Metabolic Engineering of Escherichia coli for Production of Adipic … · 2018. 6. 20. ·...
Transcript of Metabolic Engineering of Escherichia coli for Production of Adipic … · 2018. 6. 20. ·...
Metabolic Engineering of Escherichia coli for
Production of Adipic Acid through 2-Hexenedioate
Pathway
By
Shen Guo
A thesis submitted in conformity with the requirements
for the degree of Master of Applied Science
Graduate Department of Chemical Engineering and Applied Chemistry
University of Toronto
© Copyright by Shen Guo 2016
ii
Metabolic Engineering of Escherichia coli for Production of
Adipic Acid through 2-Hexenedioate Pathway
By
Shen Guo
Master of Applied Science
Graduate Department of Chemical Engineering and Applied Chemistry
University of Toronto
2016
Abstract
Adipic acid is one of the most important platform chemicals in industry. Bio-based
production of adipic acid is a promising alternative to the current petrochemical
production routes which cause environment and energy concerns. This work describes
efforts to construct a platform strain of Escherichia coli for production of adipic acid.
First, we constructed an E. coli strain harbouring part of the α-aminoadipate pathway
from Saccharomyces cerevisiae. Through fed-batch fermentation, the strain showed its
capability of producing α-ketoadipate, a precursor of adipic acid, from its native
metabolite α-ketoglutarate. Second, we constructed an E. coli strain harbouring a
pathway converting α-ketoadipate to adipic acid. Through various studies, we were able
to illustrate that all enzymes of the pathway are active in vivo. This work demonstrates
the capability of E. coli for production of α-ketoadipate and paves the way for further
studies on conversion of α-ketoadipate to adipic acid.
iii
Acknowledgements
I would like to first and foremost thank Professor Mahadevan for his guidance and
abundance of enthusiasm and ideas throughout this work. I am indebted to him for his
valuable criticism, constructive suggestions and encouragement. I would also like to thank
Professor Yakunin for his generous support.
Of course I would not have been able to accomplish this work without the love and
support of my family; to them I dedicate this thesis.
I am greatly indebted to the members of the Laboratory for Metabolic Systems
Engineering and BioZone at University of Toronto for their friendship and willingness to
share with me their experience and knowledge.
iv
Contents
1. LITERATURE REVIEW ..................................................................................................... 1
1.1 Introduction ....................................................................................................................... 1
1.2 Petroleum based production of adipic acid ..................................................................... 2
1.3 Bio-based production of Adipic Acid ............................................................................... 3
1.3.1 Microbial production of the adipic acid precursor cis, cis-muconic acid ........................ 3
1.3.2 Production of adipic acid in E. coli by reversal of dicarboxylate β-oxidation ................ 7
1.3.3 A newly designed biosynthetic pathway for production of α-ketoadipate and adipic
acid. ......................................................................................................................................... 9
1.3.3.1 From α-ketoglutarate to α-ketoadipiate ................................................................... 9
1.3.3.2 From α-ketoadipate to adipic acid ......................................................................... 11
1.4 Evaluating biosynthetic pathways of adipic acid with metabolic modeling tools ...... 12
2. MOTIVATION AND STATEMENT OF OBJECTIVES................................................ 16
3. MATERIAL AND METHODS .......................................................................................... 17
3.1 Cultivation and fermentation of E. coli ......................................................................... 17
3.1.1 Storage of E. coli strains ................................................................................................ 17
3.1.2 Cultivation of E. coli for plasmid isolation ................................................................... 17
3.1.3 Cultivation of E. coli for enzyme work ......................................................................... 18
3.1.4 Fermentation experiments of E. coli in bioreactors ....................................................... 18
3.1.5 Fermentation experiments of E.coli in shake flasks for the upper pathway .................. 19
3.1.6 In vivo biotransformation for the lower pathway .......................................................... 19
3.2 Methods for DNA work ................................................................................................... 20
3.2.1 Plasmid DNA isolation .................................................................................................. 20
3.2.2 Agarose gel electrophoresis ........................................................................................... 21
3.2.3 DNA restriction and ligation ......................................................................................... 21
3.2.4 Transformation of chemically competent E. coli cells .................................................. 22
3.2.5 Polymerase chain reaction (PCR) .................................................................................. 22
3.2.6 Construction of expression plasmids ............................................................................. 22
3.2.7 Site directed mutagenesis .............................................................................................. 23
3.2.8 DNA concentration and purity determination ............................................................... 23
3.2.9 Sequencing of cloned genes .......................................................................................... 24
3.3 Methods for protein work ............................................................................................... 24
3.3.1 SDS-PAGE procedure ................................................................................................... 24
3.3.2 Cell extract assay of the lower pathway strain .............................................................. 24
v
3.4 Analysis ............................................................................................................................. 25
4. RESULTS AND DISCUSSION .......................................................................................... 26
4.1 Characterization of the upper pathway in E. coli: from α-ketoglutarate to α-
ketoadipate ................................................................................................................................... 26
4.1.1 Construction of E. coli strain with the upper pathway (U1 strain) ................................ 26
4.1.2 Alpha-ketoadipate production of upper-pathway E. coli strain ..................................... 27
4.2 Characterization of the lower pathway in E. coli: from α-ketoadipate to adipate .... 34
4.2.1 Construction of E. coli strain with the lower pathway (L1&L2 strain) ......................... 34
4.2.2 In vivo biotransformation test for the lower pathway strain .......................................... 38
4.2.3 Fermentation test on glutaconate pathway (L2_C5 strain) to validate in vivo activity of
enzymes HgdCAB and GctAB in lower pathway ..................................................................... 39
4.2.4 Fermentation test on the lower pathway converting α-ketoadipate to adipic acid ........ 42
5. CONCLUSIONS .................................................................................................................. 43
6. RECOMMENDATIONS .................................................................................................... 45
7. REFERENCES .................................................................................................................... 46
8. APPENDIX .......................................................................................................................... 51
8.1 Sequences of relevant enzymes ....................................................................................... 51
8.2 Plasmids, strains, and primers ....................................................................................... 58
8.3 Chemicals and culture media ......................................................................................... 64
List of Figures 1 North America adipic acid market revenue by product, 2012-2020 ................................... 2
2 Traditional chemical route of adipic acid production from benzene ................................... 3
3 Associated metabolites and enzymes in biosynthetic pathways of cis,cis-muconic acid
from benzoate .................................................................................................................................. 5
4 Biosynthetic pathway of cis,cis-muconic acid from glucose............................................... 6
5 Biosynthetic pathway of adipic acid inspired by reversal of dicarboxylate β-oxidation ..... 8
6 Biosynthetic pathways of adipic acid and glutaconate from α-ketoglutarate .................... 10
7 The work flow diagram ..................................................................................................... 17
8 Plasmid construction strategy for the upper pathway strain .............................................. 26
9 SDS gel for heterologous expressed enzymes of the upper pathway strain ...................... 27
10 Characterization of the upper pathway in constructed E. coli U1 strain .......................... 29
vi
11 Growth curve and AKA production profile of U1 strain and WT strain under anaerobic
and aerobic conditions in bioreactor fermentation where no casamino acid was supplemented .. 31
12 Characterization of the upper pathway strain in shake flasks ............................................ 33
13 Comparison between shake flask fermentations and bioreactor fermentations of the upper
pathway strain ................................................................................................................................ 34
14 Plasmid construction strategy for the first lower pathway strain L1 ................................. 35
15 Plasmid construction strategy for the second lower pathway strain L2 ............................ 36
16 SDS gel for heterologous expressed enzymes of the lower pathway strain L1 and L2 ..... 37
17 An overview of the lower pathway ................................................................................... 38
18 Growth curve and glutaconate production profile of L2_C5 strain and WT strain in the
anaerobic fermentation experiment ............................................................................................... 41
List of Tables 1 Theoretical yields and predicted revenues of adipic acid production from the three
biosynthetic pathways ................................................................................................................... 14
2 Summary of biosynthetic pathways of adipic acid ............................................................ 15
3 BLAST of upper pathway enzymes to identify enzymes in E. coli with similarity in
sequences ....................................................................................................................................... 30
4 Summary of AKA production titre of the upper pathway strain based on different
bioreactor fermentation methods ................................................................................................... 31
5 Summary of enzyme activity in E. coli and their corresponding experiments where the
activity has been illustrated ........................................................................................................... 41
6 Plasmids used in this study and their relevant characteristics ........................................... 59
7 Strains used in this study and their relevant characteristics .............................................. 61
8 Primers used in this study .................................................................................................. 62
1
1. Literature Review
1.1 Introduction
Adipic acid (hexanedioic acid or 1,4-butanedicarboxylic acid), a straight–chain
dicarboxylic acid with a molecular mass of 146.14 g mol-1 and pKa values of 4.43
and 5.41, plays a significant role in chemical industry. It is isolated as colourless,
odourless crystals and is slightly soluble in water (24g/L at 25 0C) (Musser, 2000). It
occurs rarely in nature and can be found in beets and sugar cane (Musser, 2000). Adipic
acid is a high volume petrochemical commodity with a selling price of around
$1,373/tonne (Reed Business Information Limited, 2014). The price of adipic acid highly
depends on the price of cyclohexane, the raw material for traditional adipic acid
production, which is coupled to the oil price (Global Industry Analysts Inc., 2012). The
global production volume of adipic acid is estimated to be 2.6 million tons per year, with
an average production growth rate of 4.1%, and is expected to exceed 2.7 million tons by
2017 (Global Industry Analysts Inc., 2012).
More than 80 percent of adipic acid in the market is consumed to make nylon 6-6
polyamide, which is further utilized across a variety of industries such as automobiles and
electronics. High purity grade of adipic acid is used for synthesis of nylon, while low
purity grade of adipic acid is mainly used for producing polyurethane, which is the second
largest application of adipic acid, taking over 7% of the market volume share. Adipic acid
is also consumed to produce paints and coatings, plastic additives, polyurethane resins,
low temperature lubricants, food additives and synthetic fibers. Global adipic acid market
size was estimated at USD 4.55 billion in 2013. Growing industry in electronics and
automobiles is expected to increase the demand of adipic acid in the next 7 years (Figure
1) (Grandview research, 2014).
2
Figure 1. North America adipic acid market revenue by product , 2012-2020 (USD
Million) (Grandview Research 2014)
1.2 Petroleum based production of adipic acid
Traditionally, adipic acid has been produced from various petroleum derivatives
such as cyclohexane or cyclohexene. The cyclohexane process has been the dominant
production route for adipic acid, accounting for over 90% of global adipic acid produced.
First the cyclohexane is oxidized at 150-160 0C with oxygen, catalyzed by cobalt or
manganese, into a mixture of cyclohexanol and cyclohexanone called ketone-alcohol
(KA oil). The KA oil is then oxidized with nitric acid into adipic acid (Figure 2) (IHS
Inc., 2012). Similarly, the cyclohexene process also uses nitric acid to oxidize
cyclohexene into adipic acid (van de Vyver et al., 2013). During the oxidation nitrous
oxide is emitted as a main by-product. Nitrous oxide is a greenhouse gas, contributing to
global warming and ozone depletion. It is estimated that 10% of the industrial nitrous
oxide emission comes from adipic acid production, even though the production process
has been improved by modern tail gas treatment (Alini et al., 2007; Blach et al., 2010).
To avoid emission of nitrous oxide, a new production route has been designed and
studied, which involves a direct oxidation of cyclohexane into adipic acid using 30%
hydrogen peroxide (Sato et al., 1998). However, the high cost of hydrogen peroxide
makes this route less attractive. Moreover, the starting materials of adipic acid production
are derived from limited, non-renewable fossil fuels and have some common harmful
3
properties overall. For example, benzene, which is used to make cyclohexane, is a
volatile carcinogen and may cause acute myeloid leukaemia (Galbraith et al., 2010).
Due to the growing concerns of the environmental impact of adipic acid
production, the industry has been looking into developing biotechnological production of
adipic acid as an alternative. Unlike traditional routes for adipic acid, bio-based
production of adipic acid uses glucose as a basic feedstock which is environment-friendly
in nature. In addition, through techno-economic analysis, its cost shows competitiveness
against petroleum-based adipic acid production. It provides high value product, at a
smaller scale, with lower capital investment required (Diamond et al., 2014). Capital
required for bio-based production of adipic acid is approximately 20% lower than that for
petroleum based adipic acid production; the utility cost is approximately 15% lower; the
manufacturing cost is 30% lower (Diamond et al., 2014). Governments across the world
have been issuing policies that support companies involved in manufacturing bio-based
adipic acid in various forms such as price subsidies, green mandates and loan guarantees.
These advantages make bio-based adipic acid a promising market (Diamond et al., 2014).
Figure 2. Traditional chemical route of adipic acid production from benzene through cyclohexane
process (Niu et al., 2002; Polen et al., 2012)
1.3 Bio-based production of Adipic Acid
1.3.1 Microbial production of the adipic acid precursor cis, cis-muconic acid
Cis,cis-muconic acid is a promising bulk chemical due to its ability to convert into
adipic acid and other valuable compounds. It is a dicarboxylic acid with conjugated
bonds. The double bonds can be reduced by hydrogenation using platinum as a catalyst,
which leads to adipic acid (Niu et al., 2002; van Duuren et al., 2011.)
4
Currently, two biosynthetic pathways for cis-cis muconic acid have been
extensively studied. The first one is the conversion from benzoate, via catechol branch or
protocatechuate branch depending on the organisms (Figure 3). Several bacteria have
been described as having this pathway and the corresponding genes have been identified
and enzymes characterized (Cao et al., 2008; Collier et al., 1998; Denef et al., 2006;
Jeffrey et al., 1992; Kitagawa et al., 2001; Takenaka et al., 2005; Zhan et al., 2008). In
2011, van Duuren et al. isolated a derivative of Pseudomonas putida, P. putida KT2440-
JD1. The strain can no longer use benzoate as a carbon source, but can still metabolize
benzoate to cis,cis-muconic acid when grown on glucose. The production rate of cis,cis-
muconic acid was about 4.3 mM/g dry cell weight/h under a pH-stat fed-batch process,
the highest among all reported strains (van Duuren et al., 2012). Using life cycle analysis
as a tool, Duuren et al studied the feasibility of this benzoate-muconate pathway for
manufacturing adipic acid through relevant chemical processes. They concluded that this
production route can significantly reduce the environmental impact of adipic acid
production if phenol is used as petrochemical feedstock. However, for other feedstocks
such as benzene and toluene, improvement of yield is needed to make a difference from
the traditional production route. Solution may involve increasing catechol 1,2-
dioxygenase activity and transport activity of cis,cis-muconic acid through the cell
membrane (van Duuren et al., 2011). However, like the traditional route, this pathway,
which converts petroleum-based benzoate to adipic acid via cis,cis-muconic acid, neither
addresses the problem of toxic starting materials nor the limitation of petroleum-based
feedstocks in the long run (Polen et al., 2012). Thus, a biosynthetic pathway to cis,cis-
muconic pathway from a renewable resource such as glucose is more desirable.
5
Figure 3. Associated metabolites and enzymes in biosynthetic pathways of cis,cis-muconic acid
from benzoate (Polen et al., 2012).
In terms of energy and environmental concern, the second pathway which has
been constructed in E. coli has an advantage over the previous one since the raw material
is identified as glucose (Figure 4). The first three steps are from the native shikimate
pathway in E. coli, converting glucose to 3-dehydroshikimate. The following steps
convert 3-dehydroshikimate to cis,cis-muconic acid with the help of three heterologous
enzymes: 3-dehydroshikimate dehydratase and protocatachuate decarboxylase from
Klebsiella pneumonia and catechol 1,2-dioxygenase from Acinetobacter calcoaceticus
(Niu et al., 2002).
Niu et al. implemented numerous strategies to direct carbon flow into the
pathway. E. coli AB2834, a strain which lacks AroE gene encoding shikimate
dehydrogenase and is thus unable to convert 3-dehydroshikimate (DHS) into shikimate,
was selected for muconic acid production. 3-deoxy-arabinoheptulosonic acid 7-phosphate
(DAHP) synthase in the pathway was engineered to abolish its susceptibility to feedback
inhibition, and was expressed by an extra DAHP synthase promoter on a plasmid to
neutralize the transcriptional control. An additional AroB gene encoding 3-
dehydroquinate synthase was integrated into the genome to increase its expression level
6
and consequently the conversion rate of DAHP to 3-dehydroquinic acid (DHQ) such that
it exceeded the excretion rate of DAHP into the culture media. AroZ gene encoding DHS
synthase was successfully integrated into the genome to minimize the burden of gene
expression from plasmids. The optimized strain was reported to produce 36.8g/L cis,cis-
muconic acid after 48h culturing under fed-batch fermenter conditions, corresponding to
24% mol/mol yield from glucose (Niu et al., 2002).
Figure 4. Biosynthetic pathway of cis,cis-muconic acid from glucose (Niu et al., 2002; Polen et
al., 2012). The E. coli strain lacks the shikimate dehydrogenase encoded by AroE gene to prevent
the carbon flow towards shikimic acid. The dashed arrows indicate production of erythrose-4-
phosphate (E4P) and phosphoenol-pyruvate (PEP) from central metabolism.
Other strategies to optimize this cis,cis-muconic acid pathway have been studied
by different research groups. To solve for the problem that the intermediate DHS secreted
from the cell into the culture media and was unable to participate in the downstream
pathway, Zhang et al. designed a transporter shiA of E. coli which takes up the DHS in
the culture media back into the cell (Zhang et al., 2014). A co-culture system, which
7
contained an E. coli strain harbouring only the first three steps of cis,cis-muconic acid
pathway (from glucose to DHS) and an E. coli strain harbouring the shiA transporter and
the rest of the pathway, has shown to enhance the production of cis,cis-muconic acid
compared to a single E. coli strain harbouring the complete pathway (Zhang et al., 2015).
Lin et al. designed a pathway converting shikimate to cis,cis-muconic acid instead of
implementing the original strategy of eliminating shikimate (Lin et al., 2013). Curran el
al. tested the cis,cis-muconic acid pathway in S. cerevisiae, with a titre of 141mg/L and a
yield of 0.07g/g glucose in shake flask conditions (Curran et al., 2013).
1.3.2 Production of adipic acid in E. coli by reversal of dicarboxylate β-oxidation
In cellular metabolism of organisms such as filamentous fungus Penicillium
chrysogenum, adipic acid can be degraded through a β-oxidation process similar to that of
fatty acids. Adipic acid is first activated into adipyl-CoA, and then degraded into
succinyl-CoA and acetyl-CoA (Thykaer et al., 2002). Inspired by the reverse of this β-
oxidation, Yu et al. designed a pathway in E. coli which involves six enzymatic steps: 1.
condensation of acetyl-CoA and succinyl-CoA, which originate from D-glucose through
glycolysis and TCA cycle, to form C6 backbone 3-oxoadiyl-CoA by β-ketoaidpyl-
thiolase (PaaJ) of E. coli; 2. reduction of 3-oxoadipyl-CoA into 3-hydroxyadipyl-CoA by
3-hydro-acyl-CoA reductase (PaaH1) of Ralstonia eutropha; 3. dehydration of 3-
hydroxyadipyl-CoA into 2,3-dehydroadipyl-CoA by the putative enoyl-CoA hydratase of
R. eutropha; 4. hydrogenation of 2,3-dehydroadipyl-CoA into adipyl-CoA by trans-
enoyl-CoA reductase (Ter) from Euglena gracillis; 5. substitution of CoA in adipyl-CoA
with phosphate group by phosphate butyryltransferase (Ptb) from Clostridium
acetobutylicum. 6. removal of the phosphate group of adipyl-phosphate by butyryl kinase
(Buk1) from C. acetobutylicum (Figure 5). E. coli K12 MG1655 was chosen as the host
strain, which was transformed with two plasmids carrying the genes encoding the
enzymes of the designed pathway. The pathway was tested by heterologous expression of
these enzymes (Yu et al., 2014).
