This is further fuelled by the
opening of new hotels with MICE facilities, increasing the focus of DMCs. At the moment,
I would agree that India’s MICE industry is fragmented, with less specialisation than some
other destinations.”
He believes that the main challenge, currently faced by the industry, is the global
economic climate which has encouraged meetings industry suppliers to become a lot more
resourceful to generate the greatest return on investment. He further informs that, “In the present scenario, the
organiser basically wants a
one-window operation from
the venue so that they may
save time and energy from
approaching one department
to another to meet their
requirements. Also, since an
exhibition centre caters to
exhibitors and visitors from
both India and abroad, the
organisers expect the facilities
to be world-class to avoid any
awkward situation in front of
their clients.”
14 MICEtalk November 2013
cover story
Adding to the discussion, Shagun Sethi, Director - Sales & Marketing,
Fairmont Jaipur, points out, “Availability of large room inventories, spacious and
flexible meeting/banquet spaces and the latest technology and infrastructure attract
any event organiser. A positive history of successful events, a perception of safety and
security, close proximity to leisure experiences and a range of quality accommodation
are also crucial.”
Today, technology largely influences venue selection because the needs of attendees
differ according to the theme, purpose, location and volume. Size of a convention centre
is also critical because area layouts are specifically configured to maximise lines of sight
and attendee participation. The availability of comfortable and luxurious on-site accommodation is also a major
influencer clubbed with an eclectic array of fine dining options. Below: Fairmont Jaipur
On comparing
India with other
destinations,
Sanjay Grover,
General Manager,
TravelSpiderTM
(A division of
Paharpur Business
Centre), opines
that, “MICE industry has a huge scope for
growth and is at a nascent stage in India. It is
fragmented and requires to be streamlined.
We need to have some effective strategies to
make it successful.”
Discussing about the venue expectations,
Sanjay updates that organisers expect a venue
to be easily accessible in terms of domestic
and international flights and equipped with
amenities like Yoga and Ayurveda Centre,
Discotheque, Spa and Health and Wellness
facilities along with sports activities.
Below: Spa/Wellness Centre at Lebua Lodge, Amer
“It is an added advantage if a venue is equipped with amenities like Yoga & Ayurveda Centre, Discotheque, Spa & Health and Wellness facilities along with sports
activities like Tennis, Squash, Badminton, Golf Course, etc.
Above: Umaid Bhawan Palace, Jodhpur
cover story
The need of the hourMarketing a destinationA key driver of success for a hotel and convention space is being able to market itself as an appropriate venue.
Given the requirements of its guests, the efforts involve marketing the city, highlighting the support infrastructure
available and creating a unique experience for delegates.
Michel Koopman,
General Manager,
The Leela, speaks of
the same phenomenon,
“Hotels are big
beneficiaries of MICE
business but first the
destination is to be
sold. It is the allure of
the destination that
will invite traffic and
only then can we get
into the nitty-gritty of
convention spaces. We
need people to look
beyond the perception
of India as a mystic
place and more as a
MICE destination.”
Karan Anand, Head - Relationships, Cox & Kings Ltd, voices his opinion, “India
attracts its fair share of MICE movements though we could do even better. In cities such
as Mumbai, Delhi and NCR or for that matter Chennai, we need more 2 and 3-star hotels
that can accommodate a large number of delegates. The government should also be
more liberal in granting licenses to promote nightlife as it becomes very important when
choosing a MICE destination for companies.”
Below: Lobby of The Leela, New Delhi
18 MICEtalk November 2013
cover story
India has the potential of becoming a leading MICE player, but the lack of integrated convention centres that
people expect hampers the development per se.
Naveen Rizvi, Sr. Vice President- India & Head, ICE- Integrated Conference & Event
Management & TUI- Meetings & Incentives, says, “Though there has been considerable
improvement in the number of hotels and convention centres being opened, lack of quality
infrastructure is a major concern for MICE business in India. The country offers myriad of
experiences but the concentration is limited to a few places only. The Andaman & Nicobar
Islands, offering exotic beach vacations on the Indian Ocean, lack good quality hotels and
have extraordinary high airfares for a domestic incentive tour. Agra - the city with the
world famous Taj Mahal- has good MICE potential as it is situated on the famous Golden
Triangle route, however, has no direct air connectivity. Another destination which lacks
infrastructure from a MICE point of view is Goa. The destination has all ranges of hotels, event venues, ample of
pre-post tour options, except for a good convention centre. Only Grand Hyatt Goa offers convention facilities in
its premises to accommodate up to 1000 people. Also the fixed flight arrival/departure timing in Goa is of concern
for a good MICE Movement.”
World-class Infrastructure
cover story
Support from the government
Priti Khanna, Chairperson,
MCI Management India Pvt. Ltd., comments, “We need
some standard operating procedures in place where the
government steps in to provide support for conference
movement. The challenge for us is not infrastructure.
That’s secondary. Major challenge is government support
to make India an inviting MICE destination especially
in terms of approvals, permissions, letters, etc. Given
the broad canvass the support needs to come from
a joint effort of all relevant stakeholders such as the
government, airlines, hotels, convention centres, etc.”
The government is providing financial support for developing international convention centres
and tourism-related infrastructure but it is a process that is moving at a snail’s pace.
“ India has made
stupendous development in terms of
infrastructure and economy
and is working on upgrading
its MICE facilities.”
Below: Terminal 3 at the Indira Gandhi International Airport, Delhi
MICEtalk November 2013 21
cover story
As an emerging globalised service industry, MICE is valued by the government for its high growth
potential, large opportunities for employment, large industry associations and efficient utilisation of
assets. India is synonymous to warm hospitality and rich cultural heritage and has a strong appeal as
a MICE destination. With great hopes we can say that India is perched positively on the MICE path!
Sanjay Grover, GM, TravelSpiderTM, also feels
that taxes including service, luxury, entertainment,
sales or taxes on transportation and aviation turbine
fuel, levied across the tour operators, transporters,
airline industry, hotels, etc., make India an expensive
MICE destination. He further elaborates, “This
definitely requires a focussed approach if we want
MICE to become an integral segment of the overall
Tourism Industry. At present, incentive is the major
component in a mature MICE market. Indian
corporate world has been showing interest in taking
up MICE activities since few years. These days,
companies reward their employees with special
tour packages to motivate them. Starting from an
adventure trip to a hill station to a desert safari, one
can find out ample of options to offer as incentives.
Incentive schemes have to be promoted, which is
another challenge.”
Umaid Bhawan Palace,
Jodhpur, is one of the
largest heritage style
boutique hotel.
Above: Taj Lake
Palace, Udaipur
22 MICEtalk November 2013
Australia Offering Exclusive Meetings and Incentive options
Australia offers a plethora of MICE options with a bent towards innovative incentive activities. More and more business travellers are choosing it as a prime destination to add flavour to their incentive activities. Here’s a breakdown of the cities and the popular activities available:
Sydney Opera House at night
country talk
why Australia?
MICEtalk November 2013 25
“Australia offers an
exceptional range of top-end
corporate meeting experiences
and unique incentive options
that provide the perfect
atmosphere to reward and
energise. Australia has a
competitive advantage in its
vibrant cities, coastal lifestyle,
native wildlife, and vast
outback. For the year ended
July 2013, there was 21 per
cent increase in convention
and conference arrivals from
India, compared to the same
period last year.”
Nishant Kashikar,
Country Manager India,
Tourism Australia
26 MICEtalk November 2013
Sydney Convention Centre ,
Darling Harbour
Australia has a host of cities, each offering their own
unique experience for business events. Australia’s
coastal centres are perfect for business events with
excellent facilities right on the ocean front.