8
Growing culture exhibited accumulation of acetic acid while not succinic acid.
This indicates that the availability of succinyl-CoA may limit the adipic acid production.
E. coli MG1655 ΔptsG ΔpoxB Δpta Δsdha ΔiclR was constructed for overproduction of
succinyl-CoA based on previous study (Liu et al., 2012).
The research group optimized the production of adipic acid titre to 639±34µg/L
and a yield of ~0.064mg/g glucose in shake flask conditions (Yu et al., 2014). This adipic
acid pathway, although still low in yield, has an advantage of being a complete
biosynthesis pathway compared to the cis,cis-muconic acid pathway which requires a
chemical hydrogenation step to make adipic acid. Further strategies, such as coordinated
overexpression of the enzymes and direct evolution of the enzymes which allow superior
catalytic activities can be implemented to further improve the production.
This pathway has brought to attentions from other researchers. Deng and Mao
discovered that this pathway occurs natively in Thermobifida fusca B6 strain. Through
metabolite analysis they found adipic acid production in the strain; and by a series of
follow-up studies such as real-time qPCR and in vitro enzyme assay, they identified the
native enzymes that are responsible for each step of the pathway. The strain under batch-
fermentation achieved 2.23g/L titre of adipic acid with 0.045g/g glucose yield, which has
been the highest reported yield and titre among all the complete biosynthetic pathways of
adipic acid so far (Deng & Mao, 2015).
Figure 5. Biosynthetic pathway of adipic acid inspired by reversal of dicarboxylate β-oxidation.
(Yu, 2014)
9
1.3.3 A newly designed biosynthetic pathway for production of α-ketoadipate and adipic acid
1.3.3.1 From α-ketoglutarate to α-ketoadipiate
In S. cerevisiae, the α-aminoadipate (AAA) pathway is a biochemical pathway for
synthesis of amino acid L-lysine (Figure 6) (Vogel, 1964; Zabriesky et al., 2000). The
starting metabolite is α-ketoglutarate. The first four enzymatic steps of the AAA pathway
add one carbon to the backbone of α-ketoglutarate, which leads to α-ketoadipate. The
first reaction step is a condensation of 2-oxoglutarate and acetyl-CoA to form
homocitrate, catalysed by homocitrate synthase (HCS). This is the rate limiting step of
the AAA pathway due to feedback inhibition of HCS by the end product L-lysine
(Feller et al., 1999; Andi et al., 2005). Lys20 and lys21 encodes two isoforms of HCS
and have been characterized (Quezada et al., 2011). A metabolic control analysis by
gradually and individually manipulating lys20 and lys21 activities showed that lys20 is
much less susceptible to lysine inhibition than lys21, and thus exerts most of the flux
control over the AAA pathway (Quezada et al., 2011). Furthermore, Feller et al. showed
that a substitution of a particular amino acid in lys20 significantly reduces its sensitivity
towards lysine (Feller et al., 1999; Bulfer et al., 2010).
The next two steps of the AAA pathway are the dehydration of homocitrate to
homoaconitate and subsequent rehydration to homoisocitrate (Fazius et al., 2012). This
reaction closely resembles the isomerization of citrate via aconitate to isocitrate in TCA
cycle, where the isomerization is performed by a single enzyme aconitase (Aco1p)
(Lauble et al., 1992, 1995). Thus in convention, the isomerization of homocitrate were
also considered to be catalyzed by a single enzyme homoaconitase (HA), which belongs
to the aconitase superfamily (Xu et al., 2006). However, based on recent study of Fazius
et al., a lysine auxotrophic mutant of S. cerevisiae with a defect in the conversion
between homoisocitrate and homoaconitate has shown an accumulation of homocitrate
and homoaconitate. This pointed to the existence of two independent enzymes for the
isomerization of homocitrate. Fazius et al. identified the enzyme for the second step of
isomerization – an aconitase (Aco2p) – and characterized it. They further concluded that
10
two aconitases exist in S. cerevisiae, one mainly contributing to TCA cycle and the other
one mainly contributing to lysine biosynthesis (Fazius et al., 2012).
Homoisocitrate dehydrogenase (HICDH) catalyses the fourth step of AAA
pathway, an oxidative decarboxylation of homoisocitrate to 2-oxoadipate. The
mechanism of this reaction is proposed to be similar to that of isocitrate dehydrogenase
(Grodsky et al., 2000).
A
B
Figure 6. Biosynthesis pathways of adipic acid and glutaconate from α-ketoglutarate. (A) Biosynthetic
pathway of adipic acid from α-ketoglutarate. The pathway can be divided into upper-pathway (α-
ketoglutarate to α-ketoadipate) and lower pathway (α-ketoadipate to adipate). The upper pathway is the first
four enzymatic steps of α-aminoadipate (AAA) pathway in S. cerevisiae. The lower adipic acid pathway is
a C6 version of (B) glutaconate pathway, which was designed by Djurdjevic et al (Djurdjevic et al., 2011).
11
1.3.3.2 From α-ketoadipate to adipic acid
In 2011, a biosynthetic route for production of glutaconic acid (the “C5” version
of 2-hexendioic acid) in E. coli was reported by Djurdjevic et al (Djurdjevic et al., 2011)
(Figure 6). The pathway converts α-ketoglutarate into glutaconic acid by four enzymatic
steps: 1. a reduction of α-ketoglutarate into 2-hydroxyglutarate by hydroxyglutarate
dehydrogenase from Acidaminococcus fermentans; 2. the formation of CoA ester of 2-
hydroxyglutarate by glutaconate CoA transferase from A.fermentans; 3. an dehydration of
2-hydroxyglutaryl-CoA into glutaconyl-CoA by 2-hydroxyglutaryl-CoA dehydratase
from Clostridium symbiosum; 4. The revomal of CoA by glutaconate CoA transferase
from A. fermentans. E. coli BL21 (DE3) was selected as the host strain for two plasmids
with genes encoding enzymes of the pathway. With supplement of L-cysteine, riboflavin
and ferric citrate to facilitate the heterologous expression of 2-hydroxyglutaryl-CoA
dehydratase due to its iron-sulfur cluster characteristic, the yield of glutaconate increased
10 fold to 2mM compared to no supplement added (Djurjevic et al., 2011).
In 2012, Parthasarathy et al. proposed a biosynthesis pathway from α-ketoadipate
to adipic acid using the same enzymes of the glutaconate pathway. They demonstrated
through in vitro assay that the hydroxyglutarate dehydrogenase, 2-hydroxyglutaryl-CoA
transferase and glutaconate CoA transferase, although favoring C5 substrates, still exhibit
activity towards their corresponding C6 substrates (i.e., α-ketoadipate, 2-hydroxyadipate,
2-hydroxyadipyl-CoA, respectively) (Parthasarathy et al., 2011). However, two main
challenges regarding this adipic acid pathway remained to be solved.
The first challenge is the reduction of α-ketoadipate into 2-hydroxyadipate. HgdH
highly favors C5 substrate AKG over C6 substrate AKA. A solution has been proposed
by Reitman et al (Reitman et al., 2012). They designed a mutation on homoisocitrate
dehydrogenase of S. cerevisiae to switch its original oxidative decarboxylase activity to a
simple oxidoreductase activity. The mutant no longer has activity against AKG, but is
able to convert AKA into 2-hydroxadipate, which is the first enzymatic step of the adipic
acid pathway proposed by Parthasarathy et al. The design is inspired by a previous
discovery of a mutant of isocitrate dehydrogenase in brain cancer cell, which becomes
12
inactive with NADP+ and isocitrate, but is able to convert α-ketoglutarate to 2-
hydroxyglutarate (Reitman et al., 2012).
The second challenge is that a reductase is needed to convert 2-hexendioate to
adipic acid. No enzyme with the desired activity has been reported until recently, such
enoate reductases from several organisms have been discovered by Khusnutdinova et al.
(personal communication, November, 2015). Candidate enzymes were over-expressed in
E. coli and S. cerevisiae. Whole-cell biotransformation tests showed that the enzymes are
active in E. coli, but not in S. cerevisiae. Among various candidates, the reductase from
Bacillus coagulans showed the highest activity against 2-hexenedioate.
With the enoate reductase discovered, all the enzymes have been identified and
characterized for the adipic acid pathway where AKG is converted to adipic acid via
AKA and 2-hexenedioate. The goal of this thesis is to construct this pathway in E. coli
and validate it. We divided the pathway into two parts - the upper pathway from α-
ketoglutarate to α-ketoadipate and the lower pathway from α-ketoadipate to adipic acid -
and tested each part individually by over-expressing corresponding enzymes and feeding
the strain with appropriate substrates.
1.4 Evaluating biosynthetic pathways of adipic acid with metabolic modeling tools
Genomic, transcriptomic, and metabolomic data has been recently obtained for a
variety of organisms. Using these datasets, computational models can be built to help
predict systemic effects of genetic manipulation of microorganism (Reed et al., 2003).
Methods based on flux balance analysis have been shown to accurately predict the
physiology of the cell. At steady states, the metabolic system of an organism can be
represented as an LP problem in the model (Orth & Palsson, 2010):
Max c’v
s.t. Sv=0
lb≤v≤ub
13
where S is a stoichiometric matrix. The rows of the matrix represent metabolites and the
columns represent reactions in the metabolic system. The value sij in the matrix
represents the stoichiometry of the ith metabolite in the jth reaction. v is the reaction flux
vector, with its component vl representing the flux through the lth reaction. lb and ub are
lower bound and upper bound for the reaction flux. The objective function c’v usually
represents the maximization of biomass. At steady states, the concentration of each
metabolite remains constant and thus Sv=0.
Gawand et al. have used one of the E. coli genome-scale models to evaluate the
biosynthetic pathways of adipic acid mentioned in the previous sections, assuming these
pathways can be successfully integrated into E. coli K-12 strain (personal
communication, November, 2015). Using flux balance analysis, they calculated the
theoretical yields of adipic acid from the pathways and their corresponding revenues
(Table 1, A and B). They concluded that the reversal of dicarboxylate β-oxidation
pathway is the most promising one, considering that it provides the highest theoretical
yield. They estimated the production cost to be $0.50/kg glucose, provided that the
industry is using $300/mt glucose feedstock to manufacture adipic acid from these bio-
routes and glucose accounts for 60% of the production cost. According to their
calculation, 2-hexenedioate pathway cannot make profits under anaerobic conditions
unless the production can be achieved under microaerobic conditions, production cost can
be reduced or adipic acid can be produced in an amount more than 70% of the maximal
yield.
14
Table 1. Theoretical yields and predicted revenues of adipic acid production from the three
biosynthesis pathways under (A) microaerobic conditions and (B) anaerobic conditions were
calculated. E. coli model used for calculation was derived from a genome-scale model iJR904
(Reed 2003). Production of adipic acid was used as the maximum objective function while the
minimum growth rate and ATP maintenance requirement were set to zero. Predicted revenues
were calculated at 70% of the theoretical yield. Price of adipic acid was estimated at $2.4/kg
(Gawand et al., personal communication, November, 2015).
The adipic acid pathways introduced in this chapter are summarized in Table 2,
including the host organisms for each pathway, approaches, fermentation data, theoretical
yield, advantages, disadvantages and references.
A
B
15
Table 2. Summary of biosynthetic pathways of adipic acid.
Yield Productivity Titre
(mol/mol
glucose) (mM/g DCW /h) (g/l)
Muconate pathway I
(from benzoate)P.putida 4 N/A 4.3 18.5 N/A
High titre and
productivity
using fossil fuels as
feedstocks
van Duuren et al. ,
2011, 2012
E. coli 1,2,3 0.24 N/A 36.8 0.77/0 high titire and yield Niu et al. , 2002
S.cerevisiae 1,2,3,5 0.09 N/A 0.141 N/A decent titre and yield Curran et al. , 2013
E. coli 1,2,3 0.000078 N/A 0.00064 0.92/0.75High theoretical yield,
complete biosynthesis
Low yield and titre in
fermentationYu et al. , 2014
T. fusca 2 0.056 N/A 2.23 N/AHigh titre and yield,
complete biosynthesis
uncommonn host in
industryDeng & Mao, 2015
2-Hexendioate
pathwayE. coli NR N/A N/A N/A 0.79/0.3
decent theoretical yield,
complete biosynthesis
requires expression
of eight
heterologous
enzymes
Djurdjevic et al. ,
2011; Partharsarathy
et al. , 2014
*1: Gene deletions, 2: Over-expression, 3: Heterologous pathways, 4: mutagenesis, 5: metabolic modeling, NR: nor reported
References
Theoretical Yield
(Microaerobic/Anaerobic)
(mol/mol glucose)
Disadvantages
requires a chemical
hydrogenation step
Muconate pathway II
(from glucose)
Reversal of
dicarboxylate β-
oxidation pathway
Pathways Host Approach*
Fermentation Data
Advantages
16
2. Motivation and Statement of Objectives
In chemical industry, most value-added chemicals are produced from non-
renewable fossil fuels. The development of metabolic engineering provides an
alternative to consumption of petroleum for chemical production. Recent advances in
DNA synthesis, deletion and heterologous expression have enabled metabolic
engineering to build pathways in industrial organisms such as E. coli, and have
converted them into producers of desired chemicals. The bio-based production
mostly utilizes glucose as a basic feedstock instead of fossil fuels and is thus
environment-friendly in nature. Adipic acid is one of the most important building
blocks in chemical industry, and its bio-based production methods have been studied.
However, very few complete biosynthesis pathways for adipic acid are known and
validated so far.
The hypothesis of this project is that by combining the α-aminoadipate
pathway in S. cerevisiae, glutaconate pathway designed by Djurdjevic et al, and a
new enoate reductase discovered by Khusnutdinova et al, we are able to construct a
complete biosynthesis pathway for adipic acid (Figure 6A). We chose E. coli to be
the platform strain of this pathway. The objectives of this project are to validate and
characterize the pathway, where we:
Construct and analyze the conversion of AKG to AKA (the upper part of the
pathway) in E .coli, which involves integration of genes encoding four enzymes from
the α-aminoadipate pathway in E. coli.
Construct and analyze the conversion of AKA to adipic acid (the lower part of the
pathway) in E. coli, which involves integration of genes from the glutaconate
pathway and a gene encoding the enoate reductase in E. coli.
17
3. Material and Methods
The DNA sequences of relevant enzymes are listed in Appendix 8.1. The strains,
plasmids, and primers used in this work are listed in Appendix 8.2. The chemicals and
culture media used are listed in Appendix 8.3.
3.1 Cultivation and fermentation of E. coli
3.1.1 Storage of E. coli strains
For long term storage of E. coli strains, cells were cultivated in 5mL LB media
with corresponding antibiotics. The growing conditions were set to 37 0C, 220 rpm for
about 16 hours. Next, 0.5mL of the culture was mixed with 0.5mL 50% glycerol in a
cryovial, which was stored in -80 0C fridge.
3.1.2 Cultivation of E. coli for plasmid isolation
E. coli DH5α transformed with plasmids was cultivated in 5mL LB culture with
corresponding antibiotics. The growing conditions were set to 37 0C, 220 rpm in
Figure 7. The work flow diagram.
18
incubator for about 16 hours. Cells were then harvested by centrifugation for plasmid
isolation.
3.1.3 Cultivation of E. coli for enzyme work
A starting culture of target strain was prepared with 5mL LB and corresponding
antibiotics. The growing conditions were set to 37 0C, 220 rpm for about 16 hours. Next,
50mL TB medium was inoculated with the starting culture to OD600nm~ 0.1, with the
same growing conditions. When OD600nm reached around 0.6, strains harboring
expression plasmids with T7 promoters were induced with 1mM IPTG. After around 16
hours, cells were harvested for protein work.
3.1.4 Fermentation experiments of E. coli in bioreactors
A starting culture with 50mL LB medium and suitable antibiotics in a shake flask
was inoculated with the glycerol stock of the target strain. The inoculum was grown
under conditions of 37 0C, 220 rpm for around 16 hours. To test E. coli strain with the
upper pathway, a 500mL Applikon bioreactor with 300mL of modified M9 minimal
medium, glucose, casamino acids and corresponding antibiotics was inoculated with the
starting culture to a starting OD600nm~ 0.1. The growing temperature was set to 300C and
the stirrer speed was set to 1000rpm. The pH of the culture were measured using
Applikon pH probe and maintained at 7.0 with 5M KOH. Foam formation was detected
by Applikon antifoam sensor and prevented by automatic addition of 1:20 Antifoam C
(Sigma Aldrich) in water. The bioreactor was sparged with air to maintain aerobic
conditions or with nitrogen for anaerobic conditions. When the culture reached OD600nm
0.6-1.0, 1mM final concentration of IPTG was added to induce protein expression. After
about 3 hours, AKG was added as a substrate for the upper pathway, with some
additional glucose and casamino acid. Mass-spec (Thermo Gaswork) was connected to
the exhaust vent of the bioreactor to monitor the level of CO2, O2, N2 and ethanol in the
head-space of bioreactor. To test E. coli strain with the lower pathway, a 500mL
Applikon bioreactor with 300mL of Standard I medium, its corresponding supplements,
0.8% glucose, 0.2% casamino acid and corresponding antibiotics was inoculated with the
19
starting culture to OD600nm~ 0.1. Cells were cultivated under anaerobic conditions
throughout the whole process. The growing temperature was set to 250C, and pH to 7.4.
When the culture reached OD600nm~0.25, 1mM final concentration of IPTG was added to
induce protein expression. After 3 hours, 250mg/L AKA was added as substrate for L1
and L2 strain (AKA to adipic acid) or 500mg/L AKG was added for L2_C5 strain (AKG
to glutaconic acid).
3.1.5 Fermentation experiments of E.coli in shake flasks for the upper pathway
A starting culture with 10mL LB medium was inoculated with the glycerol stock
of the target strain. The inoculum was grown under conditions of 37 0C, 220 rpm for
around 16 hours. A 250mL shake flask with 50mL of modified M9 minimal medium,
glucose, casamino acids and corresponding antibiotics was inoculated with the starting
culture to a starting OD600nm~ 0.1. The growing temperature was set to 300C and the
shaking speed was set to 220rpm. When the culture reached OD600nm 0.6-1.0, 1mM final
concentration of IPTG was added to induce protein expression. After about 3 hours,
AKG was added as the substrate, with some additional glucose and casamino acid. For
aerobic conditions, the caps of the shake flasks were loosen and for anaerobic conditions
the caps were tightly closed. Biological triplicates were run for each type of strain or
fermentation condition.
3.1.6 In vivo biotransformation for the lower pathway
A starting culture with 50mL LB medium and appropriate antibiotics in a shake
flask was inoculated with the glycerol stock of the target strain. The inoculum was grown
under the conditions of 37 0C, 220 rpm for around 16 hours. Next, 1L TB medium in
2.5L baffled flask was inoculated with the starting culture to a starting OD600nm~0.1.