SydneySydney is one of Australia’s most cosmopolitan cities
with meeting facilities and venues complemented by
sustainable urban practices. Known for its architecture,
the Sydney Opera House and Sydney Harbour Bridge
make this city a very attractive MICE destination.
Sydney Convention & Exhibition Centre,
Darling Harbour
and monorail station access. Ferries and water taxis
provide a unique alternative journey between the
Cities with MICE facilitiesCentre and the city’s harbourside attractions.
delegates, six exhibition halls and 30,000m2 of total
exhibition space.
productions and event management.
Signature Incentive Activities
journey will provide some breathtaking views.
Opera House. Popular as an events location, the
Opera House also caters Indian food.
on Sydney Harbour.
motorcycle en route to the famous Bondi Beach.
262626262626262626262222262626 MICMICMICMICMICMICICICCMICMICMICMICMICMICMICMICEtaEtaEEtaEtaEEEtaEtaEtaEtaaEtaEtaEttt lklklklklklklklklk lk NovNovNovNovNNNoNovNovNovNovNoNoNNovembembembembembembembember er rrerer 2012201020120120101010113 3 33 3333
country talk
Skyline of Sydney
Gold Coast With 70 km of coastline, theme parks, private islands,
35,000 accommodation rooms and more than 600
restaurants and cafes, Australia’s Gold Coast continues
to enhance its business events reputation through the
acquisition of major infrastructure, the growth of
unique venues and different incentive based activities.
The Gold Coast offers award-winning, purpose-built
convention venues combined with unique meeting
spaces. The city can cater up to 6,000 delegates.
Signature incentive activities
with an Australian surf instructor.
touring the houses of the rich and the famous.
your delegates in a private evening at the picturesque
location can be set up for intimate dinners,
complemented by the luxurious cruise home.
just metres from rare Bengal and Sumatran tigers.
Delegates can even pat the tigers.
to the island of Tangalooma, famous for feeding
dolphins, is an unparalleled experience.
Gold Coast
Convention and
Exhibition Centre
The Palazzo Versace the Gold Coast
Queensland, Australia
Gold Coast offers
award-winning,
purpose-built convention
venues combined with
unique meeting spaces.
Perth Convention Exhibition Centre has 15,000sqm of exhibition floor space and a plenary facility for 2,500 delegates, supported by 18 additional meeting rooms.
venue capacity
conversions to historic homes. The ‘Six Star Green Star’ rated Melbourne Convention Centre boasts a 5,500 seat plenary, 52 meeting rooms, grand banquet room and foyer for 8,400 guests. The integrated Melbourne Exhibition Centre is 30,000 sqm.
venue capacity
28 MICEtalk November 2013
Melbourne A city of style and substance, Melbourne has more
than 25,500 rooms located in the Melbourne Tourist
Region with approximately 16,100 rooms in the City of
Melbourne and 9,400 in the central business district.
Incentive Options
at sunrise then sharpen your wine appreciation skills
at acclaimed vineyards.
vegetation program.
PerthThe sunniest city in the world, Perth boasts coastal
charm, colonial history, fantastic seafood and fabulous
wine. Perth has over 8,000 rooms to suit a variety
of budgets.
Incentive options
Coral Coast.
- pet koalas, wombats and other native wildlife at
Caversham Wildlife Park
of Perth’s iconic structures, the Bell Tower.
country talk
Above: South Wharf & Melbourne Convention and Exhibition Centre
Below: The bright green blob-like sculpture by Perth-born artist James Angus, at Forrest Place
Above: Formula One Grand Prix
Melbourne lures MICE travellers
MICE Initiative
GROUP SIZE MCB SUPPORT
100 – 299
Welcome Pack AWelcome bags, Official Visitors Guide,Melbourne mapSouvenir for every delegateWelcome banner at Melbourne AirportVIP gifts (numbers to be pre-determined)Welcome letter from MCB’s CEO
300-499
Welcome Pack AHosted pre-event site inspection includingground transfers, official meals andaccommodation for one delegate(3 days, 2 nights)
500 and above
Welcome Pack BWelcome speech by MCB’s CEO Hosted pre-event site inspection includingone economy flight, ground transfers,official meals and accommodationfor up to two delegates(3 days, 2 nights)Financial support towards use of theMelbourne Convention and ExhibitionCentre, if applicable(subject to government approval)
Melbourne moves strategically further in inviting incentive movement to Australia. MICEtalk puts forth their new incentive scheme to enhance group movement.
‘Melbourne Values You’ offers
(Support from Melbourne Convention Bureau (MCB))
The Melbourne Convention Bureau (MCB) has
teamed up with 30 of its members in the categories
of hotels, venues, attractions and team-building
companies to bring a series of special offers designed to
make booking and planning an event in Melbourne not
only seamless but cost effective.
The following table outlines the list of discounts or
complimentary services available through Melbourne’s
premier business events suppliers, which includes
everything from free Wi-Fi and hotel room upgrades
to reduced entry into attractions and on food and
beverage packages.
To take advantage of these offers, organisations must adhere to the
following criteria:
launch of this program in February 2013
Please note: Additional terms and conditions may apply.
All costs quoted are in Australian dollars.
30 MICEtalk November 2013
Below: The Arts Centre, Melbourne
Dollar fluctuation makes India more attractive for MICEThe depreciating of the Indian rupee is ringing alarm bells across sectors in the country. The fluctuating dollar is on everyone’s mind. MICEtalk talks to some hotel stalwarts to know how the hotel industry is going to be affected and what is the next step forward? Read more...
let’s talk
32 MICEtalk November 2013
let’s talk
VELLA RAMASAWMYGeneral Manager, Kempinski Ambience Hotel, Delhi
Witnessing Marginal Growth
We are ready to cater to large
format conferences along with World
congresses into India.
Hoping for Positive SignsJAGAN LASCHERGeneral Manager, Pullman Gurgaon Central Park
“MICE Industry dynamics are relatively sensitive to currency
more lucrative and competitive for large International Conferences vis-a-vis regional destinations like Singapore, Bangkok, Hong Kong, etc.
In recent times, Indian hotels have seen increased dependency on domestic conferencing. Since a strong dollar has hit aviation fuel prices, resulting in hike in airfares, overall budgets for domestic conferences
India has become more lucrative and
competitive for large International
Conferences vis-a-vis regional
destinations like Singapore, Bangkok,
Hong Kong, etc.
MICEtalk November 2013 33
Below: Lobby of Shangri-La, New Delhi
let’s talk
With greater buying power in India, we have
witnessed an increase in numbers from key
markets like UK and some unconventional
markets like Africa.
Expecting customers from new marketsSAURABH KHURANA Director of Business Development & MICE, Shangri-La’s - Eros Hotel, New Delhi
important to note that the rupee had depreciated by about 15-16 per cent against the greenback over the last six months and hence, the consumers have shifted their focus to non-dollar destinations.
the MICE Industry is building up of quality convention centres in the country in
Incentives Galore in New Zealand
Roaring Meg on the Kawarau River
incentive talk
New Zealand’s unforgettable mix of breath-taking natural landscapes and vibrant cosmopolitan centres makes it a perfect location for conferences, business events and incentive visitors. With companies increasingly looking at overseas incentive and team-building destinations, the country boasts of an array of activities and experiences.
New Zealand’s unforgettable mix of breath-taking natural landscapes and vibrant cosmopolitan centres makes it a perfect location for conferences, business events and incentive visitors. With companies increasingly looking at overseas incentive and team-building destinations, the country boasts of an array of activities and experiences.
New Zealand’s unforgettable mix of breath-taking natural landscapes and vibrant cosmopolitan centres makes it a perfect location for conferences, business events and incentive visitors. With companies increasingly looking at overseas incentive and team-building destinations, the country boasts of an array of activities and experiences.
NNNNNNNNNNNNeeeeeeeeeeewwwwwwwwwwww ZZZZZZZZZZZZeeeeeeeeeeeaaaaaaaaaaalllllllllllllaaaaaaaaaannnnnnnnnnddddddddddddd’’’’’’’’ssssssss uuuuuuuuuuunnnnnnnnnnfffffffffffffooooooooorrrrrrrrrrggggggggggeeeeeeeeeeetttttttttttttttttttttttaaaaaaaaaabbbbbbbbbbbbblllllllllllleeeeeeeeeeee mmmmmmmmmmmiiiiiiiiiiixxxxxxxxxxx oooooooooooofffffffffffff bbbbbbbbbbbbbrrrrrrrrrreeeeeeeeeeaaaaaaaaaaattttttttttttthhhhhhhhhhhh-----tttttttttttaaaaaaaaaaakkkkkkkkkkkkkkiiiiiiiiiiiinnnnnnnnggggggggggg nnnnnnnnnaaaaaaaaaaatttttttttttttuuuuuuuuuurrrrrrrrrraaaaaaaaaaalllllllllllll lllllllaaaaaaaaaannnnnnnnnndddddddddddddsssssssssccccccccccaaaaaaaaaaapppppppppppeeeeeeeeeeeesssssssssss aaaaaaaaaaaaannnnnnnnnddddddddddddd NNNNNNNNNNeeeeeeeeewwwwwwwww ZZZZZZZZZeeeeeeeaaaaaaaaallllllllllaaaaaaaannnnnnnnndddddddddd’’’’’’ssssss uuuuuuuuunnnnnnnffffffffooooooorrrrrrrrggggggggeeeeeeeeeetttttttttttttttttaaaaaaaaabbbbbbbbbbbllllllllleeeeeeee mmmmmmmmiiiiiiiixxxxxxxxx ooooooooofffffffff bbbbbbbbbrrrrrrrreeeeeeeeaaaaaaaaattttttttthhhhhhhhh----ttttttttaaaaaaaaakkkkkkkkkkkkiiiiiiiinnnnnnggggggggg nnnnnnnnaaaaaaaaatttttttttuuuuuuuurrrrrrraaaaaaaaalllllllllll lllllaaaaaaaannnnnnnnnddddddddddssssssssccccccccaaaaaaaaappppppppppeeeeeeeeessssssss aaaaaaaaaannnnnnnnnddddddddddNNNNNNNeeeeeewwwwww ZZZZZeeeeaaaaaalllllllaaaaaannnnnndddddd’’’’ssss uuuuunnnnnffffffooooorrrrrggggggeeeeeetttttttttttaaaaaabbbbbbblllllleeeee mmmmmiiiiixxxxx ooooooffffff bbbbbbrrrrreeeeeeaaaaaatttttthhhhhh---tttttaaaaaakkkkkkkiiiiinnnnggggg nnnnnaaaaaattttttuuuuurrrrraaaaaallllll lllaaaaaannnnnnddddddssssscccccaaaaaappppppeeeeeesssss aaaaaaannnnnddddddNNNNNNNeeeeeewwwwww ZZZZZeeeeaaaaaalllllllaaaaaannnnnndddddd’’’’ssss uuuuunnnnnffffffooooorrrrrggggggeeeeeetttttttttttaaaaaabbbbbbblllllleeeee mmmmmiiiiixxxxx ooooooffffff bbbbbbrrrrreeeeeeaaaaaatttttthhhhhh---tttttaaaaaakkkkkkkiiiiinnnnggggg nnnnnaaaaaattttttuuuuurrrrraaaaaallllll lllaaaaaannnnnnddddddssssscccccaaaaaappppppeeeeeesssss aaaaaaannnnnddddddvvvvvvvvvvvviiiiiiiiiiiibbbbbbbbbbbbrrrrrrrrraaaaaaaaaannnnnnnnnntttttttttt cccccccccoooooooooosssssssssmmmmmmmmmmoooooooooppppppppppoooooooooollllllllllliiiiiiiiiiittttttttttaaaaaaaaaannnnnnnnnn cccccccccceeeeeeeeeennnnnnnnntttttttttttrrrrrrrrreeeeeeeeeessssssssss mmmmmmmmmmmmaaaaaaaaaaakkkkkkkkkkkkkkeeeeeeeeeesssssssssss iiiiiitttttttttt aaaaaaaaaaaa ppppppppppppeeeeeeeeeeerrrrrrrrrrffffffffffffeeeeeeeeeeccccccccccttttttttt llllllloooooooooccccccccccaaaaaaaaaaattttttttttttiiiiiiiiiiooooooooonnnnnnnnn fffffffffffoooooooorrrrrrrrrr ccccccccoooooooooonnnnnnnnnffffffffffffeeeeeeeeeerrrrrrrrrreeeeeeeeeennnnnnnnnccccccccceeeeeeeeeesssssssssss,,,,, vvvvvvvvviiiiiiiiibbbbbbbbbrrrrrrrraaaaaaaaannnnnnnntttttttt cccccccoooooooossssssssmmmmmmmmoooooooopppppppppoooooooollllllllliiiiiiittttttttaaaaaaaaannnnnnnn ccccccceeeeeeennnnnnnttttttttrrrrrreeeeeeeessssssss mmmmmmmmaaaaaaaaakkkkkkkkkkkeeeeeeeeessssssss iiiiittttttt aaaaaaaaa pppppppppeeeeeeeeerrrrrrrrfffffffffeeeeeeeecccccccccttttttt lllllooooooccccccccaaaaaaaaattttttttttiiiiiiiooooooonnnnnnnn fffffffooooooorrrrrrrr ccccccoooooooonnnnnnnfffffffeeeeeeeerrrrrrreeeeeeeennnnnnnncccccccceeeeeeeessssssss,,,,vvvvviiiiiibbbbbrrrrraaaaaannnnnnttttt cccccooooosssssmmmmmoooooppppppoooooolllllliiiitttttaaaaaannnnnn ccccceeeeennnnnttttttrrrrreeeeeesssss mmmmmmaaaaaakkkkkkkeeeeesssss iiitttt aaaaaa ppppppeeeeeerrrrrffffffeeeeecccccctttt llloooocccccaaaaaattttttiiiiiiooooonnnnn ffffooooorrrrr cccooooonnnnnfffffeeeerrrrreeeeennnnnccccceeeeesssss,,vvvvviiiiiibbbbbrrrrraaaaaannnnnnttttt cccccooooosssssmmmmmoooooppppppoooooolllllliiiitttttaaaaaannnnnn ccccceeeeennnnnttttttrrrrreeeeeesssss mmmmmmaaaaaakkkkkkkeeeeesssss iiitttt aaaaaa ppppppeeeeeerrrrrffffffeeeeecccccctttt llloooocccccaaaaaattttttiiiiiiooooonnnnn ffffooooorrrrr cccooooonnnnnfffffeeeerrrrreeeeennnnnccccceeeeesssss,,bbbbbbbbbbbbuuuuuuuuuussssssssssiiiiiiiiiiiinnnnnnnnneeeeeeeeeessssssssssssssssssss eeeeeeeeeeeevvvvvvvvvvveeeeeeeeeeeennnnnnnnnttttttttttttsssssssss aaaaaaaaaaaaannnnnnnnnnddddddddddddd iiiiiiinnnnnnnnccccccccceeeeeeeeeennnnnnnnnttttttttttttiiiiiiiiiiivvvvvvvvvvveeeeeeeeeeee vvvvvvvvvvvviiiiiiiiiiiiisssssssssiiiiiiiiiiiitttttttttttooooooooorrrrrrrrrsssssssss... WWWWWWWWWWWWWiiiiiiiiitttttttttthhhhhhhhhhhh ccccccccccoooooooommmmmmmmmppppppppppaaaaaaaaaaannnnnnnnnniiiiiiiiiiieeeeeeeeeessssssssss iiiiiiiinnnnnnnnncccccccccrrrrrrrreeeeeeeeeeaaaaaaaaaaassssssssssiiiiiiiiiiinnnnnnnngggggggggggllllllllllllyyyyyyyyyyyy