Same growing conditions were applied until OD600nm reached around 0.8. Culture
medium were transferred to 1L capped bottle and a final concentration of 1mM IPTG
were added to induce enzyme expression. The cell culture were stirred by a stirring bar
and the bottle were cap-sealed and kept in room temperature for 16 hours. Cells were
20
harvested and washed with 100mM potassium phosphate buffer pH 7.4; anaerobic
chamber was used during this process to ensure strict anaerobicity. In the chamber, cells
were re-suspended in 10mL potassium phosphate buffer and transferred to a 15mL
reaction vial. Antibiotics, 3% glucose, and 5mM AKA as the substrate for C6 lower
pathway testing (or 5mM AKG as the substrate for C5 lower pathway testing) were
added. The reaction vial was sealed by a rubber stopper and the reaction conditions were
set to 37 0C, 220 rpm.
3.2 Methods for DNA work
3.2.1 Plasmid DNA isolation
E. coli strains harbouring the plasmids were cultivated overnight in 5mL LB
medium containing the appropriate antibiotics at 37 0C, 220 rpm. The cells were
harvested at room temperature by centrifugation at 8000 rpm for 2 minutes. QIAprep
Spin Miniprep Kit (Qiagen, Hilden, Germany) or GeneJET Plasmid Miniprep Kit
(Fermentas) were used for plasmid DNA isolation. The cell pellet was re-suspended in
250µL resuspension buffer in a 2mL Eppendorf tube, then lysed by 250µL lysis buffer
and neutralized by 350µL neutralization buffer. The mixture was centrifuged at
13000rpm for 10 minutes and the supernatant was transferred to the spin column. DNA in
the supernatant was bound to the column at room temperature through centrifugation at
13000rpm for 1 minute, and the flow-through was discarded. 750µL washing buffer were
added to the column and centrifuged for 1 minute at 13000 rpm to wash off the non-DNA
impurities binding to the column. Flow-through was discarded and the column was
centrifuged once more to remove the residual washing buffer. The column was
transferred into a 1.5mL microcentrifuge tube, and 25-50µL nuclease free water was
added to the column which was centrifuged at 13000rpm for 2 minutes to elute the
desired DNA.
21
3.2.2 Agarose gel electrophoresis
Negatively charged DNA molecules can be separated by size in electric field.
Electrophoresis was performed in 1% (w/v) agarose gel, which is made by mixing
agarose with 0.5x TAE buffer. The mixture was heated in a microwave oven until it
completely melted. RedSafe (iNtRON) was added to the mixture as nucleic acid stain.
The mixture was poured into a casting tray containing a sample comb and allowed to cool
at room temperature. After the gel had solidified, the comb was removed and gel was
transferred into an electrophoresis chamber covered with 0.5x TAE buffer. DNA samples
were mixed with 6x DNA Gel Loading Dye (ThermoFisher Scientific) and pipetted into
the sample wells. One sample lane contained exclusively 6µL 1kb Plus DNA Ladder
(ThermoFisher Scientific). Electrophoresis was carried out at 135V for 25 minutes. The
resulting gel was examined under UV transilluminator.
50x TAE buffer: 242 g/L Tris, 57.1 ml/L glacial acetic acid, 16.8 g/L EDTA
3.2.3 DNA restriction and ligation
Restriction of DNA fragments was performed using type II restriction
endonucleases at 37 0C. The enzymes were obtained from New England Biolabs.
Restriction reaction mixture contained 1000-2000ug PCR products or plasmids, 10U of
the corresponding enzymes, Smartcut Buffer (New England Biolabs) and appropriate
amount of nuclease free water to make the total volume into 50uL.
The T4 DNA ligase, obtained from New England Biolabs, catalyses the formation
of a phosphodiester bond between 5’-phosphate and 3’-hydroxy groups in double-
stranded DNA. Ligation of double digested PCR products and appropriate plasmids
were carried out in 20µL mixture containing 50ng plasmid DNA, 3-9 times molar excess
of PCR product, 200U T4 DNA ligase, T4 Ligase Reaction Buffer (New England
Biolabs), and appropriate amount of nuclease free water. The ligation reaction mixture
was incubated for 16h at 160C.
22
3.2.4 Transformation of chemically competent E. coli cells
Transformation of chemically competent cells were performed by a heat shock
protocol. Chemically competent cells of E. coli DH5α and E. coli BL21(DE3) were
obtained from New England Biolabs. For transformation, the competent cells were
thawed from -80 0C freezer. 30-100ng of plasmid DNA or 5uL ligation mixture was
mixed with 50uL of compotent cells in a 1.5mL Eppendorf tube and incubated on ice for
30 minutes. To transfer the DNA into the cells, the mixture was heat shocked at 420C for
15 seconds for E. coli BL21(DE3) or at 370C for 2 minutes for E. coli DH5α, and then
transferred on ice for 5 minutes. The cells were regenerated by adding 950mL of LB
medium to the mixture and by incubation for 1-1.5h at 370C and 220rpm. 50-200uL of
cell suspension was plated on the LB agar plate with appropriate antibiotics. The plate
was incubated at 370C overnight.
3.2.5 Polymerase chain reaction (PCR)
The polymerase chain reaction is a method for amplification of DNA fragments
(Mullis, 1986). In this work, Q5 High-Fidelity DNA Polymerase with 5x Q5 Reaction
Buffer was obtained from New England Biolabs and used for PCR. The components of a
50uL PCR reaction mixture and the thermocycling conditions for PCR followed the
protocol provided by NEB on their website.
3.2.6 Construction of expression plasmids
For expression of heterologous genes in E. coli, the plasmids pETDuet-1,
pACYCDuet-1, pColaDuet-1, and pCDFDuet-1 from Novagen were used (Table 6). The
target genes were amplified from chromosomal DNA of Saccharomyces cerevisiae
(provided by Yakunin Lab, University of Toronto, Canada), Acidaminococcus fermentans
(DSMZ, Braunschweig, Germany), or Clostridium symbiosum (DSMZ, Braunschweig,
Germany) using the oligonucleotides listed in Table 8. After amplification the DNA
fragments were purified using GeneJet PCR Purification Kit (ThermoFisher Scientific)
23
and restricted with appropriate enzymes. The restricted DNA fragments were purified
again with GeneJet PCR Purification Kit (ThermoFisher Scientific) and ligated with
appropriate restricted plasmid DNA (Table 6), followed by transformation of E. coli
DH5α cells. E.coli colonies grown on selective agar plates were chosen for plasmid DNA
isolation. To screen for the desired recombinant plasmids, PCR or digestion test were
performed (Table 8).
3.2.7 Site directed mutagenesis
Site-directed mutagenesis of homocitrate synthase (lys20) and homoisocitrate
dehydrogenase (lys12) of S.cerevisiae were performed in this work. For lys20, a
replacement of three bases from “GAT” to “AAT” caused a change in the amino acid
sequence from arginine to histidine (Feller et al., 1999). The plasmid
pACYCDuet+lys20+aco2 served as the template for amplification with oligonucleotides
F_D111N_lys20 and R_D111N_lys20 (Table 8) which contained the point mutation. For
lys12, a replacement of a single base from “G” to “A” caused a change in the amino acid
sequence from arginine to histidine (Reitman et al., 2012). The plasmid
pETDuet+lys12+lys4 served as the template for amplification with the oligonucleotides
F_R143H_lys12 and R_R143H_lys12 (Table 8) which contained the point mutation. Q5
High-Fidelity DNA Polymerase from New England Biolabs were used for PCR
amplification. After PCR, the reaction mixture was treated with 1uL of 20,000u/mL DpnI
(NEB) for 1.5h at 370C to digest the original plasmid template, followed by
transformation of E. coli DH5α cells. E. coli colonies grown on selective agar plates were
chosen for plasmid DNA isolation. The desired point mutation was checked via DNA
sequencing.
3.2.8 DNA concentration and purity determination
The concentration of DNA was measured at 260nm with a spectrophotometer
(Nanodrop); the purity of the DNA was measured by the ratio of OD260/OD280, which
is optimal between 1.8 and 2.0.
24
3.2.9 Sequencing of cloned genes
DNA sequencing was performed using the sequencing service of TCAG. 7uL of
sequencing sample contained 250-300ng target DNA, 0.7uL 10uM sequencing primer
and nuclease free water. The received sequencing results were compared with the in-
silico sequences using software Geneious.
3.3 Methods for protein work
3.3.1 SDS-PAGE procedure
The method of cultivation of E. coli for protein work was described in section
3.1.3. The cells were harvested by centrifugation for 10min at 5000rpm and 40C. The
pellet was re-suspended in 2mL lysis buffer (50mM Tris/HCl, pH7.5, 100mM NaCl, 5%
glycerol, 1mM dithiothreitol) with a final concentration of 300ug/mL lysozyme and 1
mM phenylmethanesulfonylfluoride (PMSF), and incubated on ice for 3-5h at 60rpm to
lyse the cell. 500uL of cell lysate was transferred in a 1.5mL Eppendorf tube and
centrifuged for 10 minutes at 13000rpm and 40C. The supernatant or insoluble fraction
was mixed with 6x sample loading buffer and incubated at 950C for 10min to denature
the proteins. 10-20uL of the samples and PageRuler Plus Prestained Protein Ladder
(ThermoFisher Scientific) were loaded on the wells of SDS-PAGE gel. Electrophoresis
was run at constant voltage of 140V until the blue marker reached the bottom of the gel
(~70 minutes). The protein were stained by microwaving the gel with 0.1% Coomassie
Brilliant blue for 1 minutes and leaving it at room temperature for 1 hours. The gel was
destained by microwaving with water and leaving it overnight on an orbital shaker.
3.3.2 Cell extract assay of the lower pathway strain
The strain cultivation and protein expression methods were the same as the ones
in the in vivo biotransformation test (Section 3.1.6). After overnight induction, cells were
harvested and washed with 100mM potassium phosphate buffer pH 7.4; anaerobic
25
chamber was used during this process to ensure strict anaerobicity. The cells were re-
suspended in 10mL potassium phosphate buffer, and then lysed by French press. The cell
lysate was transferred to a 15mL reaction vial. Antibiotics, 3% glucose, and 5mM AKA
as the substrate for C6 lower pathway testing were added. The reaction vial was sealed by
a rubber stopper and the reaction conditions were set to 37 0C, 220 rpm.
3.4 Analysis
Sample analysis was performed under HPLC Ultimate 3000 and Mass-
spectrometry (ThermoFisher scientific). For HPLC analysis, Aminex HPX-87H column
(Bio-Rad) was used. HPLC method is 2.5mM or 5mM H2SO4 as eluent, 37 0C for
column temperature, 45min running time per sample, and UV and RI as detection
method. For mass-spec analysis, 500mL cell sample was mixed with 1mL of
methanol/acetonitrile/formic acid (2:2:1), and incubated at -200C for 1h to lyse the cell.
The cell lysate were centrifuged at 13000rpm and the supernatant was transferred to
1.5mL Eppendorf tube, followed by concentration using speed-vac. The concentrated
sample were dissolved in 100uL 0.1% formic acid, followed by filtration with VWR
Centrifugal Filter 10k (VWR International) and sent for mass-spec analysis.
Cellular Growth was monitored through optical density measurements using a
spectrophotometer (Genesys 20, Thermo Scientific).
26
4. Results and Discussion 4.1 Characterization of the upper pathway in E. coli: from α-ketoglutarate to α-
ketoadipate 4.1.1 Construction of E. coli strain with the upper pathway (U1 strain)
To construct the upper pathway in E. coli. The gene lys4 encoding homoaconitase
and the gene lys12 encoding homoisocitrate dehydrogenase of S.cerevisiae were
introduced into two multiple cloning sites of a pETDuet-1 vector; aco2 encoding
homocitrate dehydratase and lys20 encoding homocitrate synthase of S.cerevisiae were
introduced into two multiple cloning sites of a pACYCDuet-1 vector. Each of the
multiple cloning sites is preceded by a T7 promoter/lac operator and a ribosome binding
site (rbs). E. coli BL21(DE3) were co-transformed with the two constructed plasmids
(Figure 8). Existence of the four target genes in the constructed strain was verified by
PCR tests, using the amplification primers of the four genes. The gel result showed bands
corresponding to the four target genes, indicating the upper pathway was transformed in
E. coli BL21(DE3) (data not shown).
Figure 8. Two plasmids were constructed harbouring upper pathway genes and transformed into
E. coli BL21(DE3). (A) The gene lys12 and lys4 were integrated into pETDuet-1 vector. (B) lys20
and aco2 were integrated into pACYCDuet-1 vector.
A B
27
To test the expression levels of lys4, lys12, lys20 and aco2, the upper pathway
strain (U1 strain) was grown in TB medium and induced with IPTG. SDS-Page analysis
of the cell-free extract showed a thick protein band (Figure 9) corresponding to lys12,
which was not present in the control (wild type strain E. coli BL21(DE3) with two empty
plasmids pETDuet-1 and pACYCDuet-1). Protein bands corresponding to lys20, lys4 and
aco2 could not be found; considering that SDS-Page analysis has low sensitivity and low
resolution for protein identification, it was not conclusive whether those three proteins
were expressed or not.
Figure 9. SDS gel for heterologous expressed enzymes of the upper pathway strain U1. Page ruler
was used as marker
4.1.2 Alpha-ketoadipate production of upper-pathway E. coli strain
We hypothesized that that E. coli is a suitable platform for our studied adipic acid
biosynthetic pathway, and therefore the constructed upper pathway strain should be an α-
ketoadipate producer. We conducted fermentation experiment in bioreactor to test the
production of α-ketoadipate from the upper-pathway strain (U1 strain). The strain was
cultivated as described in Material and Method section. Growing temperature was set to
300C, which is the optimal temperature for S. cerevisiae and therefore the enzymes in the
upper pathway as well. E. coli BL21(DE3) was transformed with empty plasmids
pETDuet-1 and pACYCDuet-1as the wild type strain for negative control. AKG was
added after 3 hours of induction of enzyme expression by IPTG (at t=2). The culture was
28
supplemented with 0.4% casamino acids. Cell growth behavior was monitored by
spectrophotometer and the growth rates were calculated from the data (Figure 10). AKG
and AKA in the extracellular culture media were identified by mass spectrometry and
quantified through HPLC. The data indicates that AKA production, AKG consumption
had strong correlation with the cell growth (Figure 10).
Through fermentation experiments in bioreactors, the strain produced 135mg/L
AKA in aerobic conditions within 11 hours of cultivation and 121mg/L AKA in
anaerobic conditions within 51 hours of cultivation (Figure 10). No AKA was detected in
the wild type. The results therefore demonstrate our hypothesis that the upper pathway
works in E. coli. In previous section, expression of lys20, lys4 and aco2 has not been
shown by SDS-Page analysis; however, based on the result that AKA was produced, it is
likely that they were expressed. However, we cannot neglect the possibility that due to
enzyme promiscuity, some native enzymes of E. coli may have similar function as the
upper pathway enzymes, so that the upper pathway may still be established in E. coli
without expression of all the integrated genes. Through a BLAST of the upper pathway
enzymes, some native E. coli enzymes were identified with high similarity in sequence
(Table 3). For example, tartrate dehydrogenase in E. coli shows high identity (38%) with
the upper pathway enzyme lys12, with a matching score of 212 and E value of 5E-63. In
order to completely rule out the possibility of enzyme promiscuity, future experiments
can be done in which each gene of the upper pathway is deleted respectively and the
deleted strains are tested to see if they are still able to produce AKA.
29
Growth curve
0 20 40 600
2
4
6
8U1 strain_aerobic
WT strain_aerobic
U1 strain_anaerobic
time(h)
OD
(600n
m)
AKA concentration in cell culture
0 20 40 600
50
100
150
200U1 strain_aerobic
WT strain_aerobic
U1 strain_anaerobic
time (h)
AK
A(m
g/L
)
AKG concentration in culture media
0 20 40 600
200
400
600
800
1000U1 strain_aerobic
WT strain_aerobic
U1 strain_anaerobic
time (h)
AK
G (
mg
/L)
Figure 10. Characterization of the upper pathway in constructed E. coli strain U1 in bioreactor. M9
minimal medium was used with supplement of casamino acids. AKG was added after 3 hours
of induction of enzyme expression by IPTG (t=2). (A) Growth curve of U1 strain and WT strain.
The growth rates were calculated as follows: U1 strain_aerobic: 0.28h-1; WT strain_aerobic:
0.31h-1; U1 strain _anaerobic: 0.14h-1. (B) AKA production of U1 strain and WT strain under
aerobic and anaerobic conditions. (C) AKG concentration in cell culture. (D) An overview of the
upper pathway. Error bars were calculated from two technical replicates.
A B
C
D
30
Table 3. BLAST of upper pathway enzymes to identify enzymes in E. coli with similarity in
sequences.
In an economic point of view, in order to commercialize the adipic acid producer
strain, it is desirable that the strain can be cultivated in an environment as simple as
possible. Additional supplements to the strain, although may benefit the growth and
enhance the production, may also significantly increase the production cost. Therefore,
our work studied the impact of the casamino acids supplement on AKA production. We
conducted fermentation experiments in bioreactors without supplementing casamino
acids, and compared the AKA production with the previous experiments. The growth
curve and AKA production profile were shown in Figure 11; together with the results of
previous experiments, relevant data were summarized in Table 4. Through fermentation
of upper pathway strain without casamino acids, 38mg/L AKA was produced after 60
hours of anaerobic cultivation, corresponding to a yield of 0.11mol AKA/mol AKG. The
titre and yield were significantly less than those supplemented with casamino acids. Thus,
we concluded that casamino acids can significantly affect AKA production. The reason
can be in many aspects. First, as Table 4 shows, supplementing casamino acids could
benefit cell growth (OD600nm of 2.71 compared to 1.5), which had a strong positive
correlation with AKA production. Second, casamino acids could facilitate synthesis of
heterologous enzymes from the upper pathway. Third, casamino acids might also be a
source for native metabolic system to synthesize AKG which is the starting material for
the upper pathway.
Upper pathway
genesUpper pathway enzymes
Best matching enzymes from
E.coliMatching Score E value % identity
lys20 homocitrate synthase 2-isopropyl malate synthase 147 3E-37 28%
lys12 homoisocitrate dehydrogenase tartrate dehydrogenase 212 5E-63 38%
aco2 aconitase aconitate hydratase 175 6E-44 25%
lys4 homoaconitase aconitate hydratase 112 6E-22 24%
31
Figure 11. (A) Growth curve and (B) AKA production profile of U1 strain and WT strain under anaerobic
conditions in bioreactor fermentation where no casamino acid was supplemented, with and without
substrate AKG added. Error bars were calculated from two technical replicates.
Table 4. A summary of AKA production titre of the upper pathway strain based on different
bioreactor fermentation methods.
According to the results of the bioreactor fermentations, AKA yield in anaerobic
conditions (0.28mol AKA/mol AKG) was higher than that of aerobic conditions (0.18mol
AKA/mol AKG) (Table 4). The reason of this might be that anaerobic conditions
inhibited some native competitive pathways which consumed AKG. Thus, in terms of
A B
Fermentation
method
casamino
acid
added
AKG
added
(mg/L)
final
concentration
of AKG (mg/L)
AKG
consumed
(mg/L)
AKA
Production
titre (mg/L
AKA)
AKA Yield
(mol
AKA/mol
AKG)
End point
OD(600nm)
WT_Aerobic 0.4% 750 0 750 0 0 6.02
U1_Aerobic 0.4% 750 73 677 135 0.18 5.62
U1_Anaerobic 0.4% 750 360 390 121 0.28 2.71
U1_Anaerobic 0 500 186 314 38 0.11 1.5
WT_Anaerobic 0 500 228 272 0 0 1.2
U1_Anaerobic 0 0 0 0 0 0 1.6
U1_Two phase
method0 500 17 483 47 0.09 3.9
32
AKG conversion to AKA, anaerobic condition is more efficient than aerobic condition.