lllllloooooooooooooooooookkkkkkkkkkkkkiiiiiiiiiiinnnnnnnngggggggggg aaaaaaaaaaaattttttttttttt bbbbbbbbbbuuuuuuuuussssssssiiiiiiiiinnnnnnneeeeeeeeesssssssssssssss eeeeeeeeevvvvvvvveeeeeeeeennnnnnnnttttttttsssssss aaaaaaaaaannnnnnnnddddddddd iiiiiinnnnnnccccccceeeeeeeeennnnnnnttttttttiiiiiiivvvvvvvveeeeeeeee vvvvvvvviiiiiiiiisssssssiiiiiiiiitttttttttooooooorrrrrrrsssssss... WWWWWWWWWWiiiiiitttttttthhhhhhhhh cccccccoooooooommmmmmmmppppppppaaaaaaaaannnnnnnniiiiiiiieeeeeeeessssssss iiiiiinnnnnncccccccrrrrreeeeeeeaaaaaaaaassssssssiiiiiiiiinnnnnnngggggggggllllllllllyyyyyyyyy lllllooooooooooooooookkkkkkkkkkkiiiiiiinnnnnngggggggg aaaaaaaaaatttttttttbbbbbbuuuuuusssssiiiiiinnnnneeeeeessssssssss eeeeeevvvvveeeeeennnnntttttsssss aaaaaaannnnnndddddd iiinnnnccccceeeeennnnntttttiiiiivvvvveeeeee vvvvviiiiiisssssiiiiiittttttooooorrrrrssss.. WWWWWWWiiiittttthhhhhh cccccooooommmmmppppppaaaaaannnnnniiiiieeeeeesssss iiinnnncccccrrrreeeeeaaaaaassssssiiiiiinnnnngggggglllllllyyyyy llllooooooooookkkkkkkiiiiinnnnggggg aaaaaattttttbbbbbbuuuuuusssssiiiiiinnnnneeeeeessssssssss eeeeeevvvvveeeeeennnnntttttsssss aaaaaaannnnnndddddd iiinnnnccccceeeeennnnntttttiiiiivvvvveeeeee vvvvviiiiiisssssiiiiiittttttooooorrrrrssss.. WWWWWWWiiiittttthhhhhh cccccooooommmmmppppppaaaaaannnnnniiiiieeeeeesssss iiinnnncccccrrrreeeeeaaaaaassssssiiiiiinnnnngggggglllllllyyyyy llllooooooooookkkkkkkiiiiinnnnggggg aaaaaattttttooooooooooovvvvvvvvvvveeeeeeeeeeeeerrrrrrrrrrsssssssssseeeeeeeeeeeaaaaaaaaaaassssssssssss iiiiiiiinnnnnnnnnccccccccceeeeeeeeeeennnnnnnnnnttttttttttttiiiiiiiiiiivvvvvvvvvveeeeeeeeeeee aaaaaaaaaaaaannnnnnnnnnnddddddddddddd tttttttttteeeeeeeeeeeaaaaaaaaaaammmmmmmmmmm------bbbbbbbbbbbbuuuuuuuuuuuiiiiiiiiiiilllllllllllddddddddddddiiiiiiiiiiinnnnnnnnnnggggggggggg ddddddddddddddeeeeeeeeeeeessssssssssttttttttttttiiiiiiiiiiinnnnnnnnnnaaaaaaaaaaaattttttttttttiiiiiiiiiiioooooooooonnnnnnnnnnsssssssssss,,,,, tttttttttttthhhhhhhhhhhheeeeeeeeeee ccccccccccooooooooouuuuuuuuuunnnnnnnnnnnttttttttttttrrrrrrrryyyyyyyyyy bbbbbbbbbbbbboooooooooooaaaaaaaaaaasssssssssssttttttttttttsssssssssss ooooooooooooffffffffffff aaaaaaaaaaaaannnnnnnnnnn oooooooovvvvvvvveeeeeeeeerrrrrrrrsssssssseeeeeeeeeaaaaaaaaasssssssss iiiiiinnnnnnnccccccceeeeeeeeennnnnnnnttttttttiiiiiiivvvvvvvveeeeeeeee aaaaaaaaaannnnnnnnnddddddddd tttttttteeeeeeeeeaaaaaaaaammmmmmmmm----bbbbbbbbbuuuuuuuuuiiiiiiiiilllllllllddddddddddiiiiiiinnnnnnnggggggggg dddddddddddeeeeeeeeesssssssstttttttttiiiiiiinnnnnnaaaaaaaaaattttttttttiiiiiiioooooooonnnnnnnnssssssss,,, ttttttthhhhhhhhheeeeeeeee cccccccooooooouuuuuuuunnnnnnntttttttttrrrrrryyyyyyyy bbbbbbbbbboooooooooaaaaaaaaassssssssstttttttttsssssss ooooooooofffffffff aaaaaaaaaannnnnnnnnoooooovvvvveeeeeerrrrrssssseeeeeeaaaaaassssss iiinnnnccccceeeeennnnnttttttiiiiivvvvveeeeee aaaaaaannnnndddddd ttttteeeeeeaaaaaammmmmm---bbbbbbuuuuuuiiiiilllllddddddiiiinnnnnggggg dddddddeeeeeesssssttttttiiiiinnnnnaaaaaaattttttiiiiiiooooonnnnnsssss,,, ttttthhhhhheeeeee cccccooooouuuuuunnnnnttttttrrrrryyyyy bbbbbboooooaaaaaassssssttttttsssss ooooooffffff aaaaaaannnnnoooooovvvvveeeeeerrrrrssssseeeeeeaaaaaassssss iiinnnnccccceeeeennnnnttttttiiiiivvvvveeeeee aaaaaaannnnndddddd ttttteeeeeeaaaaaammmmmm---bbbbbbuuuuuuiiiiilllllddddddiiiinnnnnggggg dddddddeeeeeesssssttttttiiiiinnnnnaaaaaaattttttiiiiiiooooonnnnnsssss,,, ttttthhhhhheeeeee cccccooooouuuuuunnnnnttttttrrrrryyyyy bbbbbboooooaaaaaassssssttttttsssss ooooooffffff aaaaaaannnnnaaaaaaaaaaaaaarrrrrrrrrrrrrrrrrrraaaaaaaaaaayyyyyyyyyyy oooooooooooffffffffffff aaaaaaaaaaaacccccccccccttttttttttiiiiiiiiiivvvvvvvvviiiiiiiiiiiitttttttttttiiiiiiiiiieeeeeeeeeeessssssssss aaaaaaaaaaaaaannnnnnnnnnddddddddddddd eeeeeeeeeeexxxxxxxxxxppppppppppeeeeeeeeeeeerrrrrrrrriiiiiiiiiiieeeeeeeeeeennnnnnnnnccccccccceeeeeeeeeeesssssssssss.... aaaaaaaaaarrrrrrrrrrrrrrrraaaaaaaaayyyyyyyyy oooooooffffffff aaaaaaaaaacccccccccttttttttiiiiiiivvvvvvvviiiiiiiitttttttiiiiiiieeeeeeeessssssss aaaaaaaaaannnnnnnnddddddddd eeeeeeeexxxxxxxxppppppppeeeeeeeeeerrrrrrriiiiiiiieeeeeeeennnnnnnnccccccceeeeeeeessssssss...aaaaaaarrrrrrrrraaaaaayyyyyy ooooofffff aaaaaaaccccccttttiiiiivvvvviiiiiitttttiiiiiieeeeeesssss aaaaaaannnnnndddddd eeeeexxxxxxppppppeeeeeerrrrriiiieeeeeennnnnccccceeeeesssss..aaaaaaarrrrrrrrraaaaaayyyyyy ooooofffff aaaaaaaccccccttttiiiiivvvvviiiiiitttttiiiiiieeeeeesssss aaaaaaannnnnndddddd eeeeexxxxxxppppppeeeeeerrrrriiiieeeeeennnnnccccceeeeesssss..