However, in either case, the yield was far from 1, which indicates that there were even
more native branches consuming AKG which could not be inhibited by anaerobicity.
Identifying those branches and designing optimization strategies may be of interest for
future work.
It has been reported by Nemr et al. that a two-phase fermentation can improve the
product yield from a pathway which desires anaerobicity (personal communication,
April, 2015). In the two-phase fermentation, cells are grown aerobically to high OD and
then the batch is switched to anaerobic condition and protein expression is induced. A
two-phase fermentation for the upper pathway strain was conducted. However, no
significant change of yield or titre was observed (Table 4).
A fermentation experiment with shake flasks was conducted with 4% glucose,
0.4% casamino aicds, and 750mg/L AKG. The cell growth, AKA production and AKG
consumption were summarized in Figure 12.
In the shake flask fermentation, 254mg/L AKA was produced in aerobic
conditions, leading to a yield of 0.36 mol AKA/mol AKG; 214mg/L AKA was produced
in anaerobic conditions, leading to a yield of 1.19 mol AKA/mol AKG. Counter-
intuitively, in both aerobic and anaerobic conditions, more AKA was produced in shake
flask fermentation than in bioreactor fermentation; also, in aerobic conditions, shake flask
fermentation showed better cell growth than the bioreactor one (Figure 13). The yield of
AKA was higher in anaerobic conditions than in aerobic conditions, which is similar to
the results of the bioreactor fermentations (Figure 13). However, it is noticeable that in
anaerobic conditions, the yield was more than 1 mol AKA/mol AKG, which indicates
that part of the AKA was produced from other carbon sources than the added substrate
AKG, such as glucose or casamino acid. This is different from the results of the
bioreactor fermentations.
The fermentation experiments successfully validated the upper pathway in E. coli.
The constructed strain has not been optimized for AKA production, and thus it is
33
promising to increase the production yield of AKA to a significantly higher level.
Strategies improving AKA production has been discussed in the Recommendation
Section.
Figure 12. Characterization of the upper pathway in shake flasks. (A) and (B): aerobic and
anaerobic growth curves. (C) and (D): AKA concentration in aerobic and anaerobic conditions.
(E) and (F): AKG concentration in aerobic and anaerobic conditions. Error bars were calculated
from three biological replicates.
A B
C D
E F
34
Figure 13. Comparison of (A) AKA titre, (B) AKA yield, (C) cell growth between shake flask
fermentations and bioreactor fermentations of the upper pathway strain.
4.2 Characterization of the lower pathway in E. coli: from α-ketoadipate to adipate 4.2.1 Construction of E. coli strain with the lower pathway (L1&L2 strain)
Two E. coli strains with the lower pathway were constructed. The first strain (L1
strain) harbours two recombinant plasmids, while the second strain (L2 strain) harbours
three recombinant plasmids carrying target genes of the lower pathway. In the first
constructed strain, lys12(R143H) encoding a mutant of homocitrate dehydrogenase of S.
cerevisiae and HgdCAB encoding 2-hydroxyglutaryl-CoA dehydratase C.symbiosum and
its activator were introduced into two multiple cloning sites of a pColaDuet-1 vector;
GctAB encoding glutaconate CoA transferase of A. fermentans and EredBC encoding
enoate reductase of B. coagulans were introduced into two multiple cloning sites of a
A B
C
35
pCDFDuet-1 vector. Each of the multiple cloning sites is preceded by a T7 promoter/lac
operator and a ribosome binding site (rbs). E. coli BL21(DE3) were co-transformed with
the two constructed plasmids (Figure 14). In the second constructed strain,
lys12(R143H) of S. cerevisiae and HgdC encoding activator of 2-hydroxyglutaryl-CoA
dehydratase of A. fermentans were introduced into two multiple cloning sites of a
pColaDuet-1 vector; GctAB of A. fermentans and EredBC of B.coagulans were
introduced into two multiple cloning sites of a pCDFDuet-1 vector; HgdA and HgdB
encoding α and β subunit of 2-hydroxyglutaryl-CoA dehydratase of C.symbiosum were
introduced into two multiple cloning sites of a pETDuet-1 vector. Each of the multiple
cloning sites is preceded by a T7 promoter/lac operator and ribosome binding site (rbs).
E. coli BL21(DE3) was co-transformed with the three constructed plasmids (Figure 15).
Existences of the seven target genes in each of the two constructed strains were verified
by PCR test. The gel results showed bands corresponding the seven target genes,
indicating the lower pathway was constructed in the two E. coli BL21(DE3) strains (data
not shown).
Figure 14. Plasmid construction strategy in the first constructed lower pathway strain (L1 strain). Two
constructed plasmids were incorporated into BL21(DE3) strain. (A) HgdCAB(cs)/(af) and lys12(R143H)
were integrated into pColaDuet-1 vector. (B) EredBC and GctAB were integrated into pCDFDuet-1 vector.
A B
36
Figure 15. Plasmid construction strategy in the second constructed lower pathway strain (L2 strain). Three
constructed plasmids were incorporated into BL21(DE3) strain. Compared to the first lower pathway strain,
each component of HgdCAB were integrated into a single multiple cloning site in the second lower
pathway strain. Switching lys12(R143H) with HgdH in the strain will make the strain a glutaconate
producer (L2_C5 strain). (A) HgdA(cs) and HgdB(cs) were integrated into pETDuet-1 vector. (B)
HgdC(af) and lys12(R143H)/HgdH were integrated into the pColaDuet-1 vector. (C) EredBC and GctAB
were integrated into pCDFDuet-1 vector.
To test the enzyme expression of the lower pathway genes, the L1 and L2 strains
were grown in TB medium and induced with IPTG. After further growth, cells were
harvested and opened as described in Materials and Methods section. SDS-Page analysis
of the cell-free extract showed thick protein bands corresponding to the target enzymes
(Figure 16A&C). Without induction these bands were absent.
A B C
37
Figure 16. SDS gel for heterologous expressed enzymes of the lower pathway strain L1 and L2. Page ruler
plus was used as marker. (A) Gel for lower pathway strain with the two-plasmid construction method. (B)
Gel for strain BL21 pO*(cs) harbouring plasmid pColaDuet+lys12(R143H)+HgdCAB(cs) and strain BL21
pF* harbouring plasmid pCDFDuet+GctAB+EredBC. From (A) and (B) we can see that lower pathway
enzymes other than HgdC and HgdB showed evidence of expression in the medium. (C) Gel for lower
pathway strain with three-plasmid construction method. (D) Gel for strain BL21 pO*(12) harbouring
plasmid pColaDuet+lys12(R143H)+HgdC(af) and strain BL21 pE* harbouring plasmid
pETDuet+HgdA(cs)+HgdB(cs). Since the two lower pathway strain shared a common plasmid
pCDFDuet+EredBC+GctAB, and its enzymes already showed evidence of expression in (A) and (B),
together with results of (C) and (D), we can see that all enzymes of the lower pathway showed evidence of
expression in the medium for the lower pathway strain with three-plasmid construction method.
Due to the similar sizes of some of the target enzymes, a protein band of interest
in SDS-Page analysis may not represent a single target protein expressed. BL21(DE3)
was transformed with each of the constructed plasmids respectively and enzyme
expression was tested through SDS-Page analysis on each of the constructed strains.
Through the tests, more target enzymes were confirmed to be expressed (Figure 16
A B
C D
38
B&D). Combining all the SDS-Page analysis results, we could see that all the seven
target enzymes showed evidence of expression in the second lower pathway strain, while
the expression of HgdC and HgdB was not illustrated in the first lower pathway strain.
We thus chose the second lower pathway strain for the fermentation experiment to test
the pathway. The reason for the better expression may be due to the fact that each
components of the dehydratase and its activator had a T7 promoter and a ribosome
binding site in front of its gene, unlike the first plasmid construction strategy where
HgdCAB were cloned all together into one multiple cloning site of the plasmid, with only
one T7 promoter in front of HgdC.
4.2.2 In vivo biotransformation test for the lower pathway strain
Figure 17. An overview of the lower pathway.
To test whether the constructed strains were able to convert α-ketoadipate into
adipate, we conducted whole cell assay on L1 and L2 strain. The strains were grown in
1L TB and induced with 1mM IPTG at OD~0.8 overnight. Cells were collected and re-
suspended in 10mL K-P buffer with substrate AKA, 3% glucose and antibiotics for the
whole cell assay. The reaction mixture was analyzed by HPLC-MS.
Through the in vivo biotransformation, 2-hydroxyadipate was produced, which is
the product of the first enzymatic step of the lower pathway. This shows that the mutant
of homocitrate dehydrogenase of S.cerevisiae encoded by lys12(R143H) gene was active
39
in E. coli. However, other intermediates or adipic acid from the lower pathway could not
be detected, indicating that the corresponding enzymes – HgdCAB, GctAB or EredBC -
may not be active in this experimental condition. A lack of pH control of the reaction
mixture may have a negative impact on the cell viability and therefore the activity of
those enzymes. Also, HgdCAB encodes a dehydratase and its activator with multiple iron
sulfur clusters, which may bring difficulty for protein synthesis.
A cell extract assay was conducted, where cells were lysed by French press before
the substrate AKA was added for the reaction. Similar to the results of the in vivo
biotransformation, this in vitro test also showed that only 2-hydroxyadipate in the lower
pathway was produced.
4.2.3 Fermentation test on glutaconate pathway (L2_C5 strain) to validate in
vivo activity of enzymes HgdCAB and GctAB in lower pathway
In previous section, the in vivo biotransformation test exhibited evidence of
enzyme activity for lys12(R143H), but not for GctAB, HgdCAB and EredBC, which may
be due to unfavorable reaction conditions such as high cell density or lack of extracellular
pH control. To improve the reaction conditions, we tested the enzyme activity of GctAB
and HgdCAB through bioreactor fermentation, where cell growth conditions such as pH
and anaerobicity were well controlled. For the test, we decided to use the glutaconate
pathway from Djurdjevic et al. instead of the lower pathway since both of the pathways
contain GctAB and HgdCAB, while α-ketoglutarate is a much more economic substrate
than α-ketoadipate (Djurdjevic et al., 2011). Therefore, lys12(R143H) gene on the
constructed pColaDuet plasmid was substituted by HgdH gene (Figure 15B). E. coli
BL21(DE3) was co-transformed with this new pColaDuet derivative carrying HgdH and
HgdC and the previously constructed pETDuet and pCDFDuet derivatives carrying
GctAB, HgdA, HgdB, and EredBC (Figure 15). The glutaconate strain (L2_C5 strain)
was tested in bioreactors under anaerobic conditions. Standard I medium was used with
supplement of L-cysteine, riboflavin, ferric citrate, and Na-glutamate. The supplement
has been reported to facilitate synthesis of proteins with iron sulfur cluster (Jaganaman et
al., 2007). According to Djurdjevic et al., the glutaconate strain was grown at 250C and
40
induced with 1mM IPTG when OD600nm reached ~0.25. After 3h of induction, 500mg/L
AKG was added as substrate. Cell growth behavior was monitored by spectrophotometer
and culture media was analyzed by HPLC and MS.
After 40 hours of cultivation, 74mg/L glutaconate was produced (Figure 18). No
glutaconate was detected in the wild type. This illustrates that GctAB and HgdCAB were
active in vivo under current fermentation conditions. Khusnutdinova et al. have illustrated
the in vivo activity of EredBC through in vivo biotransformation, where 2-hexenedioate
was converted to adipic acid (personal communication, November, 2015). Together with
the result of the in vivo biotransformation in the previous section, which shows
lys12(R143H) was also active, we were able to illustrate the in vivo activities of all
enzymes of the lower pathway (Table 5).
However, it should be noted that through the fermentation test on glutaconate
pathway, we have only been able to illustrate the in vivo activity of GctAB and HgdCAB
against C5 substrates, and we assumed that as a consequence, they are also active against
C6 substrates. According to the in vitro characterization by Partharsarathy et al., where
GctAB and HgdCAB showed in vitro activity against both C5 and C6 substrate, it is
likely that our assumption is correct. However, a fermentation experiment of the lower
pathway is needed to directly verify our assumption.
It should also be noted that no glutaric acid was detected in the cell culture. This
shows that although the enoate reductase encoded by EredBC works on C6 substrate 2-
hexenedioate, it does not work on C5 substrate glutaconate and cannot convert it to
glutaric acid. According to Khusnutdinova et al., an in vitro enzymatic assay of EredBC
against glutaconate also showed no activity (personal communication, November, 2015).
41
Figure 18. A) Growth curve and (B) glutaconate (GTC) production profile of L2_C5 strain and WT strain
in the anaerobic fermentation experiment. (C) An overview of glutaconate pathway from AKG. Error bars
were calculated from two technical replicates.
Table 5. Summary of enzyme activity in E. coli and their corresponding experiments where the activity has
been illustrated.
Growth curve
0 10 20 30 40 500.0
0.5
1.0
1.5
2.0
2.5L2_C5 strain
WT
Time(h)
OD
60
0n
mA B
C
GTC concentration in culture media
0 10 20 30 40 500
20
40
60
80L2_C5 strain
WT strain
time (h)
GT
C(m
g/L
)
42
4.2.4 Fermentation test on the lower pathway converting α-ketoadipate to adipic acid
The lower pathway strain was cultivated under the same conditions as the
glutaconate pathway strain to ensure the in vivo activity of GctAB and HgdCAB.
However, OD600nm started to drop after several hours of 1mM IPTG induction, indicating
cells dying. No intermediate product of the lower pathway could be detected.
We reasoned that the death of cells might be due to the burden of heterologous
expression of the enzymes. Thus, we have changed the fermentation conditions by using
less amount of IPTG (~0.1mM) or using a two-phase fermentation method as described
above. No dropping of cell OD600nm was observed. However, in either case, no
intermediate product of the lower pathway was detected as well.
43
5. Conclusions
In this work, we sought to illustrate the potential of converting E. coli into an
adipic acid producer through the heterologous 2-hexenedioate pathway. The pathway was
divided into upper pathway (AKG to AKA) and lower pathway (AKA to adipic acid) for
testing, which were integrated in E. coli BL21 (DE3) strain separately. Enzymes of the
AAA pathway of S. cerevisiae were heterologously expressed in E. coli for the upper
pathway, and seven genes encoding mutant of homocitrate dehydrogenase, glutaconate
CoA-transferase, 2-hydroxyglutaryl-CoA dehydratase and its activator were introduced to
E. coli for the lower pathway.
Under anaerobic conditions of the fed-batch fermentations, the upper pathway
strain was able to produce 121mg/L AKA in bioreactors and 214mg/L in shake flasks.
Under aerobic conditions, the upper pathway strain was able to produce 135mg/L AKA
in bioreactors and 254mg/L in shake flasks. By switching the fermentation conditions, we
showed that the supplement of casamino acids and anaerobicity have significant impact
on the AKA production. Further studies can target on redirecting carbon flow to AKA by
deletion of genes which involves competing pathways.
To test the lower pathway in E. coli, we conducted an in vivo biotransformation
experiment. 2-Hydroxyadipate was converted from AKA, indicating the first enzyme of
the lower pathway is active in vivo. However, no adipic acid or other intermediate were
detected. In order to verify the in vivo enzyme activity of GctAB and HgdCAB, we
constructed a glutaconate producer from a lower pathway E.coli strain. The result that
glucatonate was produced from the strain indicates that GctAB and HgdCAB were active
in vivo. Together with the research conducted by Khusnutdinova et al., which showed
that EredBC is active in E. coli, all enzymes of the lower pathway have illustrated their in
vivo activity. However, a fed-batch fermentation of the lower pathway strain showed no
conversion of AKA to adipic acid. The death of the cell after adding 1mM IPTG can be
explained by several possibilities: 1. the glycerol stock of the lower pathway strain has
deteriorated; 2. some components of the medium has deteriorated; 3. there is something
wrong with the bioreactor settings. Further studies should investigate this issue by
reconstruction of the strain or by switching culture medium. It should also be noted that
44
we have made a hypothesis that since enzymes of the lower pathway are active against
C5 substrates in vivo and are active against both C5 and C6 substrates in vitro, they
should be active against C6 substrates in vivo. We could not verify this hypothesis and
there is a possibility, although a low one, that this hypothesis is incorrect.
This work shows that we are able to convert E. coli into an AKA producer, which
is a precursor of adipic acid. It also illustrates the potential of converting AKA to adipic
acid by confirming the in vivo activity of the enzymes of lower pathway. Broadly, the
approaches highlighted in this work may be applied to strain designs for production of
target metabolites.
45
6. Recommendations
The work presented herein is an investigation of the potential of this adipic acid
biosynthetic pathway and the potential of E. coli as an adipic acid producer. While an
important step, additional research is required in order to develop strains that can produce
adipic acid through this pathway. Prospective follow-up studies are discussed in this
section. Firstly, regardless of the ability of the upper pathway strain to convert AKG into
AKA, it has been shown in the bioreactor fermentations that no significant AKA can be
produced by only feeding with glucose. Increasing AKG pool in E. coli may solve this
issue. Hyland has shown that a glucose-6-phosphate dehydrogenase (ZWF1) gene
deletion and an aldehyde dehydrogenase (ALD6) gene deletion can increase the NADPH
pool and AKG production in S. cerevisiae (Hyland, 2013). A similar strategy might also
work for E. coli. Alternatively, a modification of fermentation conditions may also help
the upper pathway strain to produce AKA from glucose. In shake flask fermentations, the
AKA yield in anaerobic conditions was more than 1mol AKA/mol AKG, which indicates
that AKA was converted from other carbon sources than the AKG substrate, such as
glucose or casamino acids. Therefore it would be interesting to conduct shake flask
fermentations without feeding AKG. Other optimization strategies for AKA production
may involve the mutation of lys20 to eliminate its susceptibility to feedback inhibition by
lysine (Feller et al., 1999), or integration of target genes into chromosomes which can
release the stress of plasmids on cell growth.
For the lower pathway, although we have shown that the relevant enzymes are
active in E. coli, the lower pathway strain was not able to survive after IPTG induction.
The reason of this is still unknown. Further investigation may involve reconstructing the
strain, switching medium components, or modifying fermentation conditions to facilitate
the growth of lower pathway strain.
46
7. References
Alini, S., Basile, F., Blasioli, S., Rinaldi, C., & Vaccari, A., (2007). Development of new catalysts for N2O-decomposition from adipic acid plant. Applied Catalysis B: Environmental, 70, 323–329. Andi, B., West, A. H., & Cook, P. F., (2005). Regulatory mechanism of histidine-tagged homocitrate synthase from Saccharomyces cerevisiae. J Biol Chem, 280, 31624-31632.
Blach, P., Bostrom, Z., Franceschi-Messant, S., Lattes, A., Perez, E., & Rico-Lattes, I., (2010). Recyclable process for sustainable adipic acid production in microemulsions. Tetrahedron, 66, 7124–7128.
Bulfer, S. L., Scott, E. M., Pillus, L. & Trievel, R. C., (2010). Structural basis for L-lysing feedback inhibition of homocitrate synthase. J Biol Chem, 285, 10446-10453.
Cao, B., Geng, A., & Loh, K.C., (2008). Induction of ortho- and meta-cleavage pathways
in Pseudomonas in biodegradation of high benzoate concentration: MS identification of
catabolic enzymes. Applied Microbiology and Biotechnology, 81, 99–107. Collier, L.S., Gaines 3rd, G.L., & Neidle, E.L., (1998). Regulation of benzoate degradation in Acinetobacter sp. strain ADP1 by BenM, a LysR-type transcriptional activator. Journal of Bacteriology, 180, 2493–2501. Curran, K., Leavitt, J., Karim, A., & Alper, H., (2013) Metabolic engineering of muconic acid production in Saccharomyces cerevisiae. Metabolic Engineering, 15, 55-66. 180, 24 Denef, V.J., Klappenbach, J.A., Patrauchan, M.A., Florizone, C., Rodrigues, J.L., Tsoi,T.V., Verstraete, W., Eltis, L.D., & Tiedje, J.M., (2006). Genetic and genomic insights into the role of benzoate-catabolic pathway redundancy in Burkholderia
xenovorans LB400. Applied and Environment Microbiology, 72, 585–595.
Deng, Y., & Mao, Y., (2015). Production of adipic acid by the native-occurring pathway in Thermobifida fusca B6. J Appl Microbiol, 119(4), 1057-1063. Diamond, G.M., Murphy, V. & Boussie, T.R., (2014). Application of high throughput experimentation to the production of commodity chemicals from renewable feedstocks. In: Modern Applications of High Throughput R&D in Heterogeneous Catalysis. Bentham Science, 288-309. Djurdjevic, I., Zelder, O. & Buckel, W., (2011). Production of glutaconic acid in a recombinant Escherichia coli strain. Appl Environ Microbiol, 77, 320-322. Fazius, F., Shelest, E., Gebhardt, P., & Brock, M., (2012). The fungal α-aminoadipate pathway for lysine biosynthesis require two enzymes of the aconitase family for the isomerization of homocitrate to homoisocitrate. Molecular Microbiology, 86, 1508-1530.
47
Feller, A., Ramos, F., Pierard, A., & Dubois, E., (1999). In Saccharomyces cerevisae,
feedback inhibition of homocitrate synthase isoenzymes by lysine modulates the
activation of LYS gene expression by Lys14p. Eur J Biochem, 261, 163-170.
Galbraith, D., Gross, S.A., & Paustenbach, D., (2010). Benzene and human health: a
historical review and appraisal of associations with various diseases. Critical Reviews in
Toxicology, 40, 1–46.
Global Industry Analysts Inc., (2012). Adipic acid: a global strategic business report.
Global Industry Analysts, Inc., (2012). Global adipic acid market to cross 6 billion
pounds. http://www.prweb.com/releases/adipic_acid_market/polyurethane_resins/prweb9
410852.htm
Grand View Research, (2014). Adipic acid market analysis by application (nylon 6,6
fiber, nylon 6,6 resin, polyurethane, adipate ester) and segment forecasts to 2020.
Grodsky, N. B., Soundar, S., & Colman, R. F., (2000). Evaluation by site-directed
mutagenesis of aspartic acid residues in the metal site of pig heart NADP- dependent
isocitrate dehydrogenase. Biochemistry, 39, 2193-2200.
Hyland, P., (2013). Development of a platform strain for production of adipic acid yields
insights into the localized redox metabolism of S. cerevisiae (MASc dissertation).
Retrieved from TSpace of University of Toronto.
IHS Inc., (2012). Process economics program 284 – bio-based adipic acid report.
Jaganaman, S., Pinto, S., Tarasev, M., & Ballou, D.P., (2007). High levels of expression
of the iron-sulfur proteins phthalate dioxygenase and phthalate dioxygenase reductase
in Escherichia coli. Protein Expr Purif, 52(2), 273-27
Jeffrey, W.H., Cuskey, S.M., Chapman, P.J., Resnick, S., & Olsen, R.H., (1992).
Characterization of Pseudomonas putida mutants unable to catabolize benzoate: cloning
and characterization of Pseudomonas genes involved in benzoate catabolism and
isolation of a chromosomal DNA fragment able to substitute for xylS in activation of the
TOL lower-pathway promoter. Journal of Bacteriology, 174, 4986–4996.
Kitagawa, W., Miyauchi, K., Masai, E., & Fukuda, M., (2001). Cloning and characteriza-
tion of benzoate catabolic genes in the gram-positive polychlorinated biphenyl degrader
Rhodococcus sp. strain RHA1. Journal of Bacteriology, 183, 6598–6606.
Lauble, H., Kennedy, M.C., Beinert, H., & Stout, C.D., (1992). Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry, 31, 2735–2748.
48
Lauble, H., & Stout, C.D., (1995). Steric and conformational features of the aconitase
mechanism. Proteins, 22, 1–11.
Lin, Y., Sun, X., Yuan, Q., & Yan, Y., (2013). Extending shikimate pathway for the
production of muconic acid and its precursor salicylic acid in Escherichia coli. Metabolic
Engineering, 23, 62-69.
Liu, Z., Wang, X., Qi, Q., & Hua, Q., (2012). Quantification and analysis of metabolic
characteristics of aerobic succinate-producing Escherichia coli under different aeration
conditions. Process Biochem, 47, 1532–1538.
Musser, M.T., (2000). Adipic acid. In: ULLMANN´S Encyclopedia of Industrial Chemistry. Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 537-548. Niu, W., Draths, K. M., & Frost, J. W., (2002). Benzene-free synthesis of adipic acid. Biotechnol Prog, 18, 201-211. Orth, J.D., & Palsson, B.O., (2010). Systematizing the generation of missing metabolic knowledge. Biotechnology and Bioengineering, 107, 403–412. Orth, J.D., Thiele, I., & Palsson B.O., (2010). What is flux balance analysis? Nature Biotechnology, 28, 245-248. Parthasarathy, A., Pierik, A. J., Kahnt, J., Zelder, O. & Buckel, W., (2011). Substrate specificity of 2-hydroxyglutaryl-CoA dehydratase from Clostridium symbiosum: toward a bio-based production of adipic acid. Biochemistry, 50, 3540-3550. Reitman, Z. J., Choi, B. D., Spasojevic, I., Bigner, D. D., Sampson, J. H., & Yan, H., (2012). Enzyme redesign guided by cancer-derived IDH1 mutations. Nat Chem Biol, 8, 887- 889. Polen, W., Spelberg, M., & Bott, M., (2012). Toward biotechnological production of adipic acid and precursors from biorenewables. J. Biotechnology, 167, 75-84 Quezada, H., Marín-Hernández, A., Aguilar, D., López, G., Gallardo-Pérez, J. C., & Jasso Chávez, R., (2011). The Lys20 homocitrate synthase isoform exerts most of the flux control over the lysine synthesis pathway in Saccharomyces cerevisiae. Molecular Microbiology, 82, 578-590.
Reed Business Information Limited, (2014). ICIS pricing: adipic acid.
http://www.icis.com/globalassets/global/icis/pdfs/sample-reports/chemicals-adipic-
acid.pdf
Reed, J.L., Vo, T.D., Schilling, C.H, & Palsson, B.O., (2003). An expanded genome-
scale model of Escherichia coli K-12 (iJR904 GSM/GPR). Genome Biol., 4(9), R54.
49
Sato, K., Aoki, M., & Noyori, R., (1998). A “green” route to adipic acid: direct oxidation
of cyclohexenes with 30 percent hydrogen peroxide. Science, 281, 1646–1647.
Takenaka, S., Setyorini, E., Kim, Y.J., Murakami, S., & Aoki, K., (2005). Constitutive
synthesis of enzymes involved in 2-aminophenol metabolism and inducible synthesis of
enzymes involved in benzoate, p-hydroxybenzoate, and protocatechuate metabolism in
Pseudomonas sp. strain AP-3. Bioscience, Biotechnology, and Biochemistry, 69, 1033–
1035.
Thykaer, J., Christensen, B., & Nielsen, J., (2002). Metabolic network analysis of an
adipoyl-7-ADCA-producing strain of Penicillium chrysogenum: elucidation of adipate
degradation. Metab Eng, 4, 151–158.
van de Vyver, S., & Roman-Leshkov, Y., (2013). Emerging catalytic processes for the
production of adipic acid. Catal Sci Technol, 3, 1465-1479
van Duuren, J. B., Brehmer, B., Mars, A. E., Eggink, G., Dos Santos, V. A., &
Sanders, J. P., (2011). A limited LCA of bio-adipic acid: manufacturing the nylon-6,6
precursor adipic acid using the benzoic acid degradation pathway from different
feedstocks. Biotechnol Bioeng, 108, 1298-1306.
van Duuren, J. B., Wijte, D., Karge, B., dos Santos, V. A., Yang, Y., & Mars, A.
E., (2012). pH-stat fed-batch process to enhance the production of cis, cis-muconate
from benzoate by Pseudomonas putida KT2440-JD1. Biotechnol Prog, 28, 85-92.
van Duuren, J. B., Wijte, D., Leprince, A., Karge, B., Puchalka, J., & Wery, J. (2011)
Generation of a catR deficient mutant of P. putida KT2440 that produces cis, cis
muconate from benzoate at high rate and yield. J Biotechnol, 156, 163-172.
Vogel, H. J., (1964). Distribution of lysine pathways among fungi: evolutionary implications. The American Naturalist, 98, 435-446. Xu, H., Andi, B., Qian, J., West, A.H., & Cook, P.F., (2006). The alpha-aminoadipate pathway for lysine biosynthesis in fungi. Cell Biochem Biophys, 46, 43–64. Yu, J., Xia, X., Zhong, J., & Qian, Z., (2014). Direct Biosynthesis of adipic acid from a synthetic pathway in recombinant Escherichia coli. Biotechnology and Bioengineering, 111, 2580-2586 Zabriskie, T. M., & Jackson, M. D., (2000). Lysine biosynthesis and metabolism in fungi. Nat Prod Rep, 17, 85-97.
50
Zhan, Y., Yu, H., Yan, Y., Chen, M., Lu, W., Li, S., Peng, Z., Zhang, W., Ping, S., Wang,
J., & Lin, M., (2008). Genes involved in the benzoate catabolic pathway in Acinetobacter
calcoaceticus PHEA-2. Current Microbiology, 57, 609–614.
Zhang, H., Pereira, B., Li, Z., & Stephanopoulos, G., (2015). Engineering Escherichia
coli coculture systems for the production of biochemical products. Proc Natl Acad
Sci., 112(27), 8266-71.
51
8. Appendix
8.1 Sequences of relevant enzymes
Aconitase - Aco2 of S.cerevisiae:
ATGCTATCTTCAGCTAATAGGTTTTATATAAAGAGGCATTTGGCAACACATGCCAATATGTTCCCCTCTGT
ATCTAAAAATTTTCAAACAAAAGTGCCACCTTATGCAAAACTTTTGACCAACCTAGACAAGATTAAACAA
ATAACAAACAATGCTCCATTGACACTAGCAGAAAAAATTTTATACTCGCATCTTTGCGATCCTGAAGAAT
CGATTACTTCTTCTGATCTGTCCACCATCCGTGGTAATAAATACTTGAAGCTAAACCCAGACCGTGTAGC
TATGCAGGACGCTTCTGCCCAAATGGCGCTTCTACAATTCATGACCACCGGTCTAAATCAAACATCTGTC
CCAGCATCCATACATTGTGATCATTTAATTGTAGGTAAGGACGGTGAAACTAAAGATTTACCCTCTTCCA
TAGCTACCAACCAAGAAGTTTTCGATTTCTTGGAGAGTTGCGCAAAGAGATATGGAATTCAATTCTGGGG
CCCAGGTTCTGGTATCATTCACCAGATTGTTTTGGAAAATTTCTCAGCTCCAGGTCTAATGATGCTAGGTA
CTGATTCCCATACACCAAATGCAGGCGGTCTGGGAGCTATTGCCATCGGGGTTGGTGGTGCGGATGCAG
TTGATGCCCTCACAGGCACTCCATGGGAATTAAAAGCACCAAAAATTTTAGGTGTTAAATTGACCGGAA
AGTTAAACGGATGGTCCACTCCTAAAGATGTAATCACAAAGCTCGCTGGTTTACTAACTGTCAGAGGTG
GTACTGGTTATATCGTCGAGTACTTCGGCGAAGGTGTATCCACTCTATCTTGCACAGGTATGGCAACCAT
CTGTAATATGGGAGCTGAAATCGGTGCTACAACGTCAACTTTCCCTTACCAAGAAGCTCACAAGCGTTAT
TTGCAAGCAACTAATAGAGCAGAGGTCGCTGAAGCAGCTGATGTTGCTTTAAACAAGTTTAACTTCTTAA
GAGCCGACAAAGATGCTCAATACGATAAAGTTATTGAAATTGACTTATCCGCAATTGAACCTCACGTTAA
TGGTCCATTTACACCAGACCTTTCAACCCCAATATCTCAATATGCCGAAAAAAGTTTGAAGGAAAACTGG
CCCCAAAAAGTTAGCGCTGGTTTGATTGGATCATGTACCAATTCATCTTATCAAGACATGAGTCGTGTTG
TCGACTTGGTCAAGCAAGCTTCCAAAGCCGGCTTGAAACCACGTATCCCCTTCTTTGTCACCCCTGGTTC
AGAACAAATTAGAGCTACCTTGGAAAGAGATGGAATCATCGATATTTTCCAAGAAAATGGTGCCAAAGT
TTTAGCAAATGCATGCGGCCCTTGTATCGGACAATGGAATAGGGAAGATGTCTCGAAAACATCAAAAGA