New Zealand’s unforgettable mix of breath-taking natural landscapes and vibrant cosmopolitan centres makes it a perfect location for conferences, business events and incentive visitors. With companies increasingly looking at overseas incentive and team-building destinations, the country boasts of an array of activities and experiences.
36 MICEtalk November 2013
incentive talk
equipped to cater to different requirements and offer a range of Indian-style vegetarian options
travellers. Language is not a barrier as English is
USP of New Zealand
connectivityconnectivityconnectivityconnectivityconnectivity
MICEtalk November 2013 37
Popular activities for incentive tripsCompanies can reward their best employees with all
manner of experiences, from exhilarating jet boat
safaris and heli-skiing to award winning food and
wine, luxurious spas and fascinating Māori cultural
experiences. There’s also a wide range of luxury
accommodation available, from lakeside villas with
awe-inspiring views to cliff-top lodges with world class
golf courses on site.
Wild on Waiheke
experience. Try archery, laser clay bird shooting and
brilliant team-building challenges such as the Great
Escape – an experience that is part ‘Amazing Race’,
part ‘Survivor Waiheke Island’.
3600 view of Auckland: The Only way to
experience the Auckland Harbour Bridge by foot!
Climb under, around, up and over one of Auckland’s
incentive talk
rafting, abseiling and other outdoor
activities near Dunedin.
experience with Adventure Waikato.
Don’t miss The Tomo Escape – abseil into
an underground world with your team and
work together to find your way out.
Agroventures, near Rotorua, race
against each other in teams of two on
the Schweeb – a unique pedal-powered
monorail circuit.
Scale New Zealand’s tallest building,
the Sky Tower, for a SkyWalk around the
tower’s spectacular outdoor walkway. A
full body harness and overhead safety lines
keep you safe as you gaze over Auckland
from 192m up.
Above: Sky Diving over Lake Taupo
Below: Race down a mountainside on a three-wheel luge kart at Skyline Rotorua
38 MICEtalk November 2013
most iconic landmarks on this 1.5 hour personally
guided tour with extensive commentary.
Terrace Downs Resort for team-building
experiences in the foothills of the Southern Alps.
Options include clay target shooting and archery,
and there’s also a world-class golf course on site.
forest canopy in Queenstown. This
unique experience involves zipping through the trees
while harnessed to a zipwire or flying fox.
Nomad off-road adventure.
Moonlight Country
tailor-made team-building experiences including
orienteering, sheepdog trials, clay target shooting
and quad bike riding.
Mountain Biking: Rotorua has over 90 km of world-
class mountain biking trails – all located in lush
native forests - that are popular with both amateurs
and experts alike.
Milford Sound: Milford Sound is breathtaking
in any weather. The fiord’s cliffs rise vertically
from the dark waters, mountain peaks scrape
the sky and waterfalls cascade downwards.
Boat cruises are an excellent way to experience
the Sound.
Boomrock Lodge near
Wellington and experience rally car racing, all
terrain 4WD, archery, knife throwing, extreme golf,
clay target shooting and a chance to fly a helicopter.
Above: Challenge yourself with some adventurous outdoor activities in Queenstown
Below: Boasting steaming mineral pools and luxurious mud treatments, Rotorua is
a haven for relaxation.
domestic MICE
Owing to the boom in tourism, IT and the shipping sector, Kerala’s commercial capital is developing as the focal point for hospitality in the state. Used as a transit point, enough demand from MICE and leisure segments has helped in the evolution of the destination.
MICE and Leisure Drive New InventoryMegha Paul
in Kochi
Above: Lobby of Crowne Plaza, Kochi
40 MICEtalk November 2013
This September, Kochi witnessed two important
events in the travel and hospitality sectors. The
Indian Association of Tour Operators (IATO)
organised its 29th
Kochi and the Federation of Hotel and Restaurant
Associations of India (FHRAI) concluded its 48th
annual convention at the same venue. The region that
was earlier used more as a transit point was undersold
in Kerala. With a slew of events in the past and enough
demand from the MICE and leisure segments has
helped in the evolution of the destination.
According to Saji Joseph, General Manager,
Le Meridien Hotel, Kochi, MICE is not just about a
meeting but also about value proposition that offers
more to clients. Kerala has a lot to offer in terms of
cultural learning, culinary
journeys, Ayurveda and
wellness that clients can
take back. This makes it
easier for the hotels to
market the destination. In
South India, Kerala has
been considered a hub
for medical events. This
has been a flourishing
segment for long. With
new inventory coming in
the city, the hotels need
to market and showcase the destination globally for
other industrial and service segments.
Feels Shilendran M, Vice President-Sales, CGH
Earth, hotels in Kochi are based in two geographical
locations. One is the hotels in the region of Kakkanad,
which is the fastest
developing commercial
and IT destination. Hotels
in this area are mainly
focusing on corporate
segment, which has seen
a relative growth in the
last two years. “Thus,
prices are extremely
competitive. In the other
side of Fort Kochi, the
hotels cater to strictly
leisure clientele. This
side of Kochi needs to garner more investments
and gear up to emerge as a MICE destination,”
he informs.
Talking about the Kochi hospitality,
Sanjay Kaushik, General Manager, Crowne Plaza
Kochi, points out, “Kochi has emerged as a gateway
to Kerala in the last five years. The hospitality industry
has seen a major transformation from the city being
dominated by local and
regional players to the
launch of almost all major
global hospitality players.
Kochi was treated as a
typical transit destination
but now it has evolved as
an emerging destination
for MICE. The growth
in corporate and IT
segment has increased
tremendously since most
of the corporate giants
have anchored in the city with their corporate offices.
This has boosted the hotel industry by reducing
dependence on seasonal international leisure travellers.
Consequently, it has helped the industry to have an
equal mix of domestic and international or business and
leisure travellers.” The region is witnessing occupancy
of about 50 per cent in the luxury five-star category,
he adds.
domestic MICE
Below: Holiday Inn, Kochi
Hotels in this area are mainly
focusing on corporate segment,
which has seen a relative
growth in the last two years.
yours officially
“England
England is not an unfamiliar destination to Indians and London has always been a favourite place for MICE and leisure travellers. Reem Khokhar, Regional Manager – Asia Pacific, VisitEngland, in conversation with MICEtalk clarifies some misconceptions related to visa clearance, shopping in London, etc., and provides vital information related to MICE opportunities in the country.
What kind of growth do you see from India in the MICE segment?Business visitor numbers from India to England was
approximately 90,000 in 2012. We’re hoping to see an
increase of at least an additional GBP 2 million worth
of business.
How do you intend to position England in India?England is synonymous of world-class facilities,
variety, accessibility and a truly memorable
experience. You can explore the excellent range of
world class conferencing facilities across the country –
from Brighton to NewcastleGateshead; unique venues
for meetings or gala dinners like Spitbank Fort where
you could have a lovely private island reserved for the
group or a stunning gala dinner in Bath at the Roman
Baths and Pump House with an atmospheric backdrop
of the steam rising over the hot water springs, the
torches alight with the magnificent Bath Abbey rising
up in the background.