AACGAACACTATTTTTACATCATTCAATAGAAATTTCAGAGCTAGAAACGATGGTAATAGGAATACAATG
AATTTCTTAACATCCCCAGAAATAGTAACAGCGATGAGTTATTCTGGAGATGCTCAGTTCAATCCGCTAA
CTGACTCAATTAAATTGCCAAATGGGAAGGATTTCAAATTCCAACCACCAAAGGGTGATGAGTTACCAA
AAAGAGGATTTGAACACGGTAGAGACAAATTTTATCCTGAAATGGATCCAAAGCCAGATAGCAATGTAG
AGATTAAGGTAGACCCTAATTCTGATCGTTTGCAATTATTAGAGCCATTCAAACCTTGGAACGGGAAGGA
ATTGAAGACAAACGTGCTTTTGAAAGTTGAAGGTAAATGTACAACAGATCATATTTCCGCTGCGGGCGT
CTGGTTGAAATATAAAGGCCATCTAGAAAACATTTCTTACAATACATTGATTGGTGCACAAAACAAAGAA
ACCGGTGAAGTCAACAAGGCTTATGACCTTGACGGAACTGAATATGATATTCCTGGTTTGATGATGAAAT
GGAAATCAGACGGTAGACCATGGACCGTGATAGCGGAACATAACTATGGTGAAGGTTCCGCAAGAGAG
CATGCTGCTTTGTCACCAAGATTTTTAGGCGGAGAGATTCTTTTAGTTAAGTCTTTTGCAAGAATTCATGA
GACAAACTTGAAGAAACAAGGTGTGTTGCCATTGACTTTTGCCAACGAATCTGACTATGATAAAATATCA
AGCGGAGATGTTTTAGAAACGTTGAACCTAGTTGACATGATTGCTAAGGATGGTAATAACGGTGGTGAA
ATTGATGTTAAAATTACTAAACCAAACGGTGAATCGTTCACCATCAAGGCAAAACATACTATGTCTAAAG
ATCAAATCGATTTTTTCAAAGCTGGTTCAGCAATCAATTATATTGGTAATATACGAAGAAACGAATAA
Homocitrate synthase - Lys20 of S.cerevisiae:
ATGACTGCTGCTAAACCAAATCCATATGCTGCCAAACCGGGCGACTATCTTTCTAATGTAAATAATTTCC
52
AGTTAATCGATTCGACGCTGAGAGAAGGTGAACAATTTGCCAACGCATTCTTCGATACTGAAAAAAAGA
TCGAAATTGCTAGAGCCTTGGACGATTTCGGTGTGGACTACATCGAGTTAACCTCACCAGTAGCATCTGA
ACAATCAAGAAAGGACTGTGAAGCTATATGTAAACTAGGTTTAAAGGCCAAGATCCTTACACACATTCG
TTGTCATATGGATGACGCCAAAGTCGCCGTAGAGACTGGTGTCGACGGTGTCGATGTCGTTATCGGCAC
CTCCAAATTTTTAAGACAATATTCCCACGGTAAGGATATGAACTACATCGCCAAGAGTGCTGTTGAAGTC
ATTGAATTTGTCAAATCCAAAGGTATTGAAATCAGATTTTCCTCTGAAGATTCCTTCAGAAGTGATCTCGT
TGATCTTTTGAACATTTATAAAACCGTTGACAAGATCGGTGTAAATAGAGTCGGTATTGCCGACACAGTT
GGATGTGCCAACCCAAGACAAGTATATGAACTGATCAGAACTTTGAAGAGTGTTGTTTCATGTGACATC
GAATGCCATTTCCACAACGATACTGGTTGTGCCATTGCAAACGCCTACACTGCTTTGGAAGGTGGTGCC
AGATTGATTGACGTCAGTGTACTGGGTATTGGTGAAAGAAACGGTATCACTCCTCTAGGTGGGCTCATG
GCAAGAATGATTGTTGCCGCACCAGACTATGTCAAGTCCAAATACAAGTTGCACAAGATCAGAGACATT
GAAAACCTGGTCGCTGATGCTGTGGAAGTTAACATTCCATTCAACAACCCTATCACCGGGTTCTGTGCAT
TCACACATAAAGCAGGTATCCATGCCAAGGCCATTTTGGCTAACCCATCTACCTACGAAATCTTGGACCC
TCACGATTTCGGTATGAAGAGGTATATCCACTTCGCCAACAGACTAACTGGCTGGAACGCCATCAAAGC
CAGAGTCGACCAGTTGAACTTGAACTTGACGGATGACCAAATCAAGGAAGTTACTGCTAAGATTAAGAA
GCTGGGTGATGTCAGATCGCTGAATATCGATGATGTTGACTCTATCATCAAGAACTTCCACGCAGAGGT
CAGCACTCCTCAAGTACTATCTGCAAAAAAGAACAAGAAGAATGACAGCGATGTACCGGAACTGGCCA
CCATCCCCGCCGCCAAGCGGACTAAGCCATCCGCCTAA
Homocitrate synthase - Lys21 of S.cerevisiae:
ATGTCTGAAAATAACGAATTCCAGAGTGTCACCGAATCGACGACTGCTCCAACCACTAGTAACCCATAT
GGCCCAAATCCTGCGGATTATCTATCCAATGTTAAGAATTTCCAGTTGATTGATTCAACACTAAGAGAGG
GTGAACAATTTGCCAACGCATTCTTCGATACTGAAAAAAAGATTGAAATTGCTAGAGCCTTGGATGATTT
CGGTGTGGACTACATCGAGTTAACCTCTCCCGTAGCATCCGAACAATCAAGAAAGGACTGTGAAGCTAT
ATGTAAACTAGGTTTAAAGGCCAAGATCCTTACACACATTCGTTGTCACATGGACGATGCCAGAGTCGC
CGTAGAGACTGGTGTCGACGGTGTCGATGTTGTTATCGGCACCTCCAAATTTTTAAGACAATATTCCCAC
GGTAAGGATATGAACTACATCGCCAAGAGTGCTGTTGAAGTCATTGAATTTGTCAAATCCAAAGGTATTG
AAATCAGATTTTCCTCTGAAGATTCCTTCAGAAGTGATCTCGTTGATCTTTTGAACATTTATAAAACCGTT
GACAAGATCGGTGTAAATAGAGTCGGTATTGCCGACACAGTTGGATGTGCCAACCCAAGACAAGTATAT
GAACTGATCAGAACTTTGAAGAGTGTTGTCTCATGTGACATCGAATGCCATTTCCACAATGATACCGGTT
GTGCCATTGCAAACGCCTACACTGCTTTGGAAGGTGGTGCCAGATTGATTGACGTCAGTGTACTGGGTA
TTGGTGAAAGAAACGGTATCACTCCTCTAGGTGGGCTCATGGCAAGAATGATTGTTGCCGCACCAGACT
ATGTCAGATCTAAATACAAGCTGCACAAGATCAGAGACATCGAAAACCTGGTCGCTGATGCTGTGGAAG
TTAACATTCCATTCAACAACCCTATCACCGGGTTCTGTGCATTCACACATAAAGCAGGTATCCATGCCAA
GGCCATTTTGGCTAACCCATCTACCTACGAAATCTTGGACCCTCACGATTTCGGTATGAAGAGATATATC
CACTTCGCCAACAGACTAACTGGTTGGAATGCAATCAAATCAAGAGTCGACCAATTGAACTTGAATTTG
ACGGATGATCAAATCAAGGAAGTTACTGCTAAGATTAAGAAGCTGGGTGATGTCAGACCGCTAAATATT
GATGATGTAGACTCCATTATCAAGGACTTCCATGCAGAATTGAGCACCCCACTTTTAAAACCAGTAAATA
AGGGTACAGATGACGACAATATCGATATTTCCAATGGGCATGTTTCTAAAAAGGCAAAGGTCACCAAAT
AG
53
Homoaconitase - Lys4 of S.cerevisiae:
ATGCTACGATCAACCACATTTACTCGTTCGTTCCACAGTTCTAGGGCCTGGTTGAAAGGTCAGAACCTAA
CTGAAAAAATTGTTCAGTCGTATGCGGTCAACCTTCCCGAGGGTAAAGTTGTGCATTCTGGTGACTATGT
ATCGATCAAGCCGGCACACTGTATGTCCCACGATAATTCGTGGCCTGTAGCTTTGAAATTCATGGGGCTT
GGCGCTACCAAGATCAAGAATCCTTCACAGATTGTGACCACTCTGGACCACGATATTCAGAACAAATCA
GAGAAAAATTTGACCAAGTACAAGAACATCGAAAATTTTGCTAAGAAACACCATATAGACCACTACCCT
GCCGGTAGAGGTATTGGTCATCAAATTATGATTGAGGAGGGCTATGCTTTCCCCTTGAACATGACTGTCG
CATCTGACTCGCATTCAAACACCTACGGTGGTCTGGGGTCGCTGGGCACTCCAATAGTGAGAACAGACG
CTGCAGCCATATGGGCCACGGGACAGACGTGGTGGCAGATCCCACCAGTGGCTCAGGTTGAGTTGAAA
GGTCAATTGCCTCAGGGTGTTTCCGGAAAAGATATCATTGTCGCATTATGTGGGCTTTTCAACAATGATC
AAGTTCTAAATCACGCCATTGAATTCACGGGTGACTCTTTGAATGCATTGCCTATCGATCACAGACTCAC
TATTGCTAACATGACCACCGAGTGGGGGGCTCTTTCTGGTTTGTTCCCCGTGGACAAAACTTTGATCGAC
TGGTATAAAAACCGTTTGCAAAAGCTGGGCACCAATAATCATCCAAGGATTAATCCAAAGACTATCCGC
GCACTAGAAGAAAAGGCGAAGATTCCGAAAGCAGACAAGGATGCACATTATGCCAAGAAACTGATCAT
CGATCTAGCCACGCTAACTCACTACGTCTCAGGTCCAAATAGTGTTAAGGTCTCCAACACCGTGCAAGA
TCTATCTCAACAAGACATCAAGATAAATAAAGCTTATCTAGTGTCATGTACAAACTCCCGTCTATCTGATT
TGCAATCTGCAGCGGATGTGGTTTGTCCTACTGGAGACTTAAACAAAGTCAACAAGGTGGCTCCAGGTG
TGGAGTTCTATGTCGCTGCTGCCTCTTCAGAAATTGAGGCTGATGCCCGTAAATCAGGCGCTTGGGAAA
AGCTGCTAAAGGCTGGCTGTATCCCACTGCCTTCTGGTTGTGGTCCATGCATCGGTCTAGGTGCGGGATT
ACTGGAACCAGGTGAAGTTGGTATCAGTGCCACAAACAGAAACTTCAAAGGTAGAATGGGTTCCAAGG
ATGCATTGGCTTACTTAGCTTCCCCTGCTGTAGTCGCCGCTTCTGCCGTGCTGGGTAAGATTAGTTCTCCT
GCTGAGGTATTGTCCACAAGCGAAATTCCATTCAGCGGCGTTAAGACTGAGATAATTGAGAATCCCGTG
GTTGAAGAGGAAGTTAACGCTCAAACAGAGGCTCCAAAACAATCCGTTGAGATATTAGAAGGTTTCCCA
AGAGAGTTTTCTGGTGAATTAGTTTTATGTGATGCCGATAACATCAATACCGATGGTATATATCCTGGTAA
GTACACTTATCAGGATGATGTGCCTAAAGAAAAGATGGCGCAAGTTTGTATGGAAAATTATGATGCCGA
GTTCAGAACCAAGGTTCATCCAGGTGATATAGTGGTCAGTGGGTTCAATTTCGGTACCGGTTCCTCCAGG
GAACAAGCGGCCACCGCCTTATTGGCTAAAGGTATCAACTTAGTTGTTTCAGGATCTTTTGGTAATATTTT
TTCAAGAAACTCCATTAACAATGCTCTTCTGACCTTGGAAATCCCAGCATTAATCAAAAAATTACGTGAG
AAATATCAAGGTGCTCCAAAAGAACTTACAAGAAGAACTGGTTGGTTTTTGAAATGGGATGTAGCTGAT
GCTAAAGTGGTCGTTACCGAAGGTTCTTTGGACGGCCCTGTGATCTTGGAGCAAAAAGTGGGTGAGCTA
GGTAAGAACCTACAAGAAATTATTGTAAAAGGAGGCTTGGAAGGTTGGGTCAAATCCCAACTATAA
Homoisocitrate dehydrogenase - Lys12 of S.cerevisiae:
ATGTTTAGATCTGTTGCTACTAGATTATCTGCCTGCCGTGGGTTAGCATCTAACGCTGCTCGCAAATCACT
CACTATTGGTCTTATCCCCGGTGACGGTATCGGTAAGGAAGTCATTCCTGCTGGTAAGCAAGTTTTGGAA
AACCTTAACTCCAAGCACGGCCTAAGCTTCAACTTTATTGATCTCTACGCCGGTTTCCAAACATTCCAAG
AAACAGGAAAGGCGTTGCCTGATGAGACTGTTAAAGTGTTGAAGGAACAATGTCAAGGTGCTCTTTTCG
GTGCAGTTCAGTCTCCAACTACTAAGGTGGAAGGTTACTCCTCACCAATTGTTGCTCTAAGGAGGGAAAT
GGGCCTTTTCGCTAATGTTCGTCCTGTTAAGTCTGTAGAGGGAGAAAAGGGTAAACCAATTGACATGGTT
ATCGTCAGAGAAAATACTGAGGACCTGTACATTAAAATTGAAAAAACATACATTGACAAGGCCACAGGT
ACAAGAGTTGCTGATGCCACAAAGAGAATATCCGAAATTGCAACAAGAAGAATTGCAACCATTGCATTA
GATATTGCCTTGAAAAGATTACAAACAAGAGGCCAAGCCACTTTGACAGTGACTCATAAATCAAATGTT
CTATCTCAAAGTGATGGTCTATTCAGAGAAATCTGTAAGGAAGTCTACGAATCTAACAAGGACAAGTAC
GGTCAAATCAAATATAACGAACAAATTGTGGATTCCATGGTTTATAGGCTGTTCAGAGAACCACAATGTT
TTGATGTGATAGTGGCACCAAACCTATACGGGGATATATTATCTGACGGTGCTGCTGCTTTAGTCGGTTC
54
ATTAGGTGTTGTTCCAAGCGCCAACGTAGGTCCAGAAATTGTCATTGGTGAACCATGCCATGGTTCTGCA
CCAGATATTGCTGGTAAAGGTATTGCTAACCCAATCGCCACTATAAGATCTACTGCTTTGATGTTGGAAT
TCTTGGGCCACAACGAAGCTGCCCAAGATATCTACAAGGCTGTTGATGCTAACTTAAGAGAGGGTTCTA
TCAAGACACCAGATTTAGGTGGTAAGGCTTCTACTCAACAAGTCGTTGACGACGTTTTGTCGAGATTATA
G
R-2-hydroxyglutarate dehydrogenase - HgdH of Acidaminococcus fermentans :
ATGAAGGTTTTATGTTATGGTGTAAGAGATGTAGAACTGCCGATTTTTGAAGCCTGCAACAAAGAATTTG
GTTACGACATCAAATGTGTCCCTGATTATCTGAACACGAAAGAAACCGCCGAAATGGCTGCTGGCTTTG
ATGCGGTTATCCTGCGCGGCAACTGCTTCGCCAATAAACAGAACCTGGACATTTACAAAAAACTGGGCG
TAAAATACATCCTGACCCGTACCGCCGGCACGGATCATATCGATAAGGAATATGCCAAGGAACTGGGCT
TCCCCATGGCTTTCGTTCCCCGTTATTCCCCCAACGCCATTGCTGAACTGGCTGTAACCCAGGCCATGAT
GCTGCTGCGTCATACCGCTTACACCACTTCCCGCACTGCCAAGAAGAACTTCAAGGTTGATGCCTTCATG
TTCTCCAAAGAAGTCCGCAACTGCACCGTGGGTGTTGTTGGTCTGGGCCGGATCGGCCGTGTGGCTGCC
CAGATCTTCCATGGCATGGGCGCTACCGTTATCGGGGAAGACGTTTTCGAAATCAAAGGGATCGAAGAT
TACTGCACCCAGGTTTCCCTGGATGAAGTCCTGGAAAAATCCGACATCATCACCATCCATGCTCCGTACA
TCAAAGAAAACGGCGCTGTGGTTACCCGCGATTTCTTGAAGAAGATGAAAGACGGCGCCATCCTGGTG
AACTGCGCTCGCGGCCAGCTGGTTGACACCGAAGCTGTCATCGAAGCTGTGGAAAGCGGTAAACTGGG
CGGCTACGGCTGCGACGTTCTGGATGGGGAAGCCAGCGTATTCGGCAAGGATCTGGAAGGCCAGAAAC
TGGAAAATCCGCTGTTCGAAAAACTGGTTGACCTGTATCCCAGAGTCCTGATCACCCCGCATCTGGGCT
CCTACACCGACGAAGCCGTAAAGAACATGGTGGAAGTTTCCTACCAGAACCTGAAAGATCTGGCTGAA
ACCGGCGACTGCCCCAACAAGATCAAA (TAG)
2-hydroxyglutaryl-CoA dehydratase and its activator - HgdCAB of Acidaminococcus
fermentans:
ATGAGTATCTATACCTTGGGAATCGATGTTGGATCTACTGCATCCAAGTGCATTATCCTGAAAGATGGAA
AAGAAATCGTGGCGAAATCCCTGGTAGCCGTGGGGACCGGAACTTCCGGTCCCGCACGGTCTATTTCG
GAAGTCCTGGAAAATGCCCACATGAAAAAAGAAGACATGGCCTTTACCCTGGCTACCGGCTACGGACG
CAATTCGCTGGAAGGCATTGCCGACAAGCAGATGAGCGAACTGAGCTGCCATGCCATGGGCGCCAGCT
TTATCTGGCCCAACGTCCATACCGTCATCGATATCGGCGGGCAGGATGTGAAGGTCATCCATGTGGAAA
ACGGGACCATGACCAATTTCCAGATGAATGATAAATGCGCTGCCGGGACTGGCCGTTTCCTGGATGTTA
TGGCCAATATCCTGGAAGTGAAGGTTTCCGACCTGGCTGAGCTGGGAGCCAAATCCACCAAACGGGTG
GCTATCAGCTCCACCTGTACTGTGTTTGCAGAAAGTGAAGTCATCAGCCAGCTGTCCAAAGGAACCGAC
AAGATCGACATCATTGCCGGGATCCATCGTTCTGTAGCCAGCCGGGTCATTGGTCTTGCCAATCGGGTG
GGGATTGTGAAAGACGTGGTCATGACCGGCGGTGTAGCCCAGAACTATGGCGTGAGAGGAGCCCTGGA
AGAAGGCCTTGGCGTGGAAATCAAGACGTCTCCCCTGGCTCAGTACAACGGTGCCCTGGGTGCCGCTCT
GTATGCGTATAAAAAAGCAGCCAAATAAGCTGTATATCATGTAAAGAAGGAAGGATCATTATGCCAAAG
ACAGTAAGCCCTGGCGTTCAGGCATTGAGAGATGTAGTTGAAAAGGTTTACAGAGAACTGCGGGAAGC
CAAAGAAAGAGGAGAAAAAGTAGGCTGGTCCTCTTCCAAGTTCCCCTGCGAACTGGCTGAATCTTTCGG
TCTGCATGTTGGGTATCCGGAAAACCAGGCTGCTGGTATCGCTGCCAACCGTGACGGCGAAGTGATGTG
CCAGGCTGCAGAAGATATCGGTTATGACAACGATATCTGCGGCTATGCCCGTATTTCCCTGGCTTATGCT
GCCGGGTTCCGGGGTGCCAACAAAATGGACAAAGATGGCAACTATGTCATCAACCCCCACAGCGGCAA
ACAGATGAAAGATGCCAATGGCAAAAAGGTATTCGACGCAGATGGCAAACCCGTAATCGATCCCAAGA
CCCTGAAACCCTTTGCCACCACCGACAACATCTATGAAATCGCTGCTCTGCCGGAAGGGGAAGAAAAG
ACCCGCCGCCAGAATGCCCTGCACAAATATCGTCAGATGACCATGCCCATGCCGGACTTCGTGCTGTGC
55
TGCAACAACATCTGCAACTGCATGACCAAATGGTATGAAGACATTGCCCGTCGGCACAACATTCCTTTG
ATCATGATCGACGTTCCTTACAACGAATTCGACCATGTCAACGAAGCCAACGTGAAATACATCCGGTCC
CAGCTGGATACGGCCATCCGTCAAATGGAAGAAATCACCGGCAAGAAGTTCGATGAAGACAAATTCGA
ACAGTGCTGCCAGAACGCCAACCGTACTGCCAAAGCATGGCTGAAGGTTTGCGACTACCTGCAGTACA
AACCGGCTCCGTTCAACGGGTTCGACCTGTTCAACCATATGGCTGACGTGGTTACCGCCCGTGGCCGTG
TGGAAGCTGCTGAAGCTTTCGAACTGCTGGCCAAGGAACTGGAACAGCATGTGAAGGAAGGCACCACC
ACCGCTCCCTTCAAAGAACAGCATCGTATCATGTTCGAAGGGATCCCCTGCTGGCCGAAACTGCCGAAC
CTGTTCAAACCGCTGAAAGCCAACGGCCTGAACATCACCGGCGTTGTATATGCTCCTGCTTTCGGGTTCG
TGTACAACAACCTGGACGAATTGGTCAAAGCCTACTGCAAAGCCCCGAACTCCGTCAGCATCGAACAG
GGTGTTGCCTGGCGTGAAGGCCTGATCCGCGACAACAAGGTTGACGGCGTACTGGTTCACTACAACCG
GTCCTGCAAACCCTGGAGCGGCTACATGCCTGAAATGCAGCGTCGTTTCACCAAAGACATGGGTATCCC
CACTGCTGGATTCGACGGTGACCAGGCTGACCCGAGAAACTTCAACGCGGCTCAGTATGAGACCCGTG
TTCAGGGCTTGGTCGAAGCCATGGAAGCAAATGATGAAAAGAAGGGGAAATAACAATGGCTATCAGTG
CACTTATTGAAGAGTTCCAAAAAGTATCTGCCAGCCCGAAGACCATGCTGGCCAAATATAAAGCCCAGG
GCAAAAAAGCCATCGGCTGCCTGCCGTACTATGTTCCGGAAGAACTGGTCTATGCTGCAGGCATGGTTC