There are other Asian destinations which get a major chunk of the Indian MICE traffic. What are you doing to increase your market share?As groups look for new experiences and destinations,
we feel that England has a very strong offering. There is
a familiarity, yet a novelty attached to the image of the
country, because there are so many great destinations
and experiences that MICE groups may not know of
and are intrigued when they learn about how much
more is on offer.
We reach out to various stakeholders in building
awareness and promoting the destination. Attending
events like IBTM India and other MICE B2B events
to network with MICE operators, associations and
corporates. We also do one-on-one meetings in a
few key cities and have participated in corporate
networking events. Destination training in the metros
along with the other British tourism partners for the
travel trade; as well as in-office trainings on request
for sales teams; and MICE brochures with a few key
operators, are ways in which we are working to increase
awareness and reach out to the relevant audience.
Media FAM trips and some online promotional
activity for MICE organisers across the Asia-Pacific
region are also in the pipeline.
What kind of challenges do you face dealing with the Indian market specially with big MICE groups?
Our biggest challenge is changing perceptions –
expense being something that comes up sometimes.
England is a compact country. If in a city, you’re never very far from the countryside. Thus you can easily integrate a varied landscape into your itinerary – planning a fun treasure hunt in the countryside for a day or adventure sports like coasteering around the coastal parts of the country.
accessibility
Offering exclusive MICE opportunities
42 MICEtalk November 2013
yours officially
“England has so much to offer to MICE
groups. Many organisers may not be
aware that on certain components of
MICE trips, one can claim the value
added tax and may save up to 20
percent of the total costs.
one can get some really cost-effective options as well
do come down as well as prices for accommodation;
something we are working on.
The perception that visas are hard to get is
misleading – as most Indians who apply for a business
or visitor visa get one. Yes, it does involve some
visa applications in 2012 and issued almost 102,000.
They received 56,000 business visa applications in
2012 and issued almost 54,000. The advantage for
MICE groups are that their timing of their travels are
pre-decided, which gives one enough time to plan for
a group.
Above: Newcastle Gateshead
Below: Royal Pavilion2, Brighton
MICEtalk November 2013 43
Explore Russia’s
Date: March 19–22, 2014Venue: Expocentre, Krasnaya Presnya, Moscow
Russia’s largest and most established travel and tourism
exhibition, MITT’s 21st edition brings together the industry’s
most influential professionals to explore Russia’s fast-growing
outbound tourism market.
With over 3,000 participating companies and 198 destinations, MITT is an excellent strategic meeting place for
the international travel industry and an opportunity to catch up with current and potential clients. It enables
participants to increase awareness of their destination, gain a real feel for the Russian travel market and gauge
the demand for their services. MITT welcomes both trade and consumer visitors, with specific ‘trade only’ days.
accessible by a network of public transport links.
Over the four days during MITT, an intensive business programme will be held in 15 conference halls. It will
include press conferences, presentations of new destinations and services, seminars, master-classes and other
events. For more details visit www.mitt.ru.
event talk
tourism marketat MITT
Frankly, your preference has no impact on the
schedule departure time. So you can sweat it,
stress it or shun it, that flight will take off just when
it is supposed to. Even though there may be technical
delays, the only thing that is relevant is that you know
you will make it to your next destination.
Now reflect at life from the same angle. We are all
ambitious and we have goals and we keep waiting for
the right opportunities that will take us to our next
level, the next destination. Again what is relevant
is that we know what the next destination is. We
continue to direct our efforts in the right direction and
have faith that we will reach where we want. But also
remember things will happen when they are supposed
to – The flight will take off when it is supposed to.
A lot of stress happens in life when we don’t get
what we desire immediately. So if you feel you are ready
for a raise or a promotion and it doesn’t happen one
loses faith and is frustrated but if you knew in advance
that the promotion was a year away and there was a
logical reason why it didn’t come through right away –
I guess you could crib but would you still get stressed
about it. ?
Everybody recommends that we live in the
‘present’, but sometimes the ‘present’ becomes a little
Shabnam Mehra
How often have you strategised on the correct time to reach the airport to catch a flight and how often have you gotten the timing perfect? You could keep a big margin and factor all obstacles and yet at times you rival an Olympic champ making the final 100m dash all the way to the aircraft. While some other occasions leave you with time enough to twiddle your thumbs and regret your own punctuality. Well! Which situation do you prefer?
too overwhelming. Overawed, we start defining our
entire life with that one lens and the big picture gets
hazy. To make the big picture a lot clearer, we need
to remember that the future is only a moment away
and will bring with it, a lot of new perspectives, new
insights, deeper understanding and a whole lot of
fresh opportunities.
So sit back and relax, and ponder on the proverb
‘This too shall pass’. And after you have absorbed
the essence, analyse your options (and if you are
truly positive in your approach, then analyse your
opportunities), and consider what actions can you
take? And like the fly by wire technologies that
planes use to overcome turbulence, glide back to your
chosen route.
There will be some around you who will cry in
alarm, but they are only voicing their fears. You are
responsible for the way your life shapes up so take
charge. Taking charge does not stop you from seeking
support but just reinforces your desire to move ahead.
So you can still debate the time you want to reach the
airport but choose to accept the outcome as only a
step in the long journey ahead.
For further details contact
expert talk
Life Management
46 MICEtalk November 2013
48 MICEtalk November 2013
Apart from high-profile destination weddings, luxury car launches, it has hosted prestigious exhibitions like World Crafts Council
Madras Week celebrations and art exhibitions in support of noble causes, to name just a few.
past events
Neha Oberoi
A tribute to Southern India’s greatest empires – the Imperial Cholas, The ITC Grand Chola is located in Guindy in close proximity to Chennai’s business district. It is also the closest luxury hotel to the IT hub on the Old Mahabalipuram Road. The hotel boasts 522 rooms and 78 serviced apartments.
hotel talk
Offering
ITC Grand Chola
Exhibiting International MICE Potential
MICEtalk November 2013 49
hotel talk
The ITC Grand Chola is 7 kms from the domestic and
international airport and the proposed metro line is
just a stone’s throw away.
Convention space
Rajendra is one of the country’s largest pillar-less
banquet halls and can accommodate a floating crowd
of 3000. It has its own pre-function area of 1584 m2
and can be divided into eight separate halls, each with
sound proofing possibility. Hence, it facilitates hosting
multiple functions simultaneously.
elevator capable of accommodating luxury cars, drop
Kaveri meeting rooms are four spaces, of a total area of
240 m2. Keeping in sync with individual requirements,
these 4 boardrooms can seat 12 guests each and
are versatile enough to be merged into one distinct
meeting space.
Tanjore is equipped with futuristic boardroom
cameras which can be controlled directly from the
table and drop-down screens. Spread across 980 sq ft,
it can seat 24 persons.
Cuisine & Relaxation
ITC’s tradition of culinary excellence is reflected in:
the Royal Vega - luxury vegetarian cuisine of India,
Ottimo – the Italian kitchen, Pan Asian, the Indian
North West Frontier Cuisine at Peshawri, the all-day
dining at Café Mercara Express, the finest three-
meal buffet experience at Madras Pavilion, sinful
indulgences at Nutmeg – the Gourmet Shop and The
Cheroot –
This is further complemented by ITC’s
internationally acknowledged indigenous spa
brand, Kaya Kalp – The Royal Spa and The Marina
pool complex.
Customised MICE
ITC Grand Chola offers several options for MICE
which can be customised in accordance with the
preferences of its guests.
Premium Meetings allows you to arrange meetings
amidst luxurious environs as you choose from an
array of gastronomic delights specially crafted and
customised for your requirements.
Dynamic Meetings provide the perfect blend of
business and pleasure. Enjoy your meetings with a
delightful culinary mix in its grandest setting.
business meetings with our Meet & Dine option.
Green Meetings
conducted with efforts to reduce carbon footprint. The
deliverables, right from the emissions of the lighting
they use to the size of the dinner plates, add towards a
greener tomorrow.
Imperial Exhibitions
ITC Grand Chola presents dynamic spaces, enhanced
by futuristic technology and state-of-the-art features,
making it the preferred choice for exhibitions and
expos. Their dedicated team of professionals provide
seamless support in designing, planning and executing
your event. Imperial Exhibitions can be tailor-made to
your needs.
location
Zambhala A Unique Yoga Festival
Elaborate on Zambhala, its significance and how did
you feel the need to organise a yoga festival?
India’s domestic wellness and spiritual tourism market
is growing at a healthy rate, and of course, Zambhala
will act as a focus for it. Zambhala is the largest festival
of Yoga, Spirituality, Music and Dance ever organised
in India. It features many from India and the world’s
greatest experts in the five classical forms of Indian
Yoga, together with masters from the US, France,
Canada and South East Asia.
How have Corporates accepted Yoga within their
business events?
Certainly in the USA, where over 20.4 million adults
(8.7 per cent of the adult population) practice Yoga,
corporate Yoga has become a mainstay of many
internal HR and fitness programmes. In India, where,
in a sense, Yoga is ‘in us’, the organised corporate sector
has been slow to take it up - but we have no doubt that
we are at the rising edge of a very large wave.
What does India offer in terms of spiritual tourism?
Spiritual Inbound Tourism into India is dominated
by Yoga and the culture and practice of staying in an
Ashram. The different spiritual practices that attract
tourists are myriad: At Zambhala, in addition to
covering the most important 5 schools of Indian Yoga,
along with many other forms of Yoga, we are featuring
speakers and experts of different spiritual and health
related disciplines: for example, past life regression,
pranic healing, meditation, dream interpretation,
fitness, dance therapy, together with the world’s
leading Nutritionists and naturotherapists.
Why have you chosen Goa as a venue for this festival?
Goa still retains the purity of the 1960’s experience: a
clean beach, waving palms, a laid back and welcoming
energy. And also, we have on the 21st and 22nd
December a huge captive audience in Goa to enjoy
themselves, and, we hope, they will experience a
world that is entirely different from their normal
urban existence.
Differentiate Zambhala from other yoga festivals and
mention its USP.
Zambhala is different, it is unique for India in that
it brings together many worlds - Yoga, Spirituality,
Fitness, Diet, Health, Mental and Physical balance -
and places them gently within a luxurious, modern
and comfortable festival environment. We will have
music and dance.
Do you practice yoga and how does it benefit you?
I do, and it helps me strengthen - physically and
mentally - my ability to deal with a busy work and
home life.
Martin da Costa, CEP,
70 EMG
event talk
December 21-22, 2013Goa
50 MICEtalk November 2013
etiquette talk
Shital Kakkar MehraPractitioner of Corporate Etiquette and International Protocol in India
The recent furor over the ‘casual’ handshake extended by Microsoft founder Bill Gates to South Korea President Park Geun-hye raised several questions – Was it a case of cultural differences or plain bad manners? Also, was Bill Gates trying to show superiority by tucking one hand in his trouser pocket while extending the other to the Korean President?
the Right HandshakeTips for
American President Obama’s
greeting style came under fire
when he extended a combination
of a handshake and an awkward
90 degrees bow to the
Japanese Emperor.
52 MICEtalk November 2013
Handshakes in politics grab attention. American
President Obama’s greeting style came
under fire when he extended a combination
of a handshake and an awkward 90 degrees bow to
the Japanese Emperor. Bill Clinton’s smiling face as
Israeli Prime Minister Yitzhak Rabin and Palestinian
leader Yasser Arafat shake hands was a high point of
his presidency. Closer home, Rahul Gandhi’s unique
demonstration of China’s strong ‘push-you-down’
tactics by extending a bone-crusher to the host at a
high-powered industry meet was much talked about.
Tips for a good handshake
Right hand: At meetings and networking events, keep
your right hand ready for a handshake. Hold your
folder or drink in the left hand (the condensation from
a chilled drink can make your hands clammy).
Body language: Handshakes create the best impact
when accompanied with direct eye contact and
a smile. While shaking hands, never look over
the person’s shoulder in a bid to spot a more
important person.
Present correctly: Keep your hand perpendicular
when extending for a handshake; palm down can be
viewed intimidating or aggressive while palm up is
translated as subservient in body language.
Convey warmth: Extend a flat palm and connect
with the other person’s web (skin between thumb and
index finger).
LORDS Expanding Horizons
Keep your hand
perpendicular when
extending for a handshake
Handshakes to avoid
Bone-crusher: This macho handshake is extra firm
and displays physical power. It intimidates the other
person and non-verbally conveys that you like to
maintain a dominant position.
Limp handshake: This kind of handshake conveys
lack of self-esteem and confidence.
Glove handshake: Common amongst political
leaders, it involves covering the person’s hand
with both your hands to subtly signal ‘I am there
for you’. This handshake is ideal for funerals and
condolence meetings.
Extended handshakes: Pumping the hand several
times and refusing to let go is embarrassing and
creates awkwardness.
Recently, Lords was awarded as ‘The New Fastest Growing Hotel
Chain’ for the second time in a row.
Before getting any property on board,
importance and value of MICE travellers.
Abiding by the rule with 19 operational
and board rooms at 13 of its properties.
Namely: Ankleshwar, Surat, Silvassa,
Bhavnagar, Kandla, Jaipur, Kathgodam,
Porbandar, Rajula, Saputara and
our Kathgodam Hotel has the largest
banquet in town and Silvassa Hotel
has 5400 sq ft of pillar-less banquet.
Addressing to the need of corporates,
and do arrangements accordingly.
It is no secret that exhibitors attend events in order to find new business, re-establish existing relationships and demonstrate products and services. New tools, marketing methods and communication systems add greater value to an exhibitor’s participation; before, during and after the event.
technology
Providing exhibitors with revenue generating leads
The fully-customisable software integrates with the event’s existing website and also offers new and exciting revenue generating products.
54 MICEtalk November 2013
Darren Edwards is the founder of Invisage Creative
Services in Australia. With more than 20 years’
experience and knowledge in the meetings and events
industry, Darren continues to drive creativity in events
and the way they are run.
Contact: [email protected]
about the author
Th In recent years, Event Apps have become a
dynamic promotional and resource sharing
tool that exhibitors have been able to harness
and exploit. Recent enhancements to these apps,
such as true leads modules (not basic business card
capture scanners) which allow real-time lead capture
and analysis, have added additional real return on
investment for exhibitors.
New Software Platform
GoExpo, founded in 2008, is the tradeshow
software designed to bring more qualified buyers
to exhibitor booths by matching attendees to their
product interests.
It provides a private social networking platform,
an online exhibitor directory, interactive floor plan,
dashboard emails, newsletters, an online conference/
speaker system, show planners, booth contracts,
segment marketing, social networking, messaging,
appointment scheduling, a self-service portal,
exhibitor email invitations, 3rd party support,
mobile apps, and many other easy-to-use features
that enhance the show experience for the attendees,
exhibitors and show management.
GoExpo integrates seamlessly with leading event
apps, allowing registrants to immediately access the
system upon the completion of their registration
and exhibitors to immediately access the system
upon completion of their booth contract. Using the
attendees’ demographic profiles, GoExpo’s search
engine returns recommended exhibitors, products
and seminar matches in real-time. Attendees can
easily add these recommendations to their planner,
or contact exhibitors for more information via the
internal GoExpo messaging system.