CCATGGGTGTATGGGGCTGCAATGGCAAACAGGAAGTCCGTTCCAAGGAATACTGTGCTTCCTTCTACT
GCACCATTGCCCAGCAGTCTCTGGAAATGCTGCTGGACGGGACCCTGGATGGGTTGGACGGGATCATC
ACTCCGGTACTGTGTGATACCCTGCGTCCCATGAGCCAGAACTTCAAAGTGGCCATGAAAGACAAGATG
CCGGTTATTTTCCTGGCTCATCCCCAGGTCCGTCAGAATGCCGCCGGCAAGCAGTTCACCTATGATGCCT
ACAGCGAAGTGAAAGGCCATCTGGAAGAAATCTGCGGCCATGAAATCACCAATGATGCCATCCTGGAT
GCCATCAAAGTGTACAACAAGAGCCGTGCTGCCCGCCGCGAATTCTGCAAACTGGCCAACGAACATCCT
GATCTGATCCCGGCTTCCGTACGGGCCACCGTACTGCGTGCCGCTTACTTCATGCTGAAGGATGAATAC
ACCGAAAAGCTGGAAGAACTGAACAAGGAACTGGCAGCTGCTCCTGCCGGCAAGTTCGACGGCCACAA
AGTGGTTGTTTCCGGCATCATCTACAACATGCCCGGCATCCTGAAAGCCATGGATGACAACAAACTGGC
CATTGCTGCTGATGACTGCGCTTATGAAAGCCGCAGCTTTGCCGTGGATGCTCCGGAAGATCTGGACAA
CGGCCTGCAGGCTCTGGCTGTACAGTTCTCCAAACAGAAGAACGATGTTCTGCTGTACGATCCTGAATTT
GCCAAGAATACCCGTTCTGAACACGTTTGCAATCTGGTAAAAGAAAGCGGCGCAGAAGGACTGATCGT
GTTCATGATGCAGTTCTGCGATCCGGAAGAAATGGAATATCCTGATCTGAAGAAGGCTCTGGATGCCCA
CCACATTCCTCATGTGAAGATTGGTGTGGACCAGATGACCCGGGACTTTGGTCAGGCCCAGACCGCTCT
GGAAGCTTTCGCAGAAAGCCTG (TAA)
2-hydroxyglutaryl-CoA dehydratase and its activator - HgdCAB of Clostridium symbiosum:
ATGAGCGGAATTTATACTTTAGGTATCGACGTSGGTTCCACAGCCTCCAAGTGCATCGTTTTAAAAGATG
GCAAAGAGATTGTGGCCAAATCACTGATAGATGTAGGCGCAGGTACCAGTGGACCGCAGCGCGCGATT
GAAGCCGTGCTCAACGAGGCAGGCATGAAGAAGGAAGACATGGCATATACGCTGGCAACAGGCTACG
GCCGTACCTCTTTGATGGATGGCATTGCCGATAAACAGATGAGCGAGCTTTCCTGCCATGCCAAGGGTG
CAACTTTTCTGTTTCCAAATGTCCACACTGTCATTGATATTGGTGGACAGGACGTAAAAGTTCTGCATATA
GATAATGGTGCAATGACCAATTTCCAGATGAATGACAAGTGTGCGGCAGGAACGGGACGGTTCCTGGA
TGTTATGGCGCGTGTTCTGGAAGTAAAGGTTGAAGATCTGGGAAGACTCGGCGCCATGTCCCGGAAGA
AAGTGGGAATCAGTTCCACTTGTACCGTTTTCGCCGAGAGTGAGGTTATAAGCCAGCTGGCAATGGGAA
CCGATAAATGTGATATTATCGACGGAATCCATCGCTCGGTGGCTCATCGTGTCACAGGGCTTGCCCACC
GTATCGGTGTGGTACCGGATGTCGTTATGACCGGCGGAGTGGCTCAGAATGAAGGCGTTGTAAAGGCG
CTTCAGGATGAGCTGGGATGTCCGATCAACACTTCCCCGCTGACACAGTATAATGGCGCGCTTGGCGCC
GCCCTGCTTGCATGGCAGGCGGCCAGCCGCCGTCAAAGCAATTCATAGAAAGAATGGAGGATAATTATT
ATGGCAAAACAAGTTAGTCCTGGCGTTCTCGCACTTCGCAAGGTCGTTGATGACGTACACAAAGAGGCG
CGCGAGGCCAAAGCAAGAGGCGAGTTAGTCGGCTGGTCCTCATCCAAGTTCCCTTGTGAGCTTGCAGCA
56
GCTTTTGATCTGAATGTTATGTATCCGGAGAACCAGGCTGCCGGCATCGCTGCAAACCGTTACGGTGAG
ATGATGTGCCAGGCCGCTGAGGATCTTGGCTATGACAACGATATCTGCGGATATGCCCGTATCAGTCTG
GCTTATGCAGCCGGTGTGCGTGTATCACGCAAATATGATGCTGAAACCGGTGAATACATCATCGATCCT
GCTACAGGCAAACCGTTAAAAGACGCAGAAGGCAATGTGGTAATCGACGAAGCAACCGGTAAACCAA
AGAAAGATCCAAAGACACAGACTCCTTATCTTGTACTGGACAATCTGCTTGAGATTGAAGCTCTTCCGGA
CGGCCCGGAGAAAGAAAGACGTCTGGAGGCAATCTCTCCAATCCGTCAGATGCGTATTCCGCAGCCGG
ACTTCGTTCTCTGCTGTAACAATATCTGCAACTGTATGACCAAATGGTATGAGAATATTGCCCGTATGTGC
AACGTACCGCTGATCATGATTGATATTCCGTATAACAATACAGTAGAGGTTCATGACGATAATGTAAAAT
ATGTACGCGCTCAGTTCGATAAGGCAATTAAGCAGTTAGAAGAACTCACAGGCAAGAAATTTGACGAGA
AGAAGTTTGAAAAAGCCTGTTCCAATGCTAACCGTACCGCACAGGCATGGTTAAAGGTTTGCGATTATCT
TCAGTATAAACCGGCTCCATACAGCGGTTTCGACCTGTTCAACCATATGGCTGACGTCGTAACTGCACGT
GCCAGAGTGGAAGCCGCTGAGGCATTTGAGCTTCTGGCAGACGATCTGGAAGAGACAGTTAAGAAGGG
TGAGACGACAACTCCGTTCCCGGAGAAATACCGTGTTATGTTCGAGGGTATTCCTTGCTGGCCGAAGCT
GCCTAACCTGTTCAAACCTCTGAAAGAGCATGGCGTCAACGTTACTGCCGTTGTTTATGCACCAGCTTTC
GGTTTTGTTTATAACAACATCGATGAGATGGCCCGCGCTTACTACAAAGCTCCGAACTCCGTCTGCATCG
AACAGGGTGTTGACTGGCGTGAAGGTATCTGCCGCGACAATAAGGTAGATGGCGTTCTTGTTCATTATA
ACAGAAGCTGTAAACCGTGGAGCGGTTATATGGCTGAGATGCAGCGGCGTTTCACTGAAGATCTGGGC
GTTCCATGCGCAGGTTTCGACGGTGACCAGGCTGACCCGCGTAACTTCAATGCCGCTCAGTATGAGACC
CGAGTACAGGGCCTTGTGGAGGCAATGGAAGCAAATAAGCAGGCAAAGGAGGCAAAGTAAGGATGAG
TATCAACGCATTATTGGATGAATTTAAAGTAAAGGCTGCCACTCCAAAACAGCAGCTTGCTGAATATAAA
GCTCAGGGCAAGAAAGTAATCGGTGTTCTGCCGTATTACGCACCGGAAGAGCTTGTTTATGCCGCAGGT
ATGGTGCCGATGGGAATCTGGGGTTCCAATAACAAGACTATCAGCCGTGCTAAAGAATACTGTGCAACT
TTCTACTGCACTATCGCACAGCTTGCTCTGGAGATGCTGTTAGACGGCACAATGGATCAGCTGGACGGA
ATCATTACTCCAACCATCTGTGATACACTGCGCCCAATGAGCCAGAACTTCCGTGTTGCTATGGGAGATA
AGATGGCAGTTATCTTCCTTGCTCAGCCTCAGAACCGTTTTGAAGATTTCGGTCTTCAGTTCAGTGTTGAC
CAGTATACAAATGTTAAGAAAGAACTGGAAAAAGTTGCCGGTAAAGAGATTACCAACGAGGCGATTCA
GGATGCCATCAAAGTATACAATAAGAGCCGTGCGGCCCGCCGTAAATTCGTAGAACTGGCAAGCGCAC
ACTGCGATGTCATTACACCAACCAAGCGTTCTGCAGTACTGAAATCCTTCTTCTTTATGGAGAAACCGGA
ATACATAGAGAAGCTGGAAGAATTGAACGCAGAGCTTGAAAAACTTCCTGTCTGTGACTGGCAGGGAA
CCAAGGTTGTTACATCCGGTATTATCTGTGACAATCCAAAGCTTCTTGAAATCTTCGAAGAGAACAACAT
TGCCATCGCCGCAGACGACGTTGGCCATGAGAGCCGTTCCTTCCGTGTAGACGCTCCGGAGGATGAGG
CAGATGCATTAATGGCACTGGCAAAACAGTTTGCCAATATGGACTATGACGTTCTTCTGTACGATCCAAA
ATCTACAGAGAACCGCCGCGGCGAATTCATTGCCAACATGGTAAAGGAAAGCGGCGCTCAGGGACTGG
TATTGTTCATGCAACAGTTCTGTGACCCGGAGGAAATGGAGTATCCATACTTAAAGAAGGCATTAAATAA
TGCAGGTATTCCGCATATCAAACTGGGTATCGATCAGCAGATGCGTGACTTCGGTCAGGCAAGCACAGC
TATCCAGGCATTTGCAGATGTACTCGAGATGCAGAAATAA
Glutaconate CoA- transferase - GctAB from Acidaminococcus fermentans:
TTGAGTAAAGTAATGACGTTAAAAGACGCAATCGCCAAGTATGTGCACAGTGGTGATCACATTGCTCTG
GGTGGTTTTACGACGGACCGTAAACCCTATGCGGCTGTGTTCGAAATCCTGAGACAGGGTATCACGGAT
CTGACCGGTCTGGGCGGCGCTGCCGGCGGCGACTGGGATATGCTGATCGGCAACGGCCGTGTGAAAGC
CTACATCAACTGCTACACCGCCAACTCCGGTGTGACCAACGTTTCCAGACGGTTCAGAAAATGGTTCGA
AGCCGGCAAACTGACCATGGAAGACTATTCCCAGGATGTTATCTACATGATGTGGCATGCCGCCGCTCT
GGGCCTGCCCTTCCTGCCTGTAACCCTGATGCAGGGCTCCGGCCTGACCGATGAATGGGGCATCAGCAA
GGAAGTCCGTAAAACCCTGGACAAAGTTCCTGATGACAAATTCAAATACATCGACAACCCCTTCAAACC
GGGTGAAAAAGTCGTGGCTGTTCCTGTTCCGCAGGTTGATGTGGCCATCATCCATGCCCAGCAGGCTTC
TCCCGATGGCACCGTTCGCATCTGGGGCGGCAAATTCCAGGATGTGGATATTGCTGAAGCAGCCAAATA
57
CACCATCGTTACCTGCGAAGAAATCATTTCTGATGAAGAAATCAGAAGAGATCCCACCAAGAACGATAT
CCCCGGCATGTGCGTAGATGCTGTTGTCCTGGCTCCTTACGGTGCACATCCTTCTCAGTGCTATGGCCTG
TACGACTACGACAATCCGTTCCTGAAAGTCTATGACAAGGTCTCCAAGACCCAGGAAGACTTCGATGCC
TTCTGCAAGGAATGGGTGTTCGACCTGAAGGATCATGACGAATACCTGAACAAACTGGGTGCCACTCGT
CTGATCAACCTGAAGGTTGTTCCTGGTCTGGGCTACCACATCGACATGACGAAGGAGGACAAATAACAA
TGGCTGATTACACGAATTATACCAATAAAGAAATGCAGGCTGTGACCATTGCCAAGCAGATCAAAAATG
GTCAGGTTGTAACGGTTGGTACCGGTCTGCCTCTGATCGGCGCCAGCGTGGCCAAGAGAGTCTATGCTC
CTGACTGCCACATCATCGTGGAAAGCGGTCTGATGGACTGCTCCCCGGTGGAAGTTCCCCGTTCCGTAG
GTGACCTGCGGTTCATGGCTCACTGCGGCTGCATCTGGCCGAACGTCCGGTTCGTGGGCTTCGAAATCA
ACGAATACCTGCACAAGGCCAACCGTCTGATCGCCTTCATCGGCGGGGCCCAGATCGATCCGTACGGC
AACGTGAACTCCACTTCCATCGGTGATTACCATCATCCGAAAACCCGTTTCACCGGGTCCGGCGGTGCC
AACGGCATTGCCACCTACTCCAACACCATCATCATGATGCAGCATGAAAAACGCAGATTCATGAACAAA
ATCGACTACGTGACCAGCCCGGGCTGGATCGACGGCCCTGGCGGACGGGAAAGACTGGGTCTGCCCG
GCGATGTGGGACCTCAGCTGGTAGTAACCGATAAAGGGATCCTGAAATTCGACGAAAAGACCAAACGG
ATGTACCTGGCTGCCTACTATCCCACTTCTTCTCCGGAAGATGTACTGGAAAACACCGGGTTCGACCTGG
ATGTATCCAAGGCTGTGGAACTGGAAGCTCCGGATCCGGCCGTCATCAAACTGATCCGTGAAGAAATCG
ATCCGGGGCAGGCCTTTATCCAGGTCCCCACGGAAGCAAAA (TAA)
Enoate reductase - EredBC from Bacillus coagulans 36D1:
ATGAAATACAAAAAGCTATTTGAAACTGTGAAAATAAGGAATGTGGAACTCAAAAATCGTTATGCAATG
GCACCAATGGGTCCGCTGGGTCTTGCCGATGCAGAAGGCGGTTTCAACCAGCGCGGGATTGAGTATTAT
ACAGCCCGTGCGCGCGGGGGAACCGCTCTGATTATTACCGGCGTCACTTTCGTTGATAATGAAGTGGAA
GAGCACGGAATGCCAAACGTACCTTGCCCGACCCATAACCCTGTCCATTTTGTCCGGACTTCCAAAGAA
ATGACAGAGCGCATCCATGCATATGATTCGAAAATTTTTCTGCAAATGAGCGCCGGTTTTGGCCGGGTG
ACGATCCCGACAAACCTTGGCGAGTACCCGCCGGTTGCACCGTCGCCAATCCCGCATCGCTGGCTGGAT
AAAACATGTCGCGAACTGACAGTTGAAGAAATTCATTCCATTGTCCGCAAATTCGGGGATGGGGCGTTC
AATGCGAAGCGCGCCGGATTTGACGGGGTGCAAATCCATGCTGTGCACGAAGGCTATTTGCTCGACCA
GTTTGCGATTGCGTTTTTCAACAAACGTACCGATGCATACGGTGGCCCGCTTGAAAATCGCCTTCGTTTT
GCCCGGGAAATTGTCGAGGAAATTAAACAGCGCTGTGGCGAAGATTTTCCTGTGACGCTCCGCTTCAGC
CCGAAAAGTTTTATCAAGGATTGGCGGGAAGGGGCACTGCCTGGCGAGGAGTTTGAAGAAAAAGGCCG
CGATTTGGATGAAGGCATCGAGGCAGCAAAGCTGCTCGTTTCCTACGGCTATGATGCTCTGGACGTCGA
TGTTGGTTCTTATGATTCATGGTGGTGGAGCCATCCTCCGATGTACCAGAAGAAGGGGCTTTACATTCCG
TATGCCAGGCTGGTGAAGGAAGCTGTCGATGTGCCTGTCCTTTGCGCGGGCCGCATGGACAATCCGGAT
CTTGCACTTGCCGCACTGGAAGACGGAGCATGTGATATTATCAGCTTGGGCCGCCCGTTATTGGCTGAC
CCGGATTACGTCAATAAGCTCCGAATCGGGCAGGTTGCCGATATCCGCCCGTGTCTGTCATGCCATGAA
GGCTGCATGGGTCGGATCCAGGAGTATTCTTCCTTAGGCTGCGCAGTGAATCCGGCTGCCTGTCGAGAA
AAAGAAGCAGCATTGACACCTGCTTTAAAAAAGAAACGCGTACTGATTGCAGGCGGCGGCGTGGCCGG
ATGCGAAGCTGCCCGTGTGCTTGCATTGCGCGGCCATGAACCGGTCATTTTTGAAAAATCGAACCGTTTA
GGCGGCAACTTGATCCCTGGCGGCGCACCTGATTTTAAAGAAGATGACCTGGCGCTTGTTGCCTGGTAT
GAGCATACGTTGGAACGCCTTGGCGTAGAAATTCATTTGAATACTGCATTGACAAAAGAAGAAATTTTG
GCTGCAAACGTGGATGCCGTGCTGATTGCAACGGGTTCGAATCCGAAAATTTTGCCGCTCGACGGAAAA
AACAAAGTATTTACAGCAGAAGATGTTTTGCTCGATAAAGTGGATGCCGGGCAACATGTTGTCATTGTCG
GCGGCGGTCTTGTCGGCTGCGAACTGGCTTTGAACCTTGCAGAAAAAGGAAAAGATGTCTCGCTTGTGG
AAATGCAGGACAAACTGCTGGCAGTTAATGGTCCGCTTTGCCACGCTAACTCGGACATGCTGGAAAGAC
TCGTACCGTTTAAAGGTGTTCAAGTCTACACTTCTTCAAAAATAGTAGATACGACAGAAAAGACAGCCGT
TGTGGATGTTGACGGCGAATTGCGTGAAATTGAAGCAGACAGCATTGTGCTCGCAGTCGGCTACTCGGC
58
TGAAAAATCACTCTATGAAGATTTAAAGTTTGAGGTTGCCGATCTTCATGTGGTTGGCGATGCCCGCAAG
GTCGCAAACATCATGTATGCCATCTGGGATGCTTACGAAGTCGCGGCAAATCTG (TAG)
Enoate reductase - EredCA from Clostridium acetobutylicum:
ATGAACAAATACAAGAAATTATTTGAACCAATCAAAATTGGAAAATGTGAAATCAAAAACCGTTTTGCAT
TAGCTCCAATGGGCCCTTTAGGACTAGCTGATAGTGAAGGTGGTTTCAACCAAAGAGGAATAGACTACT
ATACTGAAAGAGCAAAAGGTGGCACAGGATTAATAATAACAGGAGTTACCTTTGTAGATAATGAAGTTG
AAGAACACGGAATGCCTAATTGTCCTTGTCCAACACATAATCCAGTTCAATTCGTAAGAACTGGTAGAG
AAATGACTGAAAGAATACACGCATACAATTCTAAAGTATTTTTACAAATGTCAGGTGGATTTGGTAGAGT
TACTATACCTACTAACTTAGGAGAATTTCCTCCAGTTGCCCCATCTCCAATTCAACATAGATGGCTTGACA
AAACTTGTCGTGAACTTACAGTAGATGAAATTAAATCAATAGTTAAAAAATTTGGTGAAGGAGCTTTTAA
TGCTAAAAGGGCCGGCTTTGATGGAGTTCAAATTCATGCTGTTCATGAAGGATACCTTATAGATCAATTT
GCTATTTCATTATTTAATCATAGAACCGATGAATACGGCGGAAGCTTAGAAAATAGACTTCGCTTTGCAA
GAGAAATCGTTGAAGAAATTAAAAATCGCTGTGGAGAAGATTTCCCTGTAACACTTAGATATTCACCAA
AAAGCTTTATTAAAGATCTTAGAGATGGAGCACTTCCTGGTGAAGAATTCGTTGAAAAGGGAAGAGACC
TTGACGAAGGTGTTGAGGCTGCAAAACTTCTTGTATCTTATGGATATGATGCTTTAGATACAGATGTTGG
TTCTTATGATTCATGGTGGTGGAGTCATCCGCCTATGTACCAGGAAAAAGGCTTATATAGAAAATACGCT
AAATTAATGAAGGATACTGTTGATGTTCCAGTTATTTGCGCTGGAAGAATGGATGATCCTGATATGGCCT
TAGAAGCTGTAGAAAATGGAACCTGCGATGTTATAAGTCTAGGAAGACCTCTTCTTGCAGACCCTGACT
ACGTAAATAAGTTAAGAAGTAATAAATGCAAATCAATAAGACCTTGTATTTCCTGTCAAGAAGGTTGTAT
GGGACGTGTTCAACATTACTCAATGTTAAACTGCGCTGTAAACCCTCAAGCTTGTAAGGAAAGAGCTAA
CTCACTTACTCCAATAATTAAAAGCAAAAAAGTATTAATAGTTGGAGGAGGAGTTGCTGGCTGTGAAGC
TGCTAGAGTTCTAGCTCTTAGAGGTCATGAACCTGTACTTTATGAAAAGAGCAATAGATTAGGCGGAAAT
CTTATACCTGGTGGAGCACCAAGCTTTAAAGAAGATGACATAGCATTAGCTGATTGGTATACAAATACCT
TAAAAGAGCTAAACGTTGAAGTCAACTTAAATAGCGAGGTTACAAAAGAACAAATTTTAAATTCCAAGTT
TGATACAGTAATCGTAGCAACAGGATCAACTCCAAAGGTTTTCCCACTTGGAGATGACGAAAAAGTATT
CACCGCTGCTGAAGTATTACTAGGACAAAAAGATCCTGGAGAAACAACTGTTGTAGTTGGAGGAGGTCT
AGTAGGCTGCGAATTAGCATTAGATCTTGCTAAAAAAGGCAAAAAGGTAACTATTGTTGAAGCCTTAAA
TAAAATACTAGCTTTAAATGGTCCTTTATGTTCTGCAAACAGCGAAATGCTTCAAAAATTAATACCTTTTA
ATGGCATCGATGTAAAGGCAAATTCAAAAGTAAAAGGATACAAAAATGGATTGCTTAAAATGGAAACA
GAAAACGGAATAGAAGAATTACCATGTGATTCAGTAATATTATCTGTTGGATATAAAGAAGAAAACTCCT
TATACAAGGAATTAGAATTTGAAATTCCAGAAATCTACCTTCTAGGAGATGCTCGTAAGGTATCTAATAT
CATGTATGGTATTTGGGATGCTTTTGAAGTTGCAAACCATATA (TAG)
8.2 Plasmids, strains, and primers
The plasmids used in this study are listed in Table 6, the strains used are listed in
Table 7, and the primers used are listed in Table 8.