In addition to traditional sponsorship
opportunities, exhibitors can purchase enhanced
product listings and entries in an online (or onsite)
product showcase. All purchases are handled online
through the secure e-commerce interface in GoExpo
or can be entered manually when the event wishes to
collect payments directly.
For more info visit www.goexposoftware.com
technology
Movements
The Suryaa, New Delhi appoints new GMThe Surya announces the appointment of Pankaj Mathur as its new GM. Pankaj comes with a rich experience of over two decades and has worked significantly with International Hotel Chains like Starwood, Hyatt, Marriott, Oberois, Taj and ITC Welcomgroup. In his new role, he will help enhance the image of the organisation through directing the operations of the business with focus on identifying and managing growth opportunities; to rebrand and reposition The Suryaa as singularly the main choice among the leading hotels of New Delhi.
Sheraton Bangalore Hotel at Brigade Gateway appoints
Director Sales & MarketingDebanjan Kundu is the new Director Sales & Marketing of Sheraton Bangalore
Hotel at Brigade Gateway. With over 10 years’ experience in the hospitality industry, Debanjan has demonstrated
capabilities in evolving innovative sales and promotional strategies. Prior to
joining Sheraton Bangalore, he was the Director of Sales at Westin Hyderabad
Mindspace and was associated with Starwood since
March 2011.
Park Inn by Radisson Gurgaon Bilaspur appoints new GM Akash Roy Saigal is the new GM for Park Inn by
Radisson Gurgaon Bilaspur. He has 13 years of hospitality experience, out of which he worked as General Manager at The Palms Town and Country Club, Gurgaon for three years. A great team player, he is well-versed in maintaining the positioning of the brand in a competitive market.
Tourism New Zealand appoints Country Manager, Marketing Communications Manager and PR Manager Neha Bola joins Tourism New Zealand as Country Manager. Neha has over 12 years of experience in the travel and tourism space with experience in Business Development, Product Development, Contracting, Sales, Operations, and CRM.
Nisha D’souza has been appointed to the role of Marketing Communications Manager.
She has rich experience of working with Blue Square Consultants, Cox & Kings, and Ogilvy One.
Naomi Lobo is the new PR Manager. She has previously handled media relations for Korea Tourism Organisation, Sri Lanka Tourism Promotion Bureau, Star Cruises and Resorts World Sentosa.
Shangri-La’s - Eros Hotel, New Delhi, appoints Director of
CommunicationsAnjori Kumar is the new Director of Communications of Shangri-La’s - Eros Hotel.
With a Masters in Public Relations and Communication, Anjori comes with over 6 years of resonance in strategic Public Relations, Brand Building, Integrated Marketing Communications and Press Relations.
The Lalit Chandigarh welcomes new GMAshish Gawari is the new General Manager of the The Lalit Chandigarh, moving from his previous role as General Manager of the The Lalit Srinagar. In his new role, he will be responsible for the management of this business property which is also a recent venture of The Lalit Suri Hospitality Group.
DD
56 MICEtalk November 2013
eventscalendar
events
EVENT VENUE/PLACE CITY/COUOUOUOUOUNTRY DATE
Rann UUUU UUUUtsstststststststsavavava LiLiLiLiLiLLittttttttttttttttttt llellelel Rann of Kutch KuKKutctch, GGujujrarat Dec 14, 2013 - Mar 18, 2001414
NoNortrth hh AmAmAmerere ici an Intttttnterererererererrnaanannanann titiononalal MoMoM totorcrcycycycllele S S Supuppererere shshshowow
ThThThee e ToT ronto Innnnntetetetetetetetettetternrnrrrrr ationalCeCentntrere
Torontto,o,CaCanan da Jaanunuuuarary y 0303 -- 0 05,5,5 2 220110 444
TrTrTrTravaavel Expooooo MeMeMeMeMMesssss e e Luzezzezezeeeernrnrnrnrnrnrnn Luuucececccccccc rne, SSSwitzeererlalandnd Jananuauauaryryry 1 1100 0 - - 121212, 20202014114
Resorts Annnnd d ToTToToToToTTToToTTT urururrrrrisisisisisississsm m m m mmmmm ExEExExxpopopopopopp ZhZhZhZhZhZhZZZhhemememememememmemmmchccc uzhina HHHotottttotteleleleleleeel Sochhhiii, RR Rususu sissss a Janunuarary y 1010 -- 14 , ,, 20202014
Go-TTTraaaveeell l FaFF irri Brno Exhhibibbbbbbbii itititiiittitionn CeCeeCeCeCeC ntntntntntntnttrererererererere BrBrBrBrBBBB no, CzC ecechhhh hh ReRReeppupublblbliiic JJanana uauaauauaaauaauaryryryryyryyry 111111 166666666 ----- - 19191919919191 , 2020202002002002 141414444141414
Indiaa a Innnnteeernnrnnattttatiional Travel &Tourismmmm m ExExExhihhihh bibbb tion
MMMMRRDRDDAAAAA Exhibition CCeennnne teteteteteeteeterrrr MuMumbmbaii, IIndidiaa JJJJJJJJaaaannaaa uuauauaaryryryry 11 11666 - - 18818, 202 1144
Addvvev ntttttturrrure e TrTrTTT avavvell EEEExppo-o-Meeelbououuuuurnrnnnnnee
RoRoooyal l ExExExExExExExxExE hihihihihhhhhh bibibibititititionononon B BB B Buiuiuiu lddldlddiningg MeMeMeMeMeMelbblblblbboouooo rne, Austrtralaliaiaaaaaaa FFFebebebebebebebebbebbbbrurrrurrr ary 01 - 002,2 220110 44
HoHoHHoospitaaalaa ititittttti yy yyy EEExExExxExEExEExpoppopo RDRDS S SiSiiSiiimmmmmmmmmmmmmmmmmmmmononscscouo rtrttttttrttttt DuDuDuuublblbbllbblblbb inininnininnn, , , ,, ,,,, IrIrIrIrIrIrIIrrreleleelelelelelelelllanananaananaaaannanddddddddd F ebebbbebbbbbbbrrrurururururr ary 044 - - 0 0055 5 ,, 2020014144
BuBuuusinesssss TTraraaaavvevevvel & MMMMeetings ShShhow
EaEaaEaEaaarlrlrls s s CCoCoCoCCoCoooururururuu t Exhhhibitiooonon C CCCC CCCenenenennnnnntrtrreeeeLLLoonnndn on, UUnnnnnitititteeeedee KKKinnngn dooooommmmmmmm
FFFeeebeebeeeebe rur ary y 044 -- 000555, 2014
Ouuutbouuund TTTraavel MMMart-MuMuumbmmbmbmbmbmbbbbbaiaiaiaiaaaaa
BoBoBoBoBooBombmbmbmmbm aayayayaay CCConononnnveveveveveeveeenntntnnnnnnnnn iooioonnn && & & & && &&& &&ExExExxxExExhihihihhih bibibibibittit onnnnnnnnnn CCCCCenenenentrtrtrtre e e e (B(BB(BB(BBCECECECECCECECECECECEEECEC)C)C)C)CCC)C)CCC)C
MuMuMuMuMuMuMuMMuMuM mbbbbbbbbbbbaiaiiaiaiaiaiaaa , InInInnnnInIInInIndidididdididididddididiaaaaaaaaaaa FFFeeeebebbeee ruruararrrrrrrrrrrry y y y yy yyyy y 0707000000 - 0009 9999999 , , , 202022022 144
Postal Registration No.:DL(ND)/6150/2011-12-13WPP No.:U(C)-305/2011-13
for Posting on 29th-30th of Advance Month at New Delhi P.S.O.Date of Publication: 22/10/2013, RNI No.:DELENG/2010/34144