59
Table 6. Plasmids used in this study and their relevant characteristics.
plasmids description reference
pACYCDuet
CmR; two multiple cloning sites, each preceded by
a T7lac promoter and ribosome binding site;
Vector can be used in combination with
pCDFDuet, pAYCYDuet and peTDuet vector Novagen
pETDuet
ApR; two multiple cloning sites, each preceded by
a T7lac promoter and ribosome binding site;
Vector can be used in combination with
pCDFDuet, pAYCYDuet and peTDuet vector Novagen
pColaDuet
KanR; two multiple cloning sites, each preceded
by a T7lac promoter and ribosome binding site;
Vector can be used in combination with
pCDFDuet, pAYCYDuet and peTDuet vector Novagen
pCDFDuet
SpR; two multiple cloning sites, each preceded by
a T7lac promoter and ribosome binding site;
Vector can be used in combination with
pCDFDuet, pAYCYDuet and peTDuet vector Novagen
pACYCDuet+lys20
CmR; pACYCDuet derivative containing genes
lys20 encoding homocitrate synthase from
Saccharomyces cerevisiae, under control of a T7
promoter this work
pACYCDuet+lys21
CmR; pACYCDuet derivative containing genes
lys21 encoding homocitrate synthase from
Saccharomyces cerevisiae, under control of a T7
promoter this work
pACYCDuet+lys20+Aco2
CmR; pACYCDuet derivative containing genes
lys20 encoding homocitrate synthase and aco2
encoding aconitase from Saccharomyces
cerevisiae, each under control of T7 promoters this work
pACYCDuet+lys21+Aco2
CmR; pACYCDuet derivative containing genes
lys21 encoding homocitrate synthase and aco2
encoding aconitase from Saccharomyces
cerevisiae, each under control of T7 promoters this work
pACYCDuet+lys21(D125N)+Aco2
CmR; pACYCDuet derivative containing genes
lys21(D125N) encoding a mutant of homocitrate
synthase and aco2 encoding aconitase from
Saccharomyces cerevisiae, each under control of
T7 promoters. The mutation on the homocitrate
synthase is targeted to eliminate its susceptibility
to lysine inhibition. this work
pETDuet+lys12
ApR; pETDuet derivative containing genes lys12
encoding homoisocitrate dehydrogenase from
Saccharomyces cerevisiae, under control of a T7
promoter this work
pETDuet+lys4+lys12
ApR; pETDuet derivative containing genes lys4
encoding homoaconitase and lys12 encoding
homoisocitrate dehydrogenase from
Saccharomyces cerevisiae, each under control of
T7 promoters this work
60
pETDuet+lys4+lys12(R143H)
ApR; pETDuet derivative containing genes lys4
encoding homoaconitase and lys12(R143H)
encoding a mutant of homoisocitrate
dehydrogenase from Saccharomyces cerevisiae,
each under control of T7 promoters this work
pColaDuet+ lys12(R143H)
KanR; pACYC derivative containing genes
lys12(R143H) encoding mutant of homoisocitrate
dehydrogenase of Saccharomyces cerevisiae,
under control of T7 promoters this work
pColaDuet+ lys12(R143H)+HgdC(af)
KanR; pACYC derivative containing genes
lys12(R143H) encoding mutant of homoisocitrate
dehydrogenase of Saccharomyces cerevisiae and
HgdC encoding activator of 2-hydroxyglutaryl-CoA
dehydratase of Acidaminococcus fermentans,
each under control of T7 promoters this work
pColaDuet+lys12(R143H)+HgdCAB(af)
KanR; pACYC derivative containing genes
lys12(R143H) encoding mutant of homoisocitrate
dehydrogenase of Saccharomyces cerevisiae and
HgdCAB encoding 2-hydroxyglutaryl-CoA
dehydratase and its activator of Acidaminococcus
fermentans, each gene under control of T7
promoters this work
pColaDuet+lys12(R143H)+HgdCAB(cs)
KanR; pACYC derivative containing genes
lys12(R143H) encoding mutant of homoisocitrate
dehydrogenase of Saccharomyces cerevisiae and
HgdCAB encoding 2-hydroxyglutaryl-CoA
dehydratase and its activator of Clostridium
symbiosum, each gene under control of T7
promoters this work
pColaDuet+ HgdH
KanR; pACYC derivative containing genes HgdH
encoding R-2-hydroxyglutarate dehydrogenase of
of Acidaminococcus fermentans, under control of
a T7 promoter this work
pColaDuet+ HgdH+HgdC(af)
KanR; pACYC derivative containing genes HgdH
encoding R-2-hydroxyglutarate dehydrogenase
and HgdC encoding activator of 2-hydroxyglutaryl-
CoA dehydratase of Acidaminococcus fermentans,
each under control of T7 promoters this work
pColaDuet+ HgdH+HgdCAB(cs)
KanR; pACYC derivative containing genes HgdH
encoding R-2-hydroxyglutarate dehydrogenase
and HgdCAB encoding 2-hydroxyglutaryl-CoA
dehydratase and its activator of Clostridium
symbiosum, each gene under control of T7
promoters this work
pETDuet+HgdB(cs)
ApR; pACYC derivative containing genes HgdB,
encoding beta subunit of 2-hydroxyglutaryl-CoA
dehydratase of Clostridium symbiosum, under
control of T7 promoters this work
61
pETDuet+HgdA(cs)+HgdB(cs)
ApR; pACYC derivative containing genes HgdA and
HgdB, encoding alpha and beta subunit of 2-
hydroxyglutaryl-CoA dehydratase of Clostridium
symbiosum, each gene under control of T7
promoters this work
pCDFDuet+GctAB
SpR; pCDFDuet derivative containing genes GctAB
encoding glutaconate CoA- transferase of
Acidaminococcus fermentans, under control of a
T7 promoter this work
pCDFDuet+His_GctAB
SpR; pCDFDuet derivative containing genes GctAB
encoding glutaconate CoA- transferase of
Acidaminococcus fermentans, with a His-tag at it's
N-terminus. The gene is under control of a T7
promoter this work
pCDFDuet+EredBC+GctAB
SpR; pCDFDuet derivative containing genes GctAB
encoding glutaconate CoA- transferase of
Acidaminococcus fermentans and EredBC
encoding enoate reductase of Bacillus coagulans,
each under control of T7 promoters this work
pCDFDuet+EredCA+GctAB
SpR; pCDFDuet derivative containing genes GctAB
encoding glutaconate CoA- transferase of
Acidaminococcus fermentans and EredBC
encoding enoate reductase of Clostridium
acetobutylicum, each under control of T7
promoters this work
Table 7. Strains used in this study and their relevant characteristics
strain relevant characteristics reference
DH5 alpha
genotype: fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80
Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 New England Biolabs
BL21 (DE3)
genotype: fhuA2 [lon] ompT gal (λ DE3) [dcm] ∆hsdS
λ DE3 = λ sBamHIo ∆EcoRI-B
int::(lacI::PlacUV5::T7 gene1) i21 ∆nin5 New England Biolabs
BL21 pA*20+pE*
BL21(DE3) derivative containing plasmids
pACYCDuet+lys20+Aco2 and pETDuet+lys20+lys4 this work
WT: BL21 pA+pE
BL21(DE3) derivative containing empty plasmids
pACYCDuet and pETDuet this work
BL21 pO*(af)pF*(BC)
BL21(DE3) derivative containing plasmids
pColaDuet+lys12(R143H)+HgdCAB(af) and
pCDFDuet+EredBC+GctAB this work
BL21 pO*(cs)pF*(BC)
BL21(DE3) derivative containing plasmids
pColaDuet+lys12(R143H)+HgdCAB(cs) and
pCDFDuet+EredBC+GctAB this work
62
BL21 pO*(cs)pF*(CA)
BL21(DE3) derivative containing plasmids
pColaDuet+lys12(R143H)+HgdCAB(cs) and
pCDFDuet+EredCA+GctAB this work
BL21 pO*(cs)
BL21(DE3) derivative containing plasmid
pColaDuet+lys12(R143H)+HgdCAB(cs) this work
BL21 pE*pO*(12)pF*
BL21(DE3) derivative containing plasmids
pETDuet+HgdA(cs)+HgdB(cs),
pColaDuet+lys12(R143H)+HgdC(af) and
pCDFDuet+EredBC+GctAB this work
BL21 pE*pO*(HH)pF*
BL21(DE3) derivative containing plasmids
pETDuet+HgdA(cs)+HgdB(cs),
pColaDuet+HgdH+HgdC(af) and
pCDFDuet+EredBC+GctAB this work
BL21 pO*(HH)
BL21(DE3) derivative containing plasmid
pColaDuet+HgdH+HgdC(af) this work
BL21 pO*(12)
BL21(DE3) derivative containing plasmid
pColaDuet+lys12(R143H)+HgdC(af) this work
BL21 pE*
BL21(DE3) derivative containing plasmid
pETDuet+HgdA(cs)+HgdB(cs) this work
Table 8. Primers used in this study. Parts of primers designed to add restriction sites or to
introduce codon exchanges are underlined.
Primer name 5'-3' sequence and properties Description
lys4_F_pETDuet_BamHI
GCCGCCGGATCCGATGCTACGATCA
ACCACATTTACTC
Amplification of homoaconitase
gene lys4 of S.cerevisiaefor
integration into pETDuet plasmid lys4_R_pETDuet_NotHI
GCCGCCGCGGCCGCTTATAGTTGGG
ATTTGACCCA
lys12_F_pETDuet_NdeI
CATATGTTTAGATCTGTTGCTACTAG
ATTATCTGC
Amplification of homoisocitrate
dehydrogenase gene lys12 of
S.cerevisiae for integration into
pETDuet plasmid lys12_R_pETDuet_XhoI
CTCGAGCTATAATCTCGACAAAACGT
CGTCA
lys20_F_pACYC_NcoI
CCATGGGCATGACTGCTGCTAAACCA
AATC Amplification of homocitrate
synthase gene lys20 of S.cerevisiae
for integration into pACYCDuet
plasmid lys20_R_pACYC_HindIII AAGCTTTTAGGCGGATGGCTTAGTCC
lys21_F_pACYC_NcoI
CCATGGGCATGTCTGAAAATAACGA
ATTCCAGAGT Amplification of homocitrate
synthase gene lys20 of S.cerevisiae
for integration into pACYCDuet
plasmid lys21_R_pACYC_HindIII
AAGCTTCTATTTGGTGACCTTTGCCTT
T
63
aco2_F_pACYC_EcoRV
GCCGCCGATATCGATGCTATCTTCAG
CTAATAGGTTTTATAT
Amplification of aconitase gene
aco2 of S.cerevisiae aco2_R-pACYC_XhoI
GCCGCCCTCGAGTTATTCGTTTCTTC
GTATATTACCAATATAATT
F_R143H_lys12
GTTATCGTCCATGAAAATACTGAGGA
CCTG Introducing amino acid exchange
R143H within homoisocitrate
dehydrogenase gene lys12 of
S.cerevisiae R_R143H_lys12
GTATTTTCATGGACGATAACCATGTC
AATTGG
F_D111N_lys20
GGTGTCAATGTCGTTATCGGCACCTC
C
Introducing amino acid exchange
D111N within homocitrate
synthase gene lys20 of S.cerevisiae R_D111N_lys20
GATAACGACATTGACACCGTCGACAC
CAG
F_D125N_lys21
GGTGTCAATGTTGTTATCGGCACCTC
C
Introducing amino acid exchange
D125N within homocitrate
synthase gene lys21 of S.cerevisiae R_D125N_lys21
GATAACAACATTGACACCGTCGACAC
C
SG_LYS12(R143H)_F_NdeI
GCCGCCCATATGTTTAGATCTGTTGC
TACTAGATTATCTGC Amplification of mutant of
homoisocitrate dehydrogenase
gene lys12(R143H) of
S.cerevisiaefor integration into
pColaDuet plasmid SG_LYS12(R143H)_R_XhoI
GCCGCCCTCGAGCTATAATCTCGACA
AAACGTCGTCA
SG_HgdH_F_NdeI
GCCGCCCATATGAAGGTTTTATGTTA
TGGTGTAAGA Amplification of R-2-
hydroxyglutarate dehydrogenase
gene HgdH of A.fermentansfor
integration into pColaDuet plasmid SG_HgdH_R_XhoI
GCCGCCCTCGAGCTATTTGATCTTGT
TGGGGCAGT
SG_HgdCAB_F_SacI
GCCGCCGAGCTCGATGAGTATCTATA
CCTTGGGAATCG
Amplification of 2-hydroxyglutaryl-
CoA dehydratase and its activator
gene HgdCAB of A.fermentansfor
integration into pColaDuet plasmid SG_HgdCAB_R_NotI
GCCGCCGCGGCCGCTTACAGGCTTTC
TGCGAAAGCT
HgdCAB(c)_F_SacI
GCCGCCGAGCTCGATGAGCGGAATT
TATACTTTAGGTATCG Amplification of 2-hydroxyglutaryl-
CoA dehydratase and its activator
gene HgdCAB of C.symbiosumfor
integration into pColaDuet plasmid HgdCAB(c)_R_NotI
GCCGCCGCGGCCGCTTATTTCTGCAT
CTCGAGTACATCTG
SG_GctAB_F_NdeI
GCCGCCCATATGAGTAAAGTAATGA
CGTTAAAAGACG
Amplification of glutaconate CoA-
transferase gene GctAB of
A.fermentansfor integration into
pCDFDuet plasmid SG_GctAB_R_XhoI
GCCGCCCTCGAGTTATTTTGCTTCCG
TGGGGAC
SG_EREDBC_F_SacI
GCCGCCGAGCTCGATGAAATACAAA
AAGCTATTTGAAACTG
Amplification of enoate reductase
gene EredBC of B.coagulansfor
integration into pCDFDuet plasmid SG_EREDBC_R_NotI
GCCGCCGCGGCCGCCTACAGATTTGC
CGCGACTTC
64
SG_EREDCA_F_SacI
GCCGCCGAGCTCGATGAACAAATAC
AAGAAATTATTTGAACC Amplification of enoate reductase
gene EredCA of
C.acetobutylicumfor integration
into pCDFDuet plasmid SG_EREDCA_R_NotI
GCCGCCGCGGCCGCCTATATATGGTT
TGCAACTTCAAAAGC
HgdC(af)_R_NotI
GCCGCCGCGGCCGCTTATTTGGCTGC
TTTTTTATACGC
Amplification of activator of 2-
hydroxyglutaryl-CoA dehydratase
gene HgdC of A.fermentans for
integration into pColaDuet plasmid
(together with SG_HgdCAB_F_SacI
primer)
HgdA(cs)_F_SacI
GCCGCCGAGCTCGATGGCAAAACAA
GTTAGTCCTG
Amplification of α-subunit of 2-
hydroxyglutaryl-CoA dehydratase
gene HgdA of C.symbiosum for
integration into pETDuet plasmid HgdA(cs)_R_NotI
GCCGCCGCGGCCGCTTACTTTGCCTC
CTTTGCCT
HgdA(af)_F_SacI
GCCGCCGAGCTCGATGCCAAAGACA
GTAAGCCC Amplification of α-subunit of 2-
hydroxyglutaryl-CoA dehydratase
gene HgdA of A.fermentans for
integration into pETDuet plasmid HgdA(af)_R_NotI
GCCGCCGCGGCCGCTTATTTCCCCTT
CTTTTCATCA
HgdB(cs)_Stag_F_NdeI
GCCGCCCATATGAGTATCAACGCATT
ATTGGA Amplification of β-subunit of 2-
hydroxyglutaryl-CoA dehydratase
gene HgdB of C.symbiosum for
integration into pETDuet plasmid HgdB(cs)_Stag_R_KpnI
GCCGCCGGTACCTTTCTGCATCTCGA
GTACATC
HgdB(af)_Stag_F_NdeI
GCCGCCCATATGGCTATCAGTGCACT
TATTGAA
Amplification of β-subunit of 2-
hydroxyglutaryl-CoA dehydratase
gene HgdB of A.fermentans for
integration into pETDuet plasmid HgdB(af)_Stag_R_KpnI
GCCGCCGGTACCCAGGCTTTCTGCGA
AAG
GctAB_His_F_NdeI
GCCGCCCATATGCATCATCACCATCA
CCACATGAGTAAAGTAATGACGTTAA
AAGACG
Amplification of glutaconate CoA-
transferase gene GctAB of
A.fermentansfor integration into
pCDFDuet plasmid, with a His-tag
at its N-terminus (togerhter with
primer SG_GctAB_R_XhoI)
8.3 Chemicals and culture media
All chemicals used in the course of this work were obtained by Merck AG,
Sigma-Aldrich, Thermo-Fisher Scientific.
The following media were used for cultivation:
• LB medium: tryptone (10 g l-1), yeast extract (5 g l-1), NaCl (10 g l-1)
65
• TB medium: tryptone(12g/L), yeast extract (24g/L), glycerol (4mL/L),
KH2PO4(2.31g/L), K2HPO4 (12.54g/L)
• M9 minimal medium: Na2HPO4 (30g/L), KH2PO4 (15g/L), NaCl(2.5g/L),
NH4Cl(5g/L), 1mM MgSO4, 0.1mM CaCl2, thiamine( 0.5mg/L), 1x trace metal
• 1000x concentrated trace metal stock in 0.1M HCl solution: FeCl3 (1.6g/L),
CoCl2.6 H2O (0.2g/L), CuCl2 (0.1g/L), ZnCl2.4H2O (0.2g/L), NaMoO4
(0.2g/L), H3BO3 (0.5g/L)
• Modified M9 minimal medium: Na2HPO4 (30g/L), KH2PO4 (15g/L), NaCl
(2.5g/L), NH4Cl(10g/L), (NH4)2HSO4 (5g/L), 1mM MgSO4, 0.1mM CaCl2, 1x
trace metal
• Standard I medium: 1.5% peptone, 0.3% yeast extract, 100mM NaCl, 5mM
glucose
• Supplement for standard I medium: 3mM cysteine hydrochloride, 10mM Na-
glutamate, 0.2mM riboflavin, 2mM ferric citrate
For agar plates, 15g/L agar was added to the media. Ampicillin (100µg/mL),
kanamycin (25µg/mL), chloramphenicol (20µg/mL), spectinomycin (50µg/mL) were
added when